mutagens and their actions · mutagens and their actions chan ho yin, aurora (02690763) chen yiwei,...
TRANSCRIPT
![Page 1: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/1.jpg)
Mutagens and their actionsMutagens and their actions
Chan Ho Yin, Aurora (02690763)Chen Yiwei, Echo (01790443)Co Ngai Na, Chloe (02715283)Lam Kit Ming, Germaine (02770293)
![Page 2: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/2.jpg)
MutationSpontaneous Mutation & Induced Mutation
MutagenChemical MutagensRadiationBiological Mutagens
Conclusion
Introduction Introduction
![Page 3: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/3.jpg)
The process that produces an inheritable alteration in
DNA StructureChromosome Structure
There are two types of mutationsSpontaneous MutationInduced Mutation
MutationMutation
![Page 4: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/4.jpg)
Spontaneous MutationSpontaneous MutationNatural error during DNA replication or recombinationCaused by background radiationArise randomly as a result in cellsNO ARTIFICIAL TREATMENT
Spontaneous Mutation vs. Induced MutationSpontaneous Mutation vs. Induced Mutation
![Page 5: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/5.jpg)
Spontaneous Mutation vs. Induced MutationSpontaneous Mutation vs. Induced Mutation
Induced MutationInduced MutationCaused by exposure to known mutagenic agents
-- Mutagens
![Page 6: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/6.jpg)
MutagenMutagen
A natural or human-made agent which can alter the structure or sequence of genetic material and induce
Mutation
![Page 7: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/7.jpg)
There are three main types ofmutagens classifying by their sources
Chemical MutagensRadiationBiological Mutagens
![Page 8: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/8.jpg)
• Transposable element
• Ionizing Radiation
• UV Radiation
• Base analogs• Chemical
modification agents
• Intercalating agents
BiologicalMutagensRadiationChemical
Mutagens
![Page 9: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/9.jpg)
Chemicals structurally resemble normal bases, purines and pyrimidinesIncorporate into DNA during replicationLead to incorrect insertion of nucleotides opposite them in replication
Chemical Mutagens -Base analogs
![Page 10: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/10.jpg)
5-Bromouracil (5-BU)
2-Aminopurine (2-AP)
For Example
![Page 11: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/11.jpg)
resembles Thymine (T) has Br atom at C-5 instead of methyl group as in T can incorporate into DNA and pair with either A or G due to tautomerization
5-Bromouracilanalog of a pyrimidine
![Page 12: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/12.jpg)
* TAUTOMERIZATION – spontaneous structural alternations between 2 forms, keto form and enol form
5-Bromouracilanalog of a pyrimidine
![Page 13: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/13.jpg)
Mechanism of 5-Bromouracil
Mechanism of 5-Bromouracil
![Page 14: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/14.jpg)
Mechanism of 5-Bromouracil
Mechanism of 5-Bromouracil
![Page 15: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/15.jpg)
![Page 16: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/16.jpg)
Chemicals which alter structure and pairing properties of normal basesActive on both replicating and non-replicating DNAResult in mutation upon DNA replication by forming baseless sites or mispairTwo common chemical modification agents
Alkylating agentsDeaminating agents
Chemical Mutagens-Chemical Mutagens-Chemical modification agentsChemical modification agents
![Page 17: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/17.jpg)
Modify the normal bases by adding alkyl groupsCommon alkylating agents
Ethylmethane sulfonate (EMS) Nitrosoguanidine (NG)Di-(2-chloroethyl) sulfide (Sulfur mustard)Di-(2-chloroethyl) methylamine (Nitrogen mustard)
Alkylating agentsAlkylating agents
![Page 18: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/18.jpg)
Ethylmethane sulfonate (EMS)
Alkylating agentsAlkylating agents
![Page 19: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/19.jpg)
Ethylate base’s 7-N & 6-O positions
Mechanism ofMechanism ofEthylmethane sulfonate (EMS)Ethylmethane sulfonate (EMS)
![Page 20: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/20.jpg)
Ethylate base’s 7-N & 6-O positions
Mechanism ofMechanism ofEthylmethane sulfonate (EMS)Ethylmethane sulfonate (EMS)
![Page 21: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/21.jpg)
Oxidative deamination of amino group in Adenine (A), Guanine (G) and Cytosine (C)
Deaminating agentsDeaminating agents
![Page 22: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/22.jpg)
Nitrous acid (HNO2) is one of common deaminating agents
Convert the amino group (-NH2) into ketogroup (=O)Change H-bonding potential of the modified bases
Deaminating agentsDeaminating agents
![Page 23: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/23.jpg)
Adenine (A) → Hydroxanthine
Mechanism of Nitrous acidMechanism of Nitrous acid
![Page 24: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/24.jpg)
Cytosine (C) → Urail
Mechanism of Nitrous acidMechanism of Nitrous acid
![Page 25: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/25.jpg)
Guanine (G) → Xanthine
Mechanism of Nitrous acidMechanism of Nitrous acid
![Page 26: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/26.jpg)
A group of aromatic organic moleculesRoughly the same dimensions as a nitrogenous base pairIntercalate or wedge between the base pair
Chemical Mutagens-Intercalating agentsChemical Mutagens-Intercalating agents
![Page 27: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/27.jpg)
Cause addition or deletion of base pairs of intact DNAAlter reading frame of gene Result in non-functional gene product
Chemical Mutagens-Intercalating agentsChemical Mutagens-Intercalating agents
![Page 28: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/28.jpg)
Mechanism of Intercalating agents
Mechanism of Intercalating agents
![Page 29: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/29.jpg)
Mechanism of Intercalating agents
Mechanism of Intercalating agentsCommon intercalating agents
2,8-Diamino acridine (proflavin)Acridine orange
![Page 30: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/30.jpg)
Ionising radiatione.g. x rays, γrays,
cosmic rays
Non-ionising radiatione.g. UV radiation
Physical MutagensPhysical Mutagens
![Page 31: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/31.jpg)
Natural Sources:Sunlight, outer space
Artificial Sources:Medical diagnostic, powerplant
Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)
![Page 32: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/32.jpg)
MechanismProduction of highly reactive free radicals (OH• radicals)Interaction between the radicals and DNA, proteins, lipids in cell membrane etc.
Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)
![Page 33: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/33.jpg)
EffectsOrganelle failureCell division blockageCell death
Ionizing RadiationIonizing Radiation(high energy and penetrating)(high energy and penetrating)
![Page 34: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/34.jpg)
Breaks in one or both strands(can lead to rearrangements, deletions, chromosome loss death if unrepaired)
Damage to/loss of bases (mutation)
Crosslinking of DNA to itself or proteins
Interaction with DNAInteraction with DNA
![Page 35: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/35.jpg)
Interaction with DNAInteraction with DNA
CATCACCTGTACCAGTAGTGGACATGGT
deletion
CATTCACCTGTACCAGTAAGTGGACATGGT
normal sequence
Base pair mutation
![Page 36: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/36.jpg)
Take UV radiation as an exampleIts wavelengths are preferentially absorbed by bases of DNA and by aromatic amino acids of proteins
Normally classified in terms of its wavelengths:UV-A, UV-B, UV-C (in decreasing order of wavelengths)
Non-Ionizing RadiationNon-Ionizing Radiation(Less energy, Non-penetrating)(Less energy, Non-penetrating)
![Page 37: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/37.jpg)
Non-Ionizing RadiationNon-Ionizing Radiation(Less energy, Non-penetrating)(Less energy, Non-penetrating)
MechanismFormation of Thymine dimers
These dimers cause the strand to buckle, disrupting normal base pairing
Prevent normal replication and transcription
![Page 38: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/38.jpg)
Formation of Thymine-thymine dimer
![Page 39: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/39.jpg)
![Page 40: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/40.jpg)
Transposable element
Insertions result in dysfunction of genes
Common biological mutagensRubella virusCytomegalovirusHepatitis B virus
Biological MutagensBiological Mutagens
![Page 41: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/41.jpg)
Biological agents
Biological MutagensBiological Mutagens
![Page 42: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/42.jpg)
Conclusion Conclusion
MutationSpontaneous Mutation & Induced Mutation
MutagenChemical MutagensRadiationBiological Mutagens
Exposure to mutagen may induce mutation!
![Page 43: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/43.jpg)
References References
Principles of GeneticsAn Introduction of Genetic AnalysisDNA replicationhttp://pharmacology.unmc.edu/cancer/antibio.htm
![Page 44: Mutagens and their actions · Mutagens and their actions Chan Ho Yin, Aurora (02690763) Chen Yiwei, Echo (01790443) Co NgaiNa, Chloe (02715283) Lam Kit Ming,Germaine(02770293) Mutation](https://reader034.vdocuments.mx/reader034/viewer/2022050412/5f8951661ce57e461e597f26/html5/thumbnails/44.jpg)
Thank YouThank You
Chan Ho Yin, Aurora (02690763)Chen Yiwei, Echo (01790443)Co Ngai Na, Chloe (02715283)Lam Kit Ming, Germaine (02770293)