of January 30, 2018.This information is current as ExpressionγIFN-

Blood T Cells to Regulate Transactivation of Elements than Peripheralcis-Use Different

Expression: Lamina Propria T CellsγIFN-Mucosa-Specific Targets for Regulation of

Lee, Howard A. Young and Stephan R. TarganRivkah Gonsky, Richard L. Deem, Jay H. Bream, Doo Han

http://www.jimmunol.org/content/164/3/1399doi: 10.4049/jimmunol.164.3.1399

2000; 164:1399-1407; ;J Immunol 

        average*  

4 weeks from acceptance to publicationSpeedy Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

?The JIWhy

Referenceshttp://www.jimmunol.org/content/164/3/1399.full#ref-list-1

, 29 of which you can access for free at: cites 46 articlesThis article

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2000 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on January 30, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Mucosa-Specific Targets for Regulation of IFN-g Expression:Lamina Propria T Cells Use Different cis-Elements thanPeripheral Blood T Cells to Regulate Transactivation of IFN-gExpression1

Rivkah Gonsky,* Richard L. Deem,* Jay H. Bream,† Doo Han Lee,‡ Howard A. Young,† andStephan R. Targan2*

Activation of lamina propria (LP) T cells via the CD2 pathway enhances IFN-g (IFN-g) secretion with further enhancement afterCD28 coligation. The molecular mechanisms regulating IFN-g expression in LP T cells remain unknown. Previous studies in PBLand T cell lines identifiedcis- and trans-regulatory elements in TCR-mediated expression of IFN-g. This study examines CD2 andPMA/ionophore-responsive IFN-g promoter elements. Activation of LPMC via CD2-induced IFN-g secretion and a parallelup-regulation of mRNA expression. CD28 coligation enhanced mRNA stability without up-regulating transcription as measuredby nuclear run-on. Transfection of a 22.7-kb IFN-g promoter-reporter construct into PBL and LP mononuclear cells (LPMC)revealed significant promoter activity after CD2 activation, with additional transactivation after CD2/CD28 costimulation in PBL,but not in LPMC. Functional analysis using truncated promoter fragments identified distinct cis-regulatory regions selectivelytransactivating IFN-g expression in PBL compared with LPMC. In PBL, CD2 activation elements reside within the2108- to164-bp region. However, in LPMC the upstream region between2204 and2108 bp was essential. Transfection of the proximaland distal AP-1-binding elements, as well as TRE/AP-1 constructs, revealed functional activation of AP-1 subsequent to CD2signaling, with activation critical in PBL but diminished in LPMC. Electromobility shift analysis using oligonucleotides encom-passing the proximal, distal, and BED/AP-1-binding regions failed to demonstrate selective transactivation after CD2 signaling ofLPMC. This report provides evidence that activation of LPMC results in transactivation of multiple promoter elements regulatingIFN-g expression distinct from those in PBL. The Journal of Immunology,2000, 164: 1399–1407.

I nterferon is an important immunoregulatory protein withtightly controlled expression predominantly in activated Tcells and NK cells (1, 2). As has been shown with other

inflammatory mediators, expression of IFN-g in the mucosa is dif-ferent from that in the periphery. IFN-g transcription and mRNAsynthesis closely parallel those observed with IL-2, suggesting thatdifferences in the capacity of T cells to produce IFN-g are deter-mined primarily at the transcriptional level (3, 4). Although theIL-2 promoter has been well characterized, the mechanisms in-volved in regulation of IFN-g gene transcription are less well de-fined. The human IFN-g gene structure consists of four exons andthree introns and is highly conserved among mammalian species(5, 6). A number of 59-flankingcis-regulatory promoter regionshave been identified in PMA/ionophore-activated T cell lines, in-cluding proximal (273 to248) and distal (296 to280) regions

that are conserved between human and rodent (7). Both regions arebelieved to contain binding sites for jun/fos AP-1 nucleoproteincomplexes (8). The distal region contains a GATA-regulatory mo-tif similar to that found in the promoter regions of GM-CSF andmacrophage-inflammatory protein-1ab and has been shown tocontain GATA-3 as part of the nucleoprotein complex interactingwith this region (9). The proximal region displays homology withthe NFIL2A region of the human IL-2 gene and interacts withcAMP response element-binding protein/activating transcriptionfactor (ATF)3 and AP-1 nuclear binding factors (9).

It has been proposed that in T cell lines the selective binding ofc-Jun or c-Jun/ATF-2 to the proximal region results in a positivesignal and activation of transcription. A diminution of transcriptionresults from binding of other competing factors such as cAMPresponse element-binding protein/ATF-1, or after methylation ofthis site (10). Additionalcis-binding elements that inhibit IFN-gexpression, including a silencer repressor element (2251 to2215bp) that can bind Yin Yang 1 (YY-1) and an AP-2-like proteinhave been reported upstream of the minimal promoter region(2108 to164) (11, 12). An additional YY-1 site (2211 to2186)has been identified that overlaps with an AP-1-binding site. It hasbeen suggested that binding of YY-1 to this site in resting T cellsblocks constitutive transcription of IFN-g, whereas displacementof YY-1 by AP-1 results in transactivation of the IFN-g gene.Limited analyses of expression of this site in PMA1 PHA-acti-vated PBMC suggests that recruitment of AP-1 to this site triggers

*Inflammatory Bowel Disease Research Center, Cedars-Sinai Medical Center, LosAngeles, CA 90048;†Laboratory of Experimental Immunology, National Cancer In-stitute-Frederick Cancer Research and Development Center, Frederick, MD 21702;and‡Seoul Surgical Clinic, Seoul, Korea

Received for publication May 28, 1999. Accepted for publication November15, 1999.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby markedadvertisementin accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by U.S. Public Health Service Grants DK-43211 andDK-46763 and Cedars Sinai Medical Center Inflammatory Bowel Disease ResearchFunds.2 Address correspondence and reprint requests to Dr. Stephan R. Targan, Inflamma-tory Bowel Disease Research Center, Cedars-Sinai Medical Center, 8700 BeverlyBoulevard, D4063, Los Angeles, CA 90048. E-mail address: TarganS@csmc.edu

3 Abbreviations used in this paper: ATF, activating transcription factor; LP, laminapropria; LPMC, lamina propria mononuclear cells; PB, peripheral blood; PHA-L,PHA-leukoagglutinin.

Copyright © 2000 by The American Association of Immunologists 0022-1767/00/$02.00

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

selective transactivation of IFN-g expression during the differen-tiation of naive T-cells to memory T cells (13).

Two signals are required to achieve maximal activation of PB Tcells. The first signal is generated by engagement of the TCR,whereas a second signal is provided by a costimulatory molecule.One major costimulatory T cell surface molecule is CD28 (14, 15).Previous studies have reported that costimulation of TCR activatedPBL with CD28 results in enhanced T cell proliferation, as well ascytokine production including IFN-g (16). The molecular mecha-nisms that regulate increased IFN-g production, however, remainundefined. Initial nuclear run-on studies of TCR-activated PBLindicated that CD28 costimulation resulted in enhanced IFN-gmRNA stability without transcriptional up-regulation (17). Subse-quent transfection studies using PMA/ionophore activation of Tcell lines, however, suggested a modest up-regulation of IFN-gmRNA expression after CD28 costimulation but failed to identifya CD28 response element (18). The presence of AU-rich sequenceswithin the 39-untranslated region of the mRNA of many cytokines,including IFN-g, has been demonstrated to facilitate the rapid turn-over and instability of the mRNA (19). Numerous proteins thatbind to these AUUUA motifs regulate cytokine mRNA stability;however, the precise mechanism of posttranscriptional regulationof IFN-g remains to be determined.

The activation pathways of LP T cells are distinct from those ofPB T cells (20, 21). LP T cells do not respond well to activation viathe TCR/CD3 receptor, yet they do exhibit increased proliferationand cytokine production when activated via the CD2 pathway (21,22). CD28 coligation further enhances the activation, and LP Tcells are generally thought to manifest a heightened activation statecompared with PB T cells. This activated state can be further am-plified in conditions of dysregulated inflammation, such as Crohn’sdisease and ulcerative colitis. Crohn’s disease is characterized bywidespread mucosal inflammation involving an enhanced T cellactivation state characterized by increased production of inflam-matory mediators, including IFN-g (23).

Previous studies have demonstrated that there are mucosa-spe-cific mechanisms for T cell cytokine gene regulation. Recent stud-ies suggest that regulation of IL-2 production in LPMC after CD2activation may involve a different mechanism from that observedin PBL and T cell lines (24). The experiments described hereinwere designed to determine 1) the regulatory mechanisms involvedin enhanced IFN-g secretion in CD2/CD28-activated LP T cells,and 2) whether regulatory elements distinct from those previouslyreported for PBL and T cell lines play a role in IFN-g secretion byLP T cells. In this study, evidence demonstrates that the IFN-gpromoter possesses multiple CD2-responsive enhancer elementslocated between the2204- and164-bp region and that transacti-vation of IFN-g expression in PBL and LPMC occurs through theuse of differentcis-regulatory elements and requires the recruit-ment of different transactivating factors.

Materials and MethodsMonoclonal Abs

Anti-CD2 mAbs (clones CB6 and GD10) were a gift from Chris Benjamin(Biogen, Cambridge, MA). Anti-CD28 ascites (clone 9.3) was obtainedfrom Bristol-Meyers Squibb Pharmaceutical Research Institute (Princeton,NJ). The ascites was purified over a protein G column and quantified byELISA.

Purification of LPMC

Intestinal specimens were obtained from patients undergoing surgical re-section of the colon at Cedars-Sinai Medical Center, Los Angeles. Ap-proval for the use of human subjects was granted by the Institutional Re-view Board at Cedars-Sinai Medical Center. In this study, all tissuespecimens were taken from an uninvolved area of resected colon from

patients with colonic carcinoma (normal), involved areas from patientswith ulcerative colitis, and uninvolved and involved areas from patientswith Crohn’s disease.

LPMC were isolated from the resection samples by a technique modi-fied from that described previously (25). Briefly, the intestinal specimenwas washed with HBSS, and the mucosae were dissected away from theunderlying layers. The mucosal layer was incubated in a shaking water bath(100 rpm) in calcium- and magnesium-deficient HBSS, containing 1 mMEDTA, 50 mg/ml gentamicin, 100 U/ml penicillin, 100mg/ml streptomy-cin, and 50mg/ml Fungizone, with the solution changed every 30 min untilthe supernatant was free of epithelial cells. The remaining LP was mincedinto 1- to 2-mm pieces and digested for 10 min in RPMI 1640 containing10% FCS, 0.5 mg/ml collagenase B (Boehringer Mannheim, Indianapolis,IN), 1 mg/ml hyaluronidase (Sigma, St. Louis, MO), 0.1 mg/ml DNase I(Sigma), 50mg/ml gentamicin, 100 U/ml penicillin, 100mg/ml streptomy-cin, and 50mg/ml Fungizone in shaker water bath (100 rpm). The super-natant was collected, filtered through 110-mm nylon mesh (Spectrum Lab-oratory Products, Houston, TX), and centrifuged at 5003 g for 5 min. Thecell pellet was resuspended in 15 ml and centrifuged at 303 g for 5 minto remove epithelial and other large cells. The supernatant was removed,and lymphocytes were isolated by separation on Ficoll-Hypaque gradients.The cells were then washed three times with HBSS and resuspended inRPMI 1640 containing 10% FCS.

Stimulation of mononuclear cells

For stimulation through the CD2 receptor, LPMC were stimulated with 0.1mg anti-CD2 Abs (both CB6 and GD10 clones)/106 cells at 37°C for thetimes indicated for each experiment. CD28 costimulation was conductedwith 0.1 mg anti-CD28 Ab. Stimulation of T cells with anti-CD2 Abs didnot require further cross-linking because the combination of two anti-CD2Abs directed against different epitopes was sufficient to induce activation.

IFN-g assay

IFN-g was measured by an amplified ELISA assay (26). Dynatech (Burl-ington, MA) Immulon 3 microtiter plates were coated overnight with 100ml 5 mg/ml monoclonal anti-IFN-g (Endogen, Woburn, MA). Samples andstandards were added for 24 h followed by addition of 100ml of 2.5 mg/mlpolyclonal rabbit anti-IFN-g (Endogen) for 2 h. This was followed byaddition of 100ml 1:1000 diluted mouse anti-rabbit alkaline phosphatase-conjugated Ab (Jackson ImmunoResearch, West Grove, PA) for 2 h. Sub-strate, 0.2 mM NADP (Sigma), was added for 30 min followed by additionof amplifier (3% 2-propanol, 1 mM iodonitrotetrazolium violet, 75mg/mlalcohol dehydrogenase, and 50mg/ml diaphorase, Sigma) for 30 min.Plates were read at 490 nm using an E max plate reader (Molecular De-vices, Sunnyvale, CA). All data acquisition and reduction were performedwith the ELISA Master program for Macintosh computers, developed byR. L. Deem.

Northern blot analysis

Total cellular RNA was extracted using the RNeasy kit (Qiagen, Chats-worth, CA). RNA was separated electrophoretically on a denaturing 1%agarose gel containing 7% formaldehyde. Gels were transferred to nylonmembrane (Amersham, Arlington Heights, IL) and hybridized to32P-la-beled DNA probe as previously described (24).

Nuclear run-on

PBL or LPMC (5 3 107) were stimulated and nuclei were isolated aspreviously described (27). In vitro transcription was conducted at 26°C for20 min in transcription buffer (50 mM HEPES (pH 7.9), 100 mM KCl, 2mM DTT, 30 mM EDTA, 1 mM ATP, 0.5 mM GTP, 0.5 mM CTP, 2 mMMnCl2, 35 mM (NH4)2SO4, 8.8 mM creatine phosphate, 40mg/ml creatinephosphokinase) and 100mCi [a-32P]UTP. Labeled mRNA transcripts werepurified with the RNeasy kit for liquid samples and hybridized to 2mgcDNA insert immobilized on a nylon membrane.

Preparation of nuclear protein extracts

Nuclear protein extractions were conducted with 5–103 106 LPMC. Afteractivation, cells were centrifuged, washed in cold PBS, and kept on ice forsubsequent extraction steps. The cell pellet was resuspended in 0.9 ml ofRSB (10 mM Tris (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.5 mM DTT, 2mM leupeptin, 1mg/ml aprotinin, 1 mM PMSF, 0.1 mM EGTA), and 0.1ml of 5% Nonidet P-40 was added. Samples were mixed by gentle inver-sion and kept on ice for 10 min followed by centrifugation. The pellet wasresuspended in 25–60ml (volume is dependent on the starting number ofcells) cold buffer C (20 mM HEPES (pH 7.4), 0.42 mM NaCl, 1.5 mMMgCl2, 0.2 mM EDTA, 25% v/v glycerol, 0.5 mM DTT, 20mM leupeptin,

1400 MUCOSA-SPECIFIC TARGETS FOR REGULATION OF IFN-g

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

10 mg/ml aprotinin, 1 mM PMSF). Samples were incubated on ice for30–40 min during which time they were pipetted twice. Cellular debriswas removed by centrifugation, and nuclear proteins were diluted with anequal volume of buffer D (20 mM HEPES (pH 7.4), 50 mM KCl, 0.2 mMEDTA, 20% v/v glycerol, 0.5 mM DTT, 20 mM leupeptin, 10mg/ml apro-tinin, 1 mM PMSF). Protein concentrations were determined by CoomassiePlus assay (Pierce Chemical, Rockford, IL).

Gel (EMSA)

Double-stranded oligonucleotide was end-labeled with [g-32P]ATP and T4polynucleotide kinase. Nuclear extract protein (3–6mg) was incubated at25°C with 0.25 mg/ml poly(dI-dC), in 20% glycerol, 5 mM MgCl2, 2.5mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris (pH 7.5) for 10 min.The oligonucleotide was then added (20,000 cpm), and the binding reac-tions were incubated for an additional 30 min. Specificity was determinedby the addition of 100-fold excess unlabeled oligonucleotide as competitor.The DNA-protein complexes were separated from unbound probe on aprerun native 5% polyacrylamide gel in low ionic strength buffer (22.3 mMTris (pH 7.4), 22.3 mM borate, 0.5 mM EDTA (pH 8.0)). After 2 h, the gelwas dried under vacuum and exposed to x-ray film. The oligonucleotidesused were as follows: proximal conserved element, TTGTGAAAATACGTAATCC; distal conserved element, GCCTATCTGTCAAACTCTCAT;BED region AP-1-binding site, ATGGGTCTGTCTCATCGTCAAAGGA.

DNA constructs

The human IFN-g cDNA clone was obtained from American Type CultureCollection (Manassas, VA). The human IFN-g luciferase reporter plasmidscontaining22.7-kb and2204-bp fragments of the IFN-g promoter hasbeen described previously (9) and were subcloned upstream to the lucif-erase gene. The22.7 kb IFN-g luciferase reporter plasmid was subclonedby Dr. Masahiro Shiroo. The IFN-g promoter-reporter constructs contain-ing truncated promoter fragments,2538,2108,239 bp, and the internaldeletion mutantD2214/2178, as well as the dimer of proxIFN-g and tet-ramer of distIFN-g (gifts from Laurie Penix, Yale University, New Haven,CT) were subcloned upstream of the luciferase gene as described previ-ously (9, 28). The plasmid TRE2 luciferase (a gift from M. Karin, Uni-versity of California, San Diego) used to determine AP-1-dependent trans-activation was generated by subcloning two copies of the collagenase AP-1-binding sites into a luciferase reporter plasmid (29).

Transfection

Freshly isolated LPMC were primed for transfection competence by cul-turing for 16 or 20 h, respectively, in RPMI 1640 containing 10% FCS, 50mM 2-ME, and 1mg/ml PHA-L (Sigma) as previously described (24, 30).Cells were then washed and resuspended in 250ml fresh medium at 23107 cells/ml and electroporated in the presence of 50mg reporter construct(250 V, 2250mF, 48 ohms) using 4-mm (gap width) cuvettes in a BTXElectro Cell Manipulator (Genetronics, San Diego, CA). After electropo-ration, the cells were diluted in fresh medium, allowed to rest for 1 h beforeplating, and then stimulated with anti-CD2 or anti-CD21 anti-CD28mAbs for 4 h. Luminescence was measured with a Promega (Madison, WI)luciferase assay kit and counted on a 6-detector Wallac 1450 Microbetaliquid scintillation counter (Wallac, Gaithersburg, MD) with coincidencecounting deactivated.

ResultsCD28 cosignaling augments IFN-g expression by LPMCactivated via the CD2 pathway

LP T cells represent a distinct class of lymphocytes that are sig-nificantly more responsive than PB T cells to activation via theCD2 pathway (21). Stimulation of LP T cells through the CD2pathway elicits proliferation as well as secretion of IFN-g andother cytokines. In contrast to PB T cells, LP T cells do not re-spond well to activation via the TCR/CD3 pathway. Costimulationof the accessory CD28 molecule synergizes with CD2, resulting ina marked increase of IFN-g secretion in LPMC (21).

To determine the molecular events involved in regulation ofIFN-g secretion by LP T cells, LPMC were isolated and activatedwith anti-CD2 Abs in the presence or absence of CD28 costimu-lation. As seen in Fig. 1A, a measurable amount of IFN-g wasdetected in supernatants of LPMC as early as 3 h after CD2 acti-vation and continued to rise over 24 h. CD28 costimulation further

enhanced IFN-g production levels, particularly at early time pointsup to 6 h postactivation. As shown in Fig. 1B, Northern blot anal-ysis of mRNA isolated from LPMC after activation with anti-CD2or anti-CD21 anti-CD28 revealed that the increase in the level ofIFN-g was paralleled by an increase in IFN-g mRNA expression.Expression of IFN-g mRNA was detectable as early as 1 h afteractivation by CD2 and continued to rise over 24 h. CD28 costimu-lation of the CD2 activation pathway resulted in a significant in-crease in the levels of IFN-g mRNA expression by LPMC at 2 hthat was sustained over 24 h.

CD28 costimulation enhances the stability of IFN-g mRNA

The enhanced accumulation of IFN-g mRNA observed after CD28costimulation of LPMC could be a result of an increase in thetranscriptional rate or in posttranscriptional modification of IFN-gmRNA. To determine whether CD28 augmentation of mRNA lev-els in LPMC was a result of enhanced mRNA stability, LPMCwere activated with anti-CD2 or anti-CD21 anti-CD28 for 2 h(maximum for mRNA expression). Actinomycin D was then addedto prevent further transcriptional initiation, and mRNA decay wasmonitored for the indicated periods of time. Fig. 2 shows that afterCD2 activation, newly synthesized IFN-g mRNA exhibited rapiddecay, with a half-life of 43 min. CD28 coligation resulted in sta-bilization of IFN-g mRNA and extended the half-life of IFN-gmRNA from 43 min to 228 min.

CD2, but not CD28, mediates transcriptional up-regulation ofthe IFN-g promoter

In tumor T cell lines, CD28 costimulation enhanced transcriptionalactivation of transfected IFN-g promoter elements (18), yet nu-clear run-on studies conducted in PBL failed to detect transcrip-tional activation (17). To determine whether enhanced transcrip-tional activation of the IFN-g promoter was involved after CD21

FIGURE 1. Effect of costimulation by CD28 on IFN-g secretion andmRNA levels in LPMC activated via the CD2 pathway. LPMC were stim-ulated with 1mg anti-CD2/106 cells or 1mg anti-CD2/106 cells 1 1 mganti-CD28/106 cells. A, Supernatants were harvested after 18 h and ana-lyzed by ELISA.B, mRNA accumulation was measured from cells at var-ious time points after stimulation by northern blot analysis. EtBr, ethidiumbromide staining of the rRNA from equalized RNA samples used to pre-pare the blot.M, Anti-CD2 alone;E, anti-CD21 anti-CD28. Represen-tative results of three experiments with similar results.

1401The Journal of Immunology

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

CD28 costimulation of PBL or LPMC, nuclear run-on assays wereperformed on cells utilizing the same activation protocol as thatused for transfection studies. As seen in Fig. 3, a basal level ofIFN-g gene transcription was detectable in unstimulated PBL andLPMC and was up-regulated after CD2 activation. However, asreported previously (17), CD28 costimulation did not result in en-hanced transcription, as measured by run-on assays, over that ob-served by CD2 alone in PBL or LPMC. An equivalent level ofb-actin was detected in both unstimulated and stimulated condi-tions. No signal was detected hybridizing to the plasmid vectoralone (data not shown).

Transactivation of the IFN-g gene appears to be complex withnumerous, partially defined regulatory elements. However, trans-genic mice generated with a full length human genomic fragmentincluding the22.7-kb 59-flanking promoter region express humanIFN-g in a tissue-specific manner (31). These studies suggest thatthe key elements necessary for IFN-g gene regulation reside withinthe 2.7-kb region of the IFN-g promoter. To investigate the role ofthese elements in CD2 pathway activation of IFN-g production, a22.7-kb IFN-g promoter-luciferase construct was transfected intoPBL and LPMC. CD2 activation resulted in a marked up-regula-tion of reporter gene activity in both PBL and LPMC (Fig. 4).CD28 costimulation of PBL resulted in further enhancement ofpromoter activity (Fig. 4A). However, in contrast to PBL, coliga-tion of CD28 on LPMC did not increase IFN-g transactivationover that observed by CD2 alone (Fig. 4B). The results suggest theexistence of a CD2 response element within the22.7-kb promoterregion of both PBL and LPMC with additional CD28 transcrip-tional response elements activated in PBL but not LPMC.

CD2 signaling results in transactivation of multiple regulatoryelements within the IFN-g promoter region

To identify the CD2 response elements within the22.7-kb regionof the IFN-g promoter, we transfected both PBL and LPMC witha promoter-construct encompassing the entire22.7-kb region. Ex-pression was then compared with a series of constructs truncated to2538 bp,2204 bp and2108 bp immediately upstream from theIFN-g transcriptional start site, as well as the basal239-bp con-struct. Fig. 5 shows that thecis-regulatory regions involved in thetransactivation of IFN-g gene expression in PBL are different fromthose in LPMC. In CD2-activated PBL, deletion of the region be-tween2538 and2204 bp resulted in reduction of promoter ac-tivity to levels of the basal239-bp construct, although significantCD2 responsiveness was retained within the2108-bp region (Fig.5A). Moreover, the2108-bp construct consistently exhibited en-hanced expression as compared with the2204-bp construct, sug-gesting the presence of a CD2 response repressor element withinthe 2204 to2108 region. A similar pattern ofcis-regulatory re-gions was involved after PMA/ionophore activation (Fig. 5C). InLPMC, deletion of the region from22.7 kb down to2204 bp didnot diminish CD2-directed activation of the IFN-g promoter-re-porter construct (Fig. 5B). Furthermore, the2204-bp reporter con-struct consistently exhibited enhanced response to CD2 activationafter transfection compared with the22.7-kb and2538-bp pro-moter constructs, suggesting the presence of a CD2 response re-pressor element upstream of2204 region. Truncation of the regionbetween2204 and2108 bp resulted in a significant reduction ofpromoter activity, although a basal level of CD2 responsiveness

FIGURE 2. Effect of costimulation by anti-CD28 on IFN-g mRNA stability. LPMC from in-flamed mucosa were preactivated by 1mg anti-CD2/106 cells or 1mg anti-CD2/106 cells 1 1 mganti-CD28/106 cells for 2 h, followed by additionof actinomycin D (act D) (10mg/ml) to preventfurther transcription. Northern blots were prepared,and the amount of mRNA was determined at indi-cated time points by scanning densitometry (left).f, Anti-CD2 alone;F, anti-CD2 1 anti-CD28.Representative results of three experiments withsimilar results. EtBr, ethidium bromide staining.

FIGURE 3. Nuclear run-on analysis of IFN-g mRNA.PBL (A andB) or LPMC (CandD) were preactivated by1 mg anti-CD2/106 cells or 1mg anti-CD2/106 cells1 1mg anti-CD28/106 cells for 2 h, utilizing the same acti-vation protocol as that used for transfection studies, andthen nuclei were isolated. Run-on assays (AandC) wereperformed, and transcripts were hybridized to a filtercontaining 2mg plasmid inserts specific for human IFN-gor b-actin.B andD, Densitometric units were calculatedfrom b-actin (inset) and used to correct the readings forIFN-g mRNA. Representative results of two (PBL) orthree (LPMC) experiments with similar results. UT andUnstim, unstimulated.

1402 MUCOSA-SPECIFIC TARGETS FOR REGULATION OF IFN-g

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

was retained within the region from2108 to164. A similar pat-tern ofcis-regulatory regions to those identified after CD2 activa-tion was involved in promoter transactivation after PMA/iono-phore activation of LPMC (Fig. 5D).

These results suggest that LPMC have multiple CD2 and PMAactivation response elements within the IFN-g promoter, with dis-tinct cis-regulatory regions of transactivation. In PBL, the regionof 2108 to239 bp is essential for promoter function, whereas inLPMC at least two regions are involved in controlling CD2-me-diated transactivation of the IFN-g promoter: 1) a major CD2-regulatory element contained within the region2204 to2108 bpupstream of the transcriptional start site; and 2) a minor regulatoryelement residing within2108 to 240 bp of the transcriptionalstart site.

Up-regulation of AP-1 nuclear factors is involved in CD2signaling

Increased binding of transcriptional AP-1 nucleoprotein has beenimplicated in regulation of IFN-g promoter activity in T cell lines(10). Furthermore, inhibition of the binding of AP-1 is implicatedin the mechanism for glucocorticoid inhibition of IFN-g expres-sion in T cell lines (8). To determine whether induction of func-tionally active jun/fos, AP-1 nucleo-factors were involved in theregulation of IFN-g expression in PBL and LPMC, transfectionexperiments were conducted using a multimeric AP-1-bindingTRE2 reporter construct. CD2 ligation resulted in transactivationof a multimeric AP-1-binding TRE2 reporter construct in bothPBL and LPMC (Fig. 6). The increased promoter activity inducedin PBL was 100-fold (Fig. 6A), whereas only a 20-fold increase ofAP-1 transactivation occurred in LPMC (Fig. 6B). Although thebackground level in unstimulated LPMC was high, PMA/iono-phore-activated PBL and LPMC exhibited a similar level of AP-1transactivation. These results indicate that there is a functionalincrease in AP-1 binding after CD2 pathway activation of LPMCand PBL, with AP-1 activation appearing essential for transacti-vation in PBL but probably less so for LPMC.

The AP-1-binding proximal and distal conserved elements arenot critical regulators of CD2 response in LPMC

A number of AP-1-binding elements have been defined within theregion2108 bp to164 bp of the transcriptional start site neces-sary for regulation of IFN-g gene expression in T cell lines. Theconserved proximal (273 to248) and distal (296 to280) regionsare believed to be essential for regulation of IFN-g gene expres-sion in activated T cell lines. Activation of both the proximal anddistal conserved elements is mediated through the binding of AP-1,jun/fos-transacting factors (8). To ascertain the role of these ele-ments in regulation of IFN-g expression, both LPMC and PBLwere transfected with promoter-reporter constructs containingmultiple copies of the proximal or distal element upstream of aminimal IFN-g promoter. IFN-g expression was then monitoredafter activation with CD2. CD2 activation of PBL increased transac-tivation of the proximal and the distal conserved regions by 200- and

FIGURE 4. Transfection of PBL (A) or LPMC (B) with an IFN-g22.7-kb promoter-luciferase sequence. Freshly isolated PBL or LPMCwere cultured in the presence of 1mg/ml PHA-L for 20 h and electropo-rated with the IFN-g 22.7-kb promoter construct. Electroporated cellswere rested for 1 h at 37°C and then stimulated with either 1mg anti-CD2/106 cells or 1mg anti-CD2/106 cells plus 1mg anti-CD28/106 cells for 4 h.Luminescence was measured using a Promega luciferase assay kit andcounted on a 6-detector Wallac 1450 Microbeta liquid scintillation counterwith coincidence counting turned off. Fold increase was calculated as theratio of cpm stimulated divided by cpm unstimulated. Unstimulated cpmwas 972 for PBL and 878 for LPMC. Representative results of four ex-periments with similar results.

FIGURE 5. Transfection of a series of promoter construct truncationsencompassing the region of the22.7-kb IFN-g transcriptional start site.Freshly isolated PBL (AandC) or LPMC (BandD) were cultured in thepresence of 1mg/ml PHA-L for 20 h and electroporated with the IFN-gpromoter constructs. Electroporated cells were rested for 1 h at 37°C andthen stimulated with either 1mg anti-CD2/106 cells (AandB) or 20 g/mlPMA plus 400 nM calcium ionophore (Cand D) for 4 h. Luminescencewas measured using a Promega luciferase assay kit and counted on a 6-de-tector Wallac 1450 Microbeta liquid scintillation counter with coincidencecounting turned off. Fold increase was calculated as the ratio of cpm stim-ulated divided by cpm unstimulated. Unstimulated cpm were 642 for PBLand 114 for LPMC. Mean of 10 experiments.

FIGURE 6. Transfection of PBL or LPMC with a TRE2 promoter-lu-ciferase sequence. Freshly isolated PBL (A) or LPMC (B), were cultured inthe presence of 1mg/ml PHA-L for 20 h and electroporated with the TRE2promoter construct. Electroporated cells were rested for 1 h at 37°C andthen stimulated with either 1mg anti-CD2/106 cells or 20 g/ml PMA plus400 nM calcium ionophore (Ion) for 4 h. Luminescence was measuredusing a Promega luciferase assay kit and counted on a 6-detector Wallac1450 Microbeta liquid scintillation counter with coincidence countingturned off. Fold increase was calculated as the ratio of cpm stimulateddivided by cpm unstimulated. Mean unstimulated 4510 cpm was for PBLand 63 105 for LPMC. Means (6SEM) of 4 experiments (PBL) and 20experiments (LPMC: 12 normal and 4 each Crohn’s disease and ulcerativecolitis).

1403The Journal of Immunology

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

100-fold, respectively, showing that both represent CD2 response el-ements (Fig. 7A). Likewise, the proximal and distal regions respondedto PMA/ionophore activation with 100- and 700-fold increases, re-spectively (Fig. 7C). In contrast, transfection of the proximal AP-1-binding elements in LPMC did not restore loss of CD2 responsivenessabove the expression of the basal239-bp construct (Fig. 7C; notedifference in scale range). There was only a modest 2-fold increaseover basal expression by concatamers of four repeats of the distalAP-1 binding region transfected into LPMC (Fig. 7B). Similarly, afterPMA/ionophore activation, no additional transactivation was detectedwith the distal region and only a modest (,2-fold) increase was de-tected over the minimal promoter following transfection of the prox-imal AP-1-binding elements (Fig. 7D).

Because there was only marginal transactivation of the proximaland distal conserved regions in LPMC, we wished to determinewhether any nuclear proteins were bound to these elements afterCD2 activation of LPMC. Nuclear proteins were extracted fromLPMC before or after activation with CD2 and analyzed by EMSAanalysis for binding to proximal and distal conserved regions. Fig.8 shows the kinetics of induction of nuclear proteins binding to theproximal conserved region of the IFN-g promoter. After CD2 ac-tivation, up-regulation of protein complexes binding to the prox-imal AP-1 region of the IFN-g promoter is marginal. A similarlymarginal up-regulation of proteins binding to the distal conservedelement of the IFN-g promoter following CD2 activation was de-

tected (data not shown). Thus, the proximal and distal elementsmay be critical for activation of IFN-g expression in PBL and Tcell lines, although it is unlikely that they play a similarly impor-tant role after CD2 activation of LPMC.

The IFN-g BED region does not appear essential for regulationof IFN-g expression following CD2 activation of LPMC

The region2204 to2108 bp upstream of the transcriptional startsite has been defined above by functional analysis as being a majorCD2-regulatory element in LPMC. This region almost completelyoverlaps with the previously defined BED region (2211 to2186bp) in T cell lines (12). Previous studies have shown that there isa complex interaction between competitive binding of the YY-1and AP-1 transcriptional factors in T cell lines. It has been hy-pothesized that transactivation of the IFN-g gene occurs throughthe displacement of YY-1 by AP-1 (12). Subsequent studies con-firmed the importance of this region (2196 to2183 bp) in acti-vation of primary memory T cells, through the recruitment of AP-1binding to this site (13). To assess the effect of CD2 activation onfunctional regulation of the CD2 in our system, LPMC were trans-fected with a promoter-reporter construct containing an internaldeletion spanning the BED region AP-1-binding site. In contrast towhat has been reported for PBL, deletion of the entire region be-tween2214 and2178 bp did not result in a loss of CD2 respon-siveness, but rather an increase in CD2 responsiveness was de-tected, probably due to the loss of the repressor YY-1 binding site(Fig. 9A). This finding suggests that binding of AP-1 to a CD2enhancer response element occurs outside of the YY-1 site. Ad-ditionally, LPMC were activated with CD2 and nuclear proteins

FIGURE 7. A, Transfection of the proximal and distal elements withinthe region2108 bp to164 bp of the transcriptional start site of the IFN-gpromoter. Freshly isolated PBL (AandC) or LPMC (BandD) were cul-tured in the presence of 1mg/ml PHA-L for 20 h and electroporated withthe proximal, distal, or basal239-bp IFN-g promoter constructs. An emptyPGL-3 vector served as a control. Electroporated cells were rested for 1 hat 37°C and then stimulated with either 1mg anti-CD2/106 cells (AandB)or 20 g/ml PMA plus 400 nM calcium ionophore (Ion) (CandD) for 4 h.Luminescence was measured using a Promega luciferase assay kit andcounted on a 6-detector Wallac 1450 Microbeta liquid scintillation counterwith coincidence counting turned off. Fold increase was calculated as theratio of cpm stimulated divided by cpm unstimulated. Mean unstimulatedcpm was 1349 for PBL and 115 for LPMC. Mean of 5 experiments (PBL)and 12 experiments (LPMC).

FIGURE 8. Kinetics of induction of nuclear proteins binding to theproximal conserved region of the IFN-g promoter. EMSA analysis using 5mg nuclear protein isolated from LPMC binding to the AP-1p element wasconducted after stimulation with by 1mg anti-CD2/106 cells. Representa-tive results of three experiments with similar results.

FIGURE 9. The IFN-g BED region does not appear essential for reg-ulation of IFN-g expression following CD2 activation of LPMC.A, LPMCwere cultured in the presence of 1mg/ml PHA-L for 20 h and then trans-fected with a deletion mutant of the2538 to 164 region of the IFN-gpromoter. Freshly isolated LPMC were and electroporated with the TRE2promoter construct. Electroporated cells were rested for 1 h at 37°C andthen stimulated with 1mg anti-CD2/106 cells6 1 mg anti-CD28/106 cellsfor 4 h. Luminescence was measured using a Promega luciferase assay kitand counted on a 6-detector Wallac 1450 Microbeta liquid scintillationcounter with coincidence counting turned off.B, EMSA analysis of LPMCnuclear protein binding to IFN-g C-site after CD2 activation. EMSA anal-ysis using 5mg nuclear protein isolated from LPMC binding to the AP-1pelement was conducted after stimulation with by 1mg anti-CD2/106 cells.Fold increase was calculated as the ratio of cpm stimulated divided by cpmunstimulated. Mean unstimulated cpm was for PBL and for LPMC. Rep-resentative results of three experiments with similar results.

1404 MUCOSA-SPECIFIC TARGETS FOR REGULATION OF IFN-g

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

were analyzed for binding to the2198- to2180-bp AP-1-bindingsite by EMSA. Fig. 9Bshows that there was constitutive bindingof nuclear proteins to this site in unstimulated LPMC, which re-mained unchanged after CD2 activation. Thus, functional activa-tion of AP-1 appears to be up-regulated after CD2 activation; how-ever, only modest changes, if any, were observed in binding oftrans-factors to the previously characterized AP-1-binding sites.These results suggest that additional distinct sites, other than thosepreviously described in PBL and T cell line systems, are involvedin regulation of IFN-g gene expression in LPMC.

DiscussionIn this study, we examined molecular events and mechanisms in-volved in the regulation of IFN-g production after CD2 and CD21 CD28 as well as PMA/ionophore activation of LPMC. Our re-sults identify novel regulatory mechanisms in the mucosa that aredistinct from those in PBL and T cell lines. IFN-g gene expressionin LPMC is highly sensitive to CD2 activation. Coligation of theCD28 molecule further enhances IFN-g secretion by mucosal Tcells. Our data show that in CD2-activated PBL and LPMC, sim-ilar to what has been reported for TCR-activated PBL, CD28 co-stimulation enhances IFN-g mRNA stability without increasingthe rate of transcriptional activation. Transfection of a22.7-kbIFN-g promoter-reporter construct into both PBL and LPMC re-veals significant promoter activity after CD2 activation. After CD21 CD28 costimulation, there was a significantly greater increaseof transactivation in PBL, but not in LPMC. There are multipleCD2 and PMA activational response elements within the IFN-gpromoter with transactivation of IFN-g involving distinctcis-reg-ulatory regions in PBL as compared with LPMC.

Studies performed in PBMC and tumor T cell lines activated viaTCR and CD28 costimulation demonstrated that CD28 ligation ofactivated T cells results in enhanced secretion of multiple cyto-kines, including IFN-g (16, 17). The molecular mechanisms of thiseffect remain uncertain. Initially, nuclear run-on studies performedwith PBL revealed enhanced IFN-g mRNA stability after CD28costimulation. Although TCR stimulation results in IFN-g mRNAexpression, CD28 costimulation did not enhance transcriptionalactivity (16). Subsequent transfection studies in T cell lines sug-gest that a modest increase in transcriptional activation of theIFN-g promoter occurs after CD28 costimulation. Analysis of sev-eral cytokine promoter elements, including IFN-g, reveal a con-served region (2161 to2153 bp) in the 59-flanking sequence thatclosely resembles a promoter motif defined as the CD28 responseelement in the IL-2 promoter (16). Expression of the IL-2 geneafter CD28 costimulation has been well studied and occurs throughthe binding ofkB-like transcription factors to the CD28 responseelement (32). Multiple c-Rel and NFkB binding sites have beenidentified throughout the IFN-g promoter, although none of theseregions, including the conserved region2161 to 2153 bp, havebeen demonstrated to be selectively transactivated after CD28 co-stimulation (33).

At first glance, it would seem that there is a discrepancy betweenthe nuclear run-on data and the results from transfection analysis.However, several explanations could account for this discordance.Although traditionally the transcriptional run-on assay has beenfavored as the method for analyzing alterations in the rate of tran-scriptional initiation, it is relatively insensitive in part, due to mea-surement of transcription at a single time point outside the contextof the cell environment. Additionally, run-on assays do not directlymeasure initiation, but rather, they are indicative of the rate oftranscription through the measurement of elongation and run-on ofpreviously initiated transcript. Likewise, run-on assays are insen-

sitive for measuring changes in the rate of transcriptional elonga-tion, splicing, and mRNA transport and are susceptible to attenu-ation through DNA sequences within a gene (34). Indeed,regulation of IL-2 expression after cycloheximide treatment resultsin inconsistencies between the nuclear run-on data and enhancedmRNA levels, due to posttranscriptional up-regulation (35). More-over, the steady state levels of unspliced IL-2 mRNA precursorshave been shown to differ from those of IL-2-luciferase (36) due toa posttranscriptional mechanism. In contrast, transfection studiesdirectly measure the accumulative kinetics of transcriptional initi-ation within the intact cell. Our nuclear run-on data are in agree-ment with the literature (17, 18). Although one could argue thattransfection experiments measure promoter activity in the absenceof chromatin structure, marked differences in promoter responsewere displayed between PBL and LPL despite the fact that bothwould be subject to identical absence of chromatin structure. Moreimportantly, the transfection studies emphasize that although CD2leads to activation of the IFN-g promoter in both PBL and LPL,different and distinct promoter elements are involved in thisaugmentation.

In addition to the CD28 pathway, several additional signalingsystems affecting IFN-g mRNA stability have been described. Ex-pression of IFN-g mRNA in PHA-stimulated blasts or tumor Tcells is stabilized after treatment with both IL-2 and IL-12 (37).IL-7, in a dose-dependent manner, up-regulates IFN-g secretion ofCD28-coactivated T cells by increasing the transcriptional rate aswell as enhancing IFN-g mRNA stability (38). Similarly, in a mu-rine system, activation of either cAMP or protein kinase C resultedin enhanced IFN-g mRNA expression without having any effect ontransactivation of the IFN-g gene (39). Interestingly, studies ofpatients with atopic dermatitis suggest that disease pathology cor-relates with reduced IFN-g secretion (40). A posttranscriptionaldefect has been proposed as a mediator of the disease processbecause high levels of IFN-g mRNA are observed in the absenceof IFN-g protein secretion. Despite these studies, the precise mo-lecular mechanism regulating IFN-g mRNA stability remainsunclear.

The mRNA of IFN-g possesses multiple AUUUA motifs in the39-untranslated region of the mRNA (19). These sequences arebelieved to function as rapid turnover elements mediating mRNAdegradation. Indeed, the addition of AUUUA motifs onto normallystable transcripts has been shown in chimeric constructs to be suf-ficient to generate rapid turnover (41). Nevertheless, CD28 co-stimulation enhances IFN-g and IL-2 mRNA stability in PBL;however, no preferential enhancement in the stability of c-mycorc-foswas detected, notwithstanding the presence of AU-rich mo-tifs in these mRNAs (17). Recent studies of the IL-2 gene havesuggested that both 59and 39sequences within the untranslatedregion of the IL-2 mRNA are critical for mRNA stabilization (42).Indeed, the 59-untranslated region appears to be an important re-gion, targeting the activation of c-jun amino-terminal kinase,which leads to phosphorylation and activation of c-jun. Thus, c-junamino-terminal kinase activation not only results in an increase inbinding of AP-1 and up-regulated gene transcription but now alsohas been shown to directly promote mRNA stability. It is conceiv-able that similar unidentified sequences are present within theIFN-g gene that would directly link up-regulation of AP-1 activitywith enhanced IFN-g mRNA stability.

Functional studies indicate an increase in AP-1 activity afterCD2 activation of PBL and LPMC; however, the effect varies be-tween cell types. In PBL, a 120-fold increase in AP-1 activity wasdetected after transfection of an AP-1-binding construct, whereasin LPMC a more modest 20-fold enhancement of AP-1 activitywas observed. Transfection of progressive truncations of the IFN-g

1405The Journal of Immunology

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

promoter and constructs encompassing the AP-1-binding sites sug-gest that the region between2108 and164 bp, which is criticalfor CD2 and PMA/ionophore transactivation in PBL, is of onlymodest importance in transactivation in LPMC. In LPMC, a sig-nificant CD2 response element resides between2204 and2108bp, a region previously reported in PBL and T cell lines to possessan essential AP-1-binding site. CD2-mediated transactivation ofthe IFN-g promoter in LPMC is not altered by deletion of thisAP-1 site. Moreover, in direct contrast to what has been previouslyreported for PBMC, EMSA analysis of nucleoprotein binding tothe known AP-1-binding elements described within both the2108- and164-bp and2204- and2108-bp regions supports theconclusion that CD2 activation does not appreciably alter nuclearproteins binding to these sites in LPMC. However, a change in thecomposition of these nuclear protein complexes cannot be ruledout. These results illustrate the complexity of molecular eventsinvolved in transcriptional regulation of IFN-g expression inLPMC and highlight unique regulatory mechanisms distinct fromthose we observed in PBL and previously noted T cell lines.

In T cell lines, the IFN-g promoter possesses multiple AP-1-binding sites. The two promoter elements designated the proximal(273 to 248) and distal (296 to280) binding sites have beenshown to be critical for transactivation of IFN-g expression in Tcell lines. The proximal element has been shown to be a target forselective hypomethylation in cells that express IFN-g (43) and isbelieved to generate activation-specific expression in T-cell linesthrough binding of jun/ATF-2 heterodimers to this element (10).These sites are targets for selective inhibition of IFN-g gene trans-activation after glucocorticoid treatment (8), but not following ret-inoid treatment (44, 45). Additionally, whereas these sites are crit-ical in regulation in PBL and T cell lines, they are of modestimportance in modulating CD2 response in LPMC. Thus, it ap-pears that both the cell type and the mode of activation play a rolein the selective transactivation of promoter elements.

Recent studies in our laboratory evaluating expression of IL-2 inLPMC support the notion that regulation of cytokine gene expres-sion in PBL differs from that observed in LPMC (24, 46). Addi-tional studies by other groups have indicated that regulation ofIFN-g gene expression in primary T cells differs from that ob-served in tumor T cell lines and likewise differs in naive comparedwith memory T cell subsets. On a structural level, the IFN-g geneis virtually completely methylated in thymocytes or CD45RAhigh

CD45ROlow neonatal or adult T cells that do not express IFN-g(47). In contrast, the IFN-g gene is in a hypomethylated state inadult CD45RAlow CD45ROhigh T cells that express IFN-g. It hasbeen suggested that the interplay between inducible and constitu-tive nucleoprotein interactions directs IFN-g gene transcription invivo. For example, in a transgenic murine primary T cell system,expression of IFN-g in memory cells was under the control of boththe proximal and distal element, yet naive T cells required primingto activate transcription from these elements (28). Furthermore,cAMP inhibited transactivation directed by the proximal elementin primed mouse CD81 T cells; however, transactivation of thedistal element was increased in these same cells after induction ofcAMP (28). In fact, distinct differences were seen in the transac-tivation of these two elements when comparing murine CD41 andCD81 T cells subsets (28).

The mononuclear cells in this study are comprised of predom-inantly CD45RAlow CD45ROhigh memory T cells of both CD41

and CD81 T cell subsets (21). Regulation of transcription in thesecells appears distinct from that observed in PB memory T cells.The 2183- and2196-bp AP-1 binding site, located within theBED element first identified in T cell lines, encompasses a numberof overlappingcis elements capable of binding YY-1, AP-1 and

SP-1 (12). It was hypothesized that the selective binding of AP-1to this region, displacing YY-1, was critical for transcriptional ac-tivation. Studies of PBL supported this hypothesis and suggestedthat the composition of DNA-protein interactions binding to the2183- and2196-bp AP-1 site in human memory T cells differsfrom that seen in naive T-cells (13). Indeed, deletion of this sitevirtually eliminates expression of IFN-g in peripheral memory T-cells (13). In direct contrast in LPMC, Fig. 6 shows that deletionof this AP-1-binding site fails to abolish CD2 activation of LPMC.Likewise, although inducible nucleoprotein binding was detectedin peripheral memory T cells binding to this site, EMSA analysisof nucleoprotein extracted from LPMC remained unchanged afterCD2 activation.

Thus, it appears that there is a specific interplay between a com-plex of factors binding to numerouscis-regulatory sequenceswhich may be regulated differently in LP T cells from those ofPBL and T cell lines. The selective activation of these elementsmight play an important role in mediating cytokine expression inthe intestine. CD2 signaling of LPMC or PBL results in functionalactivation of AP-1, suggesting that regulation of AP-1 binding maybe essential for IFN-g production. However, the previously iden-tified AP-1-binding sites of the IFN-g promoter including theproximal, distal, as well as BED region AP-1 site, are not thetargets for CD2-directed transactivation in LPMC. In addition,these studies represent the first reports of transcriptional activationof the IFN-g promoter in response to CD2 stimulation. The datapresented in this study provide evidence indicating that regulationof IFN-g production in LP T cells is complex, involving regulationof multiple cis-regulatory sequences within the IFN-g promoterregion that differ from those elements important for IFN-g activa-tion of peripheral T cells.

AcknowledgmentsWe thank Krystine Nguyen and Alice Chen for isolating human LPMC.

References1. Young, H. A., and K. J. Hardy. 1995. Role of interferon-g in immune cell reg-

ulation.J. Leukocyte Biol. 58:373.2. Lewis, D. B., and C. B. Wilson. 1990.g-Interferon: an immunoregulatory lym-

phokine with immunotherapeutic potential.Pediatr. Infect. Dis. J. 9:642.3. Lewis, D. B., C. C. Yu, J. Meyer, B. K English, S. J. Kah, and C. B. Wilson.

1991. Cellular and molecular mechanisms for reduced interleukin 4 and interfer-on-g production by neonatal T cells.J. Clin. Invest. 87:194.

4. Kang, S. M., B. Beverly, A. C. Tran, K. Brorson, R. H. Schwartz, andM. J. Lenardo. 1992. Transactivation by AP-1 is a molecular target of T-cellclonal anergy.Science 257:1134.

5. Gray, P. W., and D. V. Goeddel. 1987. Molecular biology of interferon-g. Lym-phokines 13:151.

6. Sehgal, P. B., L. T. May, and F. R. Landsberger. 1986. Primary structural repeatsin human and in murineg-interferon.J. Interferon Res. 6:39.

7. Gray, P. W., and D. V. Goeddel. 1982 Structure of the human immune interferongene.Nature 298:859.

8. Cippitelli, M., A. Sica, V. Viggiano, J. Ye, P. Ghosh, M. J. Birrer, andH. A. Young. 1995. Negative transcriptional regulation of the interferon-g pro-moter by glucocorticoids and dominant negative mutants of c-Jun.J. Biol. Chem.270:12548.

9. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, and C. B. Wilson. 1993. Twoessential regulatory elements in the human IFN-g promoter confer activationspecific expression in T cells.J. Exp. Med. 178:1483.

10. Penix, L. A., W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, and C. B. Wilson.1996. The proximal regulatory element of the interferon-g promoter mediatesselective expression in T cells.J. Biol. Chem. 271:31964.

11. Ye, J., P. Ghosh, M. Cippitelli, J. Subleski, K. J. Hardy, J. R. Ortaldo, andH. A. Young. 1994. Characterization of a silencer regulatory element in thehuman interferon-gamma promoter. J. Biol. Chem. 269:25728.

12. Ye, J, M. Cippitelli, L. Dorman, J. R. Ortaldo, and H. A. Young. 1996. Thenuclear factor YY1 suppresses the human interferon-g promoter through twomechanisms: inhibition of AP1 binding and activation of a silencer element. Mol.Cell. Biol. 16:4744.

13. Barbulescu, K., K. H. Meyer zum Buschenfelde, and M. F. Neurath. 1997. Con-stitutive and inducible protein/DNA interactions of the interferon-g promoter inin vivo CD45RA and CD45R0 T helper subsets.Eur. J. Immunol. 27:1098.

1406 MUCOSA-SPECIFIC TARGETS FOR REGULATION OF IFN-g

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

14. Hansen, J. A., P.J. Martin, and R. C. Nowinski. 1980. Monoclonal antibodiesidentifying a novel T cell antigen and Ia antigens of human lymphocytes.Immu-nogenetics 10:247.

15. June, C.H., J. A. Ledbetter, M.M. Gillespie, T., Lindsten, and C. B. Thompson.1987. T cell proliferation involving the CD28 pathway is associated with cyclos-porine-resistant interleukin 2 gene expression.Mol. Cell. Biol. 7:4472.

16. Thompson, C. B., T. Lindsten, J. A. Ledbetter, S. L. Kunkel, H.A. Young,S. G. Emerson, J. M. Leiden, and C. H. June. 1989. CD28 activation pathwayregulates the production of multiple T cell derived lymphokines/cytokines.Proc.Natl. Acad. Sci. USA 86:1333.

17. Lindsten, T., C. H. June, J. A. Ledbetter, G. Stella, and C. B. Thompson. 1989.Regulation of lymphokine messenger RNA stability by a surface-mediated T cellactivation pathway.Science 244:339.

18. Fraser, J. D., and A. Weiss. 1992. Regulation of T-cell lymphokine gene tran-scription of the accessory molecule CD28.Mol. Cell. Biol. 12:4357.

19. Caput, D., B. Beutler, K. Hartog, R. Thayer, S. Brown-Shiner, and A. Cerami.1986. Identification of common nucleotide sequence in the 39-untranslated regionof mRNA molecules specifying inflammatory mediators.Proc. Natl. Acad. Sci.USA 83:1670.

20. Pirzer, U. C., G. Schurmann, S. Post, M. Betzler, and S. C. Meuer. 1990. Dif-ferential responsiveness to CD3-Ti vs. CD2-dependent activation of human in-testinal T-lymphocytes.Eur. J. Immunol. 20:2339.

21. Targan, S. R., R. L. Deem, M. Liu, S. Wang, and A. Nel. 1995. Definition of alamina propria T cell responsive state: enhanced cytokine responsiveness of Tcells stimulated through the CD2 pathway.J. Immunol. 154:664.

22. Boirivant, M., I. J. Fuss, C. Fiocchi, J. S. Klein, S.A. Strong, and W. Strober.1996. Hypoproliferative human lamina propria T cells retain the capacity to se-crete lymphokines when stimulated via CD2/CD28 signaling pathway.Proc. As-soc. Am. Physicians 108:55.

23. Mulin, G., Z. R. Maycon, L. Braun-Elwert, R. Cerchia, S. P. James, S. Katz,G. Weissman, M. J. McKinley, and S. E. Fisher. 1996. Inflammatory boweldisease mucosal biopsies have specialized lymphokine mRNA profiles.Inflamm.Bowel Dis. 2:16.

24. Gonsky, R., R. L. Deem, C. C. W. Hughes, and S. R. Targan. 1998. Activationof the CD2 pathway in lamina propria T cells up-regulates functionally activeAP-1 binding to the IL-2 promoter, resulting in messenger RNA transcription onIL-2 secretion.J. Immunol. 160:4914.

25. Shanahan, F., M. Brogan, and S. R. Targan. 1987. Human mucosal cytotoxiceffector cells.Gastroenterology 92:1951.

26. Self, C. H. 1985. Enzyme amplification: a general method applied to provide animmunoassisted assay for placental alkaline phosphatase.J. Immunol. Methods76:389.

27. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman,J. A. Smith, and K. Struhl, eds. 1990.Current Protocols in Molecular Biology.Greene Publishing Associates and Wiley-Interscience, New York, pp.4.10.1–4.10.8.

28. Aune, T. M., L. A. Penix, M. R. Rincon, and R. A. Flavell. 1997. Differentialtranscription directed by discreteg interferon promoter elements in naive andmemory (effector) CD4 T cells and CD8 T cells.Mol. Cell. Biol. 17:199.

29. Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat,P. Herrlich, and M. Karin. 1987. Phorbol ester-inducible genes contain a commoncis element recognized by a TPA-modulatedtrans-acting factor.Cell 49:729.

30. Hughes, C. C. W., and J. S. Pober. 1996. Transcriptional regulation of the inter-leukin-2 gene in normal human peripheral blood T cells.J. Biol. Chem. 271:5369.

31. Young, H. A., K. L. Komschlies, V. Ciccarone, M. Beckwith, M. Rosenberg,N. A. Jenkins, N. G. Copeland, and S. K. Durum. 1989. Expression of humanIFN-g genomic DNA in transgenic mice.J. Immunol. 143:2389.

32. Fraser, J. D., B. A. Irving, G.R. Crabtree, and A. Weiss. 1991. Regulation ofinterleukin-2 gene enhancer activity by the T cell accessory molecule CD28.Science 251:313.

33. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, andH. A. Young. 1997. Interaction of NF-kB and NFAT with the interferon-g pro-moter. J. Biol. Chem. 272:30412.

34. Wright, S., and J. M. Bishop. 1989. DNA sequences that mediate attenuation oftranscription from mouse protooncogene myc.Proc. Natl. Acad. Sci. USA 86:505.

35. Gerez, L., G. Arad, S. Efrat, M. Ketzinel, and R. Kaempfer. 1995. Post-tran-scriptional regulation of human interleukin-2 gene expression at processing ofprecursor transcripts.J. Biol. Chem. 270:19569.

36. Umlauf, S. W., B. Beverly, O. Lantz, and R. H. Schwartz. 1995. Regulation ofinterleukin 2 gene expression by CD28 costimulation in mouse T cell clones: bothnuclear and cytoplasmic RNAs are regulated with complex kinetics.Mol. Cell.Biol. 15:3197.

37. Chan, S. H., M. Kobayashi, D. Santoli, B. Perussia, and G Trinchieri. 1992.Mechanisms of IFN-g induction by natural killer cell stimulatory factor (NKSF/IL-12). J. Immunol. 148:92.

38. Borger, P., H. F. Kauffman, D. S. Postma, and E. Vellenga. 1996. IL-7 differ-entially modulates the expression of IFN-g and IL-4 in activated human T lym-phocytes by transcriptional and post-transcriptional mechanisms.J. Immunol.156:1333.

39. Kaldy, P., and A. M. Schmitt-Verhulst. 1995. Regulation of interferon-g mRNAin a cytolytic T cell clone:Ca2 1-induced transcription followed by mRNA sta-bilization through activation of protein kinase C or increase in cAMP.J. Immu-nol. 25:889.

40. Tang, M. L. K., G. Vargios, and A. S. Kemp. 1994. Reduced interferon-gammasecretion with increased IFN-g mRNA expression in atopic dermatitis: evidencefor a post-transcriptional defect.Clin. Exp. Immunol. 97:483.

41. Shaw, G., and R. Kamen.1986. A conserved AU sequence from the 39 untrans-lated region of GM-CSF mRNA mediates selective mRNA degradation.Cell46:659.

42. Chen, C. Y., F. D. Gatto-Konczak, Z. Wu, and M. Karin. 1998. Stabilization ofinterleukin-2 mRNA by the c-jun NH2-terminal kinase pathway.Science 280:1945.

43. Young, H.A., P. Ghosh, J. Ye, J. Lederer, A. Lichtman, J. Gerard, L. Penix,C. B. Wilson, A. J. Melvin, M. E. McGurn, D. B. Lewis, and D. D. Taub. 1994.Differentiation of the T helper phenotypes by analysis of the methylation state ofthe IFN-g gene.J. Immunol. 153:3603.

44. Cippitelli, M., J. Ye, V. Viggiano, A. Sica, P. Ghosh, A. Gulino, A. Santoni, andH. A. Young. 1996. Retinoic acid-induced transcriptional modulation of the hu-man interferon-g promoter.J. Biol. Chem. 271:26783.

45. Cantorna, M. T., F. E. Nashold, T. Y Chun, and C. E. Hayes. 1996. Vitamin Adown-regulation of IFN-g synthesis in cloned mouse Th1 lymphocytes dependson the CD28 costimulatory pathway.J. Immunol. 156:2674.

46. Gonsky, R., R. L. Deem, D. H. Lee, A. Chen, and S. R. Targan. 1999. CD28co-stimulation augments IL-2 secretion of activated lamina propria T cells byincreasing mRNA stability without enhancing IL-2 gene transactivation.J. Im-munol. 162:6621.

47. Melvin, A. J., M. E. McGurn, S. J. Bort, C. Gibson, and D. B. Lewis. 1995.Hypomethylation of the interferon-g gene correlates with its expression by pri-mary T-lineage cells.Eur. J. Immunol. 25:426.

1407The Journal of Immunology

by guest on January 30, 2018http://w

ww

.jimm

unol.org/D

ownloaded from