molecular genetic characterisation of mirafiori lettuce ...€¦ · rocky balboa, 2006 . iv . v...

i

Molecular genetic characterisation of Mirafiori lettuce

big-vein virus and Lettuce big-vein associated virus and

their vector Olpidium virulentus associated with

Lettuce Big-Vein Disease and the determination of

their inoculum sources in Western Australia.

This thesis is presented for the degree of Doctor of Philosophy of The

University of Western Australia

School of Plant Biology

Plant Pathology

The University of Western Australia

December, 2009

LINDA DIANNE MACCARONE

B. Sc (Cons. Biol.) (Murdoch University)

Hons (Biol. Sc.) (Murdoch University)

iii

“... it ain‟t how hard you hit; it‟s about how hard you can get hit

and keep moving forward...”

Rocky Balboa, 2006

v

Abstract

Lettuce Big-Vein Disease (LBVD) is a common chytrid- and soil-borne virus disease

that affects lettuce in Western Australia. It causes chlorophyll clearing of the veins of

the lettuce leaf, leaf crinkling and decreased head size, which together result in

decreased yield and quality of lettuce. The phylogenetic relationships of Lettuce big-

vein associated virus (LBVaV) and Mirafiori lettuce big-vein virus (MLBVV) and their

vector Olpidium virulentus, associated with LBVD in Western Australia were

established. Sources of inoculum in commercial lettuce seedling nurseries and

commercial lettuce growing fields in south-western Australia were identified with an

aim of improving strategies to manage the disease.

Lettuce plants showing symptoms of lettuce big-vein disease were collected from the

Perth Metropolitan region of south-west Australia and DNA extraction was done on

their roots. When PCR primers designed specifically in this study were used to amplify

the rDNA ITS region of O. brassicae and O. virulentus in extracts, only O. virulentus

was detected. Phylogenetic analysis of the complete rDNA-ITS region sequences of the

five Australian isolates and 10 others was done. The Australian isolates fitted within

two clades of O. virulentus (I and II), and within clade I, into two of its four sub-clades

(Ia and Id). LBVaV and MLBVV were both detected when symptomatic lettuce leaf

tissue samples corresponding to the root samples of these plants were tested using virus-

specific primers in Reverse Transcription-PCR. The presence of both viruses was found

to be associated with O. virulentus occurrence.

vi

MLBVV, genus Ophiovirus, was detected in samples of big-vein diseased lettuce plants

collected from seven different farms in south-west Australia. The complete coat protein

(CP) gene encoding sequences of 13 isolates were obtained from these samples.

Phylogenetic analysis of these samples and others from five continents revealed that

within each of the two major MLBVV clades (A and B) there were two sub-clades.

Sub-clade A1 contained 13 isolates from Australia, six from Europe and one from

Japan; A2 comprised one isolate from Australia and six from Europe; while B1 and B2

comprised two and five European isolates, respectively, all from Spain. The presence of

Australian isolates in two separate sub-clades suggests that there have apparently been

at least two separate introductions of MLBVV to the isolated Australian continent.

LBVaV, genus Varicosavirus, was detected in leaf samples of LBVD affected plants

collected from four different lettuce growing properties in south-west Australia. The

complete CP gene encoding sequence of seven isolates was obtained from these

samples. Phylogenetic analysis of these isolates and others from five continents, and

Tobacco stunt virus (TStV) isolates from Japan, revealed two Clades, I and II. Clade I

contained isolates only from Europe whereas Clade II contained both LBVaV and TStV

isolates from Australia and Japan and formed three distinct Sub-clades. Sub-clade IIa

contained Australian LBVaV isolates, Sub-clade IIb contained Japanese LBVaV

isolates and Sub-clade IIc contained all of the five TStV isolates which were all from

Japan. Due to the high level of genome conservation indicated with this study, further

evidence is given to support TStV as a tobacco strain of LBVaV rather than a distinct

species in the genus Varicosavirus.

vii

As previous studies have only determined the presence of LBVaV in lettuce seedling

nurseries and in commercial lettuce growing fields, this study also confirmed the

presence of LBVaV and, additionally, the presence of MLBVV in both situations by

using RT-PCR and DAS-ELISA. Lettuce seed coat contamination with viruliferous O.

virulentus resting spores was investigated as a potential source of inoculum. O.

virulentus, LBVaV and MLBVV were all detected by PCR on the lettuce seed coat.

Seeds harvested from lettuce plants that had previously tested positive for LBVaV and

MLBVV were either surfaced sterilised with sodium hypochlorite or trisodium

phosphate, with both, or left unsurfaced sterilised and sown into disinfested potting mix.

None of the experimental plants tested positive to LBVaV or MLBVV by DAS-ELISA

which suggests that either the propagule numbers were too low to cause systemic

infection or the detection method by DAS-ELISA was not sufficiently sensitive as it had

been shown by RT-PCR that all pathogens associated with LBVD could be detected on

lettuce seed coats.

In a study of alternative hosts of LBVaV and MLBVV, two known hosts Sonchus

oleraceous and S. asper as well as three unreported hosts S. hydrophilus, Reichardia

sp. and Actites sp. were used as bait plants grown in infested LBVD soil under

experimental conditions to determine if they were susceptible to both viruses. All

species were found to be susceptible to LBVaV and MLBVV and, additionally, one

Arctotheca calendula plant collected from a commercial lettuce growing field tested

positive for MLBVV. Of the species tested, there was a higher incidence of LBVaV

and/or MLBVV detected in the root tissue of the experimental plants than in the leaf

tissue of the same plants. S. asper was determined as the most susceptible of the species

tested for LBVaV and MLBVV.

viii

Additional knowledge regarding the genetic characteristics of O. virulentus, LBVaV

and MLBVV, as well as more information regarding disease epidemiology such as

sources of inoculum of the organisms associated with LBVD, either by vector-assisted

seed transmission or by alternative hosts possibly acting as disease reservoirs as

determined in this study, is expected to help in establishing more effective methods of

control for the disease as well as enhancing the current Integrated Disease Management

Strategy which has already been established for the disease.

ix

Table of Contents

Abstract ______________________________________________________________ v

Table of Contents ______________________________________________________ ix

Acknowledgements ____________________________________________________xiii

Candidate’s Declaration _______________________________________________ xiv

List of Abbreviations __________________________________________________ xv

Amino Acid Codes ___________________________________________________ xviii

List of Virus Acronyms ________________________________________________ xix

Papers arising from this study ___________________________________________ xx

Oral presentations ____________________________________________________ xx

Poster presentations ___________________________________________________ xxi

Other Publications and Media Interest ____________________________________ xxi

Chapter 1 General Introduction and Literature Review________________________ 1

1.1 General Introduction _______________________________________________ 1

1.2 Lettuce production in Australia _____________________________________ 4

1.3 Lettuce production in Western Australia ______________________________ 7

1.4 Commonly occurring diseases of lettuce in Australia ____________________ 8

1.5 Chytrid and Plasmodiophorid vectors of plant viruses __________________ 11

1.6 Lettuce Big Vein Disease ________________________________________ 12

1.7 Control of LBVD _______________________________________________ 15

1.8 Specific research aims ___________________________________________ 18

1.9 Structure ______________________________________________________ 20

Chapter 2: General Materials and Methods ________________________________ 24

2.1 Viruses and Inoculation __________________________________________ 24

2.2 Nucleic acid extraction __________________________________________ 24

2.2.1 DNA extraction from Olpidium spp. _____________________________ 24

2.2.2 RNA extraction from viral species ______________________________ 25

2.3 Polymerase Chain Reaction (PCR) _________________________________ 25

2.3.1 PCR for Olpidium spp. amplification ____________________________ 25

2.3.2 Reverse Transcription Polymerase Chain Reaction (RT-PCR) for viral

amplification ___________________________________________________ 26

2.4 Primers _______________________________________________________ 27

2.5 Agarose gel electrophoresis _______________________________________ 27

2.6 Purification of PCR product for cloning or direct sequencing ____________ 30

2.7 DNA and RNA quantification _____________________________________ 30

2.8 Cloning_______________________________________________________ 30

2.8.1 Ligation using pGEM®

-T Easy Vector ___________________________ 30

2.8.2 Transformation using E. coli ___________________________________ 31

2.9 Screening for recombinant plasmids ________________________________ 32

x

2.10 Plasmid preparation and analysis __________________________________ 33

2.11 Restriction digest of plasmid _____________________________________ 33

2.12 Sequencing ___________________________________________________ 33

2.13 Virus detection by Double Antibody Sandwich Enzyme Linked Immuno-

Sorbent Assay (DAS-ELISA) _________________________________________ 35

2.13.1 Coating plates ______________________________________________ 36

2.13.2 Sample Preparation _________________________________________ 36

2.13.3 Conjugation _______________________________________________ 37

2.13.4 Substrate __________________________________________________ 37

Chapter 3 - Molecular genetic characterization of Olpidium virulentus isolates

associated with big-vein diseased lettuce plants ______________________________ 39

Abstract __________________________________________________________ 40

Introduction_______________________________________________________ 41

Materials and Methods ______________________________________________ 43

Collection of field samples _________________________________________ 43

DNA extraction, PCR and agarose gel electrophoresis ___________________ 43

Virus RNA extraction and Multiplex RT-PCR __________________________ 44

Cloning and sequencing of PCR amplicons ____________________________ 45

Analysis of Sequence Data _________________________________________ 46

Results___________________________________________________________ 47

PCR DNA extracts from roots ______________________________________ 47

Nucleotide sequence identities ______________________________________ 47

Phylogenetic analysis _____________________________________________ 47

RT-PCR RNA extracts from leaves __________________________________ 48

Discussion ________________________________________________________ 49

Acknowledgements_________________________________________________ 51

Literature cited ____________________________________________________ 52

Chapter 4 Comparison of the coat protein genes of Mirafiori lettuce big-vein virus

isolates from Australia with those of isolates from other continents _____________ 62

Introduction_______________________________________________________ 62

Materials and Methods ______________________________________________ 63

Sequence Properties________________________________________________ 64


Literature cited ____________________________________________________ 67

Chapter 5 - Comparison of the coat protein genes of Lettuce big-vein associated virus

isolates from Australia with those of isolates from other continents _____________ 71

Summary _________________________________________________________ 71


References ________________________________________________________ 79

xi

Chapter 6 – Commercial Lettuce Seedling Nurseries _________________________ 87

6. 1 Introduction ___________________________________________________ 87

6.1.1 Aims _____________________________________________________ 91

6.2 Materials and Methods___________________________________________ 92

6.2.1 Field collection of samples ____________________________________ 92

6.2.2 Collection of soil samples from a commercial seedling nursery _______ 93

6.2.3 Growth of lettuce seedlings in nursery soil samples _________________ 94

6.2.4 Source of seed ______________________________________________ 94

6.2.5 Surface sterilisation of seed ___________________________________ 96

6.2.6 Growing conditions __________________________________________ 97

3.2.7 ELISA and antibodies ________________________________________ 97

6.2.8 RNA extraction _____________________________________________ 98

6.2.9 Reverse transcription (RT) ____________________________________ 98

6.2.10 DNA extraction ____________________________________________ 99

6.2.11 PCR and agarose gel electrophoresis for RNA extracts _____________ 99

6.2.12 PCR and agarose gel electrophoresis for DNA extracts ____________ 100

6.2.13 Controls for DAS-ELISA and PCR ___________________________ 100

6.3 RESULTS ___________________________________________________ 102

6.3.1 Samples collected from commercial lettuce growing fields __________ 102

6.3.2 Samples collected from seedling nurseries and tested by PCR and DAS-

ELISA _______________________________________________________ 104

6.3.3 Surface sterilisation of seed __________________________________ 107

6.4 DISCUSSION ________________________________________________ 108

Chapter 7 Alternative Hosts ____________________________________________ 112

7.2 Materials and Methods__________________________________________ 116

7.2.1 Determining alternative hosts for LBVV and MLBVV _____________ 116

7.2.2 Samples collected from the field _______________________________ 116

7.2.3 Source of seedlings and inoculum for initial experiment ____________ 117

7.2.4 Growing conditions for inoculated seedlings for the initial experiment _ 117

7.2.5 Testing by DAS-ELISA of field collected samples and inoculated seedlings

used in the initial experiment ______________________________________ 118

7.2.6 Source of seed _____________________________________________ 119

7.2.7 Germination of seeds and inoculation of seedlings used to determine

alternative hosts ________________________________________________ 119

7.2.8 Sampling of plant tissue for DAS-ELISA ________________________ 120

7.2.9 RNA extraction of leaf tissue _________________________________ 120

7.2.10 Reverse Transcription Polymerase Chain Reaction (RT-PCR) ______ 120

7.3 Results ______________________________________________________ 122

7.3.1 Results of initial experiments _________________________________ 122

7.3.2 Field samples ______________________________________________ 123

7.3.3 Growth room experiment ____________________________________ 124

7.3.4 Observed virus symptoms in plant leaves ________________________ 127

xii

7.3.5 Confirmation of DAS-ELISA results by RT-PCR __________________ 130

7.4 Discussion ____________________________________________________ 133

Chapter 8 – General Discussion _________________________________________ 138

Appendix 1 – Amount of PCR product or plasmid used in sequencing reactions __ 152

Appendix 2 – The reagents used in each of the different DAS-ELISA solutions ___ 154

Appendix 3 - O. virulentus ITS sequences (5' to 3') _________________________ 155

Appendix 4 - MLBVV CP sequences (5' to 3') ______________________________ 158

Appendix 5 - LBVaV CP sequences (5' to 3') ______________________________ 167

Appendix 6 - Locations where MLBVV isolates were collected________________172

Appendix 7 - Locations where LBVaV isolates were collected_________________173

Appendix 8 - MLBVV amino acid and nucleotide distances__________________174

Appendix 9 - LBVaV amino acid and nucleotide distances___________________175

References_________________________________________________________176

xiii

Acknowledgements

Sincere thanks must go to my supervisors; Prof. Martin Barbetti for initially giving me

the opportunity to undertake this research, Adj. Prof Roger Jones for the many hours

you spent correcting this manuscript and Prof Krishnapillai Sivasithamparam for

keeping me motivated and inspired, especially towards the end.

Thank-you to all the people in the Plant Pathology group I have had the pleasure of

working with, especially Li Hua, Margaret Collins and Harsh Garg. I have truly valued

your friendship and knowledge and your understanding has often been what has helped

me through the many challenging times.

Thank-you to all the people at DAWFA who have helped me during this project; Stuart

Vincent and Eva Gadja for watering my plants, Gail Burchell for your help in editing

my reference lists, Brenda Coutts and Belinda Cox for sharing your knowledge and

providing support and especially Monica Kehoe for your „expert computer technical

knowledge‟ and a friendship which I am grateful.

Also, I would like to thank Steve Wylie and Craig Webster from the SABC for all of

your sequencing advice and help with sequence analysis.

Finally, I would like to thank my parents Ros and Joe Maccarone for keeping me and

my dogs (Zuko and Milly) housed and fed for the past two and a half years. I appreciate

it more than I let on and am forever in your debt. Now I can get a „real‟ job and move

out of home... again.

LDM

xiv

Candidate’s Declaration

The work presented in this thesis is entirely my own, unless specifically acknowledged

otherwise.

Linda Dianne Maccarone

xv

List of Abbreviations

3′ hydroxyl-terminus of DNA molecule

5′ phosphate-terminus of DNA molecule

½ one half

¼ one quarter

⅛ one eighth

°C degrees Celcius

ABS Australian Bureau of Statistics

Amp ampicillin

bp base pairs

BSA Bovine serum albumin

Ca(OCl)2 calcium hypochlorite

CBD Central Business District

CP coat protein

cDNA complimentary deoxyribonucleic acid

CALM Conservation and Land Management

cv. cultivar

DI deionised

DAFWA Department of Agriculture and Food, Western Australia

DAS-ELISA Double antibody sandwich enzyme-linked immunosorbent assay

ddH20 double distilled water

Dn non-silent mutation

DNA deoxyribonucleic acid

Ds silent mutation

EDTA ethylene diamine tetra-acetic acid

EtBr ethidium bromide

g gram

ha hectares

xvi

h hour

ITS Internally transcribed spacer region

kb kilobase

km kilometre

LBVD Lettuce Big-Vein Disease

L litre

LB medium Luria-Bertani medium

MgCl2 magnesium chloride

µg microgram

µL microlitre

µm micrometre

µM micromolar

mg milligram

min minute

mL millilitre

mm millimeter

mM millimolar

M molar

NaAC sodium acetate

nad4 mitochondrial NADH dehydrogenase subunit 4

NaOCl sodium Hypochlorite

ng nanogram

NFT Nutrient Film Technique

PNP para-nitrophenyl phosphate

pers. comm. Personal communication

PBST phosphate buffered saline with tween 20

pmol pico mole

PCR polymerase chain reaction

RT-PCR reverse transcriptase polymerase chain reaction

xvii

RNA ribonucleic acid

rDNA ribosomal deoxyribose nucleic acid

SABC State Agricultural Biotechnology Centre

sec second

SNPs single nucleotide polymorphisms

TBE buffer tris-boric acid-EDTA electrophoresis buffer

Na3PO4 trisodium phosphate

Taq Thermus aquaticus DNA polymerase

t tonnes

U units

UK United Kingdom

USA United States of America

UV ultraviolet

V volts

WA Western Australia

Code for degenerate oligonucleotides

A Adenosine M AC V ACG

C Cytosine R AG H ACT

G Guanine W AT D AGT

I Inosine S CG B CGT

T Thymine Y CT N AGCT

U Uracil K GT

xviii

Amino Acid Codes

Glycine Gly G

Alanine Ala A

Leucine Leu L

Methionine Met M

Phenylalanine Phe F

Tryptophan Trp W

Lysine Lys K

Glutamine Gln Q

Glutamic acid Glu E

Serine Ser S

Proline Pro P

Valine Val V

Isoleucine Ile I

Cysteine Cys C

Tyrosine Tyr Y

Histidine His H

Arginine Arg R

Asparagine Asn N

Aspartic acid Asp D

Threonine Thr T

xix

List of Virus Acronyms

Barley mild mosaic virus BaMMV

Barley yellow mosaic virus BaYMV

Bean yellow mosaic virus BYMV

Citrus psorosis virus CPsV

Camellia yellow mottle virus CYMV

Freesia leaf necrosis virus FLNV

Freesia sneak virus FreSV

Lettuce big-vein associated virus LBVaV

Lettuce mosaic virus LMV

Lettuce necrotic yellows virus LNYV

Mirafiori lettuce big-vein virus MLBVV

Melon necrotic spot virus MNSV

Potato mop-top virus PMTV

Ranunculus white mottle virus RWMV

Sonchus yellow net virus SYNV

Tobacco stunt virus TStV

Tomato spotted wilt virus TSWV

Tomato yellow leaf curl Sardinia virus TYLCSV

Tulip mild mottle mosaic virus TMMMV

Turnip yellow mosaic virus TYMV

xx

Papers arising from this study

Maccarone, L.D., Barbetti, M., Sivasithamparam, K. and Jones, R.A.C. 2010. Molecular

genetic characterisation of Olpidium virulentus isolates associated with big-vein

diseased lettuce plants. Plant Disease 94:563-569.

Maccarone, L.D., Barbetti, M., Sivasithamparam, K. and Jones, R.A.C. 2010.

Comparison of the coat protein genes of Mirafiori lettuce big-vein associated virus

isolates from Australia with those of isolates from other continents. Accepted in

Archives of Virology 7th

June, 2010

Maccarone, L.D., Barbetti, M., Sivasithamparam, K. and Jones, R.A.C. 2010.

Comparison of the coat protein genes of Lettuce big-vein associated virus isolates from

Australia with those of isolates from other continents Archives of Virology DOI

10.1007/s00705-010-0641-0

Oral presentations

School of Plant Biology Rottnest Island Postgraduate Summer School, Western

Australia 2007

Maccarone, L.D., Jones, R.A.C., Barbetti, M. and Sivasithamparam, K. 2007.

Prevention and spread of Lettuce Big-Vein Disease by improved production practices in

nurseries. In University of Western Australia, School of Plant Biology, 2007 Rottnest

Island Postgraduate Summer School Proceedings, page 30

Australasian Plant Pathology Society, Plant Health Research Symposium, South Perth,

Western Australia 2008

Maccarone, L.D., Jones, R.A.C., Sivasithamparam, K., Barbetti, M. 2008. Phylogenetic

analysis of Olpidium virulentus, Lettuce big-vein virus and Mirafiori lettuce big-vein

virus: the disease causing agents of Big-Vein Disease in lettuce in Western Australia

xxi

School of Plant Biology Rottnest Island Postgraduate Summer School, Western

Australia 2009

Maccarone, L.D., Sivasithamparam, K., Barbetti, M. and Jones, R.A.C. 2009

Phylogenetic analysis of Olpidium virulentus, Lettuce big-vein virus and Mirafiori

lettuce big-vein virus isolates from Western Australia

Poster presentations

Joint meeting American Pytopathological Society/Canadian Phytopathological

Society/Mycological Society of America, Quebec City, QC, Canada 2006

Maccarone, L.D., Jones, R.A.C., Latham, L.J., Sivasithamparam, K. and Barbetti, M.J.

2006. The role of nursery practices in the survival and production spread of organisms

associated with Big-Vein Disease in lettuce in Western Australia. Phytopathology 96:

71-72.

Australiasian Plant Virology Workshop, Rottnest Island, Western Australia 2006

Maccarone, L.D., Jones, R.A., Barbetti, M and Sivasithamparam, K., (2006) The role of

nursery practices in the survival and spread of Big-Vein Disease of lettuce in Western

Australia, in 7th Australasian Plant Virology Workshop Program Book, page 66

Other Publications and Media Interest

Newspaper article and front cover by Bart McGann in Countryman Horticulture, January 2007.

Tip of the iceberg – Researcher Linda Maccarone is working to stop the spread of Lettuce Big-

vein Disease, cover

Lettuce under attack – Nurseries focus of disease battle, page 3

University of Western Australia Institute of Agriculture newsletter, Number 6, December, 2008

Plant Health Research Symposium

xxii

http://www.uwa.edu.au/__data/assets/pdf_file/0009/132867/UWA_IOA_newsletter_Dec_08.pd

f

http://www.uwa.edu.au/__data/assets/pdf_file/0009/132867/UWA_IOA_newsletter_Dec_08.pdf

http://www.uwa.edu.au/__data/assets/pdf_file/0009/132867/UWA_IOA_newsletter_Dec_08.pdf

1

Chapter 1 General Introduction and Literature Review

1.1 General Introduction

Lettuce big-vein disease (LBVD) was first reported from California (Jagger and

Chandler 1934). It occurs widely in regions of the world with temperate or

Mediterranean-type climates, and at high altitudes in subtropical regions and is common

in Australia and in Western Australia. LBVD is now known to be associated with a

complex of two viruses, Lettuce big-vein associated virus (LBVaV; genus

Varicosavirus) and Mirafiori lettuce big-vein virus (MLBVV; genus Ophiovirus)

(Roggero et al. 2000) which are vectored by the root-infecting chytrid Olpidium

virulentus. Traditionally, it has been accepted that LBVaV was the virus responsible for

LBVD symptoms however, Lot et al. (2002) and Sasaya et al. (2006) described

MLBVV as being the causal agent of big-vein symptoms of lettuce. Also, until recent

molecular studies of the chytrid vector, it has been thought that the vector for both

LBVaV and MLBVV was O. brassicae when in fact it was determined to be O.

virulentus (Koganezawa et al. 2005; Sasaya and Koganezawa 2006).

Motile zoospores O. virulentus transmit LBVD to the roots of healthy plants and, in the

absence of susceptible hosts, its resting spores retain ability to harbour and transmit

LBVD for decades in infested soil (Campbell 1985; Barr 1988; Lot et al. 2002; Rochon

et al. 2004). Methyl bromide was formerly used widely as a fungicide to control the

Olpidium vector, but has since been banned in some countries including Australia.

2

In Australia, LBVD is a widespread problem in commercial lettuce producing areas. In

south-west Australia, the lettuce production system on the Swan Coastal Plain is

intensive, often uses irrigated land that is contaminated with LBVD and sometimes

involves little rotation with other crops. In Western Australia, LBVD often results in

decreased yields of produce from infected plants in winter growing seasons and this loss

has been shown to be up to 90% of the crop (Latham and Jones 2004; Latham et al.

2004). Symptoms of this disease are the obvious chlorophyll clearing which causes the

„big-vein‟ leaf symptoms from which the disease gets its name, crinkled leaves and a

reduced head size which is often oblong in shape (Fig. 1.1) rather than round in shape as

is seen in healthy lettuce plants.

Fig. 1.1: Lettuce plants grown on a commercial lettuce growing property in Western

Australia showing symptoms of LBVD. The lettuce plant on the left is not showing any

symptoms of LBVD. The plant in the centre has severe symptoms such as leaf crinkling

and which has prevented head formation. The plant on the right shows the „oblong‟

shaped head seen with LBVD.

3

Latham et al. (2004) demonstrated up to 31% incidence of LBVD in lettuce seedlings

collected from a commercial lettuce seedling nursery known to have LBVD. These

seedlings were collected over an 18 month period and tested by DAS-ELISA to

determine LBVaV infection. In the same study, contamination of LBVaV was detected

in „bait‟ plants that were grown in potting mix over variable composting time periods, in

soil that was collected from under nursery benches and also in bark which was collected

from the potting mix supplier‟s site. Given the urban sprawl experienced in the

metropolitan region of Perth, lettuce producers are being forced further from the city

and are cultivating virgin land. Given the persistent nature of O. virulentus resting

spores, it is important that in an integrated disease management strategy for this disease,

that commercial lettuce seedling nurseries produce seedlings that are LBVD-free (Jones,

2004). This could help to reduce the spread of this disease in currently infested areas

and also to new land. A thorough survey of commercial lettuce seedling nurseries,

potting mix and pine bark suppliers in Western Australia would give a greater

understanding in regards to the source of LBVD infection in Western Australia.

The overall aims of this study were:

Determine that O. virulentus is the vector of LBVaV and MLBVV in Western

Australia, not O. brassicae

Isolate O. virulentus, LBVaV and MLBVV from Western Australian lettuce

growing areas and sequence these isolates to determine phylogenetic

relationships between each other and other isolates available on GenBank

Determine the presence of LBVaV and MLBVV in commercial lettuce seedling

nurseries as only LBVaV had been detected previously and investigate other

4

possible sources of infection outside the seedling nursery and commercial

growing environments

Assess known and unknown alien and native hosts for their ability to transmit

LBVD or act as disease reservoirs.

This review presents an overall picture of LBVD, the viruses and the vectors associated

with the disease in the literature. It also covers, in general, various sources of inoculum

of the viruses and the vector to relate them to disease management. A detailed

evaluation of the relevant results from previous studies is presented in the introduction

and discussion sections of relevant chapters of this thesis.

1.2 Lettuce production in Australia

Lettuce is commercially grown in all states and territories within Australia except in the

Australian Capital Territory. In the 2007-08 financial year, a total of 7307ha of land

sown (Table 1.1). Of this total cultivation area, 4870ha were used in the production of

outdoor and undercover-grown iceberg or „head‟ type lettuce and 2437ha were used for

the production of outdoor and under-cover grown looseleaf, butterhead and coloured

fancy lettuce types (Australian Bureau of Statistics (ABS) 2009a). This area over the

same time period, produced a total of 168 707t of lettuce, 128 733t which was „head‟

lettuce and 39 977t which was looseleaf, butterhead and coloured fancy lettuce (Table

1.1). The state of Queensland is Australia‟s major lettuce producer, producing 34.2% of

all lettuce during the 2007-08 financial year (ABS 2009a) (Table 1.1).

During the 2005-06 financial year, the gross value of lettuce production in Australia

was $159m. In the 2006-07 financial year, this figure was raised to $283m but then fell

5

to $168m during the 2007-08 financial year (Table 1.2a). The gross value of lettuce

production is based on the wholesale prices realised in the marketplace whereas the

local value (Table 1.2a) is the value placed on the lettuce crop at the point of production

(at the farm gate) by deducting the marketing costs from the gross value (ABS 2009b).

Of the total lettuce value during the 2007-08 financial year, Queensland, the country‟s

major producer of lettuce was responsible for 39% of the value (Table 1.2b).

6

Table 1.1: The total area of lettuce sown and the total production of lettuce grown in all states and territories in Australia in which lettuce is grown

commercially. The total area sown and total production of the Perth region which is the area surveyed in this study is also included (ABS 2009a).

WA Perth NSW Vic. Qld. SA Tas. NT

Vegetables for human consumption - Lettuce Vegetables for human consumption - Lettuce - outdoor and

undercover - Total area sown (ha) 841.7 339.7 1,020.4 2,846.3 2,072.0 357.2 166.7 2.8

Vegetables for human consumption - Lettuce - outdoor and

undercover - Total production (t) 20,985.7 10,612.3 23,826.9 53,611.8 57,669.5 10,917.6 1,689.5 5.6

Vegetables for human consumption - Lettuce (head) Vegetables for human consumption - Lettuce (head - outdoor and undercover) - Total area (ha)

604.0 203.5 777.3 1,678.9 1,353.3 289.9 166.7 0.0

Vegetables for human consumption - Lettuce (head - outdoor and

undercover) - Total production (t) 17,016.5 7,595.9 17,146.0 39,203.4 44,509.2 9,168.4 1,689.5 0.0

Vegetables for human consumption - Lettuce (head) - outdoor - Area sown (ha)

604.0 203.5 773.5 1,678.9 1,352.8 289.9 166.7 0.0

Vegetables for human consumption - Lettuce (head) - outdoor - Total

production (t) 17,016.5 7,595.9 17,114.1 39,203.4 44,405.2 9,165.6 1,689.5 0.0

Vegetables for human consumption - Lettuce (head) - undercover - Area sown (m2)

0.0 0.0 37,988.4 0.0 4,469.6 183.7 0.0 0.0

Vegetables for human consumption - Lettuce (head) - undercover -

Total production (kg) 0.0 0.0 31,897.0 0.0 104,026.3 2,755.5 0.0 0.0

Vegetables for human consumption - Lettuce (looseleaf,

butterheads, colour fancy)

Vegetables for human consumption - Lettuce (looseleaf, butterheads

and colour fancy - outdoor and undercover) - Total area (ha) 237.7 136.2 243.1 1,167.4 718.7 67.3 0.0 2.8

Vegetables for human consumption - Lettuce (looseleaf, butterheads and colour fancy - outdoor and undercover) - Total production (t)

3,969.2 3,016.4 6,680.9 14,408.4 13,160.3 1,749.2 0.0 5.6


and colour fancy) - outdoor - Area sown (ha) 224.6 123.8 203.9 1,145.1 702.1 37.5 0.0 2.8

Vegetables for human consumption - Lettuce (looseleaf, butterheads and colour fancy) - outdoor - Total production (t)

3,066.9 2,140.0 3,751.9 13,733.7 12,384.0 1,281.1 0.0 5.6


and colour fancy) - undercover - Area sown (m2) 130,849.3 123,849.3 391,958.2 222,442.5 166,779.0 298,472.0 0.0 0.0

Vegetables for human consumption - Lettuce (looseleaf, butterheads and colour fancy) - undercover - Total production (kg)

902,357.5 876,357.5 2,928,984.6 674,618.5 776,266.6 468,088.2 0.0 0.0

7

Table 1.2a: The total value of lettuce grown in Australia during the financial years

2005-06, 2006-07 and 2007-08. Both gross values and the value of the produce at the

farm gate (local value) are shown (ABS, 2009b).

Year Gross value ($m) Local value ($m)

2006 159.1 123.7

2007 282.9 225.1

2008 168 128.8

Table 1.2b: The total value of lettuce grown in all states and territories within Australia

where lettuce is grown commercially for the financial year 2007-08. Both gross values

and the value of the produce at the farm gate (local value) are shown (ABS, 2009b).

State Gross value ($m) Local value ($m)

NSW 22.9 15.6

Vic. 49.2 41.0

Qld. 65.6 48.1

SA 13.4 11.6

WA 14.5 10.5

Tas. 2.3 2

NT 0 0

1.3 Lettuce production in Western Australia

In Western Australia, a total of 842ha was sown for both outdoor and undercover lettuce

production in the 2007-08 financial year which was 11.5% of the total area under lettuce

production in Australia (Table 1.1). During 2007-08, Western Australia produced 20

986t (12.4%) of the total lettuce produced in Australia. In this same time period, the

gross value of lettuce production in Western Australia was $14.5m which was 8.6% of

the National total (ABS 2009) (Table 1.2b).

8

ABS recognises Statistical Divisions for the purpose of generating data. All of the

properties surveyed in this study except for the one property surveyed in Manjimup

approximately 300km south of Perth (which is the South West Statistical Division) are

found in the Statistical Division of Perth (ABS 2009a). During the 2007-08 financial

year, the area of lettuce production in the Perth region was 40.4% of the total area under

lettuce production in the state (Table 1.1). This area was responsible for 50.6% of the

total lettuce production for Western Australia. This study surveyed commercial lettuce

growing properties that grew their crops outdoors and produced „head‟ type lettuce as

well as looseleaf, butterhead and coloured fancy lettuce. The Perth region produced

9736t of outdoor-grown lettuce which was 48% of Western Australia‟s total outdoor-

grown lettuce production (ABS 2009a) (Table 1.1).

1.4 Commonly occurring diseases of lettuce in Australia

Other than LBVD, there are many other common virus, fungus and bacterial diseases

which affect lettuce production in Australia. These diseases cause significant loss to the

quality of the lettuce often resulting in a crop which cannot be harvested or a crop with

reduced yield. Of the bacterial diseases that affect lettuce, Dry Leaf Spot, which is

caused by Xanthomonas campestris pv vitians, is a common lettuce disease in Western

Australia and causes pale brown watermarked areas on the infected lettuce leaf. In

Western Australia, one of the most common sources of disease comes from two

Sclerotinia spp., S. minor which causes Lettuce Drop and S. sclerotiorum which causes

Head Rot. Both S. minor and S. sclerotiorum ensure the lettuce plants are un-

harvestable. Downy Mildew is also a common disease of lettuce in Western Australia

and is caused by the oomycete pathogen Bremia lactucae and causes brown patches on

9

the upper leaf surface and white hyphae on the under-side of the leaf. Crown Rot which

is also known as Grey Mould is caused by the fungus Botrytis cinerea and Bottom Rot

which is caused by the fungus Rhizoctonia solani are also present in Western Australia

and cause similar symptoms of brown rot at ground level often at the time of harvest.

Septoria Leaf Spot is another fungal disease of lettuce in Western Australia which is

caused by the fungus Septoria lactucae and causes symptoms such as angular pale

brown lesions which as they mature, develop pin-head black spots (Floyd 2000; Napier

2004).

Of the commonly occurring virus diseases of lettuce in Western Australia, Lettuce

necrotic yellows virus (LNYV) is a member of the genus Cytorhabdovirus and was first

described in Australia in 1954 by Stubbs and Grogan (1963). LNYV is transmitted by

the aphid vector Hyperomyzus lactucae and causes symptoms in lettuce such as vein

yellowing which is usually followed by chlorosis and leaf curling (Stubbs and Grogan

1963; Francki and Randles, 1970). LNYV is widespread throughout Australia and has

also been reported in New Zealand (Fry et al. 1973).

Weed species such as S. oleraceous, Reichardia picroides and R. tingitana and

Australian endemic species such as S. hydrophilus and Embergeria megalocarpa have

been demonstrated to be infected with this virus and it has been suggested that the

ability of such species to support colonies of the vector H. lactucae provide a possible

inoculum source of LNYV (Randles and Carver 1971). Given the ability to infect

endemic plants and the limited distribution of LNYV, Randles and Carver (1971)

suggested that LNYV may have originated from plant species endemic to Australia

and/or New Zealand.

10

Tomato spotted wilt virus (TSWV) is another commonly occurring virus among lettuce

crops and is a member of the genus Tospovirus and is vectored by many thrip species

although most efficiently by the Western Flower Thrip Frankliniella occidentalis (Zitter

and Daughtrey 1989). Like LNYV, TSWV was also first described in Australia,

although earlier, in 1915 (Brittlebank 1919). TWSV is now common in temperate,

subtropical and tropical regions around the world however, a lettuce strain of the virus

is usually found in vegetables whereas an impatiens strain is usually found in

ornamentals (Zitter and Daughtrey 1989). TSWV causes severe symptoms in lettuce

which often result in plant death. Initial infection symptoms are necrotic spotting which

may be followed by wilting, yellowing and necrotic spotting (Cho et al. 1989). TSWV

has more than 900 known host species which belong to families Solanaceae, Asteraceae

and Legumaceae. S. oleraceous and Arctotheca calendula, common weed species found

amongst lettuce growing fields are known to be hosts of TSWV (Peters 1998) and act as

inoculum sources for the virus (Wilson 1998).

Lettuce mosaic virus (LMV) is a member of the genus Potyvirus and is a common

pathogen of lettuce in Western Australia which causes restricted growth and therefore

reduced yield (Napier 2004). LMV is commonly transmitted by the Green Peach aphid

Myzus persicae however a small percentage of the virus is known to be seed-borne

(Ryder 1973). Symptoms associated with LMV infection in lettuce are necrotic or

chlorotic local lesions and streaking, mosaic, leaf yellowing and leaf malformation. As

well as being a host for other plant viruses that infect lettuce (Peters 1998; Randles and

Carver 1971; Coutts et al. 2004, Chapter 7), S. oleraceous is also a host of LMV and is

known to act as a reservoir and inoculum source (Tomlinson 1970). Moreno et al.

11

(2007) in a laboratory environment demonstrated 37.5% infection of LMV vectored by

M. persicae from Sonchus to lettuce.

1.5 Chytrid and Plasmodiophorid vectors of plant viruses

Uniflagellate chytrids (class Chytirdiomycetes), O. brassicae and O. bornovanus and

biflagellate plasmodiophorids (class Plasmodiophoromycetes), Polymyxa graminis, P.

betae and Spongospora subterranea are known to transmit viruses in the soil to plant

roots (Matthews 1981; Bos 1999). O. bornovanus is known to vector six different virus

species, O. brassicae 10, P. graminis 15, P. betae four and S. subterranea two and each

vector species is able to transmit viruses from a range of different genera (Rochon et al.

2004). However, Sasaya and Koganezawa (2006) determined that O. virulentus was

also chytrid vector responsible for transmitting TStV and MLBVV. This study (Chapter

6) has also demonstrated that LBVaV, although once thought to be vectored by O.

brassicae (Campbell and Grogan 1962) is associated with O. virulentus but not with O.

brassicae.

Soil and vector-borne viruses can be transmitted by chytrid or plasmodiophorid vectors

either externally (in vitro) on the zoospore or resting spore or internally (in vivo) within

the zoospore or resting spore (Matthews 1981; Bos 1999). In the event of in vitro virus

transmission, the virus particles are most likely carried on the zoospore flagellum and

when the zoospore attaches to the host root, the flagellum is withdrawn into the

zoospore prior to release of the cytoplasmic contents into the host epidermal cells and it

is likely that this is when the virus is able to enter the host root (Bos 1999).

12

In the case of in vivo virus acquisition by the vector, the virus enters the thallus and

remains in the zoospore or the resting spore where it does not multiply until it is

released into the host root cells (Bos 1999). For the virus, this is an effective means of

transmission as viruliferous resting spores from dry crop debris, for example, can lay

dormant in the soil until environmental conditions are favourable for zoospore

germination (Bos 1999). In this case crop infestation is usually observed after periods of

rain or irrigation (Bos 1999).

1.6 Lettuce Big Vein Disease

To elaborate on what has already been discussed in relation to LBVD previously in this

chapter, one of the most highly contested aspects of this disease has been determining

which species of Olpidium is the vector for both LBVaV and MLBVV. O. brassicae

was first described in 1939 (Sampson 1939) and then first associated with big-vein

disease of lettuce by Fry (1958). It was in 1961 that graft transmission of big-vein

disease in lettuce was first reported and it was suggested that the disease was caused by

a virus (Campbell et al. 1961). However, in 1962, it was suggested by Campbell and

Grogan, (1962) that O. brassicae was the vector of a virus that caused big-vein disease

in lettuce (Table 1.3).

In that same year, Sahtiyanci (1962) proposed that based on differing hosts ranges that

there were infact two separate species of Olpidium, a crucifer infecting strain, O.

brassicae and a non-crucifer infecting strain, O. virulentus. Sahtiyanci (1962) also

found that O. brassicae was heterothallic whereas O. virulentus was homothallic.

Sahtiyanci (1962) also proposed that due to O. brassicae, O. virulentus and O.

13

bornovanus sporangia having more than one exit tube, they should be reassigned to the

genus Pleotrachelus. Campbell and Lin (1976) disputed this work on the basis that they

found O. brassicae sporangia to have single exit tubes and hence should remain in the

genus Olpidium and Campbell and Lin (1976) also disputed the separation of two

strains of O. brassicae, because even though they determined different host ranges, they

were unable to infect plants with single-sporangial isolates of each strain. Campbell and

Lin (1976) did however also find O. virulentus to be homothallic but could not

determine the nature of O. brassicae in this regard and concluded that there was not

enough specialisation to separate O. virulentus from O. brassicae. As a consequence, O.

brassicae has continued to be traditionally regarded as the vector of LBVaV and

MLBVV. However, in 2006, Sasaya and Koganezawa (2006) using molecular analysis

techniques determined that O. brassicae and O. virulentus are in fact different species

and not strains of the same taxon. They also determined that O. virulentus, not O.

brassicae is the vector of MLBVV and that both Olpidium spp. have different host

ranges, with O. brassicae commonly infecting crucifers (cabbage and mustard) while O.

virulentus commonly infects noncrucifers (lettuce and tomato).

14

Table 1.3: Timeline of events associated with LBVD, from the first initial description

of the disease in 1934 to molecular diagnostic techniques in 2006 that relate to the

research objectives discussed in this thesis.

Year Discovery Reference

1934 First description of big-vein of lettuce Jagger and

Chandler (1934)

1939 First description of O. brassicae Sampson (1939)

1958 First reports of the relationship of O. brassicae to the big-

vein disease of lettuce

Fry (1958) and

Grogan et al.

(1958)

1961 Graft transmission of big-vein suggests it is caused by a virus Campbell et al.

(1961)

1962 Big-Vein Virus is transmitted to lettuce by Olpidium Campbell and

Grogan (1962)

1962 Big-Vein Virus survives in the resting sporangia of Olpidium

however, does not multiply within the vector

Campbell (1962)

1962 Suggestion that O. brassicae and O. virulentus are different

species based on host range (O. brassicae infests crucifers

whilst O. virulentus infests noncrucifers) and that both

should be moved to genus Pleotrachelus based on

morphological characteristics.

Sahtiyanci

(1962)

1970 Different isolates of O. brassicae have different host ranges

and also differ in their ability to transmit Tobacco necrosis

virus (TNV).

Temmink et al.

(1970)

1976 The designation made by Sahtiyanci (1962) is challenged

and it is determined that Olpidium sp. not be reassigned to

Pleotrachelus and that there is not enough specialisation to

separate O. brassicae and O. virulentus into separate species

Campbell and

Lin (1976)

1985 Longevity of viruliferous O. brassicae resting spores in air-

dried soil was determined to be between 20.8 and 22.5 years

and the persistence of the big-vein agent within these spores

was determined to be between 18.7 and 20.8 years

Campbell (1985)

2000 An Ophiovirus is isolated from lettuce plants infected with

LBVD and named Mirafiori lettuce virus (MiLV). Some

plants infected with this virus showed big-vein symptoms

Roggero et al.

(2000)

15

2002 O. brassicae is determined as the vector of both viruses

associated with LBVD and MLBVV is determined as the

virus which causes big-vein symptoms.

Lot et al. (2002)

2004 Zoospores of O. brassicae and O. virulentus are determined

to differ morphologically and with host range. O. virulentus

transmits Tobacco necrosis virus (TNV) whilst O. brassicae

did not.

Koganezawa et

al. (2004)

2004 Commercial seedling nurseries in Western Australia are

determined as sources of LBVD inoculum

Latham et al.

(2004)

2006 Molecular analysis places O. brassicae and O. virulentus as

distinct species. O. virulentus is determined as the vector of

MLBVV and TStV

Sasaya and

Koganezawa

(2006)

1.7 Control of LBVD

Previous work carried out on the control of LBVD has been concerned with controlling

O. brassicae. As it is now accepted that O. virulentus is the chytrid vector of LBVaV

and MLBVV, it is reasonable to assume that O. virulentus and O. brassicae have similar

lifecycles and that all work done on previous control methods assuming the vector to be

O. brassicae can be directly related to O. virulentus. All references in this chapter made

to reports prior to Sasaya and Koganezawa (2006), although they mention O. brassicae,

are likely, in fact, to be dealing with O. virulentus.

Methods of control of LBVD concern both the resting spore stage of the vector and the

zoospore stage. Westerlund et al. (1978) demonstrated the importance of the soil-water

relationship required for O. brassicae germination. It was shown that zoospores were

released from sporangia when the soil was saturated and that a high level of moisture in

16

the soil also facilitated zoospore movement. This is an important consideration relating

the spread of LBVD in Western Australia as irrigation is common, often leaving the soil

saturated for a period. Westerlund et al. (1978) also made comparisons between O.

brassicae and Phytophthora in relation to zoospore movement in the soil and the water

requirements for zoospore production. This is an important comparison as similar

comparisons are suggested in the general discussion of this thesis. Jones (2004)

suggested that to reduce the spread of LBVD in the field, lettuce should be planted on

well drained soil and in areas where overhead irrigation is applied, soil should be

covered with black plastic mulch or lettuce plants grown on raised beds to reduce

excessive moisture levels in the soil and therefore reduce zoospore activity.

Given the thick cell-walled nature of O. brassicae resting spores and their persistence in

the soil for greater than 20 years, their control is most challenging. Previously, the use

of the volatile chemical methyl bromide has been used to control O. brassicae resting

spores. However, after initial control using up to two times the normal dose used on a

field, big-vein symptoms appeared in plants after the third year (Campbell et al. 1980;

White 1980). It also took three years from the first application of methyl bromide for

bromide levels in lettuce leaf tissue to be low enough to be suitable for human

consumption (White 1983). However, methyl bromide was recognised as an ozone

depleting substance and has been banned in Australia and in 159 other countries

worldwide who signed “The Montreal Protocol on Substances that Deplete the Ozone

Layer” in 1997 for a complete phase out of methyl bromide for non-quarantine purposes

by 2005.

17

Other forms of chemical control which are aimed at controlling O. brassicae zoospores

have been more effective. For example, Tomlinson (1988), found that growing a lettuce

crop using the recirculated Nutrient Film Technique (NFT) showed up to 100%

infection as conditions were ideal for zoospore movement. NFT however, provides an

ideal and effective way of delivering surfactant to the crop. It was demonstrated that a

20µL/mg concentration of Agral delivered through NFT suppressed viruliferous

zoospores for the life of the crop (Tomlinson 1988).

The use of resistant lettuce cultivars is also a means of controlling LBVD. In Western

Australia, different cultivars are grown at different times of the year and these seem to

have an effect on the incidence of LBVD. For example, in summer crisphead lettuce cv.

Raider and Aztec Sun are commonly grown; in spring and autumn cv. Jefferson,

Silverado and Marksman are grown whereas, in winter, cv. Titanic and Patagonia are

grown. (Funnekotter, pers. comm. 2006). Latham and Jones (2004) determined that by

placing black plastic mulch (to decrease soil moisture and increase temperature,

conditions that are not conducive to the multiplication and spread of LBVD) on the soil

of lettuce crops and by growing the partially resistant breeding line LE169, the

incidence of LBVD was reduced. When the susceptible cv. Oxley was compared to

LE169 in the same study, LE169 had an increased head weight of 17-48%. Complete

resistance to LBVD has only been reported in wild lettuce, L. virosa. However, the

mechanism of resistance to LBVD in lettuce is not known (Bos and Huijberts 1990;

Hayes et al. 2004) so more genetic information regarding O. virulentus, LBVaV and

MLBVV is needed in order to evaluate such mechanisms.

18

Based on previous work described here regarding the control of LBVD, and previous

integrated control methods suggested by Campbell et al. (1980), Jones (2004)

developed an Integrated Disease Management Strategy for control of LBVD in both the

seedling nursery environment and in commercial lettuce production areas. Several

methods of control were suggested in four different categories: Firstly, phytosanitary

cultural control methods such as ensuring seedling nurseries provide disease-free

seedlings to growers and avoid LBVD introductions via machinery and/or contaminated

water sources. Secondly, agronomic cultural control such as avoiding poorly drained

soil and manipulating the planting date. Thirdly, host resistance by deploying partially

resistant genotypes and finally, chemical control such as treating seedling nursery

potting mix and farming land with fungicides. Whilst this IDM strategy is

comprehensive, more information is needed with regards inoculum sources both in

commercial seedling nurseries and lettuce farms in order to better structure an IDM

strategy and make it region-specific. Also, Jones (2004) suggests that there might be

some vector-assisted seed transmission of the disease, so determining if this could

provide another source of inoculum is important for both lettuce seed producers and

commercial lettuce growers.

1.8 Specific research aims

To build on the overall aims of this study which were to determine O. virulentus as the

vector of LBVaV and MLBVV in Western Australia, determine the phylogenetic

relationships of O. virulentus, LBVaV and MLBVV isolates in Western Australia both

between each other and between other isolates of the same species found on GenBank

and to investigate possible sources of LBVD inoculum both in lettuce seedling nurseries

19

and in commercial lettuce growing fields, the specific aims relating to this study are as

follows:

Develop molecular techniques to detect both O. brassicae and O. virulentus

from lettuce tissue infected with LBVD

Determine if in Western Australia, the vector of LBVaV and MLBVV which

causes LBVD is O. brassicae or O. virulentus

Determine the phylogenetic relationship of the rDNA ITS region of Western

Australian Olpidium isolated from the roots of lettuce plants infected with

LBVD and compare them to each other and also to other Olpidium sequences

from Europe and Japan which are available on GenBank.

Develop molecular techniques to detect MLBVV from lettuce tissue infected

with LBVD

Determine the phylogenetic relationship of Western Australian isolates of the

CP gene of MLBVV and compare them to each other and also the same gene

sequence available on GenBank from five different continents

Develop molecular techniques to detect LBVaV from lettuce tissue infected with

LBVD

Determine the phylogenetic relationship of Western Australian isolates of the

CP gene of LBVaV and compare them to each other and also the same gene

sequence available on GenBank from five different continents

Determine the presence of LBVaV and MLBVV on commercial lettuce growing

farms in the Swan Coastal Plain of south-west Australia by testing samples by

DAS-ELISA.

20

Determine the presence of LBVaV and MLBVV in a commercial seedling

nursery in the Perth metropolitan region by testing samples by DAS-ELISA and

PCR.

Determine whether transmission of LBVD occurs through lettuce seed coat

contamination by resting spores of viruliferous O. virulentus by: a) detecting the

presence of LBVaV and/or MLBVV on the surface of lettuce seeds b)

determining whether sowing infected seed can result in infection with LBVaV

and/or MLBVV in lettuce plants grown from seeds harvested from LBVD-

infected plants.

to identify alternative weed hosts for LBVaV and MLBVV growing on the

Swan Coastal Plain of south-west Australia

to establish whether two native species of Asteraceae are hosts of to LBVaV and

MLBVV

to determine whether natural weed species collected in LBVD-affected lettuce

fields in Western Australia were infected with LBVaV and/or MLBVV

1.9 Structure

This thesis is in accordance with the Graduate Research School of the University of

Western Australia styles and format regulations, and is presented as one chapter of

general materials and methods used in this study, a series of three research papers and

two chapters that resulted from this study. Each of the three research papers can be read

as a separate entity or part of this thesis as a whole. Chapter 3 and Chapter 4 were

prepared for submission to Plant Disease and are presented in the format required for

21

that journal. Chapter 3 was accepted for publication on 19th

November, 2009 whilst

Chapter 4 was submitted on 18th

November, 2009. Chapter 5 was prepared and has been

submitted short communication to Archives of Virology on 30th

November, 2009 and is

presented in the format required for that journal. Each of these three chapters has a

separate abstract, introduction, materials and methods, results, discussion and reference

sections. There is some repetition especially in the introduction and discussion and

referencing sections however this is unavoidable given the related nature of each

chapter. Chapters 6 and 7 represent work which is yet to be transformed into a

publication format other than the requirements of this thesis. Chapter 8 includes a

general discussion and conclusions linking all of the chapters together as one coherent

body of research. A complete reference list which encompasses contributions of

previous work reported in all eight chapters closes this thesis. Relevant appendices are

also included.

In the current chapter, the aims, background and purpose of this research are presented.

The purpose of this research and research questions which were addressed in this study

are also presented.

In the second chapter (Chapter 2: General Materials and Methods) a general description

of all of the different protocols used within this study is provided. It includes growing

conditions of plants as well and molecular techniques that were used.

In the third chapter (Chapter 3: Molecular genetic characterization of Olpidium

virulentus isolates associated with big-vein diseased lettuce plants), five complete and

two partial rDNA ITS region sequences of O. virulentus were sequenced and compared

22

to sequences of other O. virulentus and O. brassicae sequences for the same region

were compared and this chapter presents the phylogenetic relationship amongst isolates

of O. brassicae, O. bornovanus and O. virulentus from Europe, Japan and Australia.

This chapter presents the first recorded rDNA ITS sequences of O. virulentus isolates

from Australia. The nucleotide sequences for these Western Australian isolates are

presented in the appendix.

A phylogenetic analysis of MLBVV is presented next (Chapter 4: Molecular genetic

characterization of Mirafiori lettuce big-vein virus isolates from five continents). This

chapter presents the phylogenetic relationships of the CP gene of MLBVV using

isolates from five continents, 13 of which were complete CP genes isolated in this

study. The complete nucleotide and amino acid sequences for the Western Australian

isolates are presented in the appendix.

The final research paper presented in this thesis presents the phylogenetic relationships

of the CP gene of LBVaV using isolates from five continents, seven of which were

isolated in this study (Chapter 5: Molecular genetic characterization of Lettuce big-vein

associated virus isolates from five continents). The complete nucleotide and amino acid

sequences of these isolates are included in the appendix.

The role of commercial seedling nurseries in the spread of LBVD is discussed in

Chapter 6. Chapter 6 (Nursery), for the first time reports the externally seed-borne

nature of viruliferous O. virulentus resting spores and highlights the importance of

disease-free seed in any integrated disease management strategy that would be

suggested for control of this disease. This chapter also demonstrates the presence of

23

MLBVV in commercial seedling nurseries for the first time in Western Australia as

previous studies did not include MLBVV as it had not yet been discovered as the causal

agent of LBVD.

In Chapter 7 (Alternative hosts for LBVaV and MLBVV), known and unknown hosts

were assessed both in the field and under experimental conditions for the presence of

LBVaV and MLBVV. Native Asteraceae, S. hydrophilus and Actites sp. were

determined as new hosts for LBVaV and MLBVV. Alien species Reichardia sp. and A.

calendula were determined as new hosts of MLBVV whilst Reichardia sp. was also

determined as a host of LBVaV.

The final chapter presents a detailed discussion and conclusion linking the findings of

each separate research paper and chapter reported in this thesis to the overall aims of

this study.

24

Chapter 2: General Materials and Methods

2.1 Viruses and Inoculation

Seeds used in this study were grown in seedling trays in potting mix in an insect proof,

controlled environment room at the Department of Agriculture and Food, South Perth,

Western Australia or in a similar growth room at the University of Western Australia

which was kept at a constant temperature of 18°C with a 12h photoperiod.

Approximately 4 weeks after germination, experimental seedlings were transplanted

into 140mm pots and inoculated with a 1:1 mixture of potting mix and soil infected with

LBVD. Plants were grown the same conditions as for germinating seeds and were

watered daily. Further materials and methods regarding growing conditions and soil

inoculum are given in Chapters 6 and 7.

2.2 Nucleic acid extraction

2.2.1 DNA extraction from Olpidium spp.

The Qiagen DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA ) was used on plant root

tissue according to the protocol supplied. This method gave consistently high yields of

DNA which could be used for amplification.

25

2.2.2 RNA extraction from viral species

Two different methods of RNA extraction were used which gave consistently high

yields of RNA which could be used for amplification. The Qiagen RNeasy Plant Mini

Kit (Qiagen Inc., Valencia, CA ) and the UltraClean™ Plant RNA Isolation Kit (MoBio

Laboratories, Inc. ) were used on plant root and leaf tissue as per the manufacturer‟s

protocol for each kit.

2.3 Polymerase Chain Reaction (PCR)

2.3.1 PCR for Olpidium spp. amplification

The 5 × polymerisation buffer used for this PCR mixture was purchased from Fisher

Biotec, Perth. The reagents used for a standard reaction were as follows:

Reagent Volume (µL)

5 × polymerisation buffer 20

50mM MgCl2 5 (2.5mM)

Taq polymerase (5.5 U/µL) 0.5

Primers (10pmol/µL) 0.5 each

cDNA template 2/reaction

Water To 100µL

The PCR reactions were then placed in the thermocycler under the following

temperature conditions:

94ºC for 1min

Then 35 cycles of:

26

94ºC for 30sec (denaturation)

60ºC for 30sec (annealing)

72ºC for 1min (extension)

Then a final extension at 72ºC before being held at 14ºC

2.3.2 Reverse Transcription Polymerase Chain Reaction (RT-PCR) for viral

amplification

OneStep RT-PCR kit was purchased from Qiagen, Australia. The following reagents

were used for each single reaction:

Reagent Volume

(µL)

5 × Polymerisation

buffer

2

10mM dNTPs 0.4

Primers (10pmol/µL) 0.2

Enzyme (5U/µL) 0.4

Rnasin 0.05

RNA template 0.5/tube

Water To 10µL

The PCR reactions were then placed in the thermocycler under the following

temperature conditions:

50°C for 30min

95°C for 15min

Then 30 cycles of:

94°C for 1min (denaturation)

50-57°C for 1min (annealing)

27

72°C for 1min (extension)

Then a final extension at 72°C for 10min before being held at 14°C

2.4 Primers

Primers used for amplification were either designed specifically by aligning known

sequences on Genbank or chosen from already known primer sequences (Table 2.1). All

primers were purchased from GeneWorks Pty Ltd, South Australia.

2.5 Agarose gel electrophoresis

PCR amplicons were visualised on 1% agarose gels by electrophoresis. Tris-boric acid-

EDTA (TBE) electrophoresis buffer was used (Sambrook and Russell, 2001). The gels

were run with 8µL of PCR product and 1µL of sucrose-based loading buffer (Sambrook

and Russell, 2001) and 6µL of 100bp ladder molecular weight marker (Axygen Corp.)

was used as a size standard. The gels were run on either Bio-Rad Mini-Sub Cells™ or

Bio-Rad Wide Mini-Sub Cells™ at 80V until the products were separated. The gels

were then stained in a 1µg/mL Ethidium Bromide (EtBr) solution for 15–20min and

then visualised on a transilluminator.

28

Table 2.1: Sequences of primers used for amplification

Primer name Target Species Primer sequence 5' to

3'

Gene of

Origin

Reference

ITS1 O. brassicae

O. virulentus

TCC GTA GGT GAA

CCT GCG G

ITS White et

al. (1990)

ITS4 O. brassicae

O. virulentus

TCC TCC GCT TAT

TGA TAT GC

ITS White et

al. (1990)

Ov1 O. virulentus CAA GAC CTG CCC

CCA AAA GGG

ITS This study

Ov2 O. virulentus CCA AGT TCG CAA

ACG TGG CG

ITS This study

Ob1 O. brassicae TCA TTA ATA AAT

GCT TCA TTG CAT

ITS This study

Ob2 O. brassicae TCC AGC AAC AAG

TCT TCC CAA

ITS This study

VP248 LBVaV CGC CAG GAT CTT

TGA TCC ATC TG

Coat protein Navarro et

al. (2004)

CP42F LBVaV CGT CGT GGA AAT

CAC AGG TAA GAC

Coat protein Hayes et

al. (2006)

CP426R LBVaV CGT AGA GAC AGC

GAT GAA TGC


al. (2006)

CP647F LBVaV CAA GGC AAG CTG

AGA TGT TGT TCG


al. (2006)

CP907R LBVaV GAA GGG TTT GAA

AGA CRG ATG G


al. (2006)

VP249 LBVaV TTG CGA CAT GTT

CCT CCT CAT CG


al. (2004)

VP317 LBVaV ACA TAT GAT AGT

AGG ATC C


al. (2004)

VP318 LBVaV GGA TTC CAT CAC

CCT ATA AA


al. (2004)

29

LBVV 1-21 LBVaV ATG GCA CCC CAA

ATT GAA G

Coat protein This study

LBVV 700-679 LBVaV GTG CAT GCC AGT

GCT GGC AAG


LBVV 511-531 LBVaV AGA CCG AGT ATC

CAT TCA AG


LBVV 1210-

1185

LBVaV TCA CTC CTT CAC

TGG TGT CTC TCC

C


VP286 MLBVV TAT CAG CTC ACA

TAC TCC CTA TCG


al. (2004)

VP287 MLBVV CAA CTA GCT CAG

AAT ACA TGC AG


al. (2004)

VP289 MLBVV ACA AAG TCA AAT

GTC AGG AG


al. (2004)

MLBVV 2-21 MLBVV CAA AGT CAC AAT

GTC AGG AG


MLBVV 899-

880

MLBVV AAA AGT GCA TAC

CTC ATT GC


1100F MLBVV TGG GAC TCC AGT

GGT CTT GTA TCC

RNA 2 Hayes et

al. 2006

1407R MLBVV CGA AGG TAG AAA

TAG GAA CGA TGG

RNA2 Hayes et

al. 2006

M13F E. coli CGT CAG GCT TTT

CCC AGT CAC GAC

M13R E. coli TCA CAC AGG AAA

CAG CTA TGA C

30

2.6 Purification of PCR product for cloning or direct sequencing

PCR product was purified by ethanol precipitation as follows:

The following was added to each reaction:

10% vol of 3M NaAC, pH5.2

2.5 volumes of cold 100% ethanol

Then incubated at -20ºC for 15min to precipitate DNA

Precipitated DNA was recovered by centrifugation at 4ºC at 20,000 × g for 10min

Supernatant was discarded before the pellet was washed with 300µL 70% ethanol

Centrifugation again at 4ºC at 20,000 × g for 2min

Supernatant was discarded and the DNA pellet was dried on a 37°C heat block

DNA pellet was resuspended in 10µL ddH20

2.7 DNA and RNA quantification

Samples of DNA and RNA were quantified using a Nanodrop UV-Vis

spectrophotometer (Nanodrop Technologies) following manufacturer‟s protocol.

2.8 Cloning

2.8.1 Ligation using pGEM®

-T Easy Vector

Standard ligation reactions were set up using pGEM®

-T Easy Vector (Promega Corp,

Madison Wisconsin) as recommended in the vector protocol. This was carried out as

follows:

31

5µL of 2 × rapid ligation buffer, 1µL of pGEM®

-T Easy Vector, 3µL of purified

PCR product and 1µL T4 DNA ligase were added and incubated in a 14ºC water

bath overnight.

A negative control was set up using a vector that did not contain an insert.

2.8.2 Transformation using E. coli

After the ligation reaction, the transformation into JM109 competent E. coli cells was

completed as follows:

5µL of the ligation was added to 40µL of JM109 competent cells and incubate

on ice for 30min

Cells were heat shocked in a water bath at exactly 42°C for 45sec

Cells were transferred immediately to ice for 2min before adding 900µL of LB

broth to each tube

Tubes were placed on a shaker at 37°C for 1.5h

After incubation, the cultures were centrifuged @ 20 000 × g for 1min to pellet

the cells

Most of the supernatant was discarded leaving approximately 150µL in the tube. The

pellet was then resuspended before the entire volume of culture was spread on LB plates

containing 100mg/mL ampicillin. The plates were then wrapped in Parafilm and stored

upside-down at 37°C for 12-16h.

32

2.9 Screening for recombinant plasmids

After incubation, the colonies on the plates were screened for recombinant plasmids by

PCR. Ten colonies on each plate were chosen at random and suspended in 50µL of

water. PCR were set up as described in 2.3.1 above and 1µL of cell suspension was

added directly to the reaction mix along with M13 forward and reverse primers (Table

2.1) to amplify the cloned fragments.

The cycling conditions were as follows:

94°C for 3min

Then 25 cycles of:

94°C for 10sec (denaturation)

55°C for 30sec (annealing)


Then held at 14°C

The resulting PCR products were separated on a 1% DNA grade agarose (Fisher

Biotech) gel with TBE electrophoresis buffer and visualised on a transilluminator.

Colonies that contained an insert of the expected size were selected for plasmid

extraction.

33

2.10 Plasmid preparation and analysis

Recombinant plasmids were inoculated into 5mL of LB broth with ampicillin (100

mg/L) and incubated on a shaker at 37ºC overnight. The plasmid was then purified from

the culture using an Aurum™ Bio-Rad Plasmid Extraction Kit following the

manufacturer‟s protocol.

2.11 Restriction digest of plasmid

The presence and size of inserts was confirmed with a restriction digest of the purified

plasmid DNA by EcoR1 as follows:

10µL of purified plasmid DNA was added to 2µL of 10 × EcoR1 buffer, 1µL of

EcoR1 and 7µL of water

Tubes were then incubated on a 37°C heat block for 1h

DNA fragments were separated on a 1% agarose gel beside a 100bp molecular

weight marker

Gel was stained with EtBr and visualised on a transilluminator

2.12 Sequencing

Sequencing was done either directly from PCR product or from plasmids containing an

insert of target DNA. Dideoxy-termination sequencing was performed using the

sequencing facilities at the SABC and Royal Perth Hospital. Applied Biosystems

34

Industries (ABI) Big Dye Version 3.1 chemistry was used using ½, ¼ and ⅛ sequencing

reactions. When a plasmid containing an insert was sequenced, M13F and M13R

primers were used and when sequencing was done directly from a PCR product, the

primers used to amplify the product were used. The ½, ¼ and ⅛ reactions were made in

200µL PCR tubes as follows:

Reagent ½ reaction ¼ reaction ⅛ reaction

Dye terminator mix 4µL 2µL 1µL

5 × buffer - 1µL 1.5µL

3.2pmol/ µL F primer 1µL 1µL 1µL

3.2pmol/ µL R primer 1µL 1µL 1µL

200-500ng plasmid

10-40ng PCR product

Water To 10µL To 10µL To 10µL

The exact amounts of either PCR product or plasmid that was used in each of the

sequencing reactions are listed in Appendix 1. The reactions were then put in the

thermocycler and incubated under the following conditions:

96°C for 2min

Then 25 cycles of:

96°C for 10sec (denaturation)

55°C for 5sec (annealing)


Then held at 14°C

The post-reaction purification was adapted from the Big Dye Terminator Version 3.1

Cycle Sequencing protocol from Applied Biosystems. Each separate sequencing

reaction was purified as follows:

35

In a 0.65mL microcentrifuge tube, 25µL of 100% ethanol, 1µL of 3M sodium

acetate pH5.2 and 1µL of 125mM EDTA were added

The entire 10µL sequencing reaction was added to this and incubated at room

temperature for 20min

Centrifugation @ 20 000 × g for 30min

Supernatant was removed by pipette, making sure no excess liquid was left on

the pellet.

Pre-moulded tissues (Kimwipes) were used to blot excess liquid in the tube

being careful not to touch the pellet at the bottom of the tube.

The pellet was washed by adding 125µL of 70% ethanol

Centrifugation at 20 000 × g for 5min.

Supernatant was removed as before and the pellet dried on a 37°C heat block.

The sequences were loaded in an ABI 377XL capillary sequencing machine.

2.13 Virus detection by Double Antibody Sandwich Enzyme Linked

Immuno-Sorbent Assay (DAS-ELISA)

Leaf and root samples were tested by DAS-ELISA using a protocol developed from

Clarke and Adams, (1977). Reagents and amounts of each reagent used to make buffer

solutions and wash solutions used in this protocol are given in Appendix 2.

36

2.13.1 Coating plates

Nunc 96 well maxisorb plates were used. The inside 60 wells of the plate are used so

that the outside wells could act as a buffer. The amount of coating buffer required was

calculated by the following formula:

N = number of plates to be coated

0.1 is the volume (mL) of solution to be put in each well of the microtitre plate and

66 is the number of wells to be coated.

N × 0.1 × 66 + N = mL coating buffer

The amount of antibody required for the coating step was calculated by:

mL coating buffer × dilution factor of antibody × 1000 = µL antibody

100µL coating buffer/antibody solution was pipetted into each well except outside wells

before 200µL water was pipette into the outside wells. The plates were then incubated

for 4h at 37°C.

2.13.2 Sample Preparation

Plant samples were placed in grinding block with 1000µL Phosphate Buffered Saline

with Tween (PBST). Enough plant material was used to have a sample dilution of 1:20.

The samples in PBST were then ground using ball bearing. The plates were then washed

37

in wash buffer 3 times and left to incubate at room temperature for 3min each time. The

plates were then dried and 200µL of each sample was then pipetted into paired, coated

wells before the plates were left to incubate over night at 4°C.

2.13.3 Conjugation

The amount of PBST (mL) and the amount of conjugate (µL) used in this step was

calculated as described in 2.13.1. Bovine serum albumin (BSA) was then added to this

solution at a ratio of 2% using the following formula:

Amount of BSA (g) = mL PBST × 0.002

100µL PBST/conjugate/BSA solution was then pipetted into each coated well and then

100µL of water into the outside outside wells. The plates were then incubated for 4

hours at 37°C before being washed with wash buffer 3 times and leaving the wash

buffer to incubate at room temperature for 3min each time. Saline was then used for a

final wash and also left to incubate at room temperature for 3min. The plates were then

dried.

2.13.4 Substrate

The volume of substrate buffer (mL) was calculated by the following formula:

N = number of plates to be coated

0.1 is the volume (mL) of solution to be put in each well of the microtitre plate

38

72 is the number of wells to be coated.

N × 72 × 0.2 + N = mL substrate buffer

Para-nitrophenyl phosphate (PNP) was then added to this solution at a ratio of 0.06% by

using the following formula:

Amount of PNP (g) = mL substrate buffer × 0.0006

200µL substrate buffer/PNP solution was then pipette into the first column of wells and

all coated wells. Plates were then incubated at room temperature for 1h before reading

the plate on BioRad Plate Reader.

39

Chapter 3 - Molecular genetic characterization of Olpidium

virulentus isolates associated with big-vein diseased lettuce

plants

L. D. Maccarone, School of Plant Biology, Faculty of Natural and Agricultural

Sciences, University of Western Australia, Stirling Highway, Crawley, WA 6009; M. J.

Barbetti, School of Plant Biology, Faculty of Natural and Agricultural Sciences,

University of Western Australia, Stirling Highway, Crawley, WA 6009, and

Agricultural Research Western Australia, Department of Agriculture and Food, Locked

Bag No.4, Bentley Delivery Centre, WA 6983; K. Sivasithamparam, School of Plant

Biology, Faculty of Natural and Agricultural Sciences, University of Western Australia,

Stirling Highway, Crawley, WA 6009; R. A. C. Jones, School of Plant Biology,

Faculty of Natural and Agricultural Sciences, University of Western Australia, Stirling

Highway, Crawley, WA 6009 and Agricultural Research Western Australia,

Department of Agriculture and Food, Locked Bag No.4, Bentley Delivery Centre, WA

6983

Corresponding author email: [email protected]

Key words: Olpidium brassicae, Chytridiomycete, fungal vector, internal transcribed

spacer sequence, Lettuce big-vein associated virus, Mirafiori lettuce big-vein virus

40

Abstract

Lettuce plants showing symptoms of lettuce big-vein disease were collected from fields

in the Perth Metropolitan region of south-west Australia. When root extracts from each

plant were tested by PCR using primers specific to the rDNA internal transcribed spacer

(ITS) region of Olpidium brassicae and O. virulentus, only O. virulentus was detected

in each of them. The nucleotide sequences of the complete rDNA ITS regions of

isolates from five of the root samples and 10 isolates of O. virulentus from Europe and

Japan showed 97.9 - 100% identities. However, with the six O. brassicae isolates their

identities were 76.9 - 79.4%. On phylogenetic analysis of the complete rDNA-ITS

region sequences of the five Australian isolates and 10 others, the Australian isolates

fitted within two clades of O. virulentus (I and II), and within clade I into two of its four

sub-clades (Ia and Id). Japanese isolates had greatest sequence diversity fitting into

both clades and into all of clade I sub-clades except Ib, while European isolates were

restricted to sub-clades Ib and Id. When the partial rDNA-ITS region sequences of two

additional south-west Australian isolates, four from Europe and four from the Americas

were included in the analyses, the Australian isolates were within O. virulentus sub-

clades Ia and Id, the European isolates within sub-clade Ic, and the American isolates

within sub-clades Ia and Ib. These findings suggest that there may have been at least

three separate introductions of O. virulentus into the isolated Australian continent since

plant cultivation was introduced following its colonization by Europeans. They also

have implications regarding numbers of different introductions to other isolated regions.

Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus were both detected

when symptomatic lettuce leaf tissue samples corresponding to the root samples from

south-west Australia were tested using virus-specific primers in Reverse Transcription-

PCR, so presence of both viruses was associated with O. virulentus occurrence.

41

Introduction

Lettuce big-vein disease (LBVD) was first found in California (10). It occurs widely in

regions of the world with temperate or Mediterranean-type climates and at high altitudes

in subtropical regions. LBVD is now known to be associated with a complex of two

viruses, Lettuce big-vein associated virus (LBVaV; genus Varicosavirus) and Mirafiori

lettuce big-vein virus (MLBVV; genus Ophiovirus) (17,18,19). Its reported natural host

range is limited to lettuce (Lactuca sativa), endive (Cichorium endive), spiny sowthistle

(Sonchus asper) and common sowthistle (Sonchus oleraceus) (2,12). The vector for

both viruses is a root-infecting chytrid belonging to the genus Olpidium

(Chytridiomycota). Motile zoospores of this chytrid transmit MLBVV and LBVaV to

the roots of healthy plants and, in the absence of susceptible hosts, its resting spores

retain ability to transmit for decades in infested soil (1,17,20,23). In addition to

damaging their quality through the presence of obvious „big-vein‟ leaf symptoms

(chlorophyll clearing around leaf veins that appear enlarged) from which the disease

gets its name, LBVD decreases yield of produce from infected plants substantially

(14,15). Symptom expression is most obvious at low temperatures and low light

intensities (2,3,4,17,27,28).

Olpidium spp. are obligate plant pathogens which vector several different soil-

borne plant viruses. They are found commonly throughout the world infecting the roots

of wild and domesticated plants and until recently only two species were recognised as

vectors, O. brassicae and O. bornovanus (= O. radicale) (2,3,9,20). Sahtiyanci (21)

separated O. brassicae (formerly Pleotrachelus brassicae) into two species, O.

brassicae being crucifer-infecting and O. virulentus non-crucifer infecting.

Morphologically, O. brassicae and O. virulentus varied slightly. Pleomorphism was

present in both species with few variations in O. virulentus but more variation in O.

42

brassicae. Also, the zoosporangium of O. brassicae was larger than that of O. virulentus

(21). However, this study was overlooked by researchers investigating LBVD, who

continued to refer to a non-crucifer infecting strain of O. brassicae as the vector of

LBVaV (2,3,4,5,17,20). Recently, molecular and host range studies confirmed that O.

virulentus was sufficiently different to be considered a distinct species that differs from

O. brassicae in infecting lettuce but not Brassica species whereas O. brassicae infects

Brassica species but not lettuce (7,13,23). Nucleotide sequence data for the rDNA

internal transcribed spacer (ITS) region of its Olpidium sp. vector confirmed that it was

O. virulentus that transmitted MLBVV and the Tobacco stunt virus (TStV) strain of

LBVaV to lettuce roots (23).

In Australia, LBVD is a widespread problem in commercial lettuce producing

areas. In south-west Australia, the lettuce production system on the Swan Coastal Plain

is intensive and often uses irrigated land that is contaminated with LBVD, sometimes

without crop rotation. Also, winter plantings often have >90% of plants with symptoms

of the disease (12,14,15). However, no nucleotide sequences of Olpidium spp. are

available from the Australian continent. This paper reports studies that determined the

nucleotide sequences of the rDNA ITS region of south-west Australian Olpidium sp.

isolates obtained from the roots of lettuce plants with LBVD, and compared their

sequence identities and phylogenies with those of the rDNA ITS region of Olpidium

spp. isolates from elsewhere.

43

Materials and Methods

Collection of field samples

Whole lettuce plants showing LBVD symptoms were sampled from two crops growing

in the northern Perth Metropolitan region of south-west Australia. They came from two

different commercial lettuce growing farms, four samples from one farm (labelled Nan

6, Nan 7, Nan 8 and T1 23) and three from the other (labelled Col 1, Col 2 and Col 3).

On the same day, roots from each sample were washed and ground in liquid nitrogen

before DNA was extracted and stored at -20°C.

DNA extraction, PCR and agarose gel electrophoresis

Total DNA was extracted from the lettuce root tissue from samples Nan 6 - 8, T1 23

and Col 1 - 3 using a Qiagen DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA)

according to manufacturer‟s instructions. No cultures of O. brassicae or O. virulentus

were available to provide positive control extracts. Primers used to amplify target

Olpidium spp. came from White et al. (30) (ITS1 and ITS4) or were designed from

within the rDNA-ITS region by aligning already known sequences using Bioedit (6)

(Ob1, Ob2, Ov1 and Ov2). For amplification of O. brassicae, the primers pairs used

were Ob1 Fwd (5' TCA TTA ATA AAT GCT TCA TTG CAT 3') with ITS4 Rev (5'

TCC TCC GCT TAT TGA TAT GC 3'), and ITS1 Fwd (5' TCC GTA GGT GAA CCT

GCG G 3') (30) with Ob2 Rev (5' TCC AGC AAC AAG TCT TCC CAA 3'). For O.

virulentus amplification, the primer pairs used were Ov1 Fwd (5' CAA GAC CTG CCC

CCA AAA GGG 3') with ITS4, and ITS1 with Ov2 Rev (5' CCA AGT TCG CAA ACG

TGG CG 3'). All primer pair combinations were used on tissue extracts from each

sample. PCR reactions were done using Taq DNA polymerase and 5 × polymerisation

buffer (Fisher Biotec, Perth, Western Australia).

44

PCR amplification conditions consisted of 1 min denaturation at 94°C followed

by 35 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 1 min followed by a final

extension at 72°C for 10 min before being held at 14°C. PCR amplicons were visualised

by electrophoresis on 1% agarose gels. Tris-boric acid-EDTA (TBE) electrophoresis

buffer was used (22).

Virus RNA extraction and Multiplex RT-PCR

Symptomatic leaf tissue samples corresponding to six of the seven root samples were

used for RNA extraction (isolate T1 23 was not available). Total RNA was extracted

from each sample using an UltraClean™ Plant RNA Isolation Kit (MoBio Laboratories,

Inc.) according to manufacturer‟s instructions. RNA extracts were stored at -80°C.

Three primer pairs developed by Navarro et al. (18) were used for multiplex RT-PCR:

VP248 Fwd (5' CGC CAG GAT CTT TGA TCC ATC TG 3') with VP249 Rev (5' TTG

CGA CAT GTT CCT CCT CAT CG 3') to amplify LBVaV, VP286 Fwd (5' TAT CAG

CTC ACA TAC TCC CTA TCG 3') with VP287 Rev (5' CAA CTA GCT CAG AAT

ACA TGC AG 3') to amplify MLBVV, and control primers VP383 Fwd (5' AGC GTG

CTA ATC CCT ATG TTC AT 3') with VP389 Rev (5' AAT GAA AAT CTT AAA

AGC CGT AG 3') to amplify the mitochondrial NADH dehydrogenase subunit 4 (nad4)

of lettuce. Reverse Transcription PCR (RT-PCR) was done using a OneStep RT-PCR

kit (Qiagen, Australia) according to manufacturer‟s instructions.

PCR amplification conditions consisted of 50°C for 30 min, 95°C for 15 min

followed by 30 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 1 min followed

by a final extension at 72°C for 10 min before being held at 14°C.

45

Cloning and sequencing of PCR amplicons

PCR amplicons of Olpidium were purified by ethanol precipitation and then quantified

using a Nanodrop UV-Vis spectrophotometer following the manufacturer‟s protocol.

Next, standard ligation and transformation reactions were done into JM109 competent

cells using a pGEM®-T Easy Vector (Promega Corp, Madison Wisconsin) as

recommended in the manufacturer‟s protocol.

Screening for recombinant plasmids was done using M13 primers Fwd (5' CGT

CAG GCT TTT CCC AGT CAC GAC 3') and Rev (5' TCA CAC AGG AAA CAG

CTA TGA C 3'). Amplification conditions consisted of 1 min denaturation at 94°C

followed by 25 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec before

being held at 14°C. Amplicons were then visualised on 1% agarose gels as described

above. Recombinant plasmids were inoculated into 5mL of Luria Bertani (LB) broth

with ampicillin (100 mg/L) and incubated on a shaker at 37°C overnight. Plasmids were

then purified from the culture using an Aurum™ Bio-Rad Plasmid Extraction Kit

following the manufacturer‟s instructions. Presence and size of inserts was confirmed

with a restriction digest of the purified plasmid DNA by EcoR1 (10µL of purified

plasmid DNA, 2µL of 10 x EcoR1 buffer, 1µL of EcoR1 and 7µL of water), incubating

on a 37°C heat block for 1 h and visualising on 1% agarose gel.

Dideoxy-termination sequencing was done at the Western Australian State

Agricultural Biotechnology Centre (SABC), Murdoch University, Perth, or Royal Perth

Hospital, Perth. In both instances, Big Dye Version 3.1 chemistry was used. The

complete rDNA-ITS sequences of isolates Nan 6-8, T1 23 and Col 1 (each 632bp) and

partial sequences of isolates Col 2 (577bp) and Col 3 (503bp) were submitted to

Genbank (Table 1).

46

Analysis of Sequence Data

Nucleotide sequence data for the 21 complete rDNA-ITS regions (632bp) of

Olpidium spp. and the ten partial rDNA-ITS regions (503-577bp) was assembled and

analysed using Molecular Evolutionary Genetics Analysis (MEGA) program Version

4.1 (24). Sequence data for the rDNA ITS region of six full length sequences of O.

brassicae, ten full length sequences of O. virulentus from Europe and Japan, and eight

partial sequences from the Americas and Europe were retrieved from Genbank (Table

1). Isolates SP-010 from Spain (EU981907) and PT-01 from Portugal (EU981906) were

excluded from this analysis as they were only 176bp in length (8).

The complete Olpidium rDNA-ITS region sequences from five Australian

isolates and 16 isolates from other continents were analysed in direct pairwise

comparisons to establish percentage indentities between them. Nucleotide sequence

data for these 21 complete Olpidium rDNA-ITS region sequences were then aligned in

MEGA 4.1 using Clustal W (26) and bootstrapped with 1000 resamplings. This process

was then repeated to also include the two partial sequences from south-west Australia

and the other eight partial sequences. Evolutionary history was inferred using the

Neighbour-Joining method initially for the 21 full length sequences only and then for all

31 sequences. Evolutionary distances were computed using the Maximum Composite

Likelihood method. All positions containing gaps and missing data were eliminated

from the dataset (complete deletion option). Two sequences of O. bornovanus were

then added to the alignment and a radiation diagram constructed to show the relative

genetic distance between the different species of Olpidium reported to be virus vectors.

47

Results

PCR DNA extracts from roots

PCR amplification of the rDNA-ITS nucleotide sequence from all seven root samples

using primers designed specifically for O. virulentus always revealed presence of this

Olpidium species. However, primers designed specifically for O. brassicae produced

only one very faint amplicon from one sample. Subsequent sequencing of this band

failed suggesting that O. brassicae was absent which is consistent with recent findings

that this species does not infect lettuce (7,13,23).

Nucleotide sequence identities

Of the 21 Olpidium complete rDNA-ITS region nucleotide sequences analysed, those of

the five south-west Australian isolates showed greatest nucleotide identity with those of

O. virulentus (four isolates from Europe and six from Japan) (Table 2). Overall, there

was 97.9 - 100% identity between the 15 isolates of O. virulentus, and 99.3 - 100%

identity between the seven isolates of O. brassicae. However, the identity between O.

virulentus and O. brassicae sequences was only 76.9 - 79.4%.

Phylogenetic analysis

The five Olpidium sp. isolates with complete rDNA-ITS nucleotide sequences from

south-west Australia all grouped with O. virulentus (Fig. 1). They fitted into two O.

virulentus clades, I and II. Although the rDNA-ITS region of Olpidium is highly

conserved, it was also possible to distinguish sub clades within clade I despite the small

overall sequence divergence. Four isolates fitted into clade I within two of its four sub-

clades (Ia-d). Nan 6 and Nan 7 grouped together with Japanese isolates KZ-1 and HY-1

within sub-clade Ia while T1 23 and Col 1 grouped with Japanese isolate WOms-3 and

UK isolate GBR1 within sub-clade Id. Sub-clade Ib contained one isolate each from the

48

Netherlands (NLD4), Great Britain (GBR10) and Italy (ITA1). The third sub-clade, Ic,

contained two isolates from Japan (CH-1 and TAK-1). Australian isolate Nan 8 grouped

with Japanese isolate WT-1, and were more distant genetically from the others forming

a distinct clade on their own (clade II).

When the ten partial sequences are added to the phylogeny (Fig. 2), sub-clade Ia

then also included an Australian isolate (Col 3) and one from Guatemala (GT-08), sub-

clade Ib contained two isolates from Mexico (MX-05 and MX-06) and one from the

USA (633), four isolates from Spain (SP-06 to SP-09) were in sub-clade Ic, and the

remaining Australian isolate (Col 2) fitted into sub-clade Id. None of the partial

sequences fell within clade II.

When the relative genetic distances between the three viral vector species of

Olpidium were compared, O. virulentus and O. brassicae were much closer to one

another than either was to O. bornovanus (Fig. 3).

RT-PCR RNA extracts from leaves

When leaf tissue from samples Nan 6-8 and Col 1 were tested by RT-PCR using

primers specific for LBVaV or MLBVV, a 496bp fragment was amplified indicating

presence of MLBVV, a 292bp fragment indicating presence of LBVaV and a 360bp

control fragment indicating presence of the nad4 gene of lettuce (Fig. 4). This shows

that both viruses were present in each of the samples. Leaf tissue from samples Col 2

and Col 3 were also tested using the same method. Col 2 contained both viruses whilst

MLBVV was the only virus present in Col 3. As O. virulentus, but not O. brassicae,

was associated with the two viruses in the same lettuce plants, this indicates that it may

have been responsible for the transmission of LBVaV and MLBVV on the two farms

originally sampled.

49

Discussion

This study revealed that O. virulentus, but not O. brassicae, was associated with

samples of lettuce plants with LBVD collected from two farms in south-west Australia,

and that the same samples were infected either with LBVaV and MLBVV, or MLBVV

alone. This association of O. virulentus with the two viruses is consistent with previous

research which suggested that O. virulentus, rather than O. brassicae, was the chytrid

vector of MLBVV and the TStV strain of LBVaV (23), and that O. brassicae does not

infect lettuce (7,13,23). However, it contrasts with previous publications (e.g.

4,17,25,27) which named O. brassicae as vector of LBVaV and MLBVV.

Sasaya and Koganezawa (23) reported that the extent of nucleotide sequence

identity in the complete rDNA-ITS region of O. virulentus and O. brassicae isolates

was 98.5 – 100% and 99.3 - 100%, respectively, while it was 79.7-81.8% between the

two species. This is consistent with the percentage identities found in our study within

isolates of O. virulentus from Australia, Europe and Japan (97.9 - 100%), and of O.

brassicae from Europe and Japan (99.3 – 100%). However, the percentage rDNA-ITS

region nucleotide sequence identity between O. brassicae and O. virulentus isolates that

we found was somewhat greater (76.9 - 79.4%). This degree of sequence divergence

supports the conclusion made by Sahtiyanci (21), based on morphological evidence, and

Sasaya and Koganezawa (23), based on molecular evidence, that they are distinct

Olpidium species, not simply different strains of the same species. When the nucleotide

sequences from the complete rDNA-ITS region of five O. virulentus isolates from

samples of lettuce roots from Australia and those of the complete rDNA-ITS region of

10 O. virulentus isolates from Europe and Japan were analysed phylogenetically, two

clades were found (I and II) and, within clade I, four sub-clades were distinguishable

(Ia-Id). Australian isolates grouped within both clades and within clade I, sub-clades Ia

50

and Id. Japanese isolates fitted within both clades and in all sub-clades except 1b, while

European isolates only fitted in sub-clades Ib and 1d. When the partial rDNA-ITS

region sequences of two additional south-west Australian isolates, four from Europe and

four from the Americas were included in the analyses, the Australian isolates were

within sub-clades Ia and Id, the European isolates within sub-clade Ic, and the American

isolates within sub-clades Ia and Ib One of the Australian farms sampled contained

isolate sequences that fitted not only into both of the clades but also into two sub-clades

(Ia and Id) while the second farm contained isolates within the same sub-clades. This

suggests that since European settlement of south-west Australia more than 160 years

ago and the subsequent introduction of plant cultivation to the region, three separate

introductions of O. virulentus have occurred. The data indicate that there have been four

separate introductions to Japan. Although Japanese isolates showed the greatest

nucleotide sequence diversity for the rDNA-ITS region of O. virulentus, this does not

mean that this species originated in Japan as it is not a recognised centre of crop

domestication. Lettuce was probably domesticated first in Egypt (16). From there,

lettuce cultivation spread through the Mediterranean region, first into Italy and then to

Greece (29). Assuming that O. virulentus evolved with lettuce in its original centre of

domestication within the Mediterranean Basin, greater nucleotide sequence diversity of

O. virulentus would be expected in this region than elsewhere. However, unlike

Japanese and Australian isolates, European isolates did not fit into both clades, only into

three sub clades of clade I. Sequencing of more isolates from the Mediterranean region

and Europe in general is required to reveal the extent of diversity in the O. virulentus

population in that part of the world. Further sequencing of the rDNA-ITS region of O.

virulentus isolates from the Americas is needed to comment on the number of possible

51

introductions there, but more sequence diversity would be expected than that in

Australia given the longer history of plant cultivation since European colonization.

Methyl bromide was formerly used widely as a fungicide to control Olpidium

spp., but is no longer available in some countries, including Australia. Environmentally

friendly cultural (agronomic) and phytosanitary control measures against Olpidium

vectors were included within the LBVD integrated disease management strategies for

nurseries, nutrient film, infested land and uninfested land of Jones (12). For example,

when infested land is used, decreasing irrigation and /or placing plastic mulch on the

soil surface when overhead irrigation is used diminishes the mobility of viruliferous O.

virulentus zoospores (14).

Acknowledgements

We thank Stephen Wylie and Craig Webster for their advice on nucleotide sequencing,

local farmers for allowing sampling on their farms, and Frances Brigg and Julie

Uhlmann for operating sequencing machines and the SABC for providing laboratory

facilities. Linda Maccarone received an Australian Postgraduate Award (Industry)

jointly funded by the Australian Research Council and the Department of Agriculture

and Food Western Australia.

52

Literature Cited

1. Barr, D. J. S. 1988. Zoosporic plant parasites as fungal vectors of viruses: taxonomy

and life cycle of species involved. Pages 123-137 in: Viruses with fungal vectors. J.

I. Cooper and M.J.C. Asher, eds. Association of Applied Biologists, Wellesbourne,

UK.

2. Campbell, R.N. 1985. Longevity of Olpidium brassicae in air-dried soil and the

persistence of the lettuce big-vein agent. Can. J. Bot. 63: 2288-2289.

3. Campbell, R. N. 1996. Fungal transmission of plant viruses. Ann. Rev. Phytopathol.

34: 87-108.

4. Campbell, R. N. and Grogan R. G. 1964. Acquisition and transmission of lettuce

big-vein virus by Olpidium brassicae. Phytopathology 54: 681-690.

5. Campbell, R. N., and Lin M. T., 1976. Morphology and thermal death point of

Olpidium brassicae. Am. J. Bot. 63: 826-832.

6. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucl. Acid. Sym. Ser. 41: 95-98.

7. Hartwright, L. M., Hunter, P. J., and Walsh J. A. 2009. A comparison of Olpidium

isolates from a range of host plants using internal transcribed spacer sequence

analysis and host range studies. Mycol. Res. (in press) doi:

10.1016/j.mycres.2009.09.008.

8. Herrera-Vasquez, J. A., Cebrian, M. C., Alfaro-Fernandez, A., Cordoba-Selles, M.

D., and Jorda, C. (2009). Multiplex PCR assay for the simultaneous detection and

53

differentiation of Olpidium bornovanus, Olpidium brassicae and Olpidium

virulentus. Mycol. Res. 113:602-610

9. Herrera-Vasquez, J. A., Cordoba-Selles, M. C., Cebrian, M. C., Rosello, J. A., and

Jorda, C. 2010. Genetic diversity of Melon necrotic spot virus and Olpidium isolates

from different origins. Plant Pathol. (in press)

10. Jagger, I. C., and Chandler, N. 1934. Big-vein, a disease of lettuce. Phytopathology

24: 1253-1256.

11. James, T. Y., Letcher, P. M., Longcore, J. E., Mozley-Standridge, S. E., Porter, D.,

Powell, M. J., Griffith, G. W., and Vilgalys, R. (2006) A molecular phylogeny of

flagellated fungi (Chytridiomycota) and description of a new phylum

(Blastocladiomycota). Mycologia 98:860-871.

12. Jones, R. A. C., 2004. Using epidemiological information to develp effective

integrated virus disease management strategies. Virus Res. 100: 5-30

13. Koganezawa, H., Inoue, H., and Sasaya, J. 2005. Host specificity and multiplication

of eight isolates of Olpidium brassicae sensu lato and its related Olpidium spp. Bull.

Natl. Agric. Res. Cent. West Reg. 4:39-40.

14. Latham, L. J., and Jones, R. A. C. 2004. Deploying partially resistant genotypes and

plastic mulch on the soil surface to suppress spread of lettuce big-vein disease in

lettuce. Aust. J. Agr. Res. 55: 131-138

15. Latham, L. J., Jones, R. A. C., and McKirdy, S. J. 2004. Lettuce big-vein disease:

sources, patterns of spread, and losses. Aust. J. Agr. Res. 55: 125-130

16. Lindqvist K, 1960. On the origin of cultivated lettuce. Hereditas 46: 319-350

54

17. Lot, H., Campbell, R. N., Souche, S., Milne, R. G., and Roggero, P. 2002.

Transmission by Olpidium brassicae of Mirafiori lettuce virus and Lettuce big-vein

virus, and their roles in lettuce big-vein etiology. Phytopathology 92: 288-293.

18. Navarro, J. A., Botella, F., Maruhenda, A., Sastre, P., Sànchez-Pina, M. A., and

Pallas. V. 2004. Comparative infection progress analysis of Lettuce big-vein virus

and Mirafiori lettuce virus in lettuce crops by developed molecular diagnosis

techniques. Phytopathology 94: 470-477

19. Roggero, P., Ciuffo, M., Vaira, A. M., Accotto, G. P., Masenga, V., and Milne, R.

G., 2000. An ophiovirus isolated from lettuce with big-vein symptoms. Arch. Virol.

145: 2629-2642

20. Rochon, D‟A., Kakani, K., Robbins, M., and Reade, R. 2004. Molecular aspects of

plant virus transmission by Olpidium and Plasmodiophorid vectors. Ann. Rev.

Phytopathol. 42: 211-241.

21. Sahtiyanci, S. 1962. Studien über einige wurzelparasitäre Olpidiaceen. Arch.

Microbiol. 41: 187–228.

22. Sambrook, J., and Russell, D. W. 2001. Molecular cloning: A laboratory manual.

New York: Cold Spring Harbour Laboratory Press.

23. Sasaya, T., and Koganezawa, H. 2006. Molecular analysis and virus transmission

tests place Olpidium virulentus, a vector of Mirafiori lettuce big-vein virus and

Tobacco stunt virus, as a distinct species rather than a strain of Olpidium brassicae.

J. Gen. Plant Pathol. 72: 20-25.

55

24. Tamura, K., Dudley, J., Nei, M., and Kumar, S. 2007. MEGA4: Molecular

Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:

1596-1599.

25. Teakle, D. S. 1960. Association of Olpidium brassicae and tobacco necrosis virus.

Nature 188: 431-432.

26. Thompson, J. D., Higgins, D. G., and Gibson, T. J. 1994. CLASTAL W: Improving

the sensitivity of progressive multiple sequence alignment through sequence

weighting, position-specific gap penalties and weight matrix choice. Nucl. Acid.

Res. 22: 4673-4680.

27. Walsh, J. A. 1994. Effects of some biotic and abiotic factors on symptom expression

of lettuce big-vein virus in lettuce (Lactuca sativa). J. Hortic. Sci. 69: 21-28.

28. Westerlund, F. V., Campbell, R. N., and Grogan, R. G. 1978. Effect of temperature

on transmission, translocation, and persistence of the lettuce big-vein agent and big-

vein symptom expression. Phytopathology 68: 921-926.

29. Whitaker, T. W. 1969. Salads for everyone – A look at the lettuce plant. Econ. Bot.

23: 261-264

30. White, T. J., Bruns, T., Lee, S., and Taylor, J. W. 1990. Amplification and direct

sequencing of fungal ribosomal RNA genes for polygenetics. Pages 315-322 in:

PCR Protocols: A Guide to Methods and Applications. M. A. Inns, D. H. Gelfand, J.

J. Sninsky and T. J. White, eds., Academic Press, Inc., New York.

56

Table 1: Details of isolates of three vector Olpidium spp. used to determine relationships

using the nucleotide sequences of their rDNA ITS regions

Species Accession

number

Isolate Geographic origin Isolated from root

of:

Reference

O. bornovanus AB205214 NA Nagasaki, Japan Melon 23

O. bornovanus AB205215 CH Chiba, Japan Melon 23

O. brassicae AB205209 CBG-3 Nagano, Japan Cabbage 23

O. brassicae AB205210 NKa-3 Nagano, Japan Cabbage 23 O. brassicae AB205211 YR-2 Shimane, Japan Cabbage 23

O. brassicae AB205212 ZE-1 Zentsuji, Japan Cabbage 23

O. brassicae AB205213 EH-2 Iyo, Japan Cabbage 23

O. brassicae AY373015 GBR7 Warwickshire, UK Cauliflower 7

O. virulentus AB205203 WT-1 Wakayama, Japan Lettuce 23

O. virulentus AB205204 HY-1 Hyougo, Japan Lettuce 23 O. virulentus AB205205 KZ-1 Kagawa, Japan Lettuce 23

O. virulentus AB205206 TAK-1 Takamatsu, Japan Tobacco 23

O. virulentus AB205207 CH-1 Chunan, Japan Tobacco 23

O. virulentus AB205208 WOms-3 Toyama, Japan Welsh onion 23 O. virulentus AY373011 GBR1 Warwickshire, UK Lettuce 7

O. virulentus AY373012 ITA1 Mirafiori, Italy Lettuce 7

O. virulentus AY373013 NLD4 De Lier, the

Netherlands

Lettuce

7

O. virulentus AY373014 GBR10 Humberside, UK Cucumber 7

O. virulentus AY997067 633 Duke University

Herbarium, USA

unknown 11

O. virulentus EU981898 GT-8 Zacapa, Guatemala Cantaloupe 9 O. virulentus EU981899 MX-06 Sinaloa, Mexico Cantaloupe 9

O. virulentus EU981900 MX-05 Colima, Mexico Cantaloupe 9

O. virulentus EU981901 SP-08 Castellon, Spain Lettuce 9

O. virulentus EU981902 SP-09 Murcia, Spain Tomato 9 O. virulentus EU981903 SP-07 Alicante, Spain Watermelon 9

O. virulentus EU981905 SP-06 Seville, Spain Cantaloupe 9

O. virulentus GQ304519 Nan6 Perth, Western

Australia

Lettuce This study


Australia

Lettuce This study


Australia

Lettuce This study

O. virulentus GQ304522 T123 Perth, Western

Australia

Lettuce This study

O. virulentus GQ304523 Col1 Perth, Western

Australia

Lettuce This study


Australia

Lettuce This study


Australia

Lettuce This study

57

Table 2: Estimates of evolutionary percentage identity between isolates of O. virulentus and O. brassicae based on nucleotide sequence

alignment of the rDNA ITS region

Olpidium virulentus Olpidium brassicae

KZ-1 Nan7 Hy-1 Nan6 NDL4 GBR10 ITA1 Col1 T123 WOms3 GBR1 CH-1 TAK-1 Nan8 WT-1 YR-2 EH-2 CBG-3 GBR7 ZE-1 NKa3

KZ-1 99.8 99.8 99.4 98.3 98.3 99.3 99.1 98.9 98.9 98.9 99.3 99.1 98.7 98.5 78.2 78.2 77.9 77.7 77.4 77.4

Nan7 100 99.6 98.5 98.5 99.4 99.3 99.1 99.1 99.1 99.4 99.3 98.9 98.7 78.4 78.4 78.2 77.9 77.7 77.6

HY-1 99.6 98.5 98.5 99.4 99.3 99.1 99.1 99.1 99.4 99.3 98.9 98.7 78.4 78.4 78.2 77.9 77.7 77.6

Nan6 98.9 98.5 99.4 99.3 99.1 99.1 99.1 99.4 99.3 98.9 98.7 78.7 78.7 78.5 78.2 77.9 77.9

NLD4 98.1 99.1 98.5 98.3 98.3 98.3 98.7 98.5 98.1 97.9 77.7 77.7 77.4 77.2 76.9 76.9

GBR10 99.1 98.5 98.3 98.3 98.3 98.7 98.5 98.1 97.9 78.4 78.4 78.1 77.9 77.6 77.6

ITA1 99.4 99.3 99.3 99.3 99.6 99.4 99.1 98.9 78.7 78.7 78.4 78.2 77.9 77.9

Col1 99.4 99.4 99.4 99.4 99.3 98.9 98.7 78.4 78.4 78.2 77.9 77.7 77.7

T123 100 100 99.3 99.1 98.7 98.5 78.9 78.9 78.7 78.4 78.2 78.1

WOms3 100 99.3 99.1 98.7 98.5 78.9 78.9 78.7 78.4 78.2 78.1

GBR1 99.3 99.1 98.7 98.5 78.9 78.9 78.7 78.4 78.2 78.1

CH-1 99.8 99.1 98.9 78.9 78.9 78.7 78.4 78.2 78.1

TAK-1 98.9 98.7 78.9 78.9 78.7 78.4 78.2 78.1

Nan8 99.4 79.4 79.4 79.1 78.9 78.6 78.6

WT-1 79.4 79.4 79.2 78.9 78.7 78.6

YR-2 99.6 99.8 99.6 99.4 99.4

EH-2 99.8 99.6 99.4 99.4

CBG-3 99.8 99.6 99.6

GBR7 99.4 99.4

ZE-1 99.3

NKa-3

58

KZ-1

Nan 7

HY-1

Nan 6

NLD4

GBR10

ITA1

CH-1

TAK-1

Col 1

T1 23

WOms-3

GBR1

Nan 8

WT-1

YR-2

GBR7

EH-2

CBG-3

ZE-1

NKa-3 85 55

100

86

84

66

51

56

68

0.02

I

II

Ia

Ib

Ic

Id

Olpidium

virulentus

Olpidium

brassicae

Fig 1: Unrooted neighbour-joining relationship dendrogram for the complete 632bp

rDNA ITS nucleotide sequences of five Olpidium isolates sequenced in this study and

16 others from Europe and Japan available on Genbank. The phylogenetic tree was

generated using MEGA 4.1 using the default parameters. The tree branches were

bootstrapped with 1000 replications. Numbers at nodes indicate bootstrap scores

>50%. The scale bar represents a genetic distance of 0.02 for horizontal branch

lengths. Table 1 shows isolate designations.

59

KZ-1

Nan 7

HY-1

GT-08

Col 3

Nan 6

NLD4

ITA1

MX-O5

MX-O6

GBR10

633

SP-O6

SP-O7

CH-1

TAK-1

SP-O9

SP-O8

Col 2

Col 1

WOms-3

GBR1

T1 23

Nan 8

WT-1

YR-2

EH-2

CBG-3

GBR7

ZE-1

NKa-3 84

58

56

99

97

86

81

68

64

50

68

0.02

I

II

Ia

Ib

Ic

Id

Olpidium

virulentus

Olpidium

brassicae

Fig 2: Unrooted neighbour-joining relationship dendrogram for rDNA ITS nucleotide

sequences of the five complete and two partial Olpidium isolates sequenced in this

study and 16 complete and eight partial ones from Europe, Japan and the Americas

available on Genbank. The phylogenetic tree was generated using MEGA 4.1 using

the default parameters. The tree branches were bootstrapped with 1000 replications.

Numbers at nodes indicate bootstrap scores >50%. The scale bar represents a genetic

distance of 0.02 for horizontal branch lengths. Table 1 shows isolate designations.

60

Fig 3: Phylogenetic tree showing the relative genetic distance between the three virus

vector Olpidium species: O. bornovanus, O. brassicae and O. virulentus. The tree was

generated in MEGA 4.1 using default parameters. The scale bar represents a genetic

distance of 0.05 for branch lengths.

61

Fig 4: Agarose gel resulting from a multiplex RT-PCR to detect the presence of

MLBVV, LBVaV and control gene nad4 in four samples of lettuce with LBVD from

south-west Australia. All samples had mixed infection with LBVaV and MLBVV,

and were positive for nad4. Lane 1: isolate Nan 6, Lane 2: Nan 7, Lane 8: Nan 8,

Lane 4: Col 1. Lane M represents a 100bp molecular weight marker.

496bp MLBVV

360bp nad4

292bp LBVaV

M 1 2 3 4

62

Chapter 4 - Comparison of the coat protein genes of

Mirafiori lettuce big-vein virus isolates from Australia with

those of isolates from other continents

Linda D. Maccarone1, Martin J. Barbetti

1, Krishnapillai Sivasithamparam

1,

Roger A. C. Jones1,2,3

1School of Plant Biology, Faculty of Natural and Agricultural Sciences, University of

Western Australia, Crawley, WA 6009, Australia

2 Department of Agriculture and Food, Locked bag 4, Bentley Delivery Centre, WA

6983, Australia

3Corresponding author email: [email protected]

Introduction

Mirafiori lettuce big-vein virus (MLBVV; genus Ophiovirus) commonly occurs in

lettuce plants in mixed infection with Lettuce big-vein associated virus (LBVaV;

genus Varicasavirus) [e.g., 4, 5, 6, 9]. Both are transmitted by Olpidium virulentus [4,

10]. MLBVV causes lettuce big-vein disease (LBVD), decreasing lettuce yield and

quality [e.g., 3, 9]. It has filamentous, circularised particles [2, 9, 11]. Its known

natural host range includes lettuce, endive (Cichorium endive), spiny sowthistle

(Sonchus asper) and common sowthistle (Sonchus oleraceus) [3, 7]. When Navarro

et al. [8] analysed the complete CP nucleotide sequences of 17 MLBVV isolates

mostly from Europe, they found identities of 88.0 to 99.8% (nucleic acids) and 92.9-

99.8% (amino acids), and when these sequences were analysed phylogenetically, two

isolate groupings were found (A and B). When three further European sequences

63

from sowthistle were included, they fitted into group B [7]. This paper compares the

CPs of 13 previously unreported isolates from Australia with those of 26 previously

sequenced isolates from different continents.

Materials and Methods

Leaves with LBVD symptoms were sampled from seven farms (A-G) in four districts

in the Perth Metropolitan region. Thirteen samples were collected, one each from

farms B, C, D and F, two each from A and G, and five from E (Supplementary Fig. 1).

Procedures and conditions used for sample storage, RNA extraction, RT-PCR, PCR

amplification, electrophoresis on agarose gels, amplicon quantification, cloning and

sequencing were described previously [5]. The CP primer pairs specific for MLBVV

used were those of Navarro et al. [8], fwd VP286 (5' TAT CAG CTC ACA TAC TCC

CTA TCG 3') and rev VP289 (5' ACA AAG TCA AAT GTC AGG AG 3'), and

primers developed with sequences from GenBank using Bioedit, fwd M2-21 (5' CAA

AGT CAC AAT GTC AGG AG 3') and rev M899-880 (5' AAA AGT GCA TAC

CTC ATT GC 3'). The PCR reaction was done with an annealing temperature of

55°C for both primer pairs. Complete CP sequences of were submitted to GenBank

(Table 1). They contained one ORF 1,311bp in length encoding 437 amino acids. In

addition, 23 complete and three partial CP sequences of other isolates were retrieved

from GenBank. The partial sequences were DQ530356 and DQ530358 (both

1261bp), and DQ530357 (1260bp) from Brazil. Other partial MLBVV sequences

available were too short to use. The 36 complete CP sequences were assembled and

analysed for nucleotide and amino acid identities, and phylogeny as described

previously [5]. This process was then repeated to include the partial sequences. Next,

64

with the complete CP sequences, the mean number of non-silent substitutions (Dn)

and silent substitutions (Ds), and Dn/Ds ratios were determined [5].

Sequence properties

When the 36 complete CP nucleotide sequences were analysed phylogenetically, all

were within clades A and B. Also, each clade contained two sub-clades (Fig. 1;

Supplementary Fig. 2). This clade sub-division was also evident in earlier trees, in

clade A [8] and both clades [7]. Phylogenetic analysis of amino acid sequences from

the 36 complete CPs revealed a similar pattern. Sub-clade A1 included 12 of the 13

new Australian isolates, the Australian isolate sequenced previously [AUS1], one

Japanese isolate and six European isolates; A2 included new Australian isolate

AUSE2, two South American isolates (from Argentina) and six European isolates;

while B1 and B2 included two and five European isolates (all from Spain),

respectively. Despite being in a different sub-clade, isolate AUSE2 was originally

collected from the same farm as isolates AUSE1, AUSE3, AUSE4 and AUSE6.

Spanish isolates SON1-4 in sub-clade B2 were from sowthistle while all other isolates

in both clades were from lettuce. The three partial nucleotide sequences from Brazil

all grouped with the two complete South American sequences in sub-clade A2.

The nucleotide sequence identities of the 14 Australian isolates were 96.3–

99.9%. New isolate AUSE2 diverged most from the other 13 which had 99.1-99.9%

identities. AUSE2 was closest to the three Brazilian isolates in sub-clade A2, while

the other Australian isolates were closer to the European and Japanese isolates in sub-

clade A1. The nucleotide sequence identities of all 36 complete CPs were 85.4–

100%. Those of clade A and B isolates were 95.8–99.9% and 98.4–100%,

respectively. Isolate pairs SON1 and SON4, and SON3 and ALM5 in sub-clade B2

65

had identical sequences. Thus, the degree of nucleotide sequence divergence

resembled that reported previously, 88.0-99.8% (all isolates), 95.8-99.5% (clade A)

and 98.7-99.8% (clade B) [8]. The sequence identities of sub-clades were 98.1-99.9%

(A1), 96.1-99.5% (A2), 99.8% (B1) and 98.4-100% (B2). Overall, the identities of

Spanish isolates SON1 and SON4 (in sub-clade B2) and ALM3 (in sub-clade A2)

were most divergent, differing by 85.4%. Amino acid identities were 92.8 to 100%

(all isolates), 95.3 to 100% (clade A) and 99.1 to 100% (clade B), again resembling

values reported previously, 92.9-99.8% (all isolates), 95.8-99.8% (clade A) and 99.3-

99.5% (clade B) [8].

Assuming that MLBVV evolved with lettuce within its domestication centre in

the Mediterranean region, greatest genetic diversity would be expected there. This

was reflected in the results with the 11 Spanish isolates which were in all sub-clades

apart from A1. Occurrence of Australian isolates within two sub-clades (A1 and A2)

suggests two separate introductions. Presence of European isolates in both of these

sub-clades might reflect introduction from there. Since few isolates from Asia and

South America have been sequenced so far, their occurrence only in sub-clades A1

and A2, respectively, presumably reflects insufficient sequencing rather than single

introductions. No African isolates have been sequenced and the two partial North

American CP sequences on GenBank (DQ182564 and DQ191062) [1] are too short

(409bp) to draw conclusions.

Navarro et al. [8] reported mean Dn/Ds ratios for MLBVV CP sequences of

0.095 (all 17 sequences), 0.153 (clade A) and 0.211 (clade B). Here, the mean Dn/Ds

ratios were 0.112 (all 36 complete CPs), 0.076 (Australian isolates), 00.187 (clade A)

and 0.063 (clade B). Thus, most nucleotide substitutions are silent, mean Dn/Ds ratios

<1 suggesting selection for amino acid conservation. As overall mean Dn/Ds ratio for

66

clade B was lower than for clade A, this suggests more positive selection pressure on

the nucleotide sequence of clade A. Navarro et al. [8] based their Dn/Ds ratio for

clade B on only three CP amino acid sequences which might explain the difference

between our ratio (0.063) and theirs (0.211).

The 39 amino acid CP sequences varied considerably between clades A and B,

especially in their N-terminus and central regions (Supplementary Table 1). There

were 93 amino acid substitutions across the entire sequence, 18 of which were only in

clade B. Of these 18, 14 were in all clade B isolates, two only in sub-clade B1 isolates

ALM4 and ALM1 (codons 114 and 215), and one each only in ALM1 (codon 181)

and sub-clade B2 isolate SON2 (codon 97). Codon 305 showed a change from Ile to

Val present in all isolates except MUR1, LP1 and LP2 in sub-clade A2 and all isolates

in clade B. The 13 Australian isolates had only eight substitutions overall, which,

unlike those in the other isolates, varied most in their C-terminal regions (codon

positions 287-414). These changes were in AUSE6 at codon 7; AUSF1 at codons 118,

287 and 414; AUSG2 at codon 291; AUSA2 at codon 329; AUSA1 at codon 338; and

AUSE1 at codon 390. Isolate AUSE2 had two substitutions which were common to

most sub-clade A2 isolates at codons 305 (Ile to Val) and 314 (Thr to Ile), but absent

from sub-clade A1.

Acknowledgements

We thank Stephen Wylie, Craig Webster, Rohan Prince and Denis Phillips for advice,

the State Agricultural Biotechnology Centre for laboratory facilities and local farmers

for allowing sampling. L.M. received an Australian Postgraduate Award Industry

from the Australian Research Council.

67

References

1. Hayes RJ, Wintermantel WM, Nicely PA, Ryder EJ (2006) Host resistance to

Mirafiori lettuce big-vein virus and Lettuce big-vein associated virus and virus

sequence diversity and frequency in California. Plant Dis 90:233-239

2. Kawazu Y, Sasaya T, Morikawa T, Sugiyama K, Natsuaki T (2003) Nucleotide

sequence of the coat protein gene of Mirafiori lettuce virus. J Gen Plant Pathol

69:55–60

3. Latham LJ, Jones RAC, McKirdy SJ (2004) Lettuce big-vein disease: sources,

patterns of spread, and losses. Aust J Agric Res 55:125-130

4. Maccarone LD, Barbetti MJ, Sivasithamparam K, Jones RAC (2010) Molecular

genetic characterization of Olpidium virulentus isolates associated with big-vein

diseased lettuce plants. Plant Disease 94:563-569.

5. Maccarone LD, Barbetti MJ, Sivasithamparam K, Jones RAC (2010) Comparison

of the coat protein genes of Lettuce big-vein associated virus isolates from

Australia with those of isolates from other continents. Arch. Virol. (in press) DOI.

10.1007/s00705-010-0641-0

6. Navarro JA, Botella F, Maruhenda A, Sastre P, Sanchez-Pina MA, Pallas V (2004)

Comparative infection progress analysis of Lettuce big-vein virus and Mirafiori

lettuce virus in lettuce crops by developed molecular diagnosis techniques.

Phytopathology 94:470-477

7. Navarro JA, Botella F, Maruhenda A, Sastre P, Sanchez-Pina MA, Pallas V

(2005a) Identification and partial characterisation of Lettuce big-vein associated

virus and Mirafiori lettuce big-vein virus in common weeds found amongst

Spanish lettuce crops and their role in lettuce big-vein disease transmission.

European J Plant Path 113:25-34

68

8. Navarro JA, Torok VA, Vetten HJ, Pallas V (2005b) Genetic variability in the coat

protein genes of Lettuce big-vein associated virus and Mirafiori lettuce big-vein

virus. Arch Virol 150:681-694

9. Roggero P, Ciuffo M, Vaira AM, Accotto GP, Masenga V, Milne RG (2000) An

ophiovirus isolated from lettuce with big-vein symptoms. Arch Virol 145:2629-

2642

10. Sasaya T, Koganezawa H (2006) Molecular analysis and virus transmission tests

place Olpidium virulentus, a vector of Mirafiori lettuce big-vein virus and Tobacco

stunt virus, as a distinct species rather than a strain of Olpidium brassicae. J Gen

Plant Pathol 72:20-25

11. van der Wilk F, Dullemans AM, Verbeek M, van den Heuvel JFJM (2002)

Nucleotide sequence and genomic organization of an ophiovirus associated with

lettuce big-vein disease. J Gen Virol 83:2869–2877

69

Table 1. Isolates of Mirafiori lettuce big-vein virus used in sequence comparisons

Virus isolate Accession

number

Isolate location Species

isolated from

Reference

LS301-0 AF525935 Netherlands Lettuce [11]

JPN1 AF532872 Hyogo, Japan Lettuce [2]

MUR1 AY366415 Murcia, Spain Lettuce [8]

GAL1 AY366416 Galicia, Spain Lettuce [8]

ALM1 AY366417 Almeria, Spain Lettuce [8]


GER3 AY581598 Frankfurt, Germany Lettuce [8]]

DEN1 AY581692 Denmark Lettuce [8]

HOL2 AY581693 Netherlands Lettuce [8]

UK1 AY581694 United Kingdom Lettuce [8]

GER1 AY581695 Fischenich, Germany Lettuce [8]

AUS1 AY581696 Western Australia Lettuce [8]

GER2 AY581697 Reskia, Germany Lettuce [8]

ITA1 AY581699 Italy Lettuce [8]




SON1 AY839624 Almeria, Spain Sowthistle [7]



SON4 AY839627 Almeria, Spain Sowthistle Unpublished

LP1 FJ864681 Argentina Lettuce Unpublished

LP2 FJ864680 Argentina Lettuce Unpublished

58 a DQ530358 Brazil Lettuce Unpublished

60 a DQ530357 Brazil Lettuce Unpublished

61 a

DQ530356 Brazil Lettuce Unpublished

AUSG2 GU193114 Perth, Western

Australia

Lettuce This study

AUSE3 GU193115 Perth, Western

Australia

Lettuce This study


Australia

Lettuce This study

AUSF1 GU193117 Perth, Western

Australia

Lettuce This study

AUSB2 GU193118 Perth, Western

Australia

Lettuce This study

AUSA1 GU193119 Perth, Western

Australia

Lettuce This study


Australia

Lettuce This study

AUSG1 GU193121 Perth, Western

Australia

Lettuce This study


Australia

Lettuce This study

AUSD1 GU193123 Perth, Western

Australia

Lettuce This study

AUSA2 GU193124 Perth, Western

Australia

Lettuce This study

AUSC1 GU193125 Perth, Western

Australia

Lettuce This study


Australia

Lettuce This study

a Partial MLBVV CP sequence

70

AUSA1

AUSE4

AUSB2

AUSE3

AUSE6

AUSF1

AUSG2

AUSE1

AUSD1

AUSA2

AUSG1

AUSC1

AUS1

GER1

LS301-O

JPN1

HOL2

UK1

DEN1

GER2

A1

LP1

LP2

MUR1

ALM2

ITA1

GER3

ALM3

GAL1

AUSE2

58

60

61

A2

A1

ALM4

ALM1B1

SON1

SON4

ALM5

SON3

SON2

B2

B

99

99

97

75

99

55

98

99

77

99

99

99

66

66

60

99

99

58

74

84

61

71

0.01

CPsV

0.2

Fig 1: Phylogenetic relationships among complete coat protein (CP) nucleotide

sequences of 36 Mirafiori lettuce big-vein virus (MLBVV) isolates from Australia,

Europe, Japan and South America, and three partial MLBVV CP sequences from

Brazil. Trees generated using MEGA 4.1 using the default parameters. Tree branches

were bootstrapped with 1000 replications. Numbers at nodes indicate bootstrap scores

>50%. The scale bar represents a genetic distance of 0.01 for horizontal branch

lengths. For isolate designations, see Table 1. Inset shows isolates rooted with Citrus

psorosis virus (CPsV), accession number AF036338

71

Chapter 5 - Comparison of the coat protein genes of Lettuce

big-vein associated virus isolates from Australia with those of

isolates from other continents

Linda D. Maccarone1, Martin J. Barbetti

1, Krishnapillai Sivasithamparam

1,

Roger A. C. Jones1,2,3

1School of Plant Biology, Faculty of Natural and Agricultural Sciences, University of

Western Australia, Stirling Highway, Crawley, WA 6009, Australia

2Agricultural Research Western Australia, Department of Agriculture and Food

Western Australia, Locked bag No.4, Bentley Delivery Centre, WA 6983, Australia

3Corresponding author email: [email protected]

Summary

The complete coat protein (CP) nucleotide sequences of seven Lettuce big-vein

associated virus (LBVaV) isolates from Australia were compared to those of 22 other

LBVaV and five tobacco stunt virus (TStV) isolates. On phylogenetic analysis, clade I

contained only LBVaV isolates from Europe, sub-clade IIa only Australian LBVaV

isolates, IIb only Japanese LBVaV isolates, and IIc only TStV isolates from Japan. In

the amino acid sequences deduced, the central region of the gene was most divergent.

Mean Dn/Ds ratios were 0.283 and 0.124 for clades I and II, respectively. The

suggestion that TStV is a strain of LBVaV was supported.

72

Lettuce big-vein associated virus (LBVaV) and tobacco stunt virus (TStV) belong to

the genus Varicosavirus of which LBVaV is type species [1]. LBVaV was formerly

considered the cause of lettuce big-vein disease (LBVD) [16] until another virus

occurring in mixed infection, Mirafiori lettuce big-vein virus (MLBVV; genus

Ophiovirus), was found responsible for the symptoms [5, 7]. TStV infects tobacco

causing severe symptoms [4]. LBVaV and TStV have rod shaped particles 320-360

(LBVaV) or 300-340 (TStV) nm in length [4, 16]. Both have a CP 1194 nucleotides

long that codes for 397 amino acids [12] and are serologically related [4, 16]. Both

were considered different species despite their similar morphology, serology and

vector relationships because TStV does not to infect lettuce but infects tobacco whilst

LBVaV does the opposite [4]. Subsequently, Sasaya et al. [12] suggested that TStV

is a tobacco infecting strain of LBVaV. TStV and MLBVV are transmitted by the

chytrid Olpidium virulentus [13]. Sasaya et al. [12] reported that the complete

nucleotide and amino acid CP sequence identities between eight LBVaV and five

TStV isolates were 95.6-96.5% and 97.2-98.7%, respectively. When Navarro et al. [9]

analysed the CP sequences of 17 LBVaV isolates, they found identities of 95.2-99.8%

(nucleotides) and 98-100% (amino acids), and when they subjected 13 complete and

four partial LBVaV CP sequences to phylogenetic analysis, three isolate groupings

were found. This paper compares the CPs of seven previously unreported isolates

from Australia with those of 30 LBVaV and five TStV isolates from different

continents.

Lettuce leaves with LBVD symptoms were sampled from four farms (A, B, E

and G) in the northern Perth Metropolitan region, south-west Australia. Seven

samples were collected, one each from A and G, two from B and three from E. On the

collection day, each sample was ground in liquid nitrogen before storage at -20°C

73

before RNA extraction. Total RNA was extracted from each sample using an

UltraClean™ Plant RNA Isolation Kit (MoBio Laboratories, Inc.) according to

manufacturer‟s instructions. RNA extracts were stored at -80°C. Primer pairs specific

for the CP of LBVaV (fwd L1-21 5' ATG GCA CCC CAA ATT GAA G 3', rev

L700-679 5' GTG CAT GCC AGT GCT GGC AAG 3' and fwd L511-5 31 5' AGA

CCG AGT ATC CAT TCA AG 3', rev L1210-1185 5' TCA CTC CTT CAC TGG

TGT CTC TCC C 3') were developed by aligning known CP sequences from

GenBank in Bioedit. To amplify the entire CP sequence, both primer sets were used

on each sample. Reverse Transcription PCR (RT-PCR) was done using a OneStep

RT-PCR kit (Qiagen, Australia) according to manufacturer‟s instructions. PCR

amplification conditions consisted of 50°C for 30 min, 95°C for 15 min, followed by

30 cycles of 94°C for 1 min, 57°C for 1 min, 72°C for 1 min, then a final extension at

72°C for 10 min before being held at 14°C. PCR amplicons were visualised by

electrophoresis on 1% agarose gels. Tris-boric acid-EDTA (TBE) electrophoresis

buffer was used [10].

PCR amplicons were purified by ethanol precipitation and quantified using a

Nanodrop UV-Vis spectrophotometer following the manufacturer‟s protocol.

Standard ligation and transformation reactions were done into JM109 competent cells

using a pGEM®-T Easy Vector (Promega Corp, Madison, Wisconsin) as

recommended by the manufacturer. Screening for recombinant plasmids used M13

primers: M13 fwd (5' CGT CAG GCT TTT CCC AGT CAC GAC 3') and M13 rev (5'

TCA CAC AGG AAA CAG CTA TGA C 3'). Amplification conditions were 1 min

denaturation at 94°C followed by 25 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C

for 30 sec before being held at 14°C. Recombinant plasmids were inoculated into 5

mL of Luria-Bertani (LB) broth with ampicillin (100 mg/L) and incubated on a shaker

74

at 37°C overnight. The plasmid was then purified from the culture using an Aurum™

Bio-Rad Plasmid Extraction Kit following the manufacturer‟s protocol. Presence and

size of inserts was confirmed with a restriction digest of purified plasmid DNA by

EcoR1 (10 µL of purified plasmid DNA, 2 µL of 10 x EcoR1 buffer, 1 µL of EcoR1

and 7µ L of water). Dideoxy-termination sequencing was done at the State

Agricultural Biotechnology Centre (SABC), Murdoch University using BigDye

terminator V3.1 chemistry and an Applied Biosystems/Hitachi 37030 DNA Analyser.

The complete CP sequences of each isolate were submitted to GenBank (Table 1).

One clone was sequenced per isolate.

The complete CP genes of the seven new Australian LBVaV isolates

contained one ORF 1194 bp in length that coded for 397 amino acids. In addition, 22

complete and eight partial CP sequences of other LBVaV isolates and complete CP

sequences of five TStV isolates were retrieved from GenBank (Table 1). The partial

sequences were four from Brazil [DQ530352 (889 bp), DQ530353 (882 bp),

DQ530354 (866 bp) and DQ530355 (876 bp)] and one each from USA (AY496053),

UK (AY496054), Netherlands (AY496056) and Australia (AY496055) (all 1010bp in

length). Complete CP nucleotide sequences AB050272 (isolate LBVaV-CP) and

AB114138 (isolate Ka), both from Kagawa Japan, were identical so only the former

was included. A partial LBVaV sequence from Salinas, California (DQ182566) was

excluded as it was only 302 bp [2]. The 34 complete LBVaV and TStV CP sequences

were assembled and analysed using Molecular Evolutionary Genetics Analysis

(MEGA) program Version 4.1 with Clustal W [15] and bootstrapped with 1000 re-

samplings [14]. These sequences were analysed in direct pairwise comparisons to

establish percentage identities. Evolutionary history was inferred by the Neighbour-

Joining method. Evolutionary distances between nucleotide sequences were computed

75

using the Maximum Composite Likelihood method. This was done first with the 29

complete CP sequences of LBVaV and five of TStV, and then repeated to include the

eight partial sequences after trimming complete sequences to reflect the length of the

partial sequences. Evolutionary distances of deduced amino acid sequences were

computed for the complete CP sequences using the Poisson correction method in

MEGA4.1. Any positions containing gaps and missing data were eliminated.

Nucleotide substitutions for the CP region were inferred using the SLAC model [3].

Next, the mean number of non-silent substitutions (Dn) and silent substitutions (Ds),

and Dn/Ds ratios were determined to assess the selective constraints on the CP gene

[3]. Dn/Ds ratios for the sequences of complete CP genes were estimated first for the

seven Australian isolates alone and then for all complete nucleotide sequences.

The sequence identities of the seven new Australian isolates were 95.6-99.7%

(nucleotides) and 98.2-99.7% (amino acids). They formed a geographically distinct

group most closely related to each other and to LBVaV isolates from Japan. The

complete sequence identities of all 29 isolates of LBVaV and five of TStV ranged

from 93.6-99.7% (nucleotides) and 94.3-100% (amino acids). These values for both

nucleotide and amino acid sequence identity were the same when comparing the 29

LBVaV isolates alone. The sequence identities of the five TStV isolates alone were

95.7-99.7% (nucleotides) and 97.2-100% (amino acids). LBVaV isolate UK2 was

most divergent with 93.6% identities to Japanese LBVaV Hy and TStV Na isolates.

These sequence identities resemble those reported previously [9, 12]. Thus, our data

showing that the CP of LBVaV and TStV is highly conserved confirmed data from

previous work with fewer isolates and supported TStV being a strain of LBVaV [12].

When the complete CP nucleotide sequences (29 of LBVaV and five of TStV)

were subjected to phylogenetic analysis, all were within two clades (I and II), II being

76

resolved into three distinct sub-clades (IIa-c) (Fig. 1A). All clades and sub-clades

were geographically distinct as regards the origins of the isolates within them. Clade I

contained 12 lettuce and six sowthistle isolates of LBVaV, all from Europe. Within

clade II, sub-clade IIa only contained the seven new Australian LBVaV isolates, IIb

the four LBVaV isolates, and IIc the five Japanese TStV isolates. Sub-clades IIb and

IIc were closer to each other than to sub-clade IIa containing Australian isolates. The

groupings obtained not only agreed with the three groupings of Sasaya et al. [12], (i)

five TStV isolates, (ii) four Japanese LBVaV isolates and (iii) four Spanish LBVaV

isolates, but also added 16 extra European isolates to (iii) and revealed a new

grouping containing only Australian isolates. Our findings also agree with those of

Navarro et al. [9] in which, apart from one Japanese LBVaV isolate, the only

complete CP sequences examined were 12 from Europe. Moreover, in our study,

inclusion together in one analysis of the complete CP sequences of seven additional

isolates with those of all other 27 isolates now available on GenBank allowed greater

resolution revealing presence of two clades, and three sub-clades containing isolates

from geographically distant regions (Europe, Japan, Australia). In addition, although

lettuce isolates were present in both clades and two of the three sub-clades, sowthistle

isolates (SON1-5) were all together in one clade (I), while tobacco isolates were

isolated within a sub-clade of their own (IIc). When the eight partial CP sequences

were added to the 34 complete sequences and aligned, the single sequences of

Brazilian isolate 106 and those from Australia and the Netherlands all grouped with

the Australian isolates within sub-clade IIa (Fig. 1B). The other three Brazilian

sequences and the UK and USA sequences were in clade I, the latter being most

closely related to UK2, but the former to Spanish isolates SON1 and GAL1. None

grouped with sub-clades IIb or IIc.

77

Assuming that LBVaV evolved with lettuce in its centre of domestication in

the Mediterranean region, greatest genetic diversity would be expected there. This

was reflected in the results with the 17 Spanish isolates. Occurrence of all Australian

sequences within the same sub-clade (IIa) suggests only one introduction of LBVaV

into Australia since European settlement approximately 200 years ago. Presence of a

partial CP sequence from the Netherlands in this sub-clade might reflect its

introduction from Europe. Occurrence of only Japanese LBVaV sequences in sub-

clade IIb and Japanese TStV sequences in sub-clade IIc suggests two introductions to

Japan, but does not indicate their origin. Cultivated tobacco is from the Americas but

TStV has not been found there as yet. Further complete CP sequences of LBVaV

from North America, South America, Asia (outside Japan) and Europe (outside Spain)

would help identify the geographical origins of isolates found in different parts of the

world. Identification and sequencing of TStV isolates from countries other than Japan

would do the same for the tobacco form of LBVaV. Further sequencing might also

permit resolution of clade I into 2-3 sub-clades (Fig. 1B).

When the 34 complete amino acid sequences were compared, the central

region of the CP gene was most divergent with few amino acid substitutions towards

the N-terminus and C-terminus regions (Table 2). When the partial sequences were

included, there were 79 amino acid substitutions across the entire CP of 397

nucleotides, the partial sequences contributing an additional four. Forty six of these

substitutions occurred between amino acid positions 200 and 300. Among the isolates

in clade I, there were 55 amino acid substitutions over the entire CP gene sequence

and 48 of them were unique. There were 39 substitutions between positions 200 and

300. There were 31 amino acid substitutions in clade II which were relatively evenly

spread throughout the CP gene except for a cluster at the C-terminus. The Australian

78

LBVaV isolates in sub-clade IIa showed 13 amino acid substitutions, 10 of which

were found only in sub-clade IIa; six substitutions were in a cluster between positions

214 and 243. The Japanese LBVaV isolates in sub-clade IIb showed seven amino acid

substitutions, those at positions 110, 183 and 394 being unique. In sub-clade IIc, there

were 13 amino acid substitutions nine of which were unique, those at positions 53, 97,

183 and 393 being present in all isolates.

Navarro et al. [9] reported a mean Dn/Ds ratio of 0.132 for LBVaV CP gene

sequences. In our study, a mean Dn/Ds ratio of 0.187 was obtained for all 34 complete

CP sequences indicating that the majority of the nucleotide substitutions were silent.

The mean Dn/Ds ratios for clades I and II were 0.283 and 0.124 respectively, while

those for sub-clades IIa, IIb and IIc were 0.274, 0.060 and 0.156, respectively. Mean

Dn/Ds ratios <1 suggest selection for amino acid conservation. Genome conservation

is expected as genetic stability is commonly seen in natural plant virus populations so

the low mean Dn/Ds ratios in clades I and II reflect selection against nucleotide

changes causing amino acid substitutions, especially in sub-clades IIb and IIc. There

were 74 amino acid substitutions in the complete CP sequences, 52 were in clade I.

with 47 of them being unique. This greater level of amino acid substitution could also

explain the higher Dn/Ds ratio for clade I. Similarly, the greater Dn/Ds ratio for sub-

clade IIa might be explained by 10 of the 13 amino acid substitutions in the complete

CP sequences being unique to this sub-clade. Only three unique amino acid

substitutions were found in sub-clade IIb which had the lowest Dn/Ds ratio. The CPs

of vector-borne plant viruses are subject to greater stabilising selection than those of

viruses transmitted otherwise because interaction between the CP and cellular

receptors on vectors places greater selective constraint on the amino acid sequence

than host-virus interactions. For example, in Melon necrotic spot virus vectored by

79

Olpidium bornovanus just one amino acid substitution from Ile to Phe at position 300

resulted in loss of specific binding and fungal transmission as the CP acts as a ligand

to the vector zoospore [6]. A similar scenario might also occur within LBVaV,

explaining its high degree of CP sequence conservation.

Acknowledgements

We thank Stephen Wylie, Craig Webster and Denis Phillips for advice, the SABC for

laboratory facilities and local farmers for allowing sampling. Linda Maccarone

received an Australian Postgraduate Award from the Australian Research Council.

References

1. Brunt AA, Milne RG, Sasaya T, Verbeek M, Vetten HJ, Walsh JA (2005)

Varicosavirus. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA (eds)

Virus Taxonomy. Eighth Report of the International Committee on Taxonomy of

Viruses. Elsevier/Academic Press, London, pp. 669-671

2 Hayes RJ, Wintermantel WM, Nicely PA, Ryder EJ (2006) Host resistance to

Mirafiori lettuce big-vein virus and Lettuce big-vein associated virus and virus

sequence diversity and frequency in California. Plant Dis. 90:233-239

3. Kosakovsky-Pond SL, Frost SDW (2005) Datamonkey: rapid detection of selective

pressure on individual sites of codon alignments. Bioinformatics 21:2531-2533

4. Kuwata S, Kubo S (1986) Tobacco stunt virus. no 313Association of Applied

Biologist, Wellesbourne, UK, p4

80

5. Lot H, Campbell RN, Souche S, Milne RG, Roggero P (2002) Transmission by

Olpidium brassicae of Mirafiori lettuce virus and Lettuce big-vein virus, and their

roles in lettuce big-vein etiology. Phytopathology 92:288–293

6. Mochizuki T, Ohnishi J, Ohki T, Kanda A, Tsuda S (2008) Amino acid substitution

in the coat protein of Melon necrotic spot virus causes loss of binding to the surface of

Olpidium bornovanus zoospores. J. Gen. Plant Pathol. 74:176-181

7. Navarro JA, Botella F, Maruhenda A, Sastre P, Sánchez-Pina MA Pallas V (2004)

Comparative infection progress analysis of Lettuce big-vein virus and Mirafiori

lettuce virus in lettuce crops by developed molecular diagnosis techniques.


8. Navarro JA, Botella F, Marhuenda A, Sastre P, Sánchez-Pina MA, Pallas V (2005a)

Identification and partial characterisation of Lettuce big-vein associated virus and

Mirafiori lettuce big-vein virus in common weeds found amongst Spanish lettuce

crops and their role in lettuce big-vein disease transmission. Eur. J. Plant Path.

113:25-34

9. Navarro JA, Torok VA, Vetten HJ, Pallas V (2005b) Genetic variability in the coat

protein genes of Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus.

Arch. Virol. 150:681-694

10. Sambrook J, Russell DW (2001) Molecular cloning: A laboratory manual. Cold

Spring Harbour Laboratory Press, New York

11. Sasaya T, Ishikawa K, Koganezawa H (2001) Nucleotide sequence of the coat

protein gene of Lettuce big-vein virus. J. Gen. Virol. 82:1509-1515

12. Sasaya T, Ishikawa K, Kuwata S, Koganezawa H (2005) Molecular analysis of

coat protein coding region of tobacco stunt virus shows that it is a strain of Lettuce

big-vein virus in the genus Varicosavirus. Arch. Virol. 150:1013-1021

81

13. Sasaya T, Koganezawa H (2006) Molecular analysis and virus transmission tests

place Olpidium virulentus, a vector of Mirafiori lettuce big-vein virus and Tobacco

stunt virus, as a distinct species rather than a strain of Olpidium brassicae. J. Gen.

Plant Pathol. 72:20-25

14. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary

Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596-1599

15. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting,

position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-

4680

16. Vetten HJ, Lesemann DE, Dalchow J (1987) Electron microscopical and

serological detection of virus-like particles associated with lettuce big vein disease. J.

Phytopathol. 120:53-59

Figure Legend

Fig. 1. Phylogenetic relationships among complete coat protein (CP) nucleotide

sequences of 29 Lettuce big-vein associated virus (LBVaV) isolates from Europe,

Australia and Japan, and five tobacco stunt virus (TStV) isolates from Japan (A), and

these same sequences with eight partial LBVaV CP sequences included (B). Trees

generated with MEGA 4.1 using default parameters. Tree branches were bootstrapped

with 1000 replications. Numbers at nodes indicate bootsrap scores >50% (a) or all

scores (b). The scale bar represents a genetic distance of 0.005 for horizontal branch

lengths. For isolate designations, see Table 1. Inset shows isolates rooted with

sonchus yellow net virus (SYNV), accession number M17210.

82

Table 1 Isolates of Lettuce big-vein associated virus (LBVaV) and tobacco stunt virus (TStV)

used in sequence comparisons.

Virus isolate Accession

number

Geographic Origin Species

isolated

from

Reference

LBVaV-CP* AB050272* Kagawa, Japan lettuce [9, 11, 12]

No2† AB190521 Takamatsu, Japan tobacco [12]

No89† AB190522 Chunan, Japan tobacco [12]

No88† AB190523 Chunan, Japan tobacco [12]

Kan† AB190524 Kannonji, Japan tobacco [12]

Na† AB190525 Fukue, Japan tobacco [12]

A AB190526 Kannonji, Japan lettuce [12]

Hy AB190527 Nandan, Japan lettuce [12]

Wa AB190528 Hiochigawa, Japan lettuce [12]

MUR1 AY366411 Murcia, Spain lettuce [9]

GAL1 AY366412 Galicia, Spain lettuce [9]

ALM1 AY366413 Pulpi, Almeria, Spain lettuce [9]


USA** AY496053 Salinas, California, USA lettuce [9]

UK** AY496054 Wellesbourne, UK lettuce [9]

AUS** AY496055 Perth, south-west

Australia

lettuce [9]

NL** AY496056 De Lier, The Netherlands lettuce [9]






GRA1 AY581689 Granada, Spain lettuce [9]

UK2 AY581690 UK lettuce [9]

MUR2 AY581691 Aguilas, Murcia, Spain lettuce [9]

SON1 AY581681 Almeria, Spain sowthistle [8]




SON5 AY839622 Granada, Spain sowthistle [8]

SON6 AY839623 Granada, Spain sowthistle [8]

107** DQ530352 Bauru, Brazil lettuce Unpublished

104** DQ530353 Campinas, Brazil lettuce Unpublished

105** DQ530354 Bauru, Brazil lettuce Unpublished

106** DQ530355 Mogi das Cruzes, Brazil lettuce Unpublished

AUSE4 GU220721 Perth, south-west

Australia

lettuce This Study


Australia

lettuce This Study

AUSA5 GU220723 Perth, south-west

Australia

lettuce This Study

AUSB1 GU220724 Perth, south-west

Australia

lettuce This Study

83

AUSB2 GU220725 Perth, south-west

Australia

lettuce This Study

AUSG1 GU220726 Perth, south-west

Australia

lettuce This Study


Australia

lettuce This Study

*Complete LBVaV CP nucleotide sequences AB050272 (isolate LBVaV-CP) and

AB114138 (isolate Ka), both from Kagawa in Japan, were identical.

**Partial LBVaV CP sequences.

† TStV isolates.

84

Table 2 Variable amino acid positions in the coat protein (CP) encoding region of 37

Lettuce big-vein associated virus (LBVaV) isolates and five tobacco stunt virus

isolates.

1111111112 2222222222 2222222222 2222222222 2222233333 33333

1566899 0112267890 0000001111 1112222233 3444456667 7788956678 99999

7890379379 2066935391 2357890123 4790378956 7358904690 6734927999 12345

ALM2 KMLEVRIDKT VADVIQPTYG TLRLYALGDV TRTEFLANIP QLITTATMKK LSDNFKNMED GETPV

SON5 .......... .......... ....FR..N. Q.IK...... .......... .......... .....

SON4 .......... .......... I...LRF... .....FP... .......... .......... .....

SON3 .......... .....P.... ...F...... .....F.... .......... .......... .....

SON6 .......... ........F. ..G....E.. ..I.L..... .......... .......... .....

SON2 .......... .......... A......E.. .......... .......... .......... .....

GRA1 .......... .......... ......V... ..S....S.. .......... .......... .....

ALM1 .......... .......... A......... .......... .......... .......... .....

ALM3 .......... .......... .......... .......... .......... .......... .....

MUR1 .......... .......... .......... .......... ..L....... .......... .....

ALM4 .......... .......... .......... .......... .......... .......... .Q...

ALM7 .......... .......... .......... .......... ......A... .......... .....

ALM6 .......... .......... .......... .G........ .......... .......... .....

ALM5 .......... ......S..R .......... .......... .......... .......... A....

UK2 .I........ L.NA...... .......... .......... .......... .........N .....

UK -----..... ...A...... .......... .......... ....A..... .....----- -----

USA -----..... ...A...... .......... .......... .......... .....----- -----

MUR2 .......... .......... ......F.NG A..G...... ..SA.G.VIE RNV.L.S..N .....

104 -----.M... ...A...... .......... A......... .......... .....----- -----

105 -----GM... ...A...... .......... A......... .......... .....----- -----

107 -----....A ...A...... .......... A......... .......... .....----- -----

SON1 R......... ...A...... .......... A......... ...S...... V........N .....

GAL1 R......... ...A...... .......... A......... .......... .........N .....

AUSE4 .......... .D.A...... .......... A......STS E......... ........GN .....

AUSE5 .......... .D.A...... .......... A......STS E......... .........N .....

AUSA5 .......... .D.A...... .......... A......S.. .......... .........N .....

AUSB1 .........A .V.A...... .......... A......... .......... .........N ....E

AUS -----..... .D.A...... .......... A......... .......... .....----- -----

NL -----..G.. .D.A...... .......... A......... .......... .....----- -----

106 -----GM... .D.A...... .......... A......... .......... .....----- -----

AUSB2 .......... .D.A...... .......... A......... .......... .........N .....

AUSG1 ..P......A .V.A...... .......... A......S.. .P........ .........N .....

AUSE6 ...D.....A .V.A...... .......... A......S.. .......... .........N .....

Wa ...D...... .P.A...N.. .......... A......... .......... .........N .....

Hy ...D...... .P.A...N.. .......... A......... .......... .........N ...S.

A ...D...... .P.A...N.. .......... .......... .......... .........N .....

LBVaV-CP...D...... .P.A...N.. .......... A......... .......... .........N .....

Na ...DA...R. ...A...A.. .F........ A......... .......... ...T.....N ..A..

Kan ...DA...R. ...A...A.. .......... A......... .......... .........N ..A..

No88 ...DA...R. ...A...A.. .......... A......... .......... .....E.V.N ..A..

No89 ...DA...R. ...A...A.. .......... A......... .......... .........N ..A..

No2 ...DA...R. ...AT..A.. .......... A......... .......... .........N ..A.. * Numbers vertically positioned above the sequence alignment indicate positions of the LBVaV CP and TStV

CP amino acid residues. The consensus sequence is shown by isolate ALM2 and amino acid residues that are

different from the consensus are indicated, whereas amino acid residues that are identical to the consensus are

marked with dots. Partial sequences for which there is no amino acid sequence information available are marked

with dashes.

Amino acid substitution sites *

I

IIa

IIb

IIc

85

Fig. 1A

SON5

SON4

SON3

SON6

SON2

GRA1

ALM1

ALM3

MUR1

ALM4

ALM7

ALM6

ALM2

ALM5

UK2

MUR2

SON1

GAL1

I

AUSE4

AUSE5

AUSA5

AUSB1

AUSB2

AUSG1

AUSE6

IIa

Wa

Hy

LBVaV CP

A

IIb

Na

Kan

No88

No89

No2

IIc

II 87 50

100

93

81

55

100

100

99

99

94

98

85

62

96

86

96

74

62

64

66

98

63

65

50

52

0.005

SYNV

0.1

86

Fig. 1B

SYNV

0. 2

AUSE4

AUSE5

AUSA5

AUSB1

AUS

NL

106

AUSB2

AUSG1

AUSE6

IIa

Wa

Hy

A

LBVaV CP

IIb

Na

Kan

No88

No89

No2

IIc

II

UK2

UK

USA

ALM2

ALM5

ALM4

ALM6

MUR1

ALM7

ALM3

ALM1

GRA1

SON6

SON2

SON3

SON5

SON4

105

107

SON1

104

GAL1

MUR2

85 49

100

65

46

54

100

100

73 94

98

97

86

51

54

56

83

92

73

69 99

78

84

83

77

64

69

68

44

70

69

93

47

29

62

45

0.005

I

87

Chapter 6 – Commercial Lettuce Seedling Nurseries

6. 1 Introduction

Western Australia is unique in that its isolation from the other areas of Australia by

desert and distance means that many plant pathogens either do not occur or can be

eradicated following their introduction (McKirdy et al. 2001; Woods et al. 2001 and

Mackie et al. 2002). However, many important soil-borne pathogens of commercial

horticultural crops such as Phytophthora spp. and Pythium spp. and the vector and

viruses that cause LBVD are already well established (Davison et al. 2006; Latham et

al. 2004). For example, Phytophthora cinnamomi, the causal agent of jarrah (Eucalyptus

marginata) dieback is a soil-borne plant pathogen that is spread through contamination

from within nursery environments by motile zoospores in water, infested potting mix

and soil, dust on seed for propagation material, mud on vehicle tyres and on cultivation

implements (Sivasithamparam and Goss 1981). In order to prevent spread of pathogens

both within the nursery and onto producer‟s farms, there is a need to use seed that is

free from spore contamination, sterilised potting mixes, new or sterilised pots and

containers, free draining benches to grow plants and water decontaminated by

chlorination or exposure to ultra-violet light before coming into contact with plants

(Sivasithamparam and Goss 1981).

O. virulentus (the Chytrid vector of LBVaV and MLBVV) is holocarpic and produces

many zoosporangia and resting spores in the root tissue of infested host plants. The

zoosporangia of O. virulentus release posteriorly-uniflagellate zoospores that are motile

88

within water that is trapped between roots and soil particles. These zoospores are able to

infect roots of other host plants (Campbell 1996). The resting spores of O. virulentus

contaminate the soil when roots of infested plants die and decay and these resting spores

can remain viruliferous in the soil for up to 20 years (Campbell 1985). In lettuce

(Lactuca sativa) seedling nurseries, LBVD is spread particularly when seedling trays

are not placed on free-draining benches as the water laying on benches gives the

viruliferous O. virulentus zoospores the ability to move and infect seedlings in

neighbouring trays (Jones 2004).

On the Swan Coastal Plain of south-west Australia, most of the commercial lettuce

growing farms source their seedlings from three major lettuce seedling producers rather

than direct seeding or growing and transplanting their own seedlings. Latham et al.

(2004) reported that a lettuce seedling nursery was inadvertently on-selling LBVD

infected lettuce seedlings to commercial lettuce growers. They recorded up to 31%

incidence of LBVD on lettuce seedlings purchased from this seedling nursery. LBVD

was also evident in „bait‟ plants grown in potting mix and dirt collected from under the

nursery benches. While LBVD was detected in nursery potting mix nine weeks after

composting, no evidence was found of LBVD contamination on seedling trays, peat or

pelleted seed. It was also found that the potting mix imported to prepare the composted

final commercial mix in which seeds are sown was also contaminated.

Mature lettuce seed has three distinguishable layers, the pericarp which is the outermost

layer containing longitudinal „ribs‟ which is made out of sclerenchymatous tissue, the

integument which is also made up of dead cells and is only a few cell layers thick, and

the innermost layer, the endosperm, that tightly surrounds the embryo and is only two

89

cell layers thick (Borthwick and Robbins 1928; Paulson and Srivastava 1968; Jones,

1974; Nijsse et al. 1998) (Fig. 6.1 and Fig. 6.2). O. virulentus resting spores are able to

be carried by dust and have to potential to contaminate the seed coat of lettuce (Jones

2004) by lodging amongst the many „ribs‟ on the seed coat (Fig. 6.2).

Lettuce seedling nurseries compost a mixture of imported potting mix and peat for

various amounts of time allowing the temperature of the compost to reach a maximum

of 65°C. The nurseries surveyed make their final compost mix and then mix with peat to

make their commercial mix into which the lettuce seeds are sown. Seedling trays are

treated with chlorine and pelleted lettuce seeds are sown. With pelleting, lettuce seeds

are coated with an inert substance which gives them a round uniform shape and makes

them easier to handle. The seedling trays are placed in a 16-17°C growth chamber

maintained with 80% humidity for 48h. Lettuce seedlings are then grown outdoors from

the cotyledon stage onwards and watered daily.

Given the rapidly growing urban sprawl occurring in the outer metropolitan region of

Perth, vegetable producers are moving further from the city and cultivating virgin land.

In order to prevent the spread of LBVD onto these virgin lands, which have never

grown lettuce, an efficient integrated disease management strategy, such as the one

developed by Jones (2004), is needed and requires lettuce seedling nurseries to sell an

LBVD-free product to commercial lettuce growers. This chapter examines a lettuce

seedling nursery for the presence of LBVD and also investigates the possible seed coat

contamination of lettuce seeds by viruliferous O. virulentus resting spores.

90

Fig. 6.1: Schematic drawing of a lettuce seed showing the three layers surrounding the

embryo, endosperm, integument and „ribs‟ on the pericarp. Adapted from Nijsse et al.

(1998).

Fig. 6.2: Lettuce seed viewed under a light microscope at 4×magnification showing the

„ribs‟ on the seed coat. Scale bar represents 100.0µm

Pappus

P ericarp

Embryo

Integument

Endosperm

3.8mm

91

6.1.1 Aims

The aims of this study were to:

Determine the presence of LBVaV and MLBVV on commercial lettuce growing

farms in the Swan Coastal Plain of south-west Australia by testing samples by

DAS-ELISA.

Determine the presence of LBVaV and MLBVV in a commercial seedling

nursery in the Perth metropolitan region by testing samples by DAS-ELISA and

PCR.

Determine whether transmission of LBVD occurs through lettuce seed coat

contamination by resting spores of viruliferous O. virulentus by: a) detecting the

presence of LBVaV and/or MLBVV on the surface of lettuce seeds b)

determining whether sowing infected seed can result in infection with LBVaV

and/or MLBVV in lettuce plants grown from seeds harvested from LBVD-

infected plants.

92

6.2 Materials and Methods

6.2.1 Field collection of samples

Samples used were collected in the winter growing season of 2006 in south-western

Australia. Fourteen different commercial lettuce growing properties were visited and

sampled and 26 leaf samples taken in total. In each instance one whole lettuce leaf

represented one sample. The lettuce growing farms were assigned letter codes to protect

their anonymity (Table 6.3). Eleven of the commercial lettuce growing properties were

located in the Wanneroo to Gingin region up to 98km north of the Perth Central

Business District (CBD), two in the Peel region up to 43km south of the Perth CBD and

at Manjimup located approximately 300km south of the Perth CBD. In addition, four

lettuce plants of unknown origin, but showing LBVD symptoms (Fig. 6.3), were

purchased from a local supermarket and also tested. Of all the lettuce leaf samples

collected, three were coloured fancy lettuce cv. Lollo Rossa, 18 were crisphead/iceberg

type lettuce of unknown cultivar and three were cos type lettuce of unknown cultivar. In

addition, two leaf samples from separate S. oleraceous plants growing amongst a lettuce

crop from farm H, in which LBVD was evident, were also sampled. Leaf samples were

kept in separate zip lock bags and stored at 4°C until tested.

93

Fig 6.3: An example of a field grown crisphead type lettuce from which a leaf sample

was taken. The arrow points to obvious vein chlorosis. This particular plant was grown

in a field on Farm A.

6.2.2 Collection of soil samples from a commercial seedling nursery

One commercial seedling nursery in the Perth Metropolitan region was sampled once in

2006. The lettuce seedling nursery was also assigned a code to protect its anonymity

and will be described only as Nursery 1. No lettuce tissue samples were taken from the

nursery, rather soil and compost which could provide an inoculum source. In addition,

samples of the final compost, commercial mix and soil samples from two lettuce

seedling growing areas were all randomly taken. The samples were collected into large

bags and stored at room temperature until used. Of the two lettuce seedling growing

areas sampled, one was described as the „lettuce area‟ and had been used for growing

lettuce for between 8 and 10 years whilst the other was described as the „newer area‟

and had been used for growing lettuce seedlings for approximately two years.

94

6.2.3 Growth of lettuce seedlings in nursery soil samples

Lettuce cv. Great Lakes seeds were sown into the soil samples collected from the

nursery in 140mm pots. At least three seeds were sown per pot and once germination

has occurred, the seedlings were culled to one seedling per pot. The pots were kept in an

environment controlled growth facility at the University of Western Australia and

maintained on free draining benches at 18°C day/13°C night with a 12 hour

photoperiod. The youngest leaf of each of the seedlings was sampled five weeks after

sowing and then tested by either DAS-ELISA or PCR for both LBVaV and MLBVV.

Four lettuce seedlings grown in the final compost and six lettuce seedlings grown in the

commercial mix were tested by PCR, whilst five lettuce seedlings grown in soil

collected from the „newer lettuce growing area‟ were tested by DAS-ELISA. Four

lettuce seedlings grown in soil collected from the „lettuce growing area‟ were tested by

both PCR and DAS-ELISA. Appropriate controls for this experiment are described in

6.2.13.

6.2.4 Source of seed

The seeds used in these experiments came from two separate sources. Source 1: the

seeds used for PCR detection of LBVaV and MLBVV on the seed surface came from

lettuce cv. Lollo Rossa plants which were grown a glasshouse (Fig 6.4) which had all

previously tested positive for both LBVaV and MLBVV by PCR. Source 2: seeds

collected from lettuce cv. Great Lakes plants, that had been grown in soil infested with

LBVD collected from commercial lettuce Farm A, were used in the soil bioassay. The

lettuce plants from both sources used for seed production were grown in the same

95

conditions as those described in 6.2.3 above. For use as a negative control, seeds were

also collected from lettuce cv. Great Lakes plants that had been grown in sterilised

potting mix and had shown no visible symptoms of LBVD. Both LBVaV and MLBVV

were previously detected by PCR in the plants which were grown in LBVD-infested soil

but not in the plants grown in sterile potting mix.

Fig. 6.4: Lettuce cv. Lollo Rossa plant which had tested positive for LBVD showing

flower buds and one yellow flower. Seeds were harvested from this plant and used in

PCR detection of O. virulentus, LBVaV and MLBVV. The purple flowers in the

background are of Chicorum endiva and were not used in this study.

96

6.2.5 Surface sterilisation of seed

Two methods were used to surface sterilise the lettuce seeds. To eliminate resting

spores of Olpidium sp., seeds were surface sterilised with sodium hypochlorite

(NaOCl). Seeds from plants that tested positive for LBVaV and MLBVV, and seeds

from plants that tested negative for both viruses were placed in separate seed packets

(approximately 10 seeds per packet) folded from Whatman filter paper and then

immersed in a 2% aqueous NaOCl solution on a shaker for 20 mins at room

temperature. The seeds were then rinsed twice in sterile DI water for 1 min before being

air-dried on the open seed packets in a laminar flow cabinet. This method of seed

surface sterilisation was also used in the initial experiment.

To eliminate potential virus particle contamination of seed coats, seeds were surface

sterilised with trisodium phosphate (Na3PO4). For this, seeds were again placed in

separate filter paper seed packets (approximately 10 seeds per packet) and placed in

10% aqueous Na3PO4 solution for 2h at room temperature before being rinsed six times

for 1 min in distilled water. The seeds were then air-dried on the filter paper packets.

Seeds were also surface sterilised with both NaOCl and Na3PO4. For each treatment, 10

seeds from lettuce plants which had previously tested positive for LBVaV and MLBVV,

and 10 seeds from lettuce plants which had previously tested negative for LBVaV and

MLBVV, were used. Five seeds from lettuce plants which had previously tested

positive for both viruses were left un-surface sterilised as were five seeds from lettuce

plants which previously tested negative for both viruses. Not all of the 10 seeds for each

97

treatment germinated however the number of plants germinated for each treatment is

given in Table 6.3.

6.2.6 Growing conditions

The potting mix was autoclaved three times at 121°C for 40 mins. Lettuce cv. Great

Lakes seeds were sown into autoclaved potting mix in new 140mm diameter plastic

pots. The pots were placed in a glasshouse in which temperature was kept at

approximately 20°C on free draining benches at DAFWA, South Perth and seed

germination was observed 16 days after sowing. Leaf tissue samples were taken from

the youngest leaf 70 days after the seeds were sown.

3.2.7 ELISA and antibodies

Leaf samples (6.2.6) were tested on the day of collection by DAS-ELISA (Clark and

Adams 1977), Chapter 2 (2.14). Virus specific polyclonal antisera for LBVaV (Prime

Diagnostics, Wageningen, The Netherlands) and MLBVV (DSMZ, Braunschweig,

Germany) were used. Samples were considered positive if the absorbance reading was ≥

three times the absorbance of the healthy control sample. The controls used for this

experiment are described in 6.2.13.

98

6.2.8 RNA extraction

RNA extraction was done in order to amplify LBVaV and MLBVV. The RNA of 22

non-surface sterilised lettuce cv. Lollo Rossa seeds was extracted using a Qiagen

RNeasy Plant Mini Kit as described in Chapter 2 (2.2.2) before RT (reverse

transcription) and subsequent PCR. RNA from leaf samples of lettuce bait plants grown

in final compost and commercial mix collected from Nursery 1 were also extracted

using the same protocol.

6.2.9 Reverse transcription (RT)

The RT method used to synthesise first strand cDNA from the RNA extract used M-

MLV reverse transcriptase (Promega, Inc., Madison, WI) where 12µL of RNA was

added to 3µL of random primers and incubated at 70°C for 5min before the tubes were

put on ice for 10min and then centrifuged for 30sec at approximately 14 000 × g. Then

added to each primer/template reaction was 5µL of M-MLV 5 × reaction buffer, 1.25µL

of each 10mM dATP, 10mM dCTP, 10mM dGTP and 10mM dTTP, 0.5µL of

ribonuclease inhibitor, 1µL of M-MLV RT and 13.5µL of nuclease-free water. The

reactions were then incubated at 37°C for one hour and then used immediately in PCR

as described in Chapter 2 (2.3.1) and then stored at 80°C.

99

6.2.10 DNA extraction

In the initial experiment, DNA extraction was done in order to amplify and therefore

determine the presence of O. virulentus resting spores. The seeds harvested were from a

plant grown in a glasshouse where the majority of the plants had tested positive for

LBVaV and MLBVV and therefore it was assumed that O. virulentus resting spores

were present. Approximately 200 of these seeds were separated into four separate

1.5mL Eppendorf tubes so that there were approximately 50 seeds in each tube and

homogenised with a plastic pestle in liquid nitrogen before DNA extraction. The tubes

containing the homogenised lettuce seed samples were labelled Seed 1, Seed 2, Seed 3

and Seed 4. DNA extraction was done using Qiagen DNeasy Plant Mini Kit as

described in Chapter 2 (2.2.1). As this was an initial experiment there were no positive

or negative seed controls available.

6.2.11 PCR and agarose gel electrophoresis for RNA extracts

Promega GoTaq® Flexi chemistry was used for PCR amplification. A 100µL master

mix was made following the manufacturer‟s instructions by adding 20µL of 5 ×

GoTaq® Flexi buffer, 4µL 25mM MgCl2, 2µL 10mM dNTPs, 5µL 10pmol/µL forward

primer, 5µL 10pmol/µL reverse primer, 0.5µL GoTaq® DNA polymerase, 10µL

template cDNA and then the total volume was made up to 100µL by adding 53.5µL of

nuclease free water.

The primers used to amplify LBVaV were CP42F forward (5' CGT CGT GGA AAT

CAC AGG TAA GAC 3') and CP426R reverse (5' CGT AGA GAC AGC GAT GAA

100

TGC 3') and CP647F forward (5' CAA GGC AAG CTG AGA TGT TGT TCG 3') and

CP907R reverse (5' GAA GGG TTT GAA AGA CRG ATG G 3') (Hayes et al. 2006).

The primers used to amplify MLBVV were 1100F forward (5' TGG GAC TCC AGT

GGT CTT GTA TCC 3') and 1407R reverse (5' CGA AGG TAG AAA TAG GAA

CGA TGG 3') (Hayes et al. 2006). The PCR conditions consisted of an initial

denaturation at 95°C for 5min followed by 35 cycles of denaturation at 95°C for 30sec,

annealing at 52°C for 30sec and extension at 72°C for 1min. This was followed by a

final extension at 72°C for 10min before being held at 4°C. Agarose gel electrophoresis

was done as described in Chapter 2 (2.5).

6.2.12 PCR and agarose gel electrophoresis for DNA extracts

The PCR for DNA extracts was done as described in Chapter 2 (2.3.1). The primers

used were Ov1 forward (5' CAA GAC CTG CCC CCA AAA GGG 3') and Ov2 reverse

(5' CCA AGT TCG CAA ACG TGG CG 3'). Agarose gel electrophoresis was done as

described in Chapter 2 (2.5). As this was an initial experiment, there were no positive or

negative seed controls available so a lettuce root extract which had previously tested

positive for O. virulentus was used as a positive control and a negative water control

was used to show that there was no contamination in PCR reagents.

6.2.13 Controls for DAS-ELISA and PCR

The positive control used for testing for LBVaV and MLBVV by PCR and DAS-

ELISA, came from a lettuce plant which had previously tested positive to both LBVaV

and MLBVV by both PCR and DAS-ELISA. The positive control was grown in soil

101

that had been collected from farm A and was maintained in the same growth room

under the same conditions as the other experimental plants. A negative control lettuce

cv. Silverado plant was grown in sterilised potting mix and tested periodically by

ELISA and PCR to ensure it was not infected with either virus. It was maintained in the

same manner as was the positive control and the other experimental plants.

For the experiment regarding seed coat contamination, a sample of the youngest leaf of

a lettuce plant visibly infected with LBVD was collected from a lettuce crop grown at

the DAFWA Medina Research Station, Medina, Western Australia (approximately

40km south of the Perth CBD) and this was used as the positive control. The leaves

used as a negative control were from a plant grown in sterilised soil and maintained in a

separate glasshouse to the experimental plants to prevent any cross-contamination.

102

6.3 RESULTS

6.3.1 Samples collected from commercial lettuce growing fields

Of the 22 field collected samples, (20 lettuce and 2 sowthistle) and the 4 shop bought

lettuce samples, 23 tested positive by DAS-ELISA for MLBVV and 19 tested positive

for LBVaV. All of the four shop bought samples had a mixed infection with both

LBVaV and MLBVV, as did four samples from farm H, two samples from farm A and

one sample each from farms D, E, G, I, J, K, O and P (Table 6.1). One of the sowthistle

samples tested positive only for LBVaV whilst two samples from farm L, one sample

from farm M and two samples from farm N had an infection with only MLBVV. Two

of the samples, one sowthistle from farm H and one lettuce cv. Lollo Rossa from Farm

N, tested negative for both viruses (Table 6.1).

103

Table 6.1: DAS-ELISA results summary from a survey of lettuce growers in Western

Australia in 2006 and 2007. All growers are located in the Perth Metropolitan region

except property N which was located at Manjimup 300km south of Perth.

Farm collected from Species isolated from Virus/es positive for

Shop bought sample Lettuce, Iceberg LBVaV and MLBVV



Shop bought sample Lettuce, Cos LBVaV and MLBVV

Farm A Lettuce, Iceberg LBVaV and MLBVV

Farm A Lettuce, Cos LBVaV and MLBVV

Farm D Lettuce, Iceberg LBVaV and MLBVV

Farm E Lettuce, Iceberg LBVaV and MLBVV

Farm G Lettuce, Iceberg LBVaV and MLBVV

Farm H Sowthistle none

Farm H Lettuce, Iceberg LBVaV and MLBVV




Farm H Sowthistle LBVaV

Farm I Lettuce, Iceberg LBVaV and MLBVV

Farm J Lettuce, Iceberg LBVaV and MLBVV

Farm K Lettuce, Iceberg LBVaV and MLBVV

Farm L Lettuce, Iceberg MLBVV

Farm L Lettuce, Cos MLBVV

Farm M Lettuce, Iceberg MLBVV

Farm N Lettuce, coloured fancy MLBVV

Farm N Lettuce, coloured fancy MLBVV

Farm N Lettuce coloured fancy none

Farm O Lettuce, Iceberg LBVaV and MLBVV

Farm P Lettuce, Iceberg LBVaV and MLBVV

104

6.3.2 Samples collected from seedling nurseries and tested by PCR and DAS-

ELISA

Lettuce leaf tissue samples from bait plants grown in soil collected from Nursery 1

(final compost, final mix and soil from the lettuce seedling growing area) were taken

five weeks after germination. All 19 leaf samples tested positive by PCR for MLBVV.

LBVaV was amplified in four out of the six plants grown in the commercial mix and in

four out of the four plants grown in the soil collected from the lettuce seedling growing

area. LBVaV was not detected in plants grown in the final compost (Table 6.2). The

bands obtained using LBVaV primer pair CP42F and CP426R were of expected size

(385bp) as were the bands obtained using LBVaV primer pair CP647F and CP907R

(261bp) and MLBVV primer pair 1100F and 1407R (308bp) (Fig. 6.3). None of these

19 samples tested positive for LBVaV or MLBVV by DAS-ELISA.

Table 6.2: The areas from where samples were taken at Nursery 1 and the number of

lettuce seedlings grown in each sample and the number of plants showing the presence

of LBVaV and/or MLBVV as tested by PCR.

Sample taken Number of seedlings

grown

DAS-

ELISA/PCR

LBVaV MLBVV

Final compost 4 PCR 0/4 4/4

Commercial

mix

6 PCR 4/6 6/6

Newer area 5 DAS-ELISA 0/5 5/5

Lettuce area 4 DAS-ELISA/PCR 4/4 4/4

105

Fig. 6.3: Amplification of LBVaV and MLBVV isolated from leaves of lettuce which

had been grown in soil collected from the lettuce seedling growing area in Nursery 1.

Lane M: 6µL of 100bp molecular weight marker (Fisher Biotech), Lane 1: LBVaV

amplicon using primers CP42F and CP426R, Lane 2: LBVaV amplicons using primers

CP647F and CP907R, Lane 3: MLBVV amplicon using primers 1100F and 1407R,

Lane 4: negative control using LBVaV primers CP647F and CP907R, Lane 5: negative

control using MLBVV primers 1100F and 1407R, Lane 6: positive control using

LBVaV primers CP647F and CP907R, Lane 7: positive control using MLBVV primers

1100F and 1407R.

6.3.4 Seeds tested by PCR for LBVaV, MLBVV and O. virulentus

PCR and agarose gel electrophoresis confirmed the presence of LBVaV and MLBVV

from the RNA extracts obtained from 22 bulked lettuce seeds. The expected fragment

sizes were obtained for each primer pair; LBVaV primer pair CP647F and CP907R

(261bp) and MLBVV primer pair 1100F and 1407R (308bp) (Fig. 6.4). DNA extraction

and then PCR amplification of the four bulked lettuce seed samples, Seed 1, Seed 2,

Seed 3 and Seed 4, revealed O. virulentus amplicons in two out of the four homogenised

seed samples (Seed 3 and Seed 4). The amplicons were of expected size (361bp).

M 1 2 3 4 5 6 7

500bp

385bp

308bp

261bp

106

Fig. 6.4: Amplification of LBVaV and MLBVV from 22 bulked lettuce seeds. Lane M:

6µL 100bp molecular weight marker (Fisher Biotech), Lane 1: LBVaV amplicons using

primers CP647F and CP907R, Lane 2: MLBVV amplicon using primers 1100F and

1407R. White oval shows the location of the faint band in Lane 2.

Fig. 6.5: Amplification of O.virulentus from lettuce seeds using specific primers

Ov1(forward) and Ov2 (reverse) giving the expected fragment size of 361bp. Lane M:

6µL 100bp molecular weight marker (Fisher Biotech), Lane 1: cDNA from Seed 1,

Lane 2: cDNA from Seed 2, Lane 3: cDNA from Seed 3, Lane 4: cDNA from Seed 4,

Lane 5: negative water control, Lane 6: positive O. virulentus control.

M 1 2

500bp

308bp

261bp

M 1 2 3 4 5 6

500bp

361bp

107

6.3.3 Surface sterilisation of seed

All of the lettuce leaf tissue samples from plants grown from surface sterilised seed that

were tested by DAS-ELISA were negative for both LBVaV and MLBVV (Table 6.3).

In contrast, the positive control collected from the DAFWA Medina Research Station

gave a high absorbance reading and therefore tested positive for both viruses. This also

demonstrates that autoclaving potting mix three times at 121°C for 40 mins was an

effective sterilisation method as neither virus was detected in any of the plants grown in

this autoclaved potting mix.

Table 6.3: Method of surface sterilisation used on lettuce cv. Great Lakes seeds

harvested from plants that were either positive or negative for LBVaV and MLBVV

when tested by DAS_ELISA, and the number of plants grown for each treatment and

the number of plants in each treatment that tested positive for LBVaV or MLBVV by

DAS-ELISA

Method of

Surface

sterilisation

Positive/negative for

LBVaV and MLBVV

Number of plants

grown/treatment

LBVaV MLBVV

No surface

sterilisation

positive 4 0/4 0/4

No surface

sterilisation

negative 2 0/2 0/2

Na3PO4 positive 6 0/6 0/6 Na3PO4 negative 9 0/9 0/9 NaOCl positive 10 0/10 0/10 NaOCl negative 5 0/5 0/5

Na3PO4/ NaOCl positive 5 0/5 0/5 Na3PO4/ NaOCl negative 5 0/5 0/5

108

6.4 DISCUSSION

LBVaV and MLBVV were readily detected by DAS-ELISA in 18 lettuce samples

collected from plants almost at harvest stage. MLBVV was the only virus detected in

six of the lettuce samples but for one lettuce sample both viruses were detected. LBVaV

was the only virus detected in the first of the Sowthistle samples whilst the second

Sowthistle sample tested negative for both viruses. All of these plants with the

exception of the negative control plant and the two sowthistle samples, showed

symptoms for LBVD and were collected across 13 different commercial lettuce growing

properties and with four samples purchased from a local fruit and vegetable retailer.

DAS-ELISA however, failed to detect LBVaV or MLBVV in lettuce samples taken five

weeks after sowing from bait plants grown in soil collected from a contaminated

commercial lettuce seedling nursery. As O. virulentus, LBVaV and MLBVV were

detected in these samples by RT-PCR, this suggests that the method of testing for both

LBVaV and MLBVV by RT-PCR is more sensitive than testing by DAS-ELISA, as

both viruses were detected much earlier despite the fact that tests using DAS-ELISA

seemed to be more reliable when using leaf tissue from older plants. Roggero et al.

(2003) also reported a lack of sensitivity in MLBVV antiserum when detecting

MLBVV in low concentrations in leaf tissue. This comparison of sensitivity was also

observed by Schenk et al. (1995) who tested the movement of Barley mild mosaic virus

and Barley yellow mosaic virus which is vectored by the fungus Polymyxa graminis,

and found that both these viruses could be detected in roots by RT-PCR one day after

inoculation with viruliferous zoospores whereas it took 3-4 weeks before the viruses

could be detected in the same root tissue by DAS-ELISA.

109

Previous studies on the spread of LBVD through infected seedlings being on-sold from

nurseries to lettuce producers detected LBVaV by DAS-ELISA in lettuce leaf samples

but did not involve tests for MLBVV as this work was carried out in 1999-2000 which

was before MLBVV had been discovered in association with LBVD (Latham et al.

2004). This study (Chapter 6) has shown that both viruses involved in the LBVD

complex, LBVaV and MLBVV can be detected by DAS-ELISA. This has provided the

first evidence that both viruses are associated with LBVD in Western Australia, which

reflects the situation found previously in European temperate and Mediterranean

climates (Roggero et al. 2000), Brazil (Colariccio et al. 2003), Japan (Navarro et al.

2004) and in North America (Hayes et al. 2005). MLBVV is considered as the

symptom-causing virus whereas LBVaV is considered to be latent (Roggero et al.

2000). Given the high sensitivity of RT-PCR, some random testing of lettuce seedlings

by this method at the transplant stage could now be included within the integrated

disease management strategy suggested by Jones (2004) to more reliably ensure lettuce

seedling nurseries are not selling diseased seedlings to lettuce producers. However, the

cost of RT-PCR exceeds that of DAS-ELISA so this may be the method of choice

instead, possibly by growing batches of seedlings from nurseries in autoclaved potting

mix for several weeks until they can be reliably tested for the presence of LBVaV and

MLBVV using DAS-ELISA.

Seeds can be inadvertently contaminated with viruliferous O. virulentus resting spores.

This was demonstrated by RT-PCR amplification of O. virulentus, LBVaV and

MLBVV from extracts of lettuce seeds harvested from LBVD infected plants. Even

though the vector, LBVaV and MLBVV were all amplified on lettuce seeds, it is

suggested by the seed coat contamination experiment that if lettuce seeds come into

110

contact with viruliferous O. virulentus resting spores, the number of propagules present

on the seed is likely to be inadequate to cause systemic infection of the lettuce plant. It

is also possible that the temperature, and possibly the potting mix biology/chemistry

which may have been altered during sterilisation, were not conducive to systemic

infection. However, further detection by PCR (on both the roots and leaves) may reveal

the presence of LBVaV and MLBVV that DAS-ELISA failed to detect in lettuce leaf

tissue.

This study is the first to demonstrate the external contamination of lettuce seeds by O.

virulentus, LBVaV and MLBVV. A similar phenomenon has been previously reported

with Melon necrotic spot virus (MNSV) in melon which is also vectored by another

chytrid, Olpidium bornovanus (Faruki 1981; Campbell et al. 1996). Faruki (1981) found

that O. bornovanus zoospores acquired and transmitted MNSV that contaminated the

surface of melon seed and found that while MNSV occurred in high incidence on the

surface of the seed it would not infect the seedling unless the vector was present,

suggesting vector-dependent seed transmission. Incidence of MNSV transmission when

externally contaminated melon seeds were sown in the presence of O. bornovanus was

demonstrated to be 10-40% (Faruki 1981). However, Campbell et al. (1996) reported

transmission of MNSV in melon seeds in the absence of O. bornovanus and their

findings suggest that seed transmission can be independent of the vector.

In conclusion, this study has determined the presence of both LBVaV and MLBVV on

commercial lettuce growing farms the Swan Coastal Plain of south-west Australia by

testing samples by DAS-ELISA as well as the presence of LBVaV and MLBVV at

different stages of production in commercial seedling nurseries in the Perth

111

metropolitan region by testing „bait‟ lettuce samples by DAS-ELISA and/or PCR. This

study has also determined a), the presence of O. virulentus resting spores, LBVaV and

MLBVV on the surface of lettuce seeds and, b), that even though O. virulentus resting

spores, LBVaV and MLBVV are present on lettuce seed, the number of propagules was

shown to be too low to cause systemic infection. However, by increasing the sample

size and growing a greater number of non-surface sterilised seeds harvested from plants

which have tested positive for LBVD into autoclaved soil, and testing these plants by

the more sensitive PCR method described in this chapter, the proposed vector-assisted

seed transmission is likely to be established as a source of effective LBVD inoculum.

112

Chapter 7 Alternative Hosts

7.1 Introduction

LBVaV and MLBVV are not limited to lettuce, although both viruses have a narrow

host range. Their chytrid vector, earlier identified as O. brassicae and now determined

to be O. virulentus (Sasaya and Koganezawa 2006) has a wide host range (Campbell

1965). Other known natural hosts of LBVaV and MLBVV come from the family

Asteraceae and include: S. oleraceous, S. asper, C. endiva (endive) and chickory

(Campbell 1965). Species known as experimental hosts are Chenopodium

amaranticolor, C. quinoa, Nicotiana benthamiana, N. clevlandii, N. occidentalis and

Tetragonia tetragonioides (Huijberts et al. 1990).

Weed species found in commercial production areas play an important role in the

survival and spread of many important plant viral pathogens because the virus/vector

inoculum potential of weeds may be increased by close association with nearby

susceptible crops (Bos, 1999). In Western Australia, Coutts et al. (2004) demonstrated

in a lettuce field, that clustering of LNYV in lettuce plants occurred at the crop edge

where there was an S. oleraceous source and that there was few incidences of LNYV

further away from the S. oleraceous source. S. asper has been shown to be a virus

reservoir with natural infections of Tomato yellow leaf curl Sardinia virus, which is

vectored by the whitefly Bemisia tabaci occurring in tomato growing fields (Fanigliulo

et al. 2007).

.

113

S. oleraceous and S. asper are both introduced weed species. Both occur in lettuce

growing fields in Western Australia with S. oleraceous being the most common species

observed during this study. S. oleraceous is also commonly found growing in lettuce

growing fields in Spain where Navarro et al. (2005) confirmed the presence of LBVaV

and MLBVV in S. oleraceous leaf tissue collected from lettuce fields.

Determining what alternative hosts occur in the Western Australian lettuce production

system is important in helping to understand the epidemiology of LBVD so that further

control measures can be established. Even though infected soil is considered the main

infection source of LBVD, the elimination of such weeds could remove this additional

virus infection source by reducing both the survival and the activity of the chytrid

vector (Jones, 2004).

In this chapter, both native and alien species from the family Asteraceae (Daisy Family)

were tested for susceptibility to LBVD. The alien species tested were S. oleraceous, S.

asper (rough sowthistle), Arctotheca calendula (capeweed) and Reichardia tingitana

(false sowthistle). The native species tested were S. hydrophilus (native sowthistle) and

Actites sp. (dune thistle). S. oleraceous and A. calendula are found in almost all

horticultural and agricultural areas of south-west Australia including the Swan Coastal

Plain. Both of these species are commonly found on disturbed sites such as cultivated

areas and road verges (CALM 2007) and during this study, both species were

commonly found growing amongst lettuce crops. S. asper is not as common as S.

oleraceous but is also found on the Swan Coastal Plain on disturbed sites (CALM

2007). Reichardia spp. are also found on the Swan Coastal Plain but are more common

in the Southwest Botanical Province (CALM 2007). They grow in sandy soils, alluvial

114

river flats and coastal dunes (CALM 2007). S. hydrophilus is also common along the

Swan Coastal Plain. However, it occurs near temporarily wet ground such as on the

edges of lakes and streams (CALM 2007). Actites spp. are also common to the Swan

Coastal Plain and occur in calcareous sand, coastal dunes, cliffs and winter-wet plains

(CALM 2007). During this study S. hydrophilus and Actites sp. and Reichardia sp. were

not observed in lettuce growing areas.

115

7.1.1 Aims

The aims of this study were

to identify alternative weed hosts for LBVaV and MLBVV growing on the

Swan Coastal Plain of south-west Australia

to establish whether two native species of Asteraceae are hosts of LBVaV and

MLBVV

to determine whether natural weed species collected in LBVD-affected lettuce

fields in Western Australia were infected with LBVaV and/or MLBVV

116

7.2 Materials and Methods

7.2.1 Determining alternative hosts for LBVV and MLBVV

Species chosen for this experiment on alternative hosts included two known hosts S.

asper and S. oleraceous as well as three untested but potential hosts, S. hydrophilus,

Reichardia sp. and Actites sp.. S. hydrophilus was chosen as a species to test for

susceptibility to LBVaV and MLBVV as it is a member of the same genus as the known

LBVaV and MLBVV hosts S. asper and S. oleraceous. An initial experiment revealed

infection of both viruses in S. hydrophilus. Therefore, Reichardia sp., Actites sp. and A.

calendula were additionally chosen as they are also members of the family Asteraceae,

a family within which all other known natural hosts are found, and also because seeds

for these species were readily available (7.2.7).

7.2.2 Samples collected from the field

A. calendula and S. oleraceous plants were collected at random from four different

commercial lettuce growing farms. Those sampled were from farms B, C, E and H. In

each instance, only young inside leaves of five week old plants were sampled from each

plant. There were no root samples collected for testing. Three A. calendula samples

were taken from Farm B, one from Farm C and three samples from Farm E. One S.

oleraceous sample was taken from Farm B, two samples were taken from Farm E and

two samples were taken from Farm H. None of the samples of either species showed

disease symptoms.

117

7.2.3 Source of seedlings and inoculum for initial experiment

A small scale experiment was initially conducted to determine if S. hydrophilus is a host

of MLBVV and LBVaV. Seedlings of S. hydrophilus were obtained from Geographe

Community Landcare Nursery in Dunsborough, Western Australia. Infested soil was

collected from Farm A, from a field in which lettuce plants had shown symptoms of

LBVD.

7.2.4 Growing conditions for inoculated seedlings for the initial experiment

Thirty three S. hydrophilus seedlings were grown as bait plants in soil infested with

LBVD. The seedlings were transplanted into separate 140mm diameter pots so that

there was one seedling per pot which contained one part potting mix and one part

LBVD infested soil (7.2.3). They were grown in a controlled environment growth room

facility at DAFWA, South Perth (Fig. 7.1). The seedlings were exposed to a 12h

photoperiod and maintained at a constant temperature of 18°C. The pots were placed on

free draining benches. Negative controls were set up by transplanting 25 seedlings so

that there was one seedling per pot into pots containing only potting mix. They were

transplanted at the same time and maintained under the same temperature and light

conditions as the experimental seedlings. Also, approximately five lettuce seedlings

were transplanted into infested soil at the same time to act as positive controls.

118

Fig. 7.1: S. hydrophilus seedlings used in the initial experiment that were inoculated by

growing them in soil contaminated with LBVD pathogens and grown in 140mm

diameter pots on free-draining benches in a controlled environment room. Seeds were

harvested from these plants (7.2.6).

7.2.5 Testing by DAS-ELISA of field collected samples and inoculated seedlings

used in the initial experiment

The field collected leaf samples were stored at 4°C in sealed plastic bags on the day of

collection. The following day, the samples were analysed by DAS-ELISA, (Clark and

Adams, 1977) as described in Chapter 2 (2.14). After a 46 day growth period, the

youngest leaf on each S. hydrophilus seedling was sampled and tested for LBVaV and

MLBVV by DAS-ELISA also as described in Chapter 2 (2.14). The antisera used and

the determination of positive results, was the same as described in Chapter 6 (6.2.7).

119

7.2.6 Source of seed

S. hydrophilus seeds were collected from mature plants from the initial experiment

(7.2.4). All other seeds, of Actites sp., Reichardia sp., S. oleraceous and S. asper, were

obtained from Kathryn McCarren at CSIRO Laboratories, Floreat, Western Australia

and were of Western Australian origin.

7.2.7 Germination of seeds and inoculation of seedlings used to determine

alternative hosts

Thirty seeds of each species listed in 7.2.1 were sown and germinated in a glasshouse.

Approximately three weeks after germination, the seedlings were transplanted into

separate 140mm pots where there was one seedling per pot grown in soil that contained

one part potting mix and one part LBVD infested soil. The LBVD infested soil was

from Farm A (7.2.3). The plants in pots were grown as described in 7.2.4. However, due

to technical failures associated with the controlled environment room, a constant

temperature and light intensity could not be maintained throughout the duration of the

experiment, rather the plants were sometimes exposed to periods of darkness and high

temperatures (occasionally exceeding 30°C) which reflected the outside temperature of

the day. One negative control plant for each species was transplanted at the same time

by sowing in sterile soil which had been autoclaved three times at 120°C for 40mins.

These plants were kept in a different growth room to prevent cross-contamination and

tested periodically for the presence of LBVaV and MLBVV by DAS-ELISA.

120

7.2.8 Sampling of plant tissue for DAS-ELISA

After approximately one month of growing in infested soil, the youngest leaf of each

plant and the roots of each plant were sampled separately and each sample tested

individually for the presence of LBVV and MLBVV by DAS-ELISA as described in

Chapter 2 (2.14) and 7.2.5. The root samples were washed to remove any soil and the

possible contamination of viruliferous zoospores on the root surface or in the soil.

7.2.9 RNA extraction of leaf tissue

To re-affirm ELISA results, one leaf sample from each of the negative control plants,

Actites sp., Reichardia sp., S. asper, S. hydrophilus and S. oleraceous, was taken for

RNA extraction and testing by RT-PCR for the presence of LBVaV and MLBVV. Also

tested were plants from each species that were grown in infested soil and showing viral

infection symptoms; Actites sp. plant 19, Reichardia sp. plant 5, S. asper plants 9 and

17, S. hydrophilus plant 6 and S. oleraceous plant 4. Also sampled as a positive control,

was one lettuce plant showing LBVD symptoms that had been grown in LBVD infested

soil and one lettuce plant that had been grown with the other negative control plants.

7.2.10 Reverse Transcription Polymerase Chain Reaction (RT-PCR)

The RNA extracts from each leaf sample described in 7.2.9 were tested for the presence

of both LBVaV and MLBVV by RT-PCR. A OneStep RT-PCR kit from Qiagen,

Australia was used. The primers chosen for this assay were VP248/VP249 (LBVaV)

and VP286/VP287 (MLBVV) (Navarro et al. 2004). The sequences for these primers

121

are as listed in Table 2.1. The PCR reactions were placed in a thermocycler with

conditions as described in Chapter 2 (2.3.2) and then run on a 1% agarose gel and

viewed using a transilluminator as described in Chapter 2 (2.5).

122

7.3 Results

7.3.1 Results of initial experiments

Of the 33 S. hydrophilus seedlings grown in infested soil, 28 tested positive by DAS-

ELISA for LBVaV and 4 tested positive by DAS-ELISA for MLBVV. Of the 25 S.

hydrophilus seedlings grown as negative controls in potting mix, 10 tested positive by

DAS-ELISA for LBVaV and 5 tested positive by DAS-ELISA for MLBVV (Table 7.1).

As the negative controls tested positive ie. were three times the average absorbance

reading of the test negative controls, there was no distinct negative control. However,

the positive controls were determined by comparing their absorbance to the level

observed with the positive lettuce control sample and also to the samples on the ELISA

plate where there was very little absorbance observed.

Table 7.1: Detection of LBVaV and MLBVV in initial experiments where S.

hydrophilus seedlings were transplanted into pots containing a mixture of potting mix

and LBVD pathogen infested soil and tested by DAS-ELISA for both LBVaV and

MLBVV.

Treatment LBVaV MLBVV

Potting mix 10/25 5/25

Potting mix and soil inoculum 28/30 4/33

123

7.3.2 Field samples

A sample from one A. calendula plant (E7) of the seven tested, was positive for

MLBVV by DAS-ELISA but not for LBVaV. This single detection is a tentative first

report of A. calendula as a host of MLBVV. Samples from four of the six S. oleraceous

plants collected tested positive for LBVaV (E10, E11, H1 and H2). Samples from plants

E11 and H2 also tested positive for MLBVV indicating a mixed infection. Plant

samples B3, B4, B5, B6, E8 and E9 did not test positive by DAS-ELISA for either

LBVaV or MLBVV (Table 7.2). Neither the plants that tested positive nor the plants

that tested negative showed any visible LBVD symptoms. The same positive control as

described in 7.2.4 was used in this experiment and positive absorbance readings were

based on this control.

Table 7.2: Presence of LBVaV and/or MLBVV using DAS-ELISA test on field

collected samples of A. calendula and S. oleraceous.

Sample namea

Species sampled LBVaV MLBVV

B3 A. calendula - -

B4 A. calendula - -

B5 A. calendula - -

B6 S. oleraceous - -

C2 A. calendula - -

E7 A. calendula - +

E8 A. calendula - -

E9 A. calendula - -

E10 S. oleraceous + -

E11 S. oleraceous + +

H1 S. oleraceous + -

H2 S. oleraceous + +

Total 4/12 3/12 aLetters indicate separate commercial lettuce growing properties that leaf samples were taken from and

the numbers represent the sample number.

124

7.3.3 Growth room experiment

Of the weed species tested, the Reichardia sp. tested positive for LBVaV in 27 of the 28

root samples tested, but only one out of the 28 corresponding leaf samples tested

positive. When the Reichardia sp. was tested for MLBVV, 26 of the 28 root samples

tested positive and 16 of the 28 leaf samples also tested positive. Of the leaf samples,

there were no plants with mixed infections, one plant with LBVaV only, 16 plants with

MLBVV only and eleven plants which did not test positive for either virus. Of the root

samples, 25 were recorded as having mixed infections whilst 2 had LBVaV alone and

one plant tested positive for only MLBVV. No Reichardia sp. root samples were

negative for both viruses (Table 7.3).

S. asper showed 100% infection for LBVaV in the root samples whilst seven out of the

22 corresponding leaf samples also tested positive for LBVaV. When tested for

MLBVV, S. asper also had 100% infection in root samples and 15 of the leaf samples

also tested positive for MLBVV. Six of the S. asper leaf samples had a mixed infection

of both viruses, two had LBVaV alone and eight tested positive for only MLBVV. Six

of the leaf samples tested negative for both LBVaV and MLBVV. Of the S. asper root

samples, 22 tested positive for both LBVaV and MLBVV. There were no samples in

which either virus was detected alone or not at all (Table 7.3).

S. oleraceous tested positive for LBVaV in 27 of the 30 root samples tested with five

out of the 30 corresponding leaf samples also testing positive. When tested for

MLBVV, S. oleraceous root samples all tested positive as did 26 of the 30 leaf samples.

Of the leaf samples, five had mixed infections, no samples were positive for LBVaV

125

alone, 13 samples were infected only with MLBVV and two leaf samples tested

negative for both viruses. Of the root samples, 28 had mixed infections, no samples

were positive for LBVaV alone, three samples were infected only with MLBVV and no

samples tested negative for both viruses (Table 7.3).

Of the native species tested, Actites sp. and S. hydrophilus, Actites sp. tested positive for

LBVaV in 25 of the 30 root samples and 5 of the 30 corresponding leaf samples. When

tested for MLBVV, Actites sp. showed 100% infection in the root samples and 17 of the

30 corresponding leaf samples tested positive. Of the leaf samples, one had a mixed

infection, four samples were positive for LBVaV alone, 15 samples were infected only

with MLBVV and seven leaf samples tested negative for both viruses. Of the root

samples, 25 had mixed infections, no samples were positive for LBVaV alone, five

samples were infected only with MLBVV and no samples tested negative for both

viruses (Table 7.3).

S. hydrophilus tested positive for LBVaV in 26 of the 30 root samples but failed to test

positive in any leaf tissue samples. When tested for MLBVV, S. hydrophilus tested

positive for 28 of the 30 root samples and tested positive and 16 of the 30 leaf samples

also tested positive. Of the leaf samples, none had mixed infections or were positive for

LBVaV alone, 16 samples were infected only with MLBVV and 13 leaf samples tested

negative for both viruses. Of the root samples, 16 had mixed infections, no samples

were positive for LBVaV alone, 13 samples were infected only with MLBVV and two

tested negative for both viruses (Table 7.3).

126

Table 7.3: The incidence of LBVaV and MLBVV tested by DAS-ELISA on leaf and root tissue of three alien and two native species of Asteraceae.

Plant species Conservation

status

Tissue

tested

LBVaV and

MLBVV

LBVaV

only

MLBVV

only

Neither

virus

Total

LBVaV

Total

MLBVV

Actites sp. Not threatened

Native host

Leaf

Root

1/30

25/30

4/30

0/30

15/30

5/30

7/30

0/30

5/30

25/30

16/30

30/30

Reichardia sp. Alien Leaf

Root

0/28

25/28

1/28

2/28

16/28

1/28

11/28

0/28

1/28

27/28

16/28

26/28

S. asper Alien Leaf

Root

6/22

22/22

2/22

0/22

8/22

0/22

6/22

0/22

7/22

22/22

15/22

22/22

S. hydrophilus Not threatened

Native host

Leaf

Root

0/30

16/30

0/30

0/30

16/30

13/30

13/30

2/30

0/30

15/30

16/30

28/30

S. oleraceous Alien Leaf

Root

5/30

28/30

0/30

0/30

22/30

3/30

3/30

0/30

5/30

26/30

27/30

30/30

127

7.3.4 Observed virus symptoms in plant leaves

The plants which were infected with LBVaV and MLBVV showed a wide range of

symptoms which were different from those previously associated with LBVD in lettuce

(Table 7.4). Actites sp. (plant number 19) tested positive for both LBVaV and MLBVV

and showed necrotic petiole streaking which was not present in the negative control

(Fig. 7.2a and b). This symptom was observed in many of the Actites sp. plants infected

with LBVD. The Reichardia sp. (Fig. 7.2c) showed the widest range of symptoms when

infected with LBVD including vein clearing, interveinal chlorosis and necrotic midrib

streaking (Fig. 7.2d) and necrotic leaf spotting and yellow blotching, (Fig. 7.2e). S.

hydrophilus (Fig. 7.2f) showed mild vein clearing when infected with LBVaV and

MLBVV (Fig. 7.2g). Necrotic petiole streaking was also observed in S. hydrophilus.

Two S. asper plants (Fig. 7.2h) showed severe vein clearing and vein banding (Fig.

7.2i). Both of these plants with symptoms were positive for both viruses in the root

tissue but only positive for MLBVV in the leaf tissue. Mild vein clearing and necrotic

stem streaking was also observed in S. asper (Fig. 7.2j). In S. oleraceous (Fig. 7.2k),

mild vein clearing was observed and interveinal chlorosis was present when only

LBVaV infection was detected.

128

Table 7.4: Plant foliage symptoms on the three alien and two native Asteraceae species

grown in soil infested with LBVD pathogens.

Plant species Symptoms on foliage

Actites sp. Necrotic petiole streaking

Reichardia sp. Necrotic vein spotting

Interveinal chlorosis

Yellow blotching

Vein clearing

Necrotic midrib streaking

S. asper Necrotic petiole streaking

Mild vein clearing

Severe vein clearing

Vein banding

S. hydrophilus Mild vein clearing

Necrotic petiole streaking

S. oleraceous Interveinal chlorosis

Mild vein clearing

129

Fig. 7.2: Response of Actites sp., Reichardia sp., S. hydrophilus, S. asper and S. oleraceous to inoculation with LBVaV and MLBVV a) Actites sp. negative control, b)

Actites sp. necrotic petiole streaking c) Reichardia sp. negative control d) Reichardia sp. interveinal chlorosis, vein clearing and necrotic midrib streaking e) Reichardia sp.

yellow blotching and necrotic vein spotting on midrib f) S. hydrophilus negative control g) S. hydrophilus mild vein clearing h) S. asper negative control i) S. asper vein

clearing and vein banding j) S. asper necrotic petiole streaking k) S. oleraceous negative control l) S. oleraceous interveinal chlorosis

130

7.3.5 Confirmation of DAS-ELISA results by RT-PCR

Of the six leaf samples that were grown in potting mix only and in a separate glasshouse

to the experimental plants, five tested negative to both LBVaV and MLBVV by RT-

PCR whilst S. asper tested positive for both MLBVV and LBVaV. Of the eight

experimental plants, Actites sp. plant 19, Reichardia sp. plants 5 and 27, S. asper plant

9, S. hydrophilus plant 6 and S. oleraceous plant 4 all tested positive for LBVaV whilst

S. asper plant 17 was negative for LBVaV (Fig. 7.3). All amplicons using LBVaV

primer pair VP248 (forward) and VP249 (reverse) gave the expected fragment size of

296bp (Fig. 7.3). Of the eight experimental plants, only four tested positive for

MLBVV; L. sativa, S. hydrophilus plant 6, Reichardia sp. plant 27 and Actites sp. plant

19 (Fig 7.4). All amplicons using MLBVV specific primer pair VP286 (forward) and

VP287 (reverse) gave the expected fragment size of 469bp (Fig. 7.4). The RT-PCR

results agree with the results for each of the plants when tested for both LBVaV and

MLBVV by DAS-ELISA (Table 7.5).

Table 7.5: Positive (+) and negative (-) results obtained for each of the experimental

plants that were tested for LBVaV and MLBVV by both RT-PCR and DAS-ELISA

RT-PCR DAS-ELISA

Species LBVaV MLBVV LBVaV MLBVV

L. sativa –ve - - - -

L. sativa +ve + + + +

S. hydrophilus –ve - - - -

S.hydrophilus 6 + + + +

S. asper –ve + + + +

S. asper 9 + - + -

S. asper 17 - + - +

Reichardia sp. –ve - - - -

Reichardia sp. 5 + - + -

Reichardia sp. 27 + + + +

Actites sp. –ve - - - -

Actites sp. 19 + + + +

S. oleraceous –ve - - - -

S. oleraceous 4 + - + -

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

131

Fig 7.3: Amplification of LBVaV isolated from leaves of various native and alien

Asteraceae species which had been grown in soil infested with LBVD and leaf samples

of the same species grown in potting mix only (negative control plants). Primers used

were VP248 and VP249 giving a 296bp amplicons. Lane M: 6µL of 100bp molecular

weight marker (Fisher Biotech), Lane 1: L. sativa negative control, Lane 2: L. sativa,

Lane 3: S. hydrophilus negative control, Lane 4: S. hydrophilus plant 6, Lane 5: S. asper

negative control, Lane 6: S. asper plant 9, Lane 7: S. asper plant 17, Lane 8: Reichardia

sp. negative control, Lane 9: Reichardia sp. plant 5, Lane 10: Reichardia sp. plant 27,

Lane 11: Actites sp. negative control, Lane 12: Actites sp. plant 19, Lane 13: S.

oleraceous negative control, Lane 14: S. oleraceous plant 4, Lane 15: water negative

control, Lane 16: cDNA positive LBVaV control.

500bp

296bp

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

132

Fig 7.4: Amplification of MLBVV isolated from leaves of various native and alien

Asteraceae species which had been grown in soil infested with LBVD and leaf samples

of the same species grown in potting mix only (negative control plants). Primers used

were VP286 and VP287 giving a 469bp amplicons. Lane M: 6µL of 100bp molecular

weight marker (Fisher Biotech), Lane 1: L. sativa negative control, Lane 2: L. sativa,

Lane 3: S. hydrophilus negative control, Lane 4: S. hydrophilus plant 6, Lane 5: S. asper

negative control, Lane 6: S. asper plant 9, Lane 7: S. asper plant 17, Lane 8: Reichardia

sp. negative control, Lane 9: Reichardia sp. plant 5, Lane 10: Reichardia sp. plant 27,

Lane 11: Actites sp. negative control, Lane 12: Actites sp. plant 19, Lane 13: S.

oleraceous negative control, Lane 14: S. oleraceous plant 4, Lane 15: water negative

control, Lane 16: cDNA positive MLBVV control.

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

500bp

469bp

133

7.4 Discussion

Four previously unreported hosts of MLBVV were determined in this study; A.

calendula, S. hydrophilus, Actites sp. and Reichardia sp. Three previously unreported

hosts of LBVaV were also determined in this study; S. hydrophilus, Actites sp. and

Reichardia sp. The report of infection in A. calendula is tentative as MLBVV was only

detected in one out of six samples. Of the six different Asteraceae species tested in this

experiment, S. asper was the most susceptible to LBVaV and MLBVV as it showed

100% detection from root tissue, with the Reichardia sp. being the second most

susceptible to LBVaV with 96% recovery from root tissue. The Actites sp. and S.

oleraceous are also highly susceptible to MLBVV also showing 100% infection in root

tissue.

There is very little information regarding the function of virus resistance and movement

in roots as it is commonly the leaf tissue that is studied. However, Germundsson et al.

(2002) suggested that virus infection in plant roots could induce systemic resistance and

prevent virus movement into the leaf tissue. Germundsson et al. (2002) inoculated the

roots of CP-transgenic N. benthamiana with Spongospora subterranea zoospores that

were carrying Potato mop-top virus (PMTV) and found that whilst there was PMTV

infection in the roots (as tested by ELISA and PCR), there was no systemic movement

to the above ground parts of the plant. Due to this finding, they concluded that roots and

leaves provide different expression of virus resistance. This is similar to the situation

seen in this study where in every species tested for LBVaV and MLBVV, infection was

more common in the root tissue of the plant than in the leaf tissue. This was most

obvious with the Reichardia sp. that was infected with LBVaV with 27/28 of the root

134

samples testing positive but with only 1/28 of the leaf samples testing positive. If such a

mechanism exists in regard to the systemic spread of LBVaV and MLBVV, then this

would be an important mechanism to exploit in the development of CP gene-mediated

resistant cultivars.

The diverse symptoms observed in the five Asteraceae species grown in LBVD infested

soil in the controlled environment growth room are largely due to the way in which the

virus/es interact with each of the different host species used. Both virus and host are

genetically variable. This genetic variability and the surrounding environmental

conditions affect their interactions. The extent of the severity of virus diseases depends

both upon the virus pathogenicity as well as the susceptibility of the host, which differs

depending on the species or cultivar (Bos 1999). The infected S. oleraceous plants

collected in the lettuce growing field were symptomless whereas the infected S.

oleraceous grown in the controlled environment room showed symptoms of interveinal

chlorosis and mild vein clearing. This can perhaps be explained by the low temperatures

and low light intensity which the controlled environment room plants were subjected to,

condition conducive for optimum symptom expression (Walsh 1994), rather than the

warmer and higher light intensity summer growing conditions in which the field

collected S. oleraceous and A. calendula were grown under. Navarro et al. (2005) found

that S. oleraceous that was infected with LBVD was symptomless whilst Campbell

(1965) described yellow vein banding and chlorosis. It is unclear which virus caused the

symptoms observed by Campbell (1965) as these were observed before the discovery of

MLBVV as the symptom causing virus associated with LBVD (Lot et al. 2002).

135

In the initial experiment, 28 out of 30 S. hydrophilus leaf tissue samples tested positive

for LBVaV and 16 out of 30 tested positive for MLBVV. However, in the following

experiment, S. hydrophilus leaf tissue samples failed to test positive for LBVaV and

only MLBVV was detected and even then in only four out of the 30 samples. The

inconsistency of these results may be associated with fluctuating temperatures within

the environment controlled growth facility. During the initial experiment, growth room

conditions remained constant. However, during the latter experiment, there were

fluctuations in the temperature due to mechanical failure. The experiment was done in

summer (January and February, 2008). During this period of mechanical failure,

daytime outside temperatures occasionally exceeded 40°C. In addition, Olpidium sp.

isolates infected with LBVaV have been reported to reproduce better between 10-16°C

than at 22°C and are known to reproduce poorly at 27°C (Fry and Campbell, 1966).

Teakle and Thomas (1985) showed that Olpidium sp. associated with LBVD multiplied

at 20°C but not at 29°C. Thus, temperature may have not only affected the interaction of

the host and the viruses but also the activities of the vector.

In the initial experiment, the negative control plants grown in un-infested potting mix

showed a higher number of S. hydrophilus plants infected with MLBVV in their leaves

than those grown in soil infested with LBVD. Four of the 33 plants grown in the

infested soil inoculum tested positive for MLBVV whereas five of the 25 plants grown

in a separate growth room tested positive for MLBVV. LBVaV was also detected in ten

of the 25 S. hydrophilus plants grown in un-infested potting mix. In each DAS-ELISA

test there were clear negative and positive control absorbance readings from the plate so

it is unlikely that these results were due to false positives. The growth room had

previously been used for growing LBVD infected lettuce and viruliferous O. virulentus

136

resting spores could have still been present on the benchtop and on the floor of the

growth room. Between experiments, the growth room had not been disinfected but just

swept to remove plant debris and soil.

That such contamination had occurred is supported by the observation in a previous

experiment using LBVD pathogen infested soil in that particular growth room, where a

lettuce seed which had germinated in the crack between the floor and the wall of the

growth room showed visible vein chlorosis, consistent with LBVD. It is also possible

that the potting mix used was already infested with viruliferous O. virulentus resting

spores. It is noteworthy in that in another experiment in this study, when potting mix

was sterilised by autoclaving it three times at 120°C for 40mins (Chapter 6, 6.3.5),

lettuce plants grown in new pots tested negative by DAS-ELISA for both LBVaV and

MLBVV. The negative control S. asper plant which was grown in a growth room

separate from the others also tested positive for both LBVaV and MLBVV, suggesting

not only is it the most susceptible species to both viruses, but also that the potting mix

used was in fact inadvertantly contaminated with viruliferous O. virulentus resting

spores.

This study also highlights the pathogenicity of O. virulentus, LBVaV and MLBVV and

the need for strict sanitation practices in lettuce production. The results from these

experiments have direct relevance for lettuce farmers and those involved in the

production of lettuce seedlings in a nursery environment. Jones (2004) proposed

integrated disease management strategies to minimise LBVD infection in lettuce crops,

lettuce seedling nurseries and nutrient film growing conditions. Jones (2004) suggested

that in areas of infested land, seedling nurseries and where nutrient film techniques are

137

employed, that weeds and „volunteer‟ crop plants be removed by selective herbicide or

by hand in order to remove both the internal and the external sources of the viruses and

the vector. It was also suggested that in seedling nurseries, all potting media, benches,

seedling trays and floors should be sterilised to avoid introducing new infections via the

vector‟s resting spores (Jones 2004).

It has been shown that one of the most common weeds found in lettuce growing fields

in south-west Australia, S. oleraceous, is highly susceptible to both LBVaV and

MLBVV with 26/30 root samples testing positive to and 30/30 root samples testing

positive to MLBVV. A. calendula is also a common weed in Western Australia and a

field sample of it tested positive for MLBVV on one occasion. Even though in some

cases the viruses are not moving systemically throughout the plant, these weeds can still

effectively act as reservoirs by providing a host for the Olpidium vector and the virus

species. In a system where crop rotation is being administered or where land is left

vacant, agricultural weeds may increase persistence of LBVD that is occurring anyway

through dormant resting spores (Navarro et al. 2005). By employing weed removal into

an Integrated Disease Management Strategy, the number of viruliferous resting spores

would be greatly reduced. These results have implications in the strategies for the

management of the disease in the Western Australian environment and therefore will be

discussed in greater detail in the General Discussion (Chapter 8).

138

Chapter 8 – General Discussion

This study has determined not only the identity and the phylogeny of MLBVV and

LBVaV and their vector O. virulentus, all associated with LBVD in Western Australia,

but also some aspects of the sources of inoculum of the viruses and the vector. A better

understanding of the pathogen/vector and the nature of the disease is expected to help in

improving strategies to minimise spread and/or the severity of the disease in Western

Australia and widely in the world.

The diagnosis of MLBVV associated with LBVD in Western Australia was not

unexpected as it has been established to be the causal agent of LBVD by previous work

done in Europe (van der Wilk et al. 2002; Navarro et al. 2004; Navarro et al. 2005a),

Japan, (Kawazu et al. 2003) and America (Hayes et al. 2006; Sanches 2006). It is

interesting that in this study lettuce, S. oleraceous and one plant of A. calendula were

the only species among those tested found naturally infected in the field. This indicates

that the natural host range of LBVaV and MLBVV may be limited although the disease

is widespread as suggested previously by others (Sahtiyacnci 1962; Campbell and Lin

1976; Hartwright et al. 2009). It not only confirms that LBVD is a serious disease of the

lettuce crop but also that it is able to spread and survive in the Western Australian

environment effectively as found previously (Latham et al. (2004); Latham and Jones

2004) .

The complete coat protein (CP) coding region sequences of 13 Western Australian

MLBVV isolates all fitted within clade A following phylogenetic examination of

MLBVV in this study involving isolates from across five continents which revealed two

139

clades, A and B. Twelve of the 13 Western Australian isolates belonged in

geographically distinct sub-clade A1 which contained no other isolates whilst the 14th

isolate from Western Australia fitted into sub-clade A3 which also included isolates

from Europe and Japan. This indicates that there were probably at least two

introductions of MLBVV into Western Australia. Clade B was found to contain only

isolates of MLBVV from Spain reflecting the Mediterranean region as the centre of

domestication of the crop (Whitaker 1969). Navarro et al. (2005b) previously reported

clade A and clade B but did not discriminate sub-clades as done in this study. It is

important to note that all indications in this thesis only relate to Western Australia in

relation to information on GenBank from elsewhere because concurrent work was not

carried out in relation to the distribution of this virus elsewhere in Australia.

It is also noteworthy that the CP coding region of MLBVV was highly conserved across

five continents. Considering that lettuce originated in Egypt and then moved next into

the southern region of the Mediterranean basin (Lindqvist 1960), it is likely that the

virus and the host were spread elsewhere from this region together. This may explain

why the CP coding region is so highly conserved.

The 12 Australian isolates that were more highly conserved than the rest may indicate

that the vector and isolates within sub-clade A1 arrived together and spread from a

common source within the Australia. Therefore, the distribution patterns would be

expected to be rather limited given the limited areas within Australia where there are

horticultural industries and the advent of agriculture only 200 years ago following

European colonisation. However, presence of the isolate in sub-clade A3 indicates a

second introduction of the virus. Determining the incidence of these two sub-clade

140

introductions would involve comparing isolates of MLBVV from horticultural areas

within Western Australia, South Australia, Victoria, Queensland and Tasmania where

lettuce is commercially grown to see if both members of sub-clades occur across the

continent.

This study also reports for the first time, the ability of two Australian native plant

species Actites sp. and S. hydrophilus to be hosts for MLBVV. As the screening of

native plants in this study was limited to available seed, it is not known how many other

native Australian plants could be symptomatic or asymptomatic carriers of MLBVV.

Such knowledge is important because south-west Australia experiences a Mediterranean

climate in which in summer all annual plants die unless they are irrigated [Reichardia

sp. are annual or perennial, S. asper are annual or biennial, S. hydrophilus is either

annual, biennial or perennial, S. oleraceous is annual and Actites sp. are perennial,

(CALM 2007)]. The perpetuation of the virus in these annual plants could be limited to

situations where they are externally seed-borne in the resting spores of O. virulentus

which may not account for the widespread occurrence of this virus. Even if there was

only limited carry-over of the virus on seed, the fact that Australian native plants can be

a reservoir for MLBVV could be significant for both the Australian environment and for

commercial lettuce production. Crop viruses such as Bean yellow mosaic virus (BYMV)

in Western Australia have been shown to cause symptoms such as generalised leaf

distortion, vein clearing, chlorotic mosaic and severe plant dwarfing in the native plant

Kennedia prostrata (Webster et al. 2007). Webster et al. (2007) also suggested that

humans facilitate the frequency by which native plant communities come into contact

with crop viruses and that this could affect biodiversity.

141

The exact role of LBVaV in LBVD still remains unclear as it is generally considered

that infection with this virus does not induce symptoms in lettuce (Colariccio et al.

2005; Roggero et al. 2003). Even when lettuce is infected, it is an asymptomatic carrier

of LBVaV (Lot et al. 2002). It is also not known whether this virus has an additive or

synergistic effect on the expression of the disease in the presence of MLBVV. However,

while Colariccio et al. (2005) and Roggero et al. (2003) both report no evidence of

synergism, Roggero et al. (2003) suggest this lack of synergism may reflect the poor

detection of the two viruses rather than proof of LBVaV on its own causing the

symptoms or adding to the level of symptom expression. In tests in which LBVaV and

MLBVV were baited out of infested soil using seedlings, 88% of the soils assayed in

this study from nurseries were positive for MLBVV and 69% of the samples were

positive for both LBVaV and MLBVV, suggesting a receptiveness from lettuce to both

of these viruses even though there is little indication that the two viruses are interacting

with each other.

This study was successful in obtaining seven complete CP coding region sequences of

different LBVaV isolates which resulted in the establishment of two clades using these

sequences and those available on GenBank. All isolates from Western Australia were

distinct from the others but were most closely related to the Japanese isolates of LBVaV

and TStV (clade II) than to LBVaV isolates from Europe (clade I). This study also

showed that the CP of LBVaV is even more highly conserved than the highly conserved

CP region of MLBVV. This may indeed reflect the possibility of LBVaV having existed

in Australia even before lettuce was introduced as a crop. This is similar to the origin

reported for LNYV. LNYV was first described in Australia and has been considered as

originating from plant species endemic to Australia (Randles and Carver 1971). Also

142

LBVaV may have stabilised as a latent virus in a variety of hosts including lettuce and

with little selection pressure by the host to modify itself to the extent that MLBVV may

have had. Another possibility for the highly conserved nature of the LBVaV CP coding

region is that it is a recent introduction and evolutionary processes are yet to have

occurred.

O. virulentus was associated with both LBVaV and MLBVV in this study but, what was

interesting, was that O. brassicae was only detected in one root extract out of more than

80 that were tested throughout the course of this study. This is also the first report of

LBVaV being associated with O. virulentus as previous work done by Sasaya and

Koganezawa (2006) investigated MLBVV and TStV, but not LBVaV.

It is not clear whether O. brassicae was associated with other hosts in this study. In

early studies prior to the molecular detection of O. virulentus, Olpidia commonly

carried on grasses and field crops, especially cucurbits, were not only misidentified as

O. brassicae but also as the vector of LBVaV and MLBVV. Considering recent work,

especially from Spain (Herrera-Vasquez et al. 2009), it is clear that O. brassicae is not

common in horticultural fields in several countries and even where it did occur (which

was only 4.5% of the plants studied), it occurred only on broccoli and cabbage both

belonging to the family Cruciferae. Hartwright et al. (2009) have described three

different Olpidium isolates based on phylogenetic analysis of the ITS region sequence

and host range. O. brassicae was found to infect broccoli but not lettuce or carrot whilst

one isolate failed to infect cucumber. Olpidium isolated from lettuce failed to infect

broccoli or carrot and one isolate did not infect cucumber. Olpidium isolated from carrot

infected lettuce but failed to infect broccoli or cucumber. From this study, Hartwright et

143

al. (2009) propose that the broccoli-infecting isolates still be referred to as O. brassicae

whilst the lettuce-infecting isolates be referred to O. compositae as they infect other

members of the family Compositae and that the third group of isolates found to infect

cucumber be referred to as O. cucurbitaceae. Based on morphological characteristics,

Hartwright et al. (2009) also challenge the suggestion of Sahtiyanci (1962) to include

these species of Olpidium in the genus Pleotrachelus.

O. bornovanus was observed on 53% of all the plants studied by Herrera-Vasquez

(2009) which were collected over a ten year period from Brazil, Guatemala, Honduras,

Mexico, Panama, Portugal, Spain, the Netherlands, Tunisia, Uruguay, and the USA. It

was clearly the most common of the three Olpidium species they studied. Although

more Olpidium species are described in the literature, the scientific verification of these

species is still to be carried out because most of these species have not yet been

identified through molecular methods. O. virulentus is apparently the vector for LBVD

in Western Australia. Although under natural conditions, O. virulentus has been

reported elsewhere on melon, watermelon and tomato in addition to lettuce, in this

study, under natural conditions, MLBVV was found only in lettuce, S. oleraceous and

once on A. calendula.

Complete rDNA ITS sequences of five Western Australian isolates of O. virulentus

were obtained in this study and the phylogenetic analysis showed that the Western

Australian isolates are highly conserved and this again may indicate the uniformity of

the population in Western Australia even though the sequenced isolates were found in

two sub-clades which suggests two possible introductions of O. virulentus. The first

sub-clade included four of the five isolates as well as isolates from Europe and Japan

144

whilst the second sub-clade contained one Western Australian isolate and one other

from Japan. It is interesting that Japanese isolates are represented in both sub-clades in

which the Western Australian isolates are associated and this suggests that it is possible

both came from the same source, originally in The Mediterranean. It seems unlikely that

these isolates were moved from Japan to Australia after European colonisation. Possibly

they occur concurrently in the Western Pacific Rim. This could be established only if a

wider study is carried out of the populations that occur in China and other countries in

this region where lettuce is grown.

Management strategies realistically are not about control of the disease but about

prevention of the spread of the LBVD to virgin farming land which is currently free of

the disease (if such areas exist) and the reduction of inoculum potential. So the

management of LBVD relates to two major points. Firstly, the study of the source(s) of

the inoculum to prevent the spread of the vector and/or the viruses from production

nurseries to lettuce growers who have started cultivation on virgin lands which are

assumed to be free of LBVD contamination. Secondly, a further reason why

management of LBVD is functional is evident in the work done by Latham et al. (2004)

which shows that early infection of lettuce seedlings with LBVD causes more severe

symptoms and greater yield loss than infections which occur later once the seedlings

have been planted in the field (Fig 8.1). Prevention of LBVD at the early stages lettuce

of production, for example, in commercial seedling nurseries, can increase yields

because even where the plants are subsequently exposed to field inoculum, this is likely

to cause later infections with smaller yield losses than when infections occur early as a

consequence of early seedling infection in nurseries (Latham et al. 2004).

145

Nursery Field

Commercial lettuce seedling nurseries Commercial lettuce farms

1.

Seeds 2.

Weeds

3.

Potting

mix 4.

Water

Infected seedlings

Reduced yield

New field

8.

Weed seeds

10.

Machinery

12.

Flood and

irrigation

13. Dust storms

5. Dust

9. Weeds

6. Dry crop debris

7. Infested field soil

11. Dry crop debris

Fig. 8.1: Flow chart representing the possible sources of inoculum of LBVD carried in/on O. virulentus both in the seedling nursery environment and

also in the lettuce production fields in Western Australia. These potential sources are indicated by the broken arrows whilst inoculum sources which

have been determined in this study or by Latham et al. (2004) have been indicated by solid arrows.

146

One of the main outcomes of this study is the finding that the seeds can carry

viruliferous O. virulentus resting spores externally on the seed coat. This is significant

because even with nursery hygiene, potting mix sterilisation and all other sanitary

precautions that should ideally be associated with lettuce seedling production in a

seedling nursery, lettuce seeds still can bring in the disease into the nursery (No. 1, Fig.

8.1). Surface sterilisation to eliminate viruliferous O. virulentus resting spores would be

required to overcome this. This is a significant finding in relation to the epidemiology of

LBVD. O. bornovanus which is the vector of MNSV has similarly been shown to be

externally seed-borne (Faruki 1981; Campbell et al. 1996). In addition to the

constituents of potting mix being a potential source of inoculum as reported by Latham

et al. (2004), seeds too should be considered as an alternative source of infection, which

could be negated by the use of surface sterilisation of the seeds prior to being coated by

applying methods described in Chapter 6 relating to use of a 2% aqueous NaOCl

solution and/or a10% aqueous Na3PO4 solution.

Hardy and Sivasithamparam (1988) reported that Western Australian nurseries carry

eight different species of Phytophthora and proposed that nurseries were the source of

new strains and new species of that pathogen in Western Australia. Similarly, it is

possible for production nurseries to supply lettuce seedlings grown from seeds that

could introduce new strains and/or species of viruses into the farming environment.

Although LBVaV and MLBVV have not been detected internally within lettuce seed (in

the embryo), external transmission in the vector resting spores could be serious even at

low concentrations because that can result in the introduction of LBVD to uninfected

land and production areas. In addition to the example already described in Chapter 6 of

vector dependent virus transmission in which O. bornovanus zoospores acquired and

147

transmitted MNSV that contaminated the surface of melon seed, a similar

seed/pathogen relationship is described with white rust on brassicas. Barbetti (1981)

reported that the seeds of Brassica rapa carrying oospores of Albugo candida (white

rust) borne externally could well function as the means of introducing this disease into

commercial oilseed brassica fields in areas where the disease never existed before.

Weeds may play an important role in the spread and the carry-over of the vector and the

virus despite the long term survival of viruliferous resting spores in soil. The fact that S.

oleraceous and A. calendula, two of the most common weed species in agricultural

regions of Western Australia, might be implicated in the spread and survival of LBVD

indicates that management of these weeds, even though it would not eradicate LBVD,

would help to reduce both the level of inoculum potential in the soil over a period of

years and subsequent incidence/severity of the disease (No. 9, Fig 8.1). Weed removal

was also suggested as part of disease management strategy for the control of TSWV in

Western Australia which weeds have been shown to act as virus reservoirs (Latham and

Jones 1997). Although weeds from nurseries were not tested in this study, given the

highly susceptible nature of S. oleraceous in particular to LBVD, weeds in nurseries are

a suspected source of inoculum (No. 2, Fig. 8.1) which justifies the management of

weeds already included in the disease management strategy for LBVD (Jones 2004) and

also suggested by Navarro et al. (2005b). While it is also possible that weeds or weed

seeds infected with LBVD might sometimes enter the seedling nursery environment in

potting mix purchased by the seedling nursery thereby introducing the virus (No. 3 Fig.

8.1), this remains to be determined (as indicated by the dashed arrow in Fig. 8.1).

Potting mix and peat purchased by seedling nurseries for composting and use in their

148

commercial mix have been shown to be a source of LBVD inoculum (Latham et al.

2004) and this is represented as a solid arrow in Fig. 8.1.

Previous studies done on the occurrence of LBVaV and MLBVV separately on

individual weed plants have only included S. oleraceous (Navarro et al. 2005b) and

found that LBVaV occurred as a single infection in six of the plants tested whilst

MLBVV was never found as a single infection but only as a double infection with

LBVaV in four of the plants tested. It would be valuable to know of any interaction

between the two viruses within other weed species as this would provide further

knowledge regarding LBVD epidemiology and may have additional implications on

weed removal management strategies. It is also noteworthy that while LBVaV seems

latent not only in lettuce but also in the experimental test hosts Nicotiana benthamiana

and N. clevelandii (Huijberts et al. 1990). It is also not known, as with lettuce, whether

the presence of this virus may predispose the weeds to MLBVV infection which may be

important in the epidemiology of LBVD.

Disinfection of soil and potting mix, surface disinfection of seed and the use of clean

water and clean production areas are all important in the management of LBVD in

seedling production nurseries in Western Australia (Latham et al. 2004). Latham et al.

(2004) have also shown that contaminated potting mix is a source of inoculum for

lettuce seedling nurseries (No.3, Fig. 8.1) and even though not practical on a large scale,

this study (Chapter 6) has demonstrated that autoclaving potting mix three times at

120°C for 40min is effective in eradicating O. virulentus resting spores. Sterilisation of

potting mix and soil within commercial seedling nurseries was suggested by Latham et

al. (2004) and Jones (2004) as an important disease management strategy.

149

Water is also a possible source of LBVD in seedling nurseries and the reduction of

LBVD, which is transmitted through water (No. 4 Fig. 8.1), could be managed by the

use of filtration, which has been used successfully by nurseries to manage the spread of

Phytophthora (Ufer et al. 2005), or water may be decontaminated by chlorination or by

exposure to UV light before coming into contact with susceptible plants

(Sivasithamparam and Goss 1981; Tomlinson 1988). In addition, another source of

LBVD inoculum both in the nursery environment and the field could be by wind

dispersal if O. virulentus is carried in windborne dust (Nos. 5 and 13 Fig. 8.1) and also

with viruliferous resting spores being associated with dry crop debris within the

seedling nursery (Jones, 2004), (No. 6, Fig. 8.1).

LBVD can enter commercial lettuce growing fields via a number of routes (Fig. 8.1).

The primary source of inoculum is with the infested field soil which seedlings are being

grown (No. 7, Fig. 8.1) and the level of inoculum in infested field soil may also be

increased if there is dry crop debris left in the field (No. 11, Fig. 8.1). As previously

discussed, weeds are a source of inoculum in lettuce growing fields but given that the

seeds of S. oleraceous have a similar morphology to lettuce seeds, for example

longitudinal ribs along the surface, it is reasonable to speculate that weed seeds could

also be a source of LBVD inoculum in lettuce growing fields (No. 8, Fig. 8.1).

Contaminated weed seeds could transmit LBVD not only to lettuce but also to other

susceptible weed species including A. calendula and facilitate both the spread and the

persistence of LBVD in the field. It is also possible that, as seen with studies done on

Phytophthora (Sivasithamparam and Goss 1981), O. virulentus resting spores carrying

LBVaV and/or MLBVV could be transmitted on farm machinery [also suggested by

Jones (2004) and also on the footwear of farm workers (No. 10 Fig. 8.1)]. Some

150

commercial lettuce growing farms investigated in this study cultivate more than one

farm in which lettuce is grown and machinery such as tractors, trucks and other vehicles

are driven onto and between farms without any implementation of disinfection

strategies.

If more annual and perennial native plants are discovered to be hosts of LBVaV and

MLBVV, even if they are found to be asymptomatic, then that may add another

complexity to the LBVD story in the long term management of the disease. It is

possible that native plants which have natural infections of LBVD act as reservoirs and

if they are found to be growing in native vegetation close to lettuce growing fields,

motile O. virulentus zoospores carrying both LBVaV and MLBVV could be transported

through water by a flooding event (No. 12, Fig. 8.1). As with the consideration for

contaminated water sources in the nursery environment, the same sterilisation or

filtration management options discussed earlier also apply in relation to irrigation water

used in lettuce fields (No. 12, Fig. 8.1). However, this is not likely to be practical where

irrigation water is used in large volumes.

In conclusion, this investigation has established the phylogenetic relationships of

LBVaV, MLBVV and O. virulentus isolates from Western Australia to those in other

parts of the world. This study has also associated viruliferous O. virulentus resting

spores as external contaminants of lettuce seed and identified four new hosts of

MLBVV [A. calendula (tentative host), S. hydrophilus, Reichardia sp. and Actites sp.]

along with three new hosts of LBVaV (S. hydrophilus, Reichardia sp. and Actites sp.).

This new knowledge obtained regarding the epidemiology of LBVD can help to

enhance the effectiveness of the existing integrated management strategy for this

151

disease in order to reduce its spread and impact in Western Australia both in seedling

nurseries and also in lettuce growing fields. However, it is essential that the information

presented within this thesis and previously done by others (Latham et al. 2004 and

Jones 2004) be made available to both lettuce seedling nurseries and lettuce farmers

through extension bulletins, seminars or individual farm visits so that producers have

access to the information they need for better control the disease.

152

Appendix 1 – Amount of PCR product or plasmid used in

sequencing reactions

Origin of DNA/RNA used to generate sequence data, the primers used and the amount

of each plasmid/PCR product used for each sequencing reaction.

Plant

origin

Primer set used

to generate

amplicon

Species

amplified

Plasmid or

PCR

product

Amount of

plasmid/PCR product

sequenced per reaction

(ng)

AUSA5 L1-21/L700-679 LBVaV PCR product 95

AUSA5 L511-531/L1210-

1185

LBVaV PCR product 75

AUSB1 L1-21/L700-679 LBVaV Plasmid 702

AUSB1 L511-531/L1210-

1185

LBVaV Plasmid 684

AUSB2 L1-21/L700-679 LBVaV Plasmid 664

AUSB2 L511-531/L1210-

1185

LBVaV Plasmid 740

AUSE4 L1-21/L700-679 LBVaV PCR product 72

AUSE4 L511-531/L1210-

1185

LBVaV Plasmid 698

AUSE5 L1-21/L700-679 LBVaV PCR product 159

AUSE5 L511-531/L1210-

1185

LBVaV Plasmid 684

AUSE6 L1-21/L700-679 LBVaV Plasmid 618

AUSE6 L511-531/L1210-

1185

LBVaV Plasmid 917

AUSG1 L1-21/L700-679 LBVaV Plasmid 662

AUSG1 L511-531/L1210-

1185

LBVaV Plasmid 492

AUSA1 M2-21/M899-880 MLBVV PCR product 56

AUSA1 VP286/VP289 MLBVV PCR product 66

AUSA2 M2-21/M899-880 MLBVV Plasmid 572

AUSA2 VP286/VP289 MLBVV Plasmid 636

AUSB2 M2-21/M899-880 MLBVV PCR product 120

AUSB2 VP286/VP289 MLBVV PCR product 48

AUSC1 M2-21/M899-880 MLBVV PCR product 35

AUSC1 VP286/VP289 MLBVV PCR product 47

AUSD1 M2-21/M899-880 MLBVV PCR product 49

AUSD1 VP286/VP289 MLBVV PCR product 89

AUSE1 M2-21/M899-880 MLBVV PCR product 44

AUSE1 VP286/VP289 MLBVV PCR product 40


AUSE2 VP286/VP289 MLBVV Plasmid 351

153







AUSF1 M2-21/M899-880 MLBVV PCR product 24

AUSF1 VP286/VP298 MLBVV Plasmid 569

AUSG1 M2-21/M899-880 MLBVV PCR product 50

AUSG1 VP286/VP289 MLBVV PCR product 72

AUSG2 M2-21/M899-880 MLBVV PCR product 37

AUSG2 VP286/VP298 MLBVV Plasmid 421

Col1 Ob1/ITS4 O. virulentus Plasmid 530

Col1 ITS1/Ob2 O. virulentus PCR product 33

Col2 Ob1/ITS4 O. virulentus Plasmid 542

Col3 Ob1/ITS4 O. virulentus PCR product 33

Nan6 Ob1/ITS4 O. virulentus Plasmid 535

Nan6 ITS1/Ob2 O. virulentus PCR product 53





T123 Ob1/ITS4 O. virulentus PCR product 58

T123 ITS1/Ob2 O. virulentus PCR product 63

154

Appendix 2 – The reagents used in each of the different DAS-

ELISA solutions

Coating buffer in 1L dH2O

Na2CO3 1.59g

NaHCO3 2.93g

pH 9.6

PBST in 1L dH2O

NaCl 8.0g

KH2PO4 0.2g

Na2HPO4 1.15g

KCl 0.2g

PVP 20g

Tween 20 5.0g

pH 7.4

Substrate buffer in 1L dH2O

Diethanolamine 106.7mL

pH 9.8

Washing buffer in 5L dH2O

NaCl 40g

KH2PO4 1g

Na2HPO4 5.75g

KCl 1g

Tween 20 10g

Saline Wash Solution in 1L dH2O

NaCl 8.8g

155

Appendix 3 - O. virulentus ITS sequences (5' to 3')

Nan 6 (634bp) GQ304519

TCCGTAGGTGAACCTGCGGAAGGATCATTATAAAAAATTCGGGCTTGGGTTTAACCCAA

GACCTGCCCCCAAAAGGGACCTTTTGTGCACTGTAAAATTTTTTCACTTAAGCTTTGTC

TGATTGATATTTGTCCCGAAAGGGACAAGAATTTTAATCTAAAACAACTTTTAACAATG

GATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT

GCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCCGGCATTCCGGA

GAGCATGCCTGTTTGAGTATTGGCCTAAACGAGAGTCTTCCTTTAAAGATATAAAAAAG

AACGTTAAGAACCCTCAGTTGAGACTTCTCGACAATTCATTGCCGAGTGTTTTAAAATG

CAATAGTACCGCCACGGTTTGCGAACTTGGAGTAATATGTGAGCCTGAAAAGGTGACCT

CTATTCTCCTCGGACCACGTAGACCTGTTAAGCGGGAAGTTTTTGAATGCCGAATTATG

GGAGACGGTGTTCAATTGTTCGAGTAAACGACGAACGAAATAAACTCAATCTCAAATCA

GGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Nan 7 (632bp) GQ304520

TCCGTAGGTGAACCTGCGGAAGGATCATTATAAAAAAGTCGGGCTTGGGTTTAACCCAA


TGATGGATATTTGTACCGAAAGGGACAAGAATTTTAATCTAAAACAACTTTTAACAATG



GAGCATGCCTGTTTGAGTATTGGCCTAAACGAGAGTCTTCCTTTAAAGATATAAAAAAG


CAATAGTACCGCCACGTTTGCGAACTTGGAGTAATATGTGAGCCTGAAAAGGTGACCTC

TATTCTCCTCGGACCACGTAGACCTGTTAAGCGGGAAGTTTTTGAATGCCGAATTATGG

GAGACGGTGTTCAATTGTTCGAGTAACGACGAACGAAATAAACTCAATCTCAAATCAGG

TAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

156

Nan 8 (632bp) GQ304521

TCCGTAGGTGAACCTGCGGAAGGATCATTATAAAAAAGTCGGGCTTGGGTTTAACCCAA

GACCTGCCCCCAAAAGGGACCTTTTGTGCACTGTAAAATTTTTTCACTTAAACTTTGTC

TGATTGATATTTGTACCGAAAGGGACAAGAATTTTAATCTAAAACAACTTTTAACAATG



GAGCATGCCTGTTTGAGTATTGGCCTAAATGAGAATCATCCTTTAAAGATATAAAAAAG


CAATAGTACCGCCACGTTTGCGAACTTGGAGTAATATGTGAGCCTGAAAAGGTGACCTC

TATTCTCCTCGGAGCACGTAGACCTGTTAAGCGGGAAGTTTTTGAATGCCGAATTATGG

GAGACGGTGTTCAATTGTTCGAGTAACGACGAACGAAATAAACTCAATCTCAAATCAGG

TAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Col 1 (633bp) GQ304523






GAGCATGCCTGTTTGAGTATTGGCCTAAATGAGAGTCTTCCTTTAAAGATATAAAAAAG

AACGTCAAGAACCCTCAGTTGAGACTTCTCGACAATTCATTGCCGAGTGTTTTAAAATG


CTATTCTCCTCGTACCACGTAGACCTGTTAAGCGGGAAGTTTTTGAATGCCGAATTATG

GGAGACGGTGTTCAATTGTTCGAGTAACGACGAACGAAATAAACTCAATCTCAAATCAG

GTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

T123 (633bp) GQ304522






GAGCATGCCTGTTTGAGTATTGGCCTAAATGAGAGTCTTCCTTTAAAGATATAAAAAAG

AACGTCAAGAACCCTCAGTTGAGACTTCTCGACAATTCATTGCCGAGTGTTTTAAAATG


CTATTCTCCTCGGACCATGTAGACTTGTTAAGCGGGAAGTTTTTGAATGCCGAATTATG

GGAGACGGTGTTCAATTGTTCGAGTAACGACGAACGAAATAAACTCAATCTCAAATCAG

GTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

157

Col 2 (577bp) GQ328050

CAAGACCTGCCCCCAAAAGGGACCTTTTGTGCACTGTAAAATTTTTTCACTTAAGCTTT

GTCTGATTGATATTTGTACCGAAAGGGACAAGAATTTTAATCTAAAACAACTTTTAACA

ATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA

ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCCGGCATTCC

GGAGAGCATGCCTGTTTGAGTATTGGCCTAAATGAGAGTCTTCCTTTAAAGATATAAAA

AAGAGCGTCAAGAACCCTCAGTTGAGACTTCTCGACAATTCATTGCCGAGTGTTTTAAA

ATGCAATAGTACCGCCACGTTTGCGAACTTGGAGTAATATGTGAGCCTGAAAAGGTGAC

CTCTATTCTCCTCGGAGCACGTAGACCTGTTAAGCGGGAAGTTTTTGAATGCCGAATTA

TGGGAGACGGTGTTCAATTGTTCGAGTAACGACGAACGAAATAAACTCAATCTCAAATC

AGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Col 3 (504bp) GQ328051

AAAGGGACCTTTTGTGCACTGTAAAATTTTTTCACTTAAGCTTTGTCTGATTGATATTT

GTACCGAAAGGGACAAGAATTTTAATCTAAAACAACTTTTAACAATGGATCTCTTGGCT

CTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT

GAATCATCGAATCTTTGAACGCATATTGCGCTCTCCGGCATTCCGGAGAGCATGCCTGT

TTGAGTATTGGCCTAAACGAGAGTCTTCCTTTAAAGATATAAAAAAGAACGTTAAGAAC

CCTCAGTTGAGACTTCTCGACAATTCATTGCCGAGTGTTTTAAAATGCAATAGTACCGC

CACGTTTGCGAACTTGGAGTAATATGTGAGCCTGAAAAGGTGACCTCTATTCTCCTCGG

ACCACGTAGACCTGTTAAGCGGGAAGTTTTTGAATGCCGAATTATGGGAGACGGTGTTC

AATTGTTCGAGTAACGACGAACGAAATAAACT

158

Appendix 4 - MLBVV CP sequences (5' to 3')

AUSG2 GU139114

ATGTCAGGAGTATACAAGGTTTCCGAAATTCAGTCTATCTTGCAAAAAGATGTAACTTC

AGAAGGAGAAACAGCTATTCTAATTTCTCTTGGTCTCATGACAAAAGAAGAGAAGCCTG

TTCCTGCAAAAATGGCCATGGTGGCATCTGCAAAAGCAAACTCAATCATCTTTGTTTCG

GAAGATGGCTCTTTGTCTTTTGAAGCTCCAAAAGAAACAGGAGAGACCAGCAAACCAGG

AGAGAAGAAAGAGGAAAAGAAGGTAGAAGTGGGAGTTAAGTTTCCTTTCAGCGCAGCCA

AAGTAAAGGAGCTAATTGAAGGGAAAAGTCTTACTTTGGATCAGGACAAAATCCAAAAA

GTGCTGGAAGAATATGTTAAGAATTTGCCAAGGACTGCTGAGACTTACAAACCAAAGGA

GATTGAGATCAAATGTTTCAAGGGTGTTGACTTCAGTATCAGCAGTTTGCTTTCTTCAG

GGACCAAAATCTTAGATGCTATTCTTTACAGTACTTACAAGGATTCAGCAGAGCACAAC

TTCATATTTGATGTGAAAGTTCTATCTCCTGATTTCATCGATAGCAAGTTACTCGTGAA

CAACATCGAAACAGGCAATCGAGCAATCAAAGCAGCTTTCTGTCTTGTTTACAATCAAG

GTGGATTGCCATCAAAGACGAGTGAAGAACGACCACTGTCTAAGTTTGTAAGAGAAACG

ATATTCCGTGAGAAAGATCTCAAAGCTAACGAGTTATGTGAATACCTATCATCAGCAGA

TCCTTCTTTGTTTCCAAGTCAAGTCTTTTTGAAAATCTCACTTGAAAACCTTCCTACTG

AGGTTTCATCACGTTGCAAGATGTCGATTGCGGGCAACAAAGCATTGAGATATGCACTC

TTAGCTCAAAAGTTTGACAAAGATGAAATTCCAGTTCCAACAGAAGTGAATCCTACAAC

TAGCTCAGAATACATGCAGAAAAAGGAGAAAATAGAAAAAGCAAAAAAGATAGTTGATG

TTCTATGTTCTCTTGCTTCTGACTTCCAGGCACAAGTGAAAATGCATCCTCTCTCCCCT

GAGAGATCATCGAGGAAGAATTTCACTCTGCAATTGACTTCTGCAATTGTTACTTCACT

TTCCTACAAAGGGAGGTTAGACATGAGAAAAGCAATCGAAGAGAAAAAGATAGAGGCTT

TCAAAAGAGATGAAAATATATTTGGAAGGTTAAATGCTCTTGGACAACCCACGTTTCCT

GTTCTGACTAACGCAGATGCTGACTTTTCTGAATTGTCAGTTGAGGCCGTGAAGACAGC

TTACGGAAAGAAA

AUSE3 GU139115


CGAAGGAGAAACAGCTATTCTAATTTCTCTTGGTCTCATGACAAAAGAAGAGAAGCCTG



AGAGAAGAAAGAGGAAAAGAAGGTAGAAGTGGGAGTCAAGTTTCCTTTCAGCGCAGCCA







159




AGGTTTCATCACGTTGCAAGATGTCGATTGCGGGCAACAAAGCAATGAGATATGCACTC


TAGCTCAGAATACATGCAGAAAAAGGAGAAAATAGAAAAGGCAAAAAAGATAGTTGATG






TTACGGAAAGAAA

AUSE6 GU139116

ATGTCAGGAGTATACAAGATTTCCGAAATTCAGTCTATCTTGCAAAAAGATGTAACTTC






















TTACGGAAAGAAA

160

AUSF1 GU139117






AAGTAAAGGAGCTAATTGAAGGGAAAAGTCTTACTTTGGATCAGGACAAAATCCAAGAA






GTGGATTGCCATCAAAGACGAGCGAAGAACGACCACTGTCTAAGTTTGTAAGAGAAACG

ATATTCCGTGAGAAAGATCTCAAAGCTAACGAGTTATGTGAATACCTATCATCAGCGGA


AGGTTTCATCACGTTGCAAGATGTCGATTGCGCGCAACAAAGCAATGAGATATGCACTC







ATTCTGACTAACGCAGATGCTGACTTTTCTGAATTGTCAGTTGAGGCCGTGAAGACAGC

TTACGGAAAGAAA

AUSB2 GU139118
















161

TTAGCTCAAAAGTTTGACAAAGATGAAATTCCAGTTCAACAGAAGTGAATCCTACAACT

AGCTCAGAATACATGCAGAAAAAGGAGAAAATAGAAAAAGCAAAAAAGATAGTTGATGT

TCTATGTTCTCTTGCTTCTGACTTCCAGGCACAAGTGAAAATGCATCCTCTCTCCCCTG

AGAGATCATCGAGGAAGAATTTCACTCTGCAATTGACTTCTGCAATTGTTACTTCACTT

TCCTACAAAGGGAGGTTAGACATGAGAAAAGCAATCGAAGAGAAAAAGATAGAGGCTTT

CAAAAGAGATGAAAATATATTTGGAAGGTTAAATGCTCTTGGACAACCCACGTTTCCTG

TTCTGACTAACGCAGATGCTGACTTTTCTGAATTGTCAGTTGAGGCCGTGAAGACAGCT

TACGGAAAGAAA

AUSA1 GU139119




GAAGATGGCTCTTTGTCCTTTGAAGCTCCAAAAGAAACAGGAGAGACCAGCAAACCAGG

AGAGAAGAAAGAGGAAAAGAAGGTAGAAGTGGGAGTCAAGTTTCCTTTCAGTGCAGCCA





TTCATATTTGATGTGAAAGTTCTATCTCCTGACTTCATCGATAGCAAGTTACTCGTGAA



ATATTCCGTGAGAAAGATCTCAAAGCCAACGAGTTATGTGAATACCTATCATCAGCAGA

TCCTTCTTTGTTTCCAAGTCAAGTCTTTTTGAAAATCTCACTTGAAAACCTTCCAACTG




TTCTATGTCTTCTTGCTTCTGACTTCCAGGCCCAAGTGAAAATGCATCCTCTCTCCCCT





TTACGGAAAGAAA

162

AUSE4 GU139120




GAAGATGGCTCTTTGTCCTTTGAAGCTCCAAAAGAAACAGGAGAGACCAGCAAACCAGG

AGAGAAGAAAGAGGAAAAGAAGGTAGAAGTGGGAGTCAAGTTTCCTTTCAGTGCAGCCA





TTCATATTTGATGTGAAAGTTCTATCTCCTGACTTCATCGATAGCAAGTTACTCGTGAA



ATATTCCGTGAGAAAGATCTCAAAGCCAACGAGTTATGTGAATACCTATCATCAGCAGA

TCCTTCTTTGTTTCCAAGTCAAGTCTTTTTGAAAATCTCACTTGAAAACCTTCCAACTG







TCAAAAGAGATGAAAATATATTCGGAAGGTTAAATGCTCTTGGACAACCCACGTTTCCT


TTACGGAAAGAAA

AUSG1 GU139121







GTGCTAGAAGAATATGTTAAGAATTTGCCAAGGACTGCTGAGACTTACAAACCAAAGGA









163




GAGAGATCATCAAGGAAGAATTTCACTCTGCAATTGACTTCTGCAATTGTTACTTCACT


TCAAAAGAGATGAAAATATATTTGGAAGATTAAATGCTCTTGGACAACCCACGTTTCCT


TTACGGAAAGAAA

AUSE1 GU139122















AGGTTTCATCACGTTGCAAGATGTCAATTGCGGGCAACAAAGCAATGAGATATGCACTC





TTCCTACAAAGGGAGGTTAGACATGAGAAAAGCAATCGAAGAAAAAAGGATAGAGGCTT



TTACGGAAAGAAA

164

AUSD1 GU139123



TTCCTGCAAAAATGGNCATGGTGGCATCTGCAAAAGCAAACTCAATCATCTTTGTTTCN




















TTACGGAAAGAAA

AUSA2 GU139124













ATATTCCGTGAGAAAGATCTCAAAGCTAACGAGTTATGTGAATACTTATCATCAGCAGA



165


TAGCTCAGAATACATGCAGAAAAAGGAGAAAATAGAAAAAGGAAAAAAGATAGTTGATG





GTTTTGACTAACGCAGATGCTGACTTTTCTGAATTGTCAGTTGAGGCCGTGAAGACAGC

TTACGGAAAGAAA

AUSC1 GU139125


CGAAGGAGAAACAGCTATTCTAATTTCTCTTGGTCTCATGACAAAAGAGGAGAAGCCTG










GTGGATTGCCATCAAAGACGAGTGAAGAGCGACCACTGTCTAAGTTTGTAAGAGAAACG






TTCTATGTTCTCTTGCTTCTGACTTCCAGGCACAAGTGAAAATGCATCCTCTCTCTCCT

GAGAGATCATCGAGGAAGAATTTCACCCTGCAATTGACTTCTGCAATTGTTACTTCACT




TTACGGAAAGAAA

166

AUSE2 GU139126

ATGTCAGGAGTATACAAAGTTTCCGAAATTCAGTCTATCTTGCAAAAGGATGTAACTTC


TTCCTGCAAAAATGGCCATGGTGGCATCTGCAAAAGCTAACTCAATCATCTTTGTTTCA

GAAGATGGCTCTCTGTCTTTTGAAGCTCCAAAGGAAACAGGAGAGACCAGCAAACCAGG

AGAAAAGAAAGAGGAAAAGAAGGTAGAAGTGGGGGTCAAGTTTCCTTTCAGTGCAGCCA

AAGTAAAGGAGCTAATCGAAGGGAAAAGTCTTACTTTGGATCAGGACAAGATCCAAAAA

GTGCTGGAAGAATATGTTAAAAATCTGCCAAGGACTGCTGAGACTTACAAACCAAAAGA

GATTGAAATCAAATGTTTCAAGGGTGTTGACTTCAGTATCAGCAGTTTGCTTTCTTCAG

GGACCAAAATCCTAGATGCTATTCTCTACAGTACTTACAAAGATTCAGCGGAGCACAAC

TTCATATTTGATGTAAAAGTTCTATCCCCTGATTTCATCGACAGCAAGTTACTCGTGAA

CAACATAGAAACAGGCAATCGAGCAATCAAAGCAGCTTTCTGTCTCGTTTACAATCAAG

GTGGATTGCCATCAAAGACGAGTGAAGAACGACCACTATCCAAGTTTGTAAGAGAAACG

ATATTCCGTGAGAAAGATCTCAAAGCTAACGAGTTATGTGAATACTTGTCATCAGCGGA

TCCTTCTTTGTTTCCAAGTCAAGTCTTTTTGAAAATCTCACTTGAGAACCTTCCTACTG

AGGTTTCATCACGCTGCAAGATGTCGATTGCAGGCAACAAAGCAATGAGATATGCACTT

TTAGCTCAAAAGTTTGACAAAGATGAAGTTCCAGTTCCAACAGAAGTGAATCCTATAAC

TAGCTCAGAATACATGCAGAAAAAGGAGAAAATAGAGAAAGCAAAAAAGATAGTTGATG



TTCTTACAAAGGGAGGTTAGACATGAGAAAAGCAATCGAAGAGAAAAAGATAGAGGCCT

TCAAAAGAGATGAAAATATATTCGGAAGGTTAAATGCTCTTGGACAGCCTACGTTTCCT

GTTCTGACTAACGCAGATGCTGACTTTTCCGAATTGTCAGTTGAGGCCGTGAAGACAGC

TTACGGAAAGAAA

167

Appendix 5 - LBVaV CP sequences (5' to 3')

AUSE4 GU220721

ATGGCACACCCCAAATTGAAGATGCTAGAGGCATTCAGTGACGTCGTGGAAATCACAGG

TAAGACTGCCGGGAAAGAATCCTGGGATGATGAAAGCACAATAGCTATGCCCTCCTACA

AACTTTCCGTACTGTCCGACGCCGATGCTGTTCGTGAGGTAAAGATCTTCCTGACAGGG

CTCTTTGTGAGGTCCTCTCCGAGGGCGATTGCTGCAGCTCTCATCATGACATGGAACAT

GAGGTCTGTTGATCCCGTGGCTGTCAGAATATTCCCCGCAAAGGACAAGGGGAAAGACA

CAGCGGATGTGGATGTCAAGAATCTGGAGGTGGACGGAGTCGACTACATAGACGCAATG

GTAGAGACCAATGTGAAGGATGCTTCTGATATAGAAATCATCAGAGCCGGAGCATTCAT

CGCTGCTTCTACGCTCAAGATGTTCGCCAAGTCCTTCACTGGATGGACTCAAGCTTGGG

AACACAAGCATATCCAAAAAAGGTATGCTGATTTCTGTAAGACCGAGTATCCATTCAAG

GAATTCACGACAAACACCAAGTGCGCAGAGACCATGTATGAGGCCTACCAGGGTCAAAA

ACTGTATCAAGGAACTCTCGGCCGAATCCTCTATGCTCTGGGAGATGTGGCAGATCCAA

GGCAGACTGAGATGTTGTTCGATCAACATCTTGCCAGCACTGGCATGCACATCACTAGT

GAATTCACAAATGCTCAACTCTCGATCGGTGCCACTACGGCGGGGTTATTAAGTGCTCT

CAACTACGGACAGAACTTTGGCACTCTAATGCAGCTCAAGAAGCTCATCAATGAGAGTC

TCAGCAAACCACCGGGTCCAGACAACAGAGCAACCTGGAGATTTGCCAGGATCTTTGAT

CCATCTGTCTTTCAAACCCTTCAGACAAAATACTGTGCAGATACCGTTGCCATCTTAGC

CAACATCAATTCCATGGGAAAGCTATCTACAGAAACTAGCAATCCTCTGAACATTGCTG

TGCTAAAACAGATGGCTCCGGAGAGGAAGAGGTACACAAGACAGGTGGCGAAGAACATC

TACCATCACTTCATGGTGGTTGCCAGGGCCCTGAACAACGACATGTTCGACACAGACAA

ATACAAGTTTGTGGGATCCGACGATGAGGAGGAACATGTCGCGAATGAGGGAGAGACAC

CAGTAAAGGAG

AUSE5 GU220722












GGCAGACTGAGATGTTGTTCGATCAACATCTTGCCAGCACTGGCATGCACATCACTAGT

GAATTCACAAATGCTCAACTCTCGATCGGTGCCACTACGGCGGGGTTATTAAGTGCTCT

168







ATACAAGTTTGTGGAATCCGACGATGAGGAGGAACATGTCGCGAATGAGGGAGAGACAC

CAGTGAAGGAG

AUSA5 GU220723



AACTTTCCGTACTGTCCGACGCCGATGCTGTTCGTGAGGTAAAGATCTTCCTAACAGGG









GGCAGACTGAGATGTTGTTCGATCAACATCTTGCCAGCACTGGCATGCACATCATCCCC

CAGTTCACAAATGCTCAACTCTCGATCGGTGCCACTACGGCGGGGTTATTAAGTGCTCT








CAGTGAAGGAG

AUSB1 GU220724





GAGGTCTGTTGATCCCGTGGCTGTCAGAATATTCCCCGCAAAGGACAAGGGGAAAGACG

CAGCTGATGTGGATGTCAAGAATCTGGAGGTGGTCGGAGTCGACTACATAGACGCAATG


169





GGCAGACTGAGATGTTGTTCGATCAACACCTTGCCAACACTGGAATGCACATCATCCCC







TACCATCACTTTATGGTGGTTGCCAGGGCCCTGAACAACGACATGTTCGACACAGACAA


CAGAGAAGGAG

AUSB2 GU220725










GAATTCACGACAAACACCAAGTGCGCAGAGACCATGTACGAGGCCTATCAGGGTCAAAA


GGCAGACTGAGATGTTGTTCGATCAACATCTTGCCAACACTGGCATGCACATCATCCCC


CAACTACGGACAGAACTTTGGCACTCTAATGCAGCTCAAAAAGCTCATCAATGAGAGTC



CAACATCAATTCCATGGGAAAGCTATCTACAGAGACTAGTAATCCTCTGAACATTGCTG

TGCTAAAGCAGATGGCCCCGGAGAGGAAGAGGTACACAAGACAGGTGGCGAAGAACATC



CAGTGAAGGAG

170

AUSG1 GU220726

ATGGCACACCCCAAATTGAAGATGCCAGAGGCATTCAGTGACGTCGTGGAAATCACAGG




GAGGTCTGTTGATCCCGTGGCTGTCAGAATATTCCCCGCAAAGGACAAGGGGAAAGACG








CAGTTCACAAATGCTCAACCCTCGATCGGTGCCACTACGGCGGGGTTATTAAGTGCTCT






TATCATCACTTCATGGTGGTTGCCAGGGCCCTGAACAACGACATGTTCGACACAGACAA


CAGTGAAGGAG

171

AUSE6 GU220727





GAGGTCTGTTGATCCCGTGGCTGTCAGAATATTCCCCGCAAAGGACAAGGGAAAAGACG










TCAGCAAACCGCCGGGTCCAGACAACAGAGCAACCTGGAGATTTGCCAGGATCTTTGAT




TATCATCACTTCATGGTGGTTGCCAGGGCCCTGAACAACGACATGTTCGACACAGACAA


CAGTGAAGGAG

172

Appendix 6 – Locations where MLBVV isolates were collected

Western

AustraliaSouth

Australia

Queensland

Northern

Territory

New South Wales

Victoria

Tasmania

Australian

Capital

Territory

A

B

C

D

E

F G

Perth

Wanneroo

Indian

Ocean

20km

Inset 1

N

Indian Ocean

Antarctic Ocean

Pacific Ocean

Map of the Australian continent showing the location of the northern Perth region of

south-western Australia where MLBVV isolates were collected.

Inset 1 shows the locations of the farms sampled (red spots) and letters indicate

individual site codes.

173

Appendix 7 – Locations where LBVaV isolates were collected

Western

AustraliaSouth

Australia

Queensland

Northern

Territory

New South Wales

Victoria

Tasmania

Australian

Capital

Territory

N

Indian Ocean

Antarctic Ocean

Pacific Ocean

A

BE

G

Perth

Wanneroo

Indian

Ocean

20km

Inset 1

Map of the Australian continent showing the location of the northern Perth region of

south-western Australia where LBVaV isolates were collected.

Inset 1 shows the locations of the farms sampled (red spots) and letters indicate

individual site codes.

174

Appendix 8 – MLBVV amino acid and nucleotide distances

Percentage nucleotide (upper diagonal) and amino acid (lower diagonal) sequence identities of the coat protein (CP) encoding sequences of Mirafiori lettuce big-vein

virus. Numbers indicate MLBVV isolates; 1 (AUSG2), 2 (AUSE3), 3 (AUSE6), 4 (AUSF1), 5 (AUSB2), 6 (AUSA1), 7 (AUSE4), 8 (AUSG1), 9 (AUSE1), 10

(AUSD1), 11 (AUSA2), 12 (AUS1), 13 (AUSC1), 14 (GER1), 15 (LS301-0), 16 (HOL2), 17 (UK1), 18 (DEN1), 19 (JPN1), 20 (GER2), 21 (MUR1), 22 (ALM2),

23 (ITA1), 24 (GER3), 25 (AUSE2), 26 (ALM3), 27 (GAL1), 28 (ALM4), 29 (ALM1), 30 (SON1), 31 (SON4), 32 (SON3), 33 (ALM5) and 34 (SON2)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

1 **** 99.7 99.7 99.4 99.8 99.2 99.3 99.5 99.5 99.7 99.5 99.5 99.5 99.0 99.5 98.9 98.9 98.9 99.2 98.5 96.6 97.4 96.5 96.7 96.6 96.2 96.8 87.2 87.3 86.7 86.7 87.1 87.1 87.0

2 99.8 **** 99.8 99.5 99.9 99.3 99.5 99.7 99.7 99.8 99.6 99.7 99.6 99.2 99.7 99.1 99.1 99.1 99.4 98.6 96.7 97.5 96.7 96.9 96.7 96.4 97.0 87.3 87.4 86.9 86.9 87.2 87.2 87.1

3 99.5 99.8 **** 99.5 99.9 99.3 99.5 99.7 99.7 99.8 99.6 99.7 99.6 99.2 99.7 99.1 99.1 99.1 99.4 98.6 96.7 97.5 96.7 96.9 96.7 96.4 97.0 87.3 87.4 86.9 86.9 87.2 87.2 87.1

4 99.1 99.3 99.1 **** 99.6 99.0 99.2 99.4 99.4 99.5 99.3 99.4 99.3 98.8 99.4 98.8 98.8 98.8 99.1 98.3 96.6 97.3 96.5 96.7 96.6 96.2 96.8 86.9 87.0 86.5 86.5 86.9 86.9 86.8

5 99.8 100 99.8 99.3 **** 99.4 99.5 99.8 99.8 99.9 99.7 99.8 99.7 99.2 99.8 99.2 99.2 99.2 99.5 98.7 96.8 97.6 96.8 97.0 96.8 96.5 97.0 87.4 87.5 87.0 87.0 87.3 87.3 87.2

6 99.5 99.8 99.5 99.1 99.8 **** 99.7 99.2 99.2 99.3 99.1 99.2 99.1 98.6 99.2 98.5 98.5 98.5 98.8 98.1 96.1 96.9 96.1 96.3 96.3 95.8 96.4 86.9 87.0 86.6 86.6 87.0 87.0 86.9

7 99.8 100 99.8 99.3 100 99.8 **** 99.3 99.3 99.5 99.2 99.3 99.2 98.8 99.3 98.7 98.7 98.7 99.0 98.2 96.3 97.3 96.5 96.6 96.6 96.1 96.7 87.1 87.2 86.7 86.7 87.1 87.1 87.0

8 99.8 100 99.8 99.3 100 99.8 100 **** 99.5 99.7 99.5 99.5 99.5 99.0 99.5 98.9 98.9 98.9 99.2 98.5 96.6 97.3 96.6 96.7 96.6 96.2 96.8 87.3 87.4 86.9 86.9 87.2 87.2 87.1

9 99.5 99.8 99.5 99.1 99.8 99.5 99.8 99.8 **** 99.8 99.6 99.5 99.5 99.0 99.5 98.9 98.9 98.9 99.2 98.5 96.7 97.3 96.7 96.9 96.6 96.2 96.8 87.3 87.4 86.9 86.9 87.2 87.2 87.1

10 99.8 100 99.8 99.3 100 99.8 100 100 99.8 **** 99.8 99.7 99.6 99.2 99.7 99.1 99.1 99.1 99.4 98.6 96.9 97.5 96.7 96.9 96.7 96.4 97.0 87.3 87.4 86.9 86.9 87.2 87.2 87.1

11 99.5 99.8 99.5 99.1 99.8 99.5 99.8 99.8 99.5 99.8 **** 99.5 99.4 98.9 99.5 98.8 98.8 98.8 99.2 98.4 96.6 97.3 96.5 96.6 96.6 96.1 96.7 87.2 87.3 86.8 86.8 87.1 87.1 87.0

12 99.8 100 99.8 99.3 100 99.8 100 100 99.8 100 99.8 **** 99.5 99.0 99.5 98.9 98.9 98.9 99.2 98.6 96.7 97.3 96.5 96.7 96.6 96.2 96.8 87.3 87.4 86.9 86.9 87.2 87.2 87.1

13 99.8 100 99.8 99.3 100 99.8 100 100 99.8 100 99.8 100 **** 99.0 99.5 98.8 98.8 98.8 99.2 98.4 96.5 97.3 96.7 96.8 96.5 96.1 96.7 87.2 87.3 86.8 86.8 87.1 87.1 87.0

14 98.1 98.4 98.1 97.7 98.4 98.1 98.4 98.4 98.1 98.4 98.1 98.4 98.4 **** 99.3 98.7 98.8 98.7 99.0 98.2 96.3 97.1 96.5 96.5 96.3 96.0 96.5 86.8 86.9 86.4 86.4 86.7 86.7 86.6

15 99.5 99.8 99.5 99.1 99.8 99.5 99.8 99.8 99.5 99.8 99.5 99.8 99.8 98.1 **** 99.2 99.2 99.2 99.5 98.8 96.9 97.7 96.9 97.0 96.9 96.5 97.1 87.5 87.6 87.0 87.0 87.4 87.4 87.3

16 99.1 99.3 99.1 98.6 99.3 99.1 99.3 99.3 99.1 99.3 99.1 99.3 99.3 97.7 99.1 **** 98.9 98.9 99.0 98.1 96.4 97.0 96.2 96.4 96.2 95.9 96.5 87.0 87.1 86.5 86.5 86.9 86.9 86.8

17 98.6 98.8 98.6 98.1 98.8 98.6 98.8 98.8 98.6 98.8 98.6 98.8 98.8 97.7 98.6 98.6 **** 99.1 99.0 98.1 96.4 97.1 96.6 96.4 96.2 96.0 96.5 87.0 87.1 86.5 86.5 86.9 86.9 86.8

18 98.6 98.8 98.6 98.1 98.8 98.6 98.8 98.8 98.6 98.8 98.6 98.8 98.8 97.2 98.6 98.6 98.1 **** 99.0 98.1 96.4 97.1 96.2 96.4 96.2 95.9 96.5 87.2 87.3 86.6 86.6 87.0 87.0 86.9

19 99.5 99.8 99.5 99.1 99.8 99.5 99.8 99.8 99.5 99.8 99.5 99.8 99.8 98.1 99.5 99.1 98.6 98.6 **** 98.5 96.6 97.3 96.5 96.7 96.7 96.2 96.8 87.6 87.7 87.1 87.1 87.5 87.5 87.4

20 98.8 99.1 98.8 98.4 99.1 98.8 99.1 99.1 98.8 99.1 98.8 99.1 99.1 97.4 98.8 98.4 97.9 97.9 98.8 **** 96.2 96.9 96.4 96.7 96.2 96.0 96.5 86.8 86.9 86.6 86.6 86.9 86.9 86.8

21 98.4 98.6 98.4 97.9 98.6 98.4 98.6 98.6 98.4 98.6 98.4 98.6 98.6 97.0 98.4 97.9 97.4 97.4 98.4 97.7 **** 97.3 96.7 96.9 96.6 96.4 96.9 86.4 86.5 86.1 86.1 86.3 86.3 86.2

22 98.8 99.1 98.8 98.4 99.1 98.8 99.1 99.1 98.8 99.1 98.8 99.1 99.1 97.4 98.8 98.4 97.9 97.9 98.8 98.1 97.7 **** 97.7 97.8 97.7 97.4 98.0 87.1 87.2 86.7 86.7 87.0 87.0 86.9

23 98.4 98.6 98.4 97.9 98.6 98.4 98.6 98.6 98.4 98.6 98.4 98.6 98.6 97.4 98.4 97.9 97.9 97.4 98.4 97.7 97.2 98.1 **** 99.5 97.2 97.2 97.6 87.0 87.1 86.5 86.5 87.1 87.1 87.0

24 98.4 98.6 98.4 97.9 98.6 98.4 98.6 98.6 98.4 98.6 98.4 98.6 98.6 97.0 98.4 97.9 97.4 97.4 98.4 98.1 97.2 98.1 99.1 **** 97.4 97.3 97.7 87.2 87.3 86.8 86.8 87.3 87.3 87.2

25 99.3 99.5 99.3 98.8 99.5 99.3 99.5 99.5 99.3 99.5 99.3 99.5 99.5 97.9 99.3 98.8 98.4 98.4 99.3 98.6 98.1 99.1 99.1 99.1 **** 97.2 97.7 86.9 87.0 86.7 86.7 86.9 86.9 86.8

26 96.7 97.0 96.7 96.2 97.0 96.7 97.0 97.0 96.7 97.0 96.7 97.0 97.0 95.3 96.7 96.2 96.2 95.8 96.7 96.5 95.5 96.5 97.0 97.0 97.4 **** 98.8 85.9 86.0 85.4 85.4 85.8 85.8 85.7

27 98.8 99.1 98.8 98.4 99.1 98.8 99.1 99.1 98.8 99.1 98.8 99.1 99.1 97.4 98.8 98.4 97.9 97.9 98.8 98.1 97.7 98.6 98.6 98.6 99.5 97.4 **** 86.8 86.9 86.4 86.4 86.9 86.9 86.8

28 95.5 95.8 95.5 95.0 95.8 95.5 95.8 95.8 95.5 95.8 95.5 95.8 95.8 94.1 95.5 95.0 94.8 94.8 95.5 94.8 94.3 95.3 94.8 94.8 95.8 93.1 95.3 **** 99.8 98.8 98.8 98.5 98.5 98.5

29 95.3 95.5 95.3 94.8 95.5 95.3 95.5 95.5 95.3 95.5 95.3 95.5 95.5 93.8 95.3 94.8 94.5 94.5 95.3 94.5 94.1 95.0 94.5 94.5 95.5 92.8 95.0 99.8 **** 98.7 98.7 98.5 98.5 98.4

30 96.0 96.2 96.0 95.5 96.2 96.0 96.2 96.2 96.0 96.2 96.0 96.2 96.2 94.5 96.0 95.5 95.3 95.0 96.0 95.3 94.8 95.8 95.3 95.3 96.2 93.6 95.8 99.5 99.3 **** 100 98.8 98.8 98.7

31 96.0 96.2 96.0 95.5 96.2 96.0 96.2 96.2 96.0 96.2 96.0 96.2 96.2 94.5 96.0 95.5 95.3 95.0 96.0 95.3 94.8 95.8 95.3 95.3 96.2 93.6 95.8 99.5 99.3 100 **** 98.8 98.8 98.7

32 96.0 96.2 96.0 95.5 96.2 96.0 96.2 96.2 96.0 96.2 96.0 96.2 96.2 94.5 96.0 95.5 95.3 95.0 96.0 95.3 94.8 95.8 95.3 95.3 96.2 93.6 95.8 99.5 99.3 100 100 **** 100 99.9

33 96.0 96.2 96.0 95.5 96.2 96.0 96.2 96.2 96.0 96.2 96.0 96.2 96.2 94.5 96.0 95.5 95.3 95.0 96.0 95.3 94.8 95.8 95.3 95.3 96.2 93.6 95.8 99.5 99.3 100 100 100 **** 99.9

34 95.8 96.0 95.8 95.3 96.0 95.8 96.0 96.0 95.8 96.0 95.8 96.0 96.0 94.3 95.8 95.3 95.0 94.8 95.8 95.0 94.5 95.5 95.0 95.0 96.0 93.3 95.5 99.3 99.1 99.8 99.8 99.8 99.8 ****

Clade A Clade B

175

Appendix 9 – LBVaV amino acid and nucleotide distances

Percentage nucleotide (upper diagonal) and amino acid (lower diagonal) sequence identities of the coat protein (CP) encoding sequences of LBVaV and TStV.

Numbers indicate isolates; 1 (SON5), 2 (SON4), 3 (SON3), 4 (SON6), 5 (SON2), 6 (GRA1), 7 (ALM1), 8 (ALM3), 9 (MUR1), 10 (ALM4), 11 (ALM7), 12

(ALM6), 13 (ALM2), 14 (ALM5), 15 (UK2), 16 (MUR2), 17 (SON1), 18 (GAL1), 19 (AUSE4), 20 (AUSE5), 21 (AUSA5), 22 (AUSB1), 23 (AUSB2), 24

(AUSG1), 25 (AUSE6), 26 (Wa), 27 (Hy), 28 (LBVV-CP), 29 (A), 30 (Na), 31 (Kan), 32 (No88), 33 (No89) and 34 (No2)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34

1 **** 98.6 98.6 98.5 98.6 98.6 98.6 98.7 98.6 98.6 98.5 98.5 98.1 96.7 95.5 96.3 96.7 95.9 96.1 96.6 96.3 97.0 96.6 96.6 94.6 94.7 94.7 94.6 94.9 94.7 94.6 94.7 94.5 98.6

2 97.7 **** 98.8 98.4 98.9 98.8 98.9 99.1 98.9 99.0 98.8 98.8 98.5 97.1 95.5 96.6 97.0 96.3 96.5 97.0 96.6 97.3 96.9 97.0 94.7 94.8 95.0 94.7 95.1 95.0 94.9 95.0 94.8 99.0

3 97.4 98.5 **** 98.9 99.3 99.2 99.1 99.2 99.1 99.2 99.0 99.0 98.6 97.3 95.6 96.7 97.2 96.6 96.7 97.3 96.9 97.6 97.2 97.3 95.4 95.5 95.7 95.4 95.2 95.3 95.2 95.3 95.1 99.2

4 97.4 97.2 97.7 **** 99.4 98.9 99.1 99.1 98.9 99.0 98.8 98.8 98.5 97.3 95.3 96.5 97.0 96.4 96.5 97.1 96.7 97.4 97.0 97.1 95.4 95.5 95.7 95.4 95.2 95.1 95.0 95.1 94.9 99.0

5 98.0 98.5 99.0 98.7 **** 99.4 99.4 99.6 99.4 99.5 99.3 99.3 99.0 97.8 95.8 97.0 97.5 96.9 97.1 97.6 97.3 98.0 97.5 97.6 95.8 95.8 96.0 95.8 95.8 95.7 95.6 95.7 95.5 99.5

6 97.7 98.2 98.5 98.0 99.0 **** 99.5 99.7 99.5 99.6 99.4 99.4 99.1 97.6 95.9 97.1 97.6 97.0 97.2 97.7 97.2 97.9 97.6 97.7 95.5 95.6 95.7 95.5 95.7 95.6 95.5 95.6 95.4 99.6

7 98.2 98.5 99.0 98.7 99.5 99.0 **** 99.8 99.7 99.7 99.6 99.6 99.2 97.8 96.0 97.3 97.8 97.0 97.2 97.7 97.3 98.0 97.6 97.7 95.5 95.6 95.7 95.5 95.9 95.8 95.7 95.8 95.6 99.7

8 98.2 98.7 99.2 98.5 99.7 99.2 99.7 **** 99.8 99.9 99.7 99.7 99.4 98.0 96.2 97.4 98.0 97.2 97.3 97.9 97.5 98.2 97.8 97.9 95.7 95.7 95.9 95.7 96.0 95.9 95.8 95.9 95.8 99.9

9 98.0 98.5 99.0 98.2 99.5 99.0 99.5 99.7 **** 99.7 99.6 99.6 99.2 97.8 96.0 97.3 97.8 97.0 97.2 97.7 97.3 98.0 97.6 97.7 95.5 95.6 95.7 95.5 95.8 95.8 95.7 95.8 95.6 99.7

10 98.0 98.5 99.0 98.2 99.5 99.0 99.5 99.7 99.5 **** 99.7 99.7 99.3 97.9 96.1 97.3 97.9 97.1 97.3 97.8 97.4 98.1 97.7 97.8 95.6 95.7 95.8 95.6 95.9 95.9 95.8 95.9 95.7 99.8

11 98.0 98.5 99.0 98.2 99.5 99.0 99.5 99.7 99.5 99.5 **** 99.5 99.2 97.7 95.9 97.2 97.7 96.9 97.1 97.6 97.3 98.0 97.5 97.6 95.4 95.5 95.7 95.4 95.8 95.7 95.6 95.7 95.5 99.7

12 98.2 98.7 99.2 98.5 99.7 99.2 99.7 100 99.7 99.7 99.7 **** 99.3 97.9 96.1 97.5 98.0 97.1 97.3 97.8 97.4 98.1 97.7 97.7 95.7 95.8 96.0 95.7 95.9 95.9 95.8 95.9 95.7 99.7

13 97.4 98.0 98.5 97.7 99.0 98.5 99.0 99.2 99.0 99.0 99.0 99.2 **** 97.5 95.9 97.2 97.7 96.9 97.1 97.6 97.3 98.0 97.5 97.5 95.4 95.5 95.7 95.4 95.8 95.7 95.6 95.7 95.5 99.3

14 96.9 97.4 98.0 97.2 98.5 98.0 98.5 98.7 98.5 98.5 98.5 98.7 98.0 **** 95.4 96.7 97.3 96.8 97.0 97.5 97.2 97.7 97.3 97.3 95.3 95.4 95.5 95.2 95.4 95.3 95.3 95.4 95.2 97.9

15 94.8 94.8 94.8 94.0 95.3 95.1 95.3 95.6 95.3 95.3 95.3 95.6 94.8 94.8 **** 96.0 96.5 95.4 95.6 95.7 95.4 96.1 95.7 95.7 93.7 93.8 93.6 93.9 93.7 93.6 93.8 93.9 93.7 96.1

16 96.9 97.2 97.7 96.9 98.2 97.7 98.2 98.5 98.2 98.2 98.2 98.5 97.7 98.2 95.6 **** 99.0 96.6 96.8 97.2 96.9 97.5 97.2 97.2 95.1 95.0 95.0 94.7 95.3 95.2 95.2 95.3 95.1 97.3

17 97.4 97.7 98.2 97.4 98.7 98.2 98.7 99.0 98.7 98.7 98.7 99.0 98.2 98.7 95.6 99.5 **** 97.3 97.5 97.9 97.5 98.2 97.8 97.8 95.3 95.4 95.4 95.3 95.9 95.8 95.8 95.9 95.7 97.9

18 96.1 96.4 96.9 96.1 97.4 97.4 97.4 97.7 97.4 97.4 97.4 97.7 96.9 97.4 94.3 97.7 98.2 **** 99.8 99.2 98.6 98.5 98.1 98.1 95.4 95.5 95.5 95.4 95.8 95.9 95.9 96.0 95.8 97.1

19 96.4 96.7 97.2 96.4 97.7 97.7 97.7 98.0 97.7 97.7 97.7 98.0 97.2 97.7 94.6 98.0 98.5 99.7 **** 99.3 98.7 98.6 98.3 98.3 95.6 95.7 95.7 95.6 96.0 96.1 96.1 96.2 96.0 97.3

20 97.2 97.4 98.0 97.2 98.5 98.5 98.5 98.7 98.5 98.5 98.5 98.7 98.0 98.5 95.3 98.7 99.2 99.0 99.2 **** 99.2 99.2 98.8 98.8 96.1 96.2 96.2 96.1 96.6 96.6 96.6 96.7 96.6 97.8

21 96.9 97.2 97.7 96.9 98.2 97.7 98.2 98.5 98.2 98.2 98.2 98.5 97.7 98.2 95.1 98.5 99.0 98.0 98.2 99.0 **** 98.7 98.7 98.7 95.7 95.8 95.8 95.7 96.2 96.3 96.3 96.4 96.2 97.4

22 97.4 97.7 98.2 97.4 98.7 98.2 98.7 99.0 98.7 98.7 98.7 99.0 98.2 98.7 95.6 99.0 99.5 98.7 99.0 99.7 99.2 **** 99.4 99.4 96.6 96.7 96.7 96.6 96.7 96.8 96.8 96.9 96.7 98.1

23 96.4 96.7 97.2 96.4 97.7 97.7 97.7 98.0 97.7 97.7 97.7 98.0 97.2 97.7 94.6 98.0 98.5 98.0 98.2 99.0 99.0 98.7 **** 99.7 96.2 96.3 96.3 96.2 96.3 96.4 96.4 96.5 96.3 97.7

24 96.9 97.2 97.7 96.9 98.2 98.2 98.2 98.5 98.2 98.2 98.2 98.5 97.7 98.2 95.1 98.5 99.0 98.5 98.7 99.5 99.5 99.2 99.5 **** 96.2 96.3 96.3 96.2 96.3 96.4 96.4 96.5 96.3 97.8

25 96.9 97.2 97.7 96.9 98.2 97.7 98.2 98.5 98.2 98.2 98.2 98.5 97.7 98.2 95.1 98.5 99.0 98.0 98.2 99.0 98.7 99.2 98.2 98.7 **** 99.7 99.4 99.2 95.6 95.7 95.8 96.3 95.9 95.6

26 96.7 96.9 97.4 96.7 98.0 97.4 98.0 98.2 98.0 98.0 98.0 98.2 97.4 98.0 94.8 98.2 98.7 97.7 98.0 98.7 98.5 99.0 98.0 98.5 99.7 **** 99.3 99.2 95.7 95.8 95.9 96.4 96.0 95.7

27 96.9 97.4 98.0 97.2 98.5 98.0 98.5 98.7 98.5 98.5 98.5 98.7 98.0 98.5 94.8 98.2 98.7 97.7 98.0 98.7 98.5 99.0 98.0 98.5 99.7 99.5 **** 99.1 95.5 95.6 95.8 96.2 95.8 95.8

28 96.9 97.2 97.7 96.9 98.2 97.7 98.2 98.5 98.2 98.2 98.2 98.5 97.7 98.2 95.1 98.5 99.0 98.0 98.2 99.0 98.7 99.2 98.2 98.7 100 99.7 99.7 **** 95.4 95.5 95.7 96.1 95.8 95.6

29 95.9 96.1 96.7 95.9 97.2 96.7 97.2 97.4 97.2 97.2 97.2 97.4 96.7 97.2 94.0 97.4 98.0 96.7 96.9 97.7 97.4 98.0 96.9 97.4 98.2 98.0 98.0 98.2 **** 99.6 99.2 99.2 99.0 95.9

30 96.4 96.7 97.2 96.4 97.7 97.2 97.7 98.0 97.7 97.7 97.7 98.0 97.2 97.7 94.6 98.0 98.5 97.2 97.4 98.2 98.0 98.5 97.4 98.0 98.7 98.5 98.5 98.7 99.5 **** 99.3 99.2 99.1 95.9

31 95.9 96.1 96.7 95.9 97.2 96.7 97.2 97.4 97.2 97.2 97.2 97.4 96.7 97.2 94.0 97.4 98.0 96.7 96.9 97.7 97.4 98.0 96.9 97.4 98.2 98.0 98.0 98.2 99.0 99.5 **** 99.4 99.2 95.8

32 96.4 96.7 97.2 96.4 97.7 97.2 97.7 98.0 97.7 97.7 97.7 98.0 97.2 97.7 94.6 98.0 98.5 97.2 97.4 98.2 98.0 98.5 97.4 98.0 98.7 98.5 98.5 98.7 99.5 100 99.5 **** 99.7 95.8

33 96.1 96.4 96.9 96.1 97.4 96.9 97.4 97.7 97.4 97.4 97.4 97.7 96.9 97.4 94.3 97.7 98.2 96.9 97.2 98.0 97.7 98.2 97.2 97.7 98.5 98.2 98.2 98.5 99.2 99.7 99.2 99.7 **** 95.7

34 98.0 98.5 99.0 98.2 99.5 99.0 99.5 99.7 99.5 99.5 99.5 99.7 99.0 98.5 95.6 98.2 98.7 97.4 97.7 98.5 98.2 98.7 97.7 98.2 98.2 98.0 98.5 98.2 97.2 97.7 97.2 97.7 97.4 ****

European isolates LBVaV Australian isolates LBVaV

Japanese

isolates LBVaV

Japanese

isolates TStV

176

References

Australian Bureau of Statistics. 2009a. 7121.0 Agricultural Commodities, Australia,

2007-08. Available World Wide Web. URL:

http://www.abs.gov.au/AUSSTATS/[email protected]/DetailsPage/7121.02007-

08?OpenDocument Accessed 17 November, 2009.

Australian Bureau of Statistics. 2009b. Value of Agricultural Commodities Produced,

Australia, 2007-08. Data cube: Excel spreadsheet cat. no. 75030DO001_200708.

Available World Wide Web. URL:

http://www.abs.gov.au/AUSSTATS/[email protected]/DetailsPage/7503.02007-

08?OpenDocument Accessed 17 November, 2009.

Barbetti, M.J. 1981. Effects of sowing date and oospore seed contamination on

subsequent crop incidence of white rust (Albugo candida) in rapeseed. Australas. Plant

Path. 10:44-46

Barr, D.J.S. 1988. Zoosporic plant parasites as fungal vectors of viruses: taxonomy and

lifecycle of species involved. In: J. I. Cooper and M.J.C. Asher, Editors, Viruses with

fungal vectors, Association of Applied Biologists, Wellesbourne, UK, pp 123-137

Borthwick, H.A. and Robbins, W.W. 1928. Lettuce seed and its germination. Hilgardia.

3:275-305

Bos, L. 1999. Plant viruses, unique and intriguing pathogens – a textbook of plant

virology. Backhuys Publishers, Leiden, pp. 37, 38, 226.

Bos, L. and Huijberts, N. 1990. Screening for resistance to big vein disease of lettuce.

Crop Prot. 9:446-452

Brittlebank, C.C. 1919. Tomato diseases. J. Agric. 17:231-235

Büchen-Osmond C (ed.) (2006) Index of Viruses – Varicosavirus. In: ICTVdB - The

Universal Virus Database, version 4. Columbia University, New York

Campbell, R.N. 1962. Relationship between the lettuce big-vein and its vector Olpidium

brassicae. Nature. 195:675-677

Campbell, R.N. 1965. Weeds as reservoir hosts of the Lettuce big-vein virus. Can. J.

Botany. 43:1141-1149

Campbell, R.N. 1985. Longevity of Olpidium brassicae in air-dried soil and the

persistence of the lettuce big-vein agent. Can. J. Botany. 63:2288-2289

Campbell, R.N. 1996. Fungal transmission of plant viruses. Annu. Rev. Phytopathol.

34:87-108

http://www.abs.gov.au/AUSSTATS/[email protected]/DetailsPage/7121.02007-08?OpenDocument




177

Campbell, R.N., Greathead, R.G. and Westerlund, F.V. 1980. Big-Vein of lettuce:

infection and methods of control. Phytopathology. 70:741-746

Campbell, R.N. and Grogan, R.G. 1963. Big-vein virus of lettuce and its transmission

by Olpidium brassicae. Phytopathology. 53:252-259

Campbell, R. N., and Grogan R. G. 1964. Aquisition and transmission of lettuce big-

vein virus by Olpidium brassicae. Phytopathology 54: 681-690

Campbell, R.N., Grogan, R.G. and Purcifull, D.E. 1961. Graft transmission of big-vein

of lettuce. Virology. 15:82-85

Campbell, R. N., and Lin M. T., 1976. Morphology and thermal death point of

Olpidium brassicae. Am. J. Bot. 63: 826-832

Campbell, R.N., Wipf-Scheibel, C. and Lecoq, H. 1996. Vector-assisted seed

transmission of Melon necrotic spot virus in melon. Phytopathology. 86:1294-1298

Cho, J.J., Mau, R.F.L., German, T.L., Hartman, R.W., Yudin, L.S., Gonsalves, D. and

Provvidenti, R. 1989. A multi-disciplinary approach to management of tomato spotted

wilt virus. Plant Dis. 73:375–83

Clark, M.F. and Adams, A.N. 1977. Characteristics of the microplate method of

Enzyme-Linked Immunosorbent Assay for the detection of plant viruses. J. Gen. Virol.

34:475-483

Colariccio, A., Chaves, A.L.R., Eivas, M., Chagas, C.M., Lenzi, R. and Roggero, P.

2003. Presence of lettuce big-vein and associated viruses in a sub-tropical area of

Brazil. New Disease Report. 7:1-2

Coutts, B.A., Thomas-Carroll, M.L. and Jones, R.A.C. 2004. Analysing spatial patterns

of spread of Lettuce necrotic yellows virus and lettuce big-vein disease in lettuce field

plantings. Ann. Appl. Biol. 145:339-343

Davison, E.M., Drenth, A., Kumar, S., Mack, S., Mackie, A.E. and McKirdy, S. 2006.

Pathogens associated with nursery plants imported into Western Australia. Australas.

Plant Path. 35:473-475

Fanigliulo, A., Pacella, A., Comes, S. And Crescenzi, A. 2007. Three years survey of

Tomato yellow leaf curl Sardinia virus reservoir weed hosts in southern Italy.

Communic. Agric. Appl. Biol. Sci. 72:1023-1028

Faruki, I. 1981. Epidemiological studies on Melon necrotic spot. Technical Bulletin 14.

Shizuoka Agricultural Experiment Station, Shizuokaken, Japan

Floyd, R. 2000. Diseases of lettuce. Farmnote 48/91. Department of Agriculture and

Food, Western Australia

178

Francki, R.I.B. and Randles, J.W. 1970. Descriptions of Plant Viruses: Lettuce necrotic

yellows virus. Assoc. Appl. Biol. 26. Available World Wide Web. URL:

http://www.dpvweb.net/dpv/showdpv.php?dpvno=26 Accessed 17 Nov, 2009

Fry, P.R. 1958. The relationship of Olpidium brassicae (Wor.) Dang. to big-vein

disease of lettuce. NZ. J. Agr. Res. 1:301-304

Fry, P.R. and Campbell, R.N. 1966 Transmission of Tobacco necrosis virus by

Olpidium brassicae. Virology 30:517-527

Fry, P.R., Close, R.C., Proctor, C.H. and Sunde, R. 1973. Lettuce necrotic yellows virus

in New Zealand. NZ. J. Agr. Res. 16:143-146

Funnekotter, B. 2006. Personal communication. 16th

March.

Garcia-Arenal F, Fraile A, Malpica JM (2001) Variability and genetic structure of plant

virus populations. Annu. Rev. Phytopathol. 39: 157-186

Germundsson, A., Sandgren, M., Barker, H., Savenkov, E.I. and Valkonen, J.P.T. 2002.

Initial infection of roots and leaves reveals different resistant phenotypes associated

with coat protein gene-mediated resistance to Potato mop top virus. J. Gen. Virol.

83:1201-1209

Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucl. Acid. Sym. Ser. 41: 95-98

Hardy, G.E. and Sivasithamparam, K. 1988. Phytophthora spp. associated with

container-grown plants in nurseries in Western Australia. Plant Dis. 72:435-437

Hartwright, L. M., Hunter, P. J., and Walsh J. A. 2009. A comparison of Olpidium

isolates from a range of host plants using internal transcribed spacer sequence analysis

and host range studies. Mycol. Res. Available online 1 October, 2009. doi:

10.1016/j.mycres.2009.09.008

Hayes, R.J., Wintermantel, W.M., Nicely, P.A. and Ryder, E.J. 2006. Host resistance to

Mirafiori lettuce big-vein virus and Lettuce big-vein associated virus and virus sequence

diversity and frequency in California. Plant Dis. 90:233-239

Herrera-Vasquez, J. A., Cebrian, M. C., Alfaro-Fernandez, A., Cordoba-Selles, M. C.,

and Jorda, C. (2009). Multiplex PCR assay for the simultaneous detection and

differentiation of Olpidium bornovanus, Olpidium brassicae and Olpidium virulentus.

Mycol. Res. 113:602-610

Huijberts, N., Blystad, D.R. and Bos, L. 1990. Lettuce big-vein virus: mechanical

transmission and relationships to tobacco stunt virus. Ann. Appl. Biol. 116:463-475

Jagger, I.C. and Chandler, N. 1934. Big-Vein, a disease of lettuce. Phyotpathology

24:1253-1256

http://www.dpvweb.net/dpv/showdpv.php?dpvno=26

179

James, T. Y., Letcher, P. M., Longcore, J. E., Mozley-Standridge, S. E., Porter, D.,

Powell, M. J., Griffith, G. W., and Vilgalys, R. (2006) A molecular phylogeny of

flagallated fungi (Chytridiomycota) and description of a new phylum (Blastidiomycota).

Mycologia 98:860-871

Jones, R. A. C., 2004. Using epidemiological information to develp effective integrated

virus disease management strategies. Virus Res. 100: 5-30

Jones, R.L. 1974. The structure of the lettuce endosperm. Planta. 121:133-146

Kawazu, Y., Sasaya, T., Morikawa, T., Sugiyama, K. and Natsuaki, T. 2003. Nucleotide

sequence of the coat protein gene of Mirafiori lettuce virus. J. Gen. Plant Pathol. 69:55–

60

Koganezawa, H., Inoue, H., and Sasaya, J. 2005. Host specificity and multiplication of

eight isolates of Olpidium brassicae sensu lato and its related Olpidium spp. Japanese

National Agricultural Research Centre for Western Region, Miscellaneous Bulletin, pp.

39-59

Koganezawa, H., Takayama, T. and Sasaya, T. 2004. Difference in resting spore

formation between crucifer and non-crucifer strains of Olpidium brassicae sensu lato

(In Japanese). Jpn. J. Phytopathol. 70:307-313

Kosakovsky-Pond, S.L. and Frost, S.D.W. 2005a. Datamonkey: rapid detection of

selective pressure on individual coding sites of codon alignments. Bioinformatics.

21:2531-2533

Kosakovsky-Pond, S.L. and Frost, S.D.W. 2005b. Not so different after all: a

comparison of methods for detecting amino acid sites under selection. Mol. Biol. And

Evol. 22:1208-1222

Kuwata, S., Kubo, S. 1981. Rod-shaped particles found in tobacco plants infected with

tobacco stunt agent. Ann. Phytopath. Soc. Japan 47: 264-268

Kuwata, S. and Kubo, S. 1986. Tobacco stunt virus. Commonwealth Mycological

Institute/ Association of Applied Biologists Descriptions of Plant Viruses. No. 313 pp 4

Kuwata, S., Kubo, S., Yamashita, S. and Doi, Y. 1983. Rod-shaped particles, a probable

entity of lettuce big-vein virus. Ann. Phytopath. Soc. Japan 49: 246-251

Latham, L.J. and Jones, R.A.C. 1997. Occurrence of Tomato spotted wilt tospovirus in

native flora, weeds and horticultural crops. Aust. J. Agr. Res. 48:359-369

Latham, L.J. and Jones, R.A.C. 2004. Deploying partially resistant genotypes and

plastic mulch on the soil surface to suppress spread of lettuce big-vein disease in lettuce.

Aust. J. Agr. Res. 55:131-138

Latham, L.J., Jones, R.A.C. and Mckirdy, S.J. 2004. Lettuce big-vein disease: sources,

patterns, and losses. Aust. J. Agr. Res. 55:125-130

180

Lindqvist K, 1960. On the origin of cultivated lettuce. Hereditas 46: 319-350

Lot, H., Campbell, R.N., Souche, S., Milne, R.G. and Roggero, P. 2002. Transmission

by Olpidium brassicae of Mirafiori lettuce virus and Lettuce big-vein virus, and their

roles in lettuce big-vein etiology. Phytopathology 92:288-293

McKirdy, S., Mackie, A.E. and Kumar, S. 2001. Apple scab successfully eradicated in

Western Australia. Australas. Plant. Path. 30:371

Mackie, A.E., McKirdy, S.J., Rodoni, B. And Kumar, S. 2002. Potato tuber spindle

viroid eradicated in Western Australia. Australas. Plant. Path. 31:311-312

Martin, S., Lopez, C., Garcia, M.L., Naum-Ongania, G, Grau, O., Flores, R., Moreno, P.

and Guerri, J. 2006. Genetic variation of populations of Citrus psorosis virus. J. Gen.

Virol. 87:3097-3102

Matthews, R.E.F. 1981. Plant Virology. 2nd

edition. Academic Press, New York. pp.

285-287

Mayo, M.A. 2000. Genus Varicosavirus. In: van Regenmortel MHV, Fauquet CM,

Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch

DJ, Pringle CR, Wickner RB (eds) Virus Taxonomy. Seventh Report of the

International Committee on Taxonomy of Viruses. Academic Press, San Diego,.

pp.521-523

Napier, T. 2004. Field lettuce production. Agfact H8.1.40. NSW Agriculture

Navarro, J.A., Botella, F., Maruhenda, A., Sastre, P., Sanchez-Pina, M.A. and Pallas, V.

2004. Comparative infection progress analysis of Lettuce big-vein virus and Mirafiori

lettuce virus in lettuce crops by developed molecular diagnostic techniques.


Navarro, J.A., Torok, V.A., Vetten, H.J. and Pallas, V. 2005a. Genetic variability in the

coat protein genes of Lettuce big-vein associated virus and Mirafiori lettuce big-vein

virus. Arch. Virol. 150:681-694

Navarro, J.A., Botella, F., Maruhenda, A., Sastre, P., Sanchez-Pina, M.A. and Pallas, V.

2005b. Identification and partial characterisation of Lettuce big-vein associated virus

and Mirafiori lettuce big-vein virus in common weeds found amongst Spanish lettuce

crops and their role in lettuce big-vein disease transmission. Eur. J. Plant Pathol.

113:25-34

Nijsse, J., Erbe, E., Brantjes, N.B.M., Schel, J.H.N. and Wergin, W.P. 1998. Low-

temperature scanning electron microscopic observations on endosperm in imbibed and

germinated lettuce seeds. Can. J. Botany. 76:509-516

O‟Keefe, D.C., Berryman, D.I., Coutts, B.A. and Jones, R.A.C. 2007. Lack of seed coat

contamination with Cucumber mosaic virus in lupin permits reliable, large scale

detection of seed transmission in seed samples. Plant Dis. 91:504-508

181

Paulson, R.E. and Srivastava, L.M. 1968. The fine structure of the embryo of Lactuca

sativa. I. Dry embryo. Can. J. Botany. 46:1437-1445

Peters, D. 1998. An updated list of plant species susceptible totospoviruses. In

Proceedings of the Fourth International Symposium on Tospoviruses and Thrips

in Floral and Vegetable Crops, pp. 107-110, Eds D Peters and R Peters D. 1998

Goldbach.Wageningen, The Netherlands

Randles, J.W. and Carver, M. 1971. Epidemiology of Lettuce necrotic yellows virus in

South Australia. Aust. J. Agr. Res. 22:231-237

Rochon, D‟A., Kakani, K., Robbins, M., and Reade, R. 2004. Molecular aspects of plant

virus transmission by Olpidium and Plasmodiophorid vectors. Ann. Rev. Phytopathol.

42: 211-241

Roggero, P., Ciufffo, M., Vaira, A.M., Accotto, G.P., Masenga, V. and Milne, R.G.

2000. An ophiovirus isolated from lettuce with big-vein symptoms. Arch. Virol.

145:2629-2642

Roggero, P., Lot, H., Souche, S., Lenzi, R. and Milne, R.G. 2003. Occurrence of

Mirafiori lettuce virus and Lettuce big-vein virus in relation to development of big-vein

symptoms in lettuce crops. Eur. J. Plant Pathol. 109:261-267

Ryder, E.J. 1973. Seed transmission of LMV in mosaic resistant lettuce. J. Am. Soc.

Hort. Sci. 95:610-614

Sahtiyanci, S. 1962. Studien über einige wurzelparasitäre Olpidiaceen. Arch. Microbiol.

41: 187–228

Sambrook, J., and Russell, D. W. 2001. Molecular cloning: A laboratory manual. New

York: Cold Spring Harbour Laboratory Press

Sampson, K. 1939. Olpidium brassicae (Wor.) Dangeard and its connection with

Asterocystis vadicis de Wildeman. Trans. Br. Mycol. Soc. 23:199-205

Sanches, M.M. 2006. Molecular and biological charatcterization of lettuce big-vein

associated virus and Mirafiori lettuce big-vein virus and study of the occurrence during

the year and on lettuce plantings showing symptoms from the Sao Paulo state. Thesis.

FCA-UNESP Botucatu, Sao Paulo, Brazil.

Sasaya, T., Fujii, H., Ishikawa, K. and Koganezawa, H. 2006. Further evidence of

Mirafiori lettuce big-vein virus but not of Lettuce big-vein associated virus with big-

vein disease in lettuce. Phytopathology. 98:464-468

Sasaya T, Ishikawa K, Koganezawa H (2001) Nucleotide sequence of the coat protein

gene of Lettuce big-vein virus. J. Gen. Virol. 82: 1509-1515

Sasaya T, Ishikawa K, Kuwata S, Koganezawa H (2005) Molecular analysis of coat

protein coding region of tobacco stunt virus shows that it is a strain of Lettuce big-vein

virus in the genus Varicosavirus. Arch. Virol. 150: 1013-1021

182

Sasaya, T., and Koganezawa, H. 2006. Molecular analysis and virus transmission tests

place Olpidium virulentus, a vector of Mirafiori lettuce big-vein virus and Tobacco stunt

virus, as a distinct species rather than a strain of Olpidium brassicae. J. Gen. Plant

Pathol. 72: 20-25

Schenk, P.M., Antoniw, J.F., Batista., M.D., Jacobi, V., Adams, M.J. and Steinbiss,

H.H. 1995. Movement of Barley mild mosaic and Barley yellow mosaic viruses in

leaves and roots of barley. Ann. Appl. Biol. 126:291-305

Sivasithamparam, K. and Goss, O.M. 1981. „Jarrah dieback‟... a threat to horticulture. J.

Ag. WA. 21:88-91

Stubbs, L.L. and Grogan, R.G. 1963. Necrotic yellows: A newly recognised virus

disease of lettuce. Aust. J. Agr. Res. 14:439-459

Tamura K., Dudley J., Nei M. and Kumar S. 2007. MEGA4: molecular evolutionary

genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596-1599

Teakle, D. S. 1960. Association of Olpidium brassicae and tobacco necrosis virus.

Nature 188: 431-432

Teakle, D.S. and Thomas, B.J. 1985. Effect of heat on zoospore motility and

multiplication of Olpidium radicale and O. brassicae. Ann. Appl. Biol. 107:11-15

Temmink, J.H.M., Campbell, R.N. and Smith, P.R. 1970. Specificity and site of in vitro

acquisition of tobacco necrosis virus by zoospores of Olpidium brassicae. J. Gen. Virol.

9:201-213

Thompson, J.D., Higgins, D.G. and Gibson, T.J. 1994. ClustalW: Improving the

sensitivity of progressive multiple sequence alignment through sequence weighting,

position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-

4680

Tomlinson, J.A. 1988. Chemical control of Spongospora and Olpidium in hydroponic

systems and in soil. In: Cooper, J.I. and Asher, M.J.C. (Eds.), Developments in Applied

Biology 2: Viruses with fungal vectors. Association of Applied Biologists. Warwick,

UK. pp. 293-303

Ufer, T., Beltz, H., Brand, T., Kaminski, K., Luttman, R., Posner, M., Wagner, S.,

Werres, S. and Wessels, H-P. 2005. Introduction of filtration systems in container

nurseries for nonchemical elimination of Phytophthora spp. from irrigation water.

Proceedings of the sudden oak death second symposium: the state of our knowledge. Pg

287-289

Vetten, H.J., Lesemann, D.E. and Dalchow, J. 1987. Electron microscopical and

serological detection of virus-like particles associated with lettuce big vein disease. J.

Phytopathol. 120: 53-59

Walsh, J.A. 1994 Effects of some biotic and abiotic factors on symptom expression of

lettuce big-vein virus in lettuce (Lactuca sativa). J. Hort. Sci. 69:21-28

183

Webster, C.G., Coutts, B.A., Jones, R.A.C., Jones, M.G.K. and Wylie, S.J. 2007. Virus

impact at the interface of an ancient ecosystem and a recent agroecosystem: studies on

three legume-infecting potyviruses in southwest Australian floristic region. Plant Pathol.

56:729-742

Westerlund, F. V., Campbell, R. N., and Grogan, R. G. 1978. Effect of temperature on

transmission, translocation, and persistence of the lettuce big-vein agent and big-vein

symptom expression. Phytopathology 68:921-926

Whitaker, T.W. 1969. Salads for everyone – A look at the lettuce plant. Econ. Bot. 23:

261-264

White, T. J., Bruns, T., Lee, S., and Taylor, J. W. 1990. Amplification and direct

sequencing of fungal ribosomal RNA genes for polygenetics, pp. 315-322 In: M. A.

Inns, D. H. Gelfand, J. J. Sninsky and T. J. White, Editors PCR Protocols: A Guide to

Methods and Applications. Academic Press, Inc., New York

Wilson, C. R. 1998. Incidence of weed reservoirs and vectors of Tomato spotted wilt

tospovirus on South Tasmanian lettuce farms. Plant. Pathol. 47:171-176

Woods, W.M., Trend, W.J., Thwaite, G., Monzu, N., Portman, A., Power, G.J. and

Davis, P.R. 2001. The history of coddling moth eradication from WA. Good Fruit and

Vegetables. 12:79-81

van der Wilk, F., Dullemans, A. M., Verbeek, M. and van den Heuvel, J. F. 2002.

Nucleotide sequence and genomic organization of an ophiovirus associated with lettuce

big-vein disease. J. Gen. Virol. 83:2869–2877

Zitter, T.A. and Daughtrey, M.L. 1989. Tomato spotted wilt virus. Fact Sheet

Page:735.90. Cornell University. Available World Wide Web. URL:

http://vegetablemdonline.ppath.cornell.edu/factsheets/Virus_SpottedWilt.htm Accessed

17 Nov, 2009

http://vegetablemdonline.ppath.cornell.edu/factsheets/Virus_SpottedWilt.htm

BRIEF REPORT

Comparison of the coat protein genes of Lettuce big-vein associatedvirus isolates from Australia with those of isolates from othercontinents

Linda D. Maccarone • Martin J. Barbetti •

Krishnapillai Sivasithamparam • Roger A. C. Jones

Received: 30 November 2009 / Accepted: 17 February 2010

� Springer-Verlag 2010

Abstract The complete coat protein (CP) nucleotide

sequences of seven Lettuce big-vein associated virus

(LBVaV) isolates from Australia were compared to those

of 22 other LBVaV and five tobacco stunt virus (TStV)

isolates. On phylogenetic analysis, clade I contained only

LBVaV isolates from Europe, sub-clade IIa only Australian

LBVaV isolates, IIb only Japanese LBVaV isolates, and IIc

only TStV isolates from Japan. In the amino acid sequences

deduced, the central region of the gene was most divergent.

Mean Dn/Ds ratios were 0.283 and 0.124 for clades I and

II, respectively. The suggestion that TStV is a strain of

LBVaV was supported.

Lettuce big-vein associated virus (LBVaV) and tobacco

stunt virus (TStV) belong to the genus Varicosavirus of

which LBVaV is type species [1]. LBVaV was formerly

considered the cause of lettuce big-vein disease (LBVD)

[16] until another virus occurring in mixed infection,

Mirafiori lettuce big-vein virus (MLBVV; genus Ophiovi-

rus), was found responsible for the symptoms [5, 7]. TStV

infects tobacco causing severe symptoms [4]. LBVaV and

TStV have rod shaped particles 320–360 (LBVaV) or 300–

340 (TStV) nm in length [4, 16]. Both have a CP 1,194

nucleotides long that codes for 397 amino acids [12] and

are serologically related [4, 16]. Both were considered

different species despite their similar morphology, serology

and vector relationships because TStV does not to infect

lettuce but infects tobacco whilst LBVaV does the opposite

[4]. Subsequently, Sasaya et al. [12] suggested that TStV is

a tobacco infecting strain of LBVaV. TStV and MLBVV

are transmitted by the chytrid Olpidium virulentus [13].

Sasaya et al. [12] reported that the complete nucleotide and

amino acid CP sequence identities between eight LBVaV

and five TStV isolates were 95.6–96.5% and 97.2–98.7%,

respectively. When Navarro et al. [9] analysed the CP

sequences of 17 LBVaV isolates, they found identities of

95.2–99.8% (nucleotides) and 98.0–100% (amino acids),

and when they subjected 13 complete and four partial

LBVaV CP sequences to phylogenetic analysis, three iso-

late groupings were found. This paper compares the CPs of

seven previously unreported isolates from Australia with

those of 30 LBVaV and five TStV isolates from different

continents.

Lettuce leaves with LBVD symptoms were sampled

from four farms (A, B, E and G) in the northern Perth

Metropolitan region, south-west Australia. Seven samples

were collected, one each from A and G, two from B and

three from E. On the collection day, each sample was

ground in liquid nitrogen before storage at -20�C before

RNA extraction. Total RNA was extracted from each

sample using an UltraCleanTM Plant RNA Isolation Kit

(MoBio Laboratories, Inc.) according to manufacturer’s

instructions. RNA extracts were stored at -80�C. Primer

pairs specific for the CP of LBVaV (fwd L1-21 50ATG

GCA CCC CAA ATT GAA G30, rev L700-679 50GTG

CAT GCC AGT GCT GGC AAG 30 and fwd L511-5 31

50AGA CCG AGT ATC CAT TCA AG 30, rev L1210-1185

50TCA CTC CTT CAC TGG TGT CTC TCC C30) were

L. D. Maccarone � M. J. Barbetti � K. Sivasithamparam �R. A. C. Jones (&)

Faculty of Natural and Agricultural Sciences,

School of Plant Biology, University of Western Australia,

Stirling Highway, Crawley, WA 6009, Australia

e-mail: [email protected]

R. A. C. Jones

Department of Agriculture and Food Western Australia,

Agricultural Research Western Australia, Locked Bag No. 4,

Bentley Delivery Centre, Perth, WA 6983, Australia

123

Arch Virol

DOI 10.1007/s00705-010-0641-0

developed by aligning known CP sequences from GenBank

in Bioedit. To amplify the entire CP sequence, both primer

sets were used on each sample. Reverse transcription PCR

(RT-PCR) was done using a OneStep RT-PCR kit (Qiagen,

Australia) according to manufacturer’s instructions. PCR

amplification conditions consisted of 50�C for 30 min,

95�C for 15 min, followed by 30 cycles of 94�C for 1 min,

57�C for 1 min, 72�C for 1 min, then a final extension at

72�C for 10 min before being held at 14�C. PCR amplicons

were visualised by electrophoresis on 1% agarose gels.

Table 1 Isolates of Lettuce big-

vein associated virus (LBVaV)

and tobacco stunt virus (TStV)

used in sequence comparisons

a Complete LBVaV CP

nucleotide sequences

AB050272 (isolate LBVaV-CP)

and AB114138 (isolate Ka),

both from Kagawa in Japan,

were identicalb Partial LBVaV CP sequencesc TStV isolates

Virus isolate Accession number Geographic origin Species isolated from Reference

LBVaV-CPa AB050272a Kagawa, Japan Lettuce [9, 11, 12]

No2c AB190521 Takamatsu, Japan Tobacco [12]

No89c AB190522 Chunan, Japan Tobacco [12]

No88c AB190523 Chunan, Japan Tobacco [12]

Kanc AB190524 Kannonji, Japan Tobacco [12]

Nac AB190525 Fukue, Japan Tobacco [12]

A AB190526 Kannonji, Japan Lettuce [12]

Hy AB190527 Nandan, Japan Lettuce [12]

Wa AB190528 Hiochigawa, Japan Lettuce [12]

MUR1 AY366411 Murcia, Spain Lettuce [9]

GAL1 AY366412 Galicia, Spain Lettuce [9]

ALM1 AY366413 Pulpi, Almeria, Spain Lettuce [9]


USAb AY496053 Salinas, CA, USA Lettuce [9]

UKb AY496054 Wellesbourne, UK Lettuce [9]

AUSb AY496055 Perth, south-west Australia Lettuce [9]

NLb AY496056 De Lier, The Netherlands Lettuce [9]






GRA1 AY581689 Granada, Spain Lettuce [9]

UK2 AY581690 UK Lettuce [9]

MUR2 AY581691 Aguilas, Murcia, Spain Lettuce [9]





SON5 AY839622 Granada, Spain Sowthistle [8]

SON6 AY839623 Granada, Spain Sowthistle [8]

107b DQ530352 Bauru, Brazil Lettuce Unpublished

104b DQ530353 Campinas, Brazil Lettuce Unpublished

105b DQ530354 Bauru, Brazil Lettuce Unpublished

106b DQ530355 Mogi das Cruzes, Brazil Lettuce Unpublished

AUSE4 GU220721 Perth, south-west Australia Lettuce This study


AUSA5 GU220723 Perth, south-west Australia Lettuce This study

AUSB1 GU220724 Perth, south-west Australia Lettuce This study

AUSB2 GU220725 Perth, south-west Australia Lettuce This study

AUSG1 GU220726 Perth, south-west Australia Lettuce This study


L. D. Maccarone et al.

123

Tris-boric acid-EDTA (TBE) electrophoresis buffer was

used [10].

PCR amplicons were purified by ethanol precipitation

and quantified using a Nanodrop UV–vis spectrophotom-

eter following the manufacturer’s protocol. Standard liga-

tion and transformation reactions were done into JM109

competent cells using a pGEM�-T Easy Vector (Promega

Corp, Madison, Wisconsin) as recommended by the man-

ufacturer. Screening for recombinant plasmids used M13

primers: M13 fwd (50CGT CAG GCT TTT CCC AGT

CAC GAC30) and M13 rev (50TCA CAC AGG AAA CAG

CTA TGA C30). Amplification conditions were 1 min

denaturation at 94�C followed by 25 cycles of 94�C for

30 s, 55�C for 30 s, 72�C for 30 s before being held at

14�C. Recombinant plasmids were inoculated into 5 mL of

Luria–Bertani (LB) broth with ampicillin (100 mg/L) and

incubated on a shaker at 37�C overnight. The plasmid was

then purified from the culture using an AurumTM Bio-Rad

Plasmid Extraction Kit following the manufacturer’s pro-

tocol. Presence and size of inserts was confirmed with a

restriction digest of purified plasmid DNA by EcoR1

(10 lL of purified plasmid DNA, 2 lL of 109 EcoR1

buffer, 1 lL of EcoR1 and 7 lL of water). Dideoxy-ter-

mination sequencing was done at the State Agricultural

Biotechnology Centre (SABC), Murdoch University using

BigDye terminator V3.1 chemistry and an Applied Bio-

systems/Hitachi 37030 DNA Analyser. The complete CP

sequences of each isolate were submitted to GenBank

(Table 1). One clone was sequenced per isolate.

The complete CP genes of the seven new Australian

LBVaV isolates contained one ORF 1,194 bp in length that

coded for 397 amino acids. In addition, 22 complete and

eight partial CP sequences of other LBVaV isolates and

complete CP sequences of five TStV isolates were

retrieved from GenBank (Table 1). The partial sequences

were four from Brazil [DQ530352 (889 bp), DQ530353

(882 bp), DQ530354 (866 bp) and DQ530355 (876 bp)]

and one each from USA (AY496053), UK (AY496054),

Netherlands (AY496056) and Australia (AY496055) (all

1,010 bp in length). Complete CP nucleotide sequences

AB050272 (isolate LBVaV-CP) and AB114138 (isolate

Ka), both from Kagawa Japan, were identical so only the

former was included. A partial LBVaV sequence from

Salinas, CA (DQ182566) was excluded as it was only

302 bp [2]. The 34 complete LBVaV and TStV CP

sequences were assembled and analysed using Molecular

Evolutionary Genetics Analysis (MEGA) program Version

4.1 with Clustal W [15] and bootstrapped with 1,000

re-samplings [14]. These sequences were analysed in direct

pairwise comparisons to establish percentage identities.

Evolutionary history was inferred by the Neighbour-Join-

ing method. Evolutionary distances between nucleotide

sequences were computed using the Maximum Composite

Likelihood method. This was done first with the 29 com-

plete CP sequences of LBVaV and five of TStV, and then

repeated to include the eight partial sequences after trim-

ming complete sequences to reflect the length of the partial

sequences. Evolutionary distances of deduced amino acid

sequences were computed for the complete CP sequences

using the Poisson correction method in MEGA4.1. Any

positions containing gaps and missing data were elimi-

nated. Nucleotide substitutions for the CP region were

inferred using the SLAC model [3]. Next, the mean number

of non-silent substitutions (Dn) and silent substitutions

(Ds), and Dn/Ds ratios were determined to assess the

selective constraints on the CP gene [3]. Dn/Ds ratios for

the sequences of complete CP genes were estimated first

for the seven Australian isolates alone and then for all

complete nucleotide sequences.

The sequence identities of the seven new Australian

isolates were 95.6–99.7% (nucleotides) and 98.2–99.7%

(amino acids). They formed a geographically distinct group

most closely related to each other and to LBVaV isolates

from Japan. The complete sequence identities of all 29

isolates of LBVaV and five of TStV ranged from 93.6 to

99.7% (nucleotides) and 94.3 to 100% (amino acids).

These values for both nucleotide and amino acid sequence

identity were the same when comparing the 29 LBVaV

isolates alone. The sequence identities of the five TStV

isolates alone were 95.7–99.7% (nucleotides) and 97.2–

100% (amino acids). LBVaV isolate UK2 was most

divergent with 93.6% identities to Japanese LBVaV Hy

and TStV Na isolates. These sequence identities resemble

those reported previously [9, 12]. Thus, our data showing

that the CP of LBVaV and TStV is highly conserved

confirmed data from previous work with fewer isolates and

supported TStV being a strain of LBVaV [12].

When the complete CP nucleotide sequences (29 of

LBVaV and five of TStV) were subjected to phylogenetic

analysis, all were within two clades (I and II), II being

resolved into three distinct sub-clades (IIa–c) (Fig. 1a). All

clades and sub-clades were geographically distinct as

regards the origins of the isolates within them. Clade I

contained 12 lettuce and six sowthistle isolates of LBVaV,

all from Europe. Within clade II, sub-clade IIa only con-

tained the seven new Australian LBVaV isolates, IIb the

four LBVaV isolates, and IIc the five Japanese TStV iso-

lates. Sub-clades IIb and IIc were closer to each other than

to sub-clade IIa containing Australian isolates. The

groupings obtained not only agreed with the three group-

ings of Sasaya et al. [12], (a) five TStV isolates, (b) four

Japanese LBVaV isolates and (c) four Spanish LBVaV

isolates, but also added 16 extra European isolates to (c)

and revealed a new grouping containing only Australian

isolates. Our findings also agree with those of Navarro

et al. [9] in which, apart from one Japanese LBVaV isolate,

Comparison of the coat protein genes

123

the only complete CP sequences examined were 12 from

Europe. Moreover, in our study, inclusion together in one

analysis of the complete CP sequences of seven additional

isolates with those of all other 27 isolates now available on

GenBank allowed greater resolution revealing presence of

two clades, and three sub-clades containing isolates from

geographically distant regions (Europe, Japan and

Australia). In addition, although lettuce isolates were

present in both clades and two of the three sub-clades,

sowthistle isolates (SON1-5) were all together in one clade

(I), while tobacco isolates were isolated within a sub-clade

of their own (IIc). When the eight partial CP sequences

were added to the 34 complete sequences and aligned, the

single sequences of Brazilian isolate 106 and those from

Australia and the Netherlands all grouped with the Aus-

tralian isolates within sub-clade IIa (Fig. 1b). The other

three Brazilian sequences and the UK and USA sequences

were in clade I, the latter being most closely related to

UK2, but the former to Spanish isolates SON1 and GAL1.

None grouped with sub-clades IIb or IIc.

Assuming that LBVaV evolved with lettuce in its centre

of domestication in the Mediterranean region, greatest

genetic diversity would be expected there. This was

reflected in the results with the 17 Spanish isolates.

Occurrence of all Australian sequences within the same

sub-clade (IIa) suggests only one introduction of LBVaV

SON5

SON4

SON3

SON6

SON2

GRA1

ALM1

ALM3

MUR1

ALM4

ALM7

ALM6

ALM2

ALM5

UK2

MUR2

SON1

GAL1

I

AUSE4

AUSE5

AUSA5

AUSB1

AUSB2

AUSG1

AUSE6

IIa

Wa

Hy

LBVaV CP

A

IIb

Na

Kan

No88

No89

No2

IIc

II87

50

100

93

81

55

100

100

99

99

94

98

85

62

96

86

96

74

62

64

66

98

63

65

50

52

0.005

SYNV

0.1

ASYNV

0.2

AUSE4

AUSE5

AUSA5

AUSB1

AUS

NL

106

AUSB2

AUSG1

AUSE6

IIa

Wa

Hy

A

LBVaV CP

IIb

Na

KanNo88

No89

No2

IIc

II

UK2

UK

USA

ALM2

ALM5

ALM4

ALM6

MUR1

ALM7

ALM3

ALM1

GRA1

SON6

SON2

SON3

SON5

SON4

105

107

SON1

104

GAL1

MUR2

85

49

100

65

46

54

100

100

73

94

98

97

86

51

54

56

83

92

73

69

99

78

84

83

77

64

69

68

44

70

69

93

47

29

62

45

0.005

I

B

Fig. 1 Phylogenetic relationships among complete coat protein (CP)

nucleotide sequences of 29 Lettuce big-vein associated virus(LBVaV) isolates from Europe, Australia and Japan, and five tobacco

stunt virus (TStV) isolates from Japan (a), and these same sequences

with eight partial LBVaV CP sequences included (b). Trees generated

with MEGA 4.1 using default parameters. Tree branches were

bootstrapped with 1,000 replications. Numbers at nodes indicate

bootstrap scores[50% (a) or all scores (b). The scale bar represents a

genetic distance of 0.005 for horizontal branch lengths. For isolate

designations, see Table 1. Inset shows isolates rooted with sonchus

yellow net virus (SYNV), accession number M17210


123

into Australia since European settlement approximately

200 years ago. Presence of a partial CP sequence from the

Netherlands in this sub-clade might reflect its introduction

from Europe. Occurrence of only Japanese LBVaV

sequences in sub-clade IIb and Japanese TStV sequences in

sub-clade IIc suggests two introductions to Japan, but does

not indicate their origin. Cultivated tobacco is from the

Americas but TStV has not been found there as yet. Further

complete CP sequences of LBVaV from North America,

South America, Asia (outside Japan) and Europe (outside

Spain) would help identify the geographical origins of

isolates found in different parts of the world. Identification

and sequencing of TStV isolates from countries other than

Japan would do the same for the tobacco form of LBVaV.

Further sequencing might also permit resolution of clade I

into 2–3 sub-clades (Fig. 1b).

When the 34 complete amino acid sequences were

compared, the central region of the CP gene was most

divergent with few amino acid substitutions towards the N

and C terminus regions (Table 2). When the partial

sequences were included, there were 79 amino acid sub-

stitutions across the entire CP of 397 nucleotides, the

partial sequences contributing an additional four. Forty-

six of these substitutions occurred between amino acid

positions 200 and 300. Among the isolates in clade I,

there were 55 amino acid substitutions over the entire CP

Table 2 Variable amino acid

positions in the coat protein

(CP) encoding region of 37

Lettuce big-vein associatedvirus (LBaV) isolates and five

tobacco stunt virus isolates

1111111112 2222222222 2222222222 2222222222 2222233333 33333 1566899 0112267890 0000001111 1112222233 3444456667 7788956678 99999 7890379379 2066935391 2357890123 4790378956 7358904690 6734927999 12345 ALM2 KMLEVRIDKT VADVIQPTYG TLRLYALGDV TRTEFLANIP QLITTATMKK LSDNFKNMED GETPVSON5 .......... .......... ....FR..N. Q.IK...... .......... .......... ..... SON4 .......... .......... I...LRF... .....FP... .......... .......... ..... SON3 .......... .....P.... ...F...... .....F.... .......... .......... ..... SON6 .......... ........F. ..G....E.. ..I.L..... .......... .......... ..... SON2 .......... .......... A......E.. .......... .......... .......... ..... GRA1 .......... .......... ......V... ..S....S.. .......... .......... ..... ALM1 .......... .......... A......... .......... .......... .......... ..... ALM3 .......... .......... .......... .......... .......... .......... .....MUR1 .......... .......... .......... .......... ..L....... .......... ..... ALM4 .......... .......... .......... .......... .......... .......... .Q... ALM7 .......... .......... .......... .......... ......A... .......... ..... ALM6 .......... .......... .......... .G........ .......... .......... ..... ALM5 .......... ......S..R .......... .......... .......... .......... A.... UK2 .I........ L.NA...... .......... .......... .......... .........N ..... UK -----..... ...A...... .......... .......... ....A..... .....----- -----USA -----..... ...A...... .......... .......... .......... .....----- ----- MUR2 .......... .......... ......F.NG A..G...... ..SA.G.VIE RNV.L.S..N ..... 104 -----.M... ...A...... .......... A......... .......... .....----- ----- 105 -----GM... ...A...... .......... A......... .......... .....----- ----- 107 -----....A ...A...... .......... A......... .......... .....----- -----SON1 R......... ...A...... .......... A......... ...S...... V........N ..... GAL1 R......... ...A...... .......... A......... .......... .........N ..... AUSE4 .......... .D.A...... .......... A......STS E......... ........GN ..... AUSE5 .......... .D.A...... .......... A......STS E......... .........N ..... AUSA5 .......... .D.A...... .......... A......S.. .......... .........N ..... AUSB1 .........A .V.A...... .......... A......... .......... .........N ....E AUS -----..... .D.A...... .......... A......... .......... .....----- ----- NL -----..G.. .D.A...... .......... A......... .......... .....----- ----- 106 -----GM... .D.A...... .......... A......... .......... .....----- ----- AUSB2 .......... .D.A...... .......... A......... .......... .........N ..... AUSG1 ..P......A .V.A...... .......... A......S.. .P........ .........N ..... AUSE6 ...D.....A .V.A...... .......... A......S.. .......... .........N ..... Wa ...D...... .P.A...N.. .......... A......... .......... .........N ..... Hy ...D...... .P.A...N.. .......... A......... .......... .........N ...S. A ...D...... .P.A...N.. .......... .......... .......... .........N ..... LBVaV-CP...D...... .P.A...N.. .......... A......... .......... .........N ..... Na ...DA...R. ...A...A.. .F........ A......... .......... ...T.....N ..A.. Kan ...DA...R. ...A...A.. .......... A......... .......... .........N ..A.. No88 ...DA...R. ...A...A.. .......... A......... .......... .....E.V.N ..A.. No89 ...DA...R. ...A...A.. .......... A......... .......... .........N ..A.. No2 ...DA...R. ...AT..A.. .......... A......... .......... .........N ..A..

Amino acid substitution sites *

I

IIa

IIb

IIc

* Numbers vertically positioned above the sequence alignment indicate positions of the LBVaV CP and TStV CP amino acid residues. The consensus sequence is shown by isolate ALM2 and amino acid residues that are different from the consensus are indicated, whereas amino acid residues that are identical to the consensus aremarked with dots. Partial sequences for which there is no amino acid sequence information available are markedwith dashes.

Comparison of the coat protein genes

123

gene sequence and 48 of them were unique. There were

39 substitutions between positions 200 and 300. There

were 31 amino acid substitutions in clade II which were

relatively evenly spread throughout the CP gene except

for a cluster at the C terminus. The Australian LBVaV

isolates in sub-clade IIa showed 13 amino acid substitu-

tions, 10 of which were found only in sub-clade IIa; 6

substitutions were in a cluster between positions 214 and

243. The Japanese LBVaV isolates in sub-clade IIb

showed seven amino acid substitutions, those at positions

110, 183 and 394 being unique. In sub-clade IIc, there

were 13 amino acid substitutions 9 of which were unique,

those at positions 53, 97, 183 and 393 being present in all

isolates.

Navarro et al. [9] reported a mean Dn/Ds ratio of 0.132

for LBVaV CP gene sequences. In our study, a mean Dn/

Ds ratio of 0.187 was obtained for all 34 complete CP

sequences indicating that the majority of the nucleotide

substitutions were silent. The mean Dn/Ds ratios for clades

I and II were 0.283 and 0.124, respectively, while those for

sub-clades IIa, IIb and IIc were 0.274, 0.060 and 0.156,

respectively. Mean Dn/Ds ratios \1 suggest selection for

amino acid conservation. Genome conservation is expected

as genetic stability is commonly seen in natural plant virus

populations so the low mean Dn/Ds ratios in clades I and II

reflect selection against nucleotide changes causing amino

acid substitutions, especially in sub-clades IIb and IIc.

There were 74 amino acid substitutions in the complete CP

sequences, 52 were in clade I with 47 of them being

unique. This greater level of amino acid substitution could

also explain the higher Dn/Ds ratio for clade I. Similarly,

the greater Dn/Ds ratio for sub-clade IIa might be

explained by 10 of the 13 amino acid substitutions in the

complete CP sequences being unique to this sub-clade.

Only three unique amino acid substitutions were found in

sub-clade IIb which had the lowest Dn/Ds ratio. The CPs of

vector-borne plant viruses are subject to greater stabilising

selection than those of viruses transmitted otherwise

because interaction between the CP and cellular receptors

on vectors places greater selective constraint on the amino

acid sequence than host-virus interactions. For example, in

Melon necrotic spot virus vectored by Olpidium bornov-

anus just one amino acid substitution from Ile to Phe at

position 300 resulted in loss of specific binding and fungal

transmission as the CP acts as a ligand to the vector zoo-

spore [6]. A similar scenario might also occur within

LBVaV, explaining its high degree of CP sequence

conservation.

Acknowledgments We thank Stephen Wylie, Craig Webster and

Denis Phillips for advice, the SABC for laboratory facilities and local

farmers for allowing sampling. Linda Maccarone received an

Australian Postgraduate Award from the Australian Research

Council.

References

1. Brunt AA, Milne RG, Sasaya T, Verbeek M, Vetten HJ, Walsh

JA (2005) Varicosavirus. In: Fauquet CM, Mayo MA, Maniloff J,

Desselberger U, Ball LA (eds) Virus taxonomy. Eighth Report of

the International Committee on Taxonomy of Viruses. Elsevier/

Academic Press, London, pp 669–671

2. Hayes RJ, Wintermantel WM, Nicely PA, Ryder EJ (2006) Host

resistance to Mirafiori lettuce big-vein virus and Lettuce big-veinassociated virus and virus sequence diversity and frequency in

California. Plant Dis 90:233–239

3. Kosakovsky-Pond SL, Frost SDW (2005) Datamonkey: rapid

detection of selective pressure on individual sites of codon

alignments. Bioinformatics 21:2531–2533

4. Kuwata S, Kubo S (1986) Tobacco stunt virus, Descriptions of

plant viruses, no. 313. Association of Applied Biologists,

Wellesbourne, UK, 4 p

5. Lot H, Campbell RN, Souche S, Milne RG, Roggero P (2002)

Transmission by Olpidium brassicae of Mirafiori lettuce virusand Lettuce big-vein virus, and their roles in lettuce big-vein

etiology. Phytopathology 92:288–293

6. Mochizuki T, Ohnishi J, Ohki T, Kanda A, Tsuda S (2008)

Amino acid substitution in the coat protein of Melon necrotic spotvirus causes loss of binding to the surface of Olpidium bornov-anus zoospores. J Gen Plant Pathol 74:176–181

7. Navarro JA, Botella F, Maruhenda A, Sastre P, Sanchez-Pina

MA, Pallas V (2004) Comparative infection progress analysis of

Lettuce big-vein virus and Mirafiori lettuce virus in lettuce crops

by developed molecular diagnosis techniques. Phytopathology

94:470–477

8. Navarro JA, Botella F, Marhuenda A, Sastre P, Sanchez-Pina

MA, Pallas V (2005) Identification and partial characterisation of

Lettuce big-vein associated virus and Mirafiori lettuce big-veinvirus in common weeds found amongst Spanish lettuce crops and

their role in lettuce big-vein disease transmission. Eur J Plant

Pathol 113:25–34

9. Navarro JA, Torok VA, Vetten HJ, Pallas V (2005) Genetic vari-

ability in the coat protein genes of Lettuce big-vein associated virusand Mirafiori lettuce big-vein virus. Arch Virol 150:681–694

10. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory

manual. Cold Spring Harbour Laboratory Press, New York

11. Sasaya T, Ishikawa K, Koganezawa H (2001) Nucleotide

sequence of the coat protein gene of Lettuce big-vein virus. J Gen

Virol 82:1509–1515

12. Sasaya T, Ishikawa K, Kuwata S, Koganezawa H (2005)

Molecular analysis of coat protein coding region of tobacco stunt

virus shows that it is a strain of Lettuce big-vein virus in the genus

Varicosavirus. Arch Virol 150:1013–1021

13. Sasaya T, Koganezawa H (2006) Molecular analysis and virus

transmission tests place Olpidium virulentus, a vector of Mirafiorilettuce big-vein virus and Tobacco stunt virus, as a distinct spe-

cies rather than a strain of Olpidium brassicae. J Gen Plant Pathol

72:20–25

14. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molec-

ular Evolutionary Genetics Analysis (MEGA) software version

4.0. Mol Biol Evol 24:1596–1599

15. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W:

improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, position-specific gap

penalties and weight matrix choice. Nucleic Acids Res 22:4673–

4680

16. Vetten HJ, Lesemann DE, Dalchow J (1987) Electron micro-

scopical and serological detection of virus-like particles associ-

ated with lettuce big vein disease. J Phytopathol 120:53–59


123

molecular genetic characterisation of mirafiori lettuce ...€¦ · rocky balboa, 2006 . iv . v...

Documents