Molecular tagging of genes- an overview

Submitted to: Submitted by: Dr. V.K. Chaudhary Kirti (Department of Molecular Ph.D (MBB) Biology and Biotechnology) 2012BS26D

Advances in crop improvement (MBB 604)

Gene tagging

Gene tagging refers to the identification of existing DNA or the introduction of new DNA that can function as a tag or label for the gene of interest.

Gene tagging is a most common method used today for selection against different biotic and abiotic stress resistances studies in crop plants.

There are four different strategies used for gene tagging.

Types of gene tagging

Marker based gene tagging

Transposon tagging

T-DNA tagging

Epitope tagging

Marker based gene tagging

A Molecular marker is a DNA sequence which is readily detected and

whose inheritance can be easily monitored. The effectiveness of molecular markers depends on their ability to

identify variation in the DNA of a population, known as marker polymorphism

Molecular markers are detected as differences in DNA fragment size, which arise from differences in DNA sequence.

Molecular markers are widely used in marker-assisted breeding for tagging of an important trait or traits in a breeding program.

Types of DNA Marker can be differentiated based on molecular technique used to develop the marker

- Hybridization (eg, RFLP) - PCR (eg, SSR) - Sequencing (eg, ESTs)

The genome size of most plant species ranges between 108 to 1010 base pairs, so even a small proportion of variation in DNA can yield a large number of potential markers (Paterson et al., 1991).

Desirable properties for a good molecular marker

High PolymorphicCo-dominant inheritanceEasy, fast and cheap to detectHigh resolution with large number of samplesNondestructive assayRandom distribution throughout the genome Assay can be automated

Polymorphism-Parent 1 : one band-Parent 2 : a smaller band-Offspring 1 : heterozygote = both

bands-Offspring 2 : homozygote

PolymorphismParent 1 : one band-Parent 2 : no band-Offspring 1 : homozygote parent 1

P 2P 1 O 2O 1

Gel configuration

Co-dominant marker

P 2

Gel configurationP 1 O 1 O 2

Dominant marker

.Restriction Fragment Length Polymorphism

RFLP (The first type of DNA markers that were used for genetic mapping were RFLPs (Botstein et al., 1980)

co-dominant marker

Disadvantages– Time

consuming

– Expensive– Use of

radioactive probesRFLP

The term microsatellites was coined by Litt and Lutty (1989).

Regions of genome where a short (1-6 base) motif is repeated many times (can be repeated 10 to 100 times).

If the nucleotide sequences in the flanking regions of microsatellites are known, specific primers can be designed to amplify the microsatellite by PCR.

Simple Sequence Repeats (SSR): Microsatellites

Sequence Primer

ACTGTCGACACACACACACACGCTAGCT (AC)7

TGACAGCTGTGTGTGTGTGTGCGATCGA

ACTGTCGACACACACACACACACGCTAGCT (AC)8

TGACAGCTGTGTGTGTGTGTGTGCGATCGA

ACTGTCGACACACACACACACACACACGCTAGCT (AC)10

TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA

ACTGTCGACACACACACACACACACACACACGCTAGCT (AC)12

TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA

AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGGP1

AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCGP2

P1 P2

SSR polymorphisms

Gel configuration

These microsatellite repeat sequences are usually polymorphic in different lines because of variations in the number of repeat units.

These are used as co-dominant genetic markers.

They have high genomic abundance.

SSR offer the additional advantage that they do not involve the use of restriction endonucleases, thus avoid the problems associated with partial digestions.

Evenly distributed throughout the genome. Interpretation of result is simple. Easily automated, allowing multiplexing. Good analytical resolution and high

reproducibility.

Require very little and not necessarily high quality DNA.

Costly primer developing.

These markers are based on variation of single nucleotide between two or more genotypes or individuals.

They are more abundant polymorphic marker with 2-3 polymorphic sites every kilobase (Cooper et al., 1985).

In plants, SNPs are very abundant- in wheat 1 SNP per 20 bp and in maize 1 SNP per 70 bp in certain regions of their genotype.

DNA strand 1 differs from DNA strand 2 at a single base-pair location (a C/T polymorphism).

Single Nucleotide Polymorphisms (SNPs)

.

Hybridization using fluorescent dyescostly

labour oriented

Expressed Sequence Tags (ESTS)

ESTs are small pieces of DNA usually 200-500 nucleotide long. Their location on the chromosome and sequence are known ESTs are created from cDNA, a single strand of DNA that has

been copied from an mRNA molecule i.e. it consist only of exon. - the

method is fast - doesnot

require radioactive

material -

sequence information is

required

Molecular tagging of genes for biotic stress resistance

Biotic Stress is stress that occurs as a result of damage done to

plants by other living organisms, such as bacteria, viruses, fungi, parasites, beneficial and harmful insects, weeds, and cultivated or native plants.

To combat resistance to biotic stresses different molecular techniques are used these days. Restriction fragment length polymorphism (RFLP) have been used for the molecular tagging of various agronomic traits in different crop species.

Journal of Plant Pathology (2010), 92 (2), 495-501

Marker-assisted breeding for resistance to bacterial leaf blight in popular cultivar and parental lines of hybrid rice

M.L. Shanti, V.V. Shenoy, G. Lalitha Devi, V. Mohan Kumar, P. Premalatha, G. Naveen Kumar, H.E.

Shashidhar, U.B. Zehr and W.H. Freeman

Bacterial blight (BB) elicited by Xanthomonas oryzae pv. oryzae (Xoo) is one of the most devastating diseases across the tropics and semi-tropics.

Molecular markers are becoming essential components in breeding programs involving gene pyramiding.

Using marker-assisted selection in a backcross-breeding program, four bacterial blight resistant genes namely Xa4, xa5, xa13 and Xa21 have been introgressed into the hybrid rice parental lines KMR3, PRR78, IR58025B, Pusa 6B and the popular Mahsuri.

IRBB60, a near isogenic line carrying the four resistant genes Xa4, xa5, xa13 and Xa21 served as the donor for all the crosses attempted.

DNA isolation for PCR analysis of the parents and backcross progenies was carried out. Three sequence-tagged-site (STS) markers Npb 181, RG 136 and pTA 248, tightly linked to Xa4, xa13 and Xa21 and one simple sequence repeat (SSR) marker RM 122 tightly linked to xa5 was used to confirm the presence of each gene and the different combinations.

Screening for BB resistance. The pyramided lines in the backgrounds of Mahsuri, KMR3 and PRR78 were evaluated for their reaction to BB under glasshouse conditions.

Marker-assisted selection for BB resistant genes :Nine F1 plants from each of the crosses between Mahsuri/IRBB60 , KMR3/IRBB60, PRR78/IRBB60, IR58025B/IRBB60, Pusa 6B/IRBB60 were tested for their heterozygosity for the R gene linked markers and were backcrossed using the female parent.

The resulting BC1 F1 lines were first checked for presence of the Xa21 resistance allele.

All plants carrying the resistant allele were checked for the presence of the xa5 allele in heterozygous condition.

Plants containing resistant alleles for both genes were further screened for the Xa4 gene using Npb 181.

Finally, the triple positives were screened for the presence of xa13 allele.

.

Phenotyping of these target plants was done at the field level and only those showing the maximum similarity to the recurrent parent and showing high yield were selected.

This was continued up to the BC3F1 generation. BC3F2 that were screened using the R gene linked markers to identify plants that were homozygous for different R genes or their combinations.

Disease resistance The gene pyramids in the backgrounds of Mahsuri, KMR3 and PRR78 showed a very high degree of resistance as compared to their parents to all the Xoo isolates inoculated.

There were varying degrees of resistance to each of the isolates, but no isolate could break the resistance of any of the four-gene pyramids.

The defining property of transposable elements (jumping genes) is their mobility; i.e. they are genetic elements that can move from one position to another in the genome.

Transposon tagging is a gene cloning strategy that relies on the transposon to provide a DNA “tag” with a known sequence .

The transposon sequence is used to identify DNA sequences adjacent to the transposable element.

Some transposable elements move in a replicative manner, whereas others are nonreplicative, i.e. they move without making a copy of themselves.

Transposons describe the DNA which can be cut away from one site and paste to other place within the genome (cut and paste mechanism).

Transposon Tagging

Retrotransposon make themselves a copy and then paste to other position within the genome. The moving of retrotransposons involves RNA but not in transposons.

The maize transposable element Activator (Ac) first identified by McClintock (1948) is a kind of transposon widely used for creating MGE (mobile genetic element) insertions.

Ac element can insert themselves into genes. The mutations caused are unstable because the Ac element can be excised from the inserted gene by the transposase which is coded by Ac element itself.

Dissociation (Ds) element is usually stable because they are incapable of excising itself from the inserted gene unless with the help of Ac element.

Researchers combine these two mobile elements and named it as the Ac/Ds system to generate mutant populations.

.

.

TEs occur in families of related sequences, defined by their ability to interact genetically. Within any one family, individual elements occur in two forms:

“Autonomous” element- structurally conserved element capable of promoting its own excision.

“Non-autonomous” elements- structurally heterogeneous group of elements unable to promote their own excision.

Non-autonomous elements from one family can be trans-activated only by the autonomous member of the same family.

Examples of such families of plant TEs include Activator-Dissociation (Ac/Ds) from maize.

Other examples of Ac-Ds system includes Arabidopsis thalliana and carrot, potato, tomato, petunia, soybean, etc.

This strategy incorporates the transgene of interest into a Ds element, and introduces the construct either into plants that already contain an Ac-transposase gene, or co-transforms this construct with an Ac-transposase gene into the plant species of interest.

The reddish streaks on these corn grains are caused by transposons

The individual Ds parental lines and Ac parental lines are created by transformation of Ac element and Ds element independently into the host organism.

Then the two parental lines are crossed to induce the translocations of the Ds element in the next generation.

By crossing Ac parent line and Ds parent line, Ds element is activated- Ds element transfer from one position to another position within the genome which will create random disruption of gene functions in the following generations.

Some transposition events inactivate genes, since the coding potential or expression of a gene is disrupted by insertion of the transposable element.

A classic example is the r allele of the gene encoding a starch branching enzyme in peas is nonfunctional due to the insertion of a transposable element.

This allele causes the wrinkled pea phenotype in homozygotes originally studied by Mendel.

In other cases, transposition can activate nearby genes by bringing an enhancer of transcription (within the transposable element) close enough to a gene to stimulate its expression.

In other cases, no obvious phenotype results from the transposition.

Schematic of a transposon-tagged mutation.

Transposon tagging is of two types : (a) directed tagging (b) non-directed tagging

Directed Tagging : Directed transposon tagging recovers

mutations at a specific locus of interest.

Directed tagging identifies transposon-induced alleles by crossing transposon-active plants with a reference allele of the mutation.

The mutable alleles are separated from the reference allele by crossing the F1 to a standard line (hybrid, inbred, or tester).

To identify a co-segregating transposon, the mutable allele is backcrossed into the standard line, and the backcrossed progeny are self-pollinated.

Non-directed Tagging : Directed tagging is limited to

mutants that are non-essential for a plant to complete its life cycle. This approach requires a homozygous mutant tester and detects tagged alleles via a mutant phenotype in the F1.

If a mutant is lethal or infertile, a heterozygous tester could be generated.

Tagged-alleles would be recovered at half the frequency due to the segregation of the mutation in the tester.

However, most mutants would be lost in the first generation after the directed tagging crosses.

.

Many lethal or infertile mutants have been cloned by transposon tagging. The tagged alleles of these mutants are identified from non-directed tagging.

For non-directed tagging, transposon-active stocks are generally crossed to a standard line and the resulting progeny are self-pollinated.

The self-pollinated families are screened for recessive mutants and segregating populations are generated by backcrossing into the standard line.

Segregating populations of the mutable alleles are then screened by DNA gel blot or with PCR methods to identify transposon insertions that co-segregate with the mutable phenotype.

Although both schematics show the transposon parent as a pollen parent, transposon mutagenesis can be completed with either a male or a female transposon parent.

T-DNA tagging

T-DNA of Agrobacterium, generally used as a vector in genetic transformation, could also be considered as a insertional mutagen (Koncz et al., 1989) and with its sequence characterized T-DNA could also be used as a tag (Koncz et al., 1990).

Insertion of foreign DNA can alter the expression of neighbouring gene, resulting in gain or loss of function which produces a screenable phenotype

the sequence of the tag provided a landmark allowing its isolation along with the mutated gene

Many integrate within transcriptional units so that promoters, enhancers, exons and introns can be tagged.

The integrated T-DNA is genetically stable and however from time to time, regions within the T-DNA can become methylated and the resultant reduction in gene expression can result in phenotypic instability.

DNA transferred to the plant genome is precisely defined by the border sequences. The genes encoded by the T-DNA can be replaced without interfering with the transfer process.

Why T-DNA?

1. Active transposons do not exist in every species including Arabidopsis.

2. Agrobacterium-mediated transformation is simpler.3. More likely to generate simpler full-length integration as

compared to other methods.4. T-DNA insertion mainly occurs in transcriptionally active area

of the genome.5. The mutated locus gets tagged.

TYPES OF T-DNA TAGGING (a) Promoter tagging (b) Activation tagging

Earlier , T-DNA used as a tag involved linking a promoter less marker gene to the border of the T-DNA and selecting for transgenics.

A concern with this type tagging is that only gene fusions expressed at the time of selection may be recovered and that T-DNA insertions can occur at high copy (Koncz et al., 1989, 1992).

A. Promoter Tagging :

Promoter tagging work has focused on preliminary selection for transformants being based on constitutive expression of a marker gene followed by screening for expression of a promoter-less marker gene to identify events where a promoter has been tagged.

Other promoter-less marker genes have been adopted that are easier to screen for activity of tagged promoters such as β-glucuronidase (GUS) and luciferase (LUX).

B. Activation Tagging :

Activation tagging is a gain-of-function method that generates transgenic plants by T-DNA vectors with tetrameric cauliflower mosaic virus (CaMV) 35S enhancers which can lead to an enhancement expression of adjacent genes.

Differently from the action of the complete CaMV 35S promoter, CaMV 35S enhancers can activate both the upstream and downstream gene transcription.

Activation tagging technique was firstly developed by Walden and colleagues . Since then, several large scale activation tagging mutant resources have been generated and activation tagging method was widely used to isolate new genes.

As an early example, the activation-tagging technique was used in tissue culture to identify cytokinin-independent mutants in Arabidopsis and CKI1 gene whose overexpression can bypass the requirement for cytokinin in the regeneration of shoots was identified.

Activation tagging has identified a number of genes fundamental to plant development, metabolism and disease resistance in Arabidopsis.

A further limitation to the present generation of T-DNA activation tagging vectors is the tissue specificity of the CaMV 35S enhancer sequence (Benfey and Chua 1989). For example, while this enhancer is active in leaves it has poor activity in roots.

Utilization of T-DNA Tagging Lines in Rice Jakyung Yi and Gynheung An J. Plant Biol. (2013) 56:85-90

Rice is a good model plant for cereal research because of its small genome size and well established procedures for stable transformation (An et al.,1988).

The insertion mutants generated by T-DNA has been the most commonly used.

By sequencing PCR-amplified fragments near the inserted elements, researchers have been able to construct various flanking sequence databases (http://signal.salk.edu/cgi-bin/RiceGE).

Five binary vectors (pGA2144, pGA2707, pGA2715, pGA2717, and pGA2772) were used for insertion mutagenesis.

All contain the hygromycin-resistance gene hph,which was constructed using the α-tubulin promoter with its first intron, the coding region of hph, and the terminator from T7 or α-tubulin.

These vectors also carry the promoterless β-glucuronidase (gus) with a synthetic intron.

This feature allows for a high frequency translational fusion between the tagged gene and gus when the reporter gene is inserted within a gene in the same direction.

When a translation fusion occurs, expression patterns for the tagged gene can be easily analyzed at the cellular level through simple GUS analysis.

In pGA2715 and pGA2772, multimerized transcriptional enhancers from the cauliflower mosaic virus 35S promoter were placed next to the left border.

The enhancer can increase expression of nearby genes at the T-DNA insertion site. These activation tagging vectors produce gain-of-function mutants that have several advantages over knockout mutants.

Epitope tagging

An epitope (also called an antigenic determinant) is any structure or sequence that is recognized by an antibody. A single large molecule such as a protein may have many epitopes.

Epitope Tagging:

DNA: AAAGATGAATCAG ... ACATCGTGACCTA...Protein: N-Met-Asn-Gln-…-Thr-Ser-C

epitope:DNA: TATCCCTACGACGTTCCGGATTATGCCProtein: N-Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala-C

Fusion Gene: AAAGATGTATCCCTACGACGTTCCGGATTATGCC AATCAG...

Fusion Protein: N-Met-Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala-Asn-Gln-…-Thr-Ser-C

Epitope tagging offers several advantages over other methods of analyzing and purifying proteins:

Epitope tagging is much faster than the traditional method of producing a new antibody to every protein studied. The same tag-specific antibody will recognize the epitope tag in many different proteins.

Epitope tagging is much less costly and labor intensive than setting up and maintaining antibody-producing facilities.

Adding a small (3–14 amino acid) epitope tag generally does not affect the function of the tagged protein, allowing the study of the tagged protein’s role in the cell.

Epitope tagging makes it possible to gather information about proteins that would otherwise be too difficult to purify or too similar to other proteins to be distinguished in vivo.

pLMI carries a fusion gene consisting of the c-myc epitop tag and the DNA binding domain (GC) of the wheat EmBP-1 gene (Guiltinan et al., 1990).

Guiltinan MJ and McHenry L, Methods in cell biology, vol. 49

THANK YOU !!!!