molecular and synaptic mechanisms

MOLECULAR AND SYNAPTIC MECHANISMS

A role for solute carrier family 10 member 4, or vesicularaminergic-associated transporter, in structural remodellingand transmitter release at the mouse neuromuscularjunction

Kalicharan Patra,1,* David J. Lyons,1,* Pavol Bauer,1 Markus M. Hilscher,1,2,3 Swati Sharma,1

Richardson N. Le~ao1,2,3 and Klas Kullander11Department of Neuroscience, Uppsala University, Uppsala, Sweden2The Beijer Laboratory for Gene and Neurosciences, Uppsala, Sweden3Brain Institute, Federal University of Rio Grande do Norte, Natal, Brazil

Keywords: acetylcholine, peripheral nervous system, SLC10A4, synaptic transmission, vesicular aminergic-associated trans-porter, vesicular content

Abstract

The solute carrier and presynaptic vesicle protein solute carrier family 10 member 4, or vesicular aminergic-associated transporter(VAAT), was recently proven to have a modulatory role in central cholinergic signalling. It is currently unknown whether VAATalso affects peripheral cholinergic synapses. Here we demonstrated a regulatory role for the presynaptic vesicle protein VAAT inneuromuscular junction (NMJ) development and function. NMJs lacking VAAT had fewer branch points, whereas endplatesshowed an increased number of islands. Whereas the amplitude of spontaneous miniature endplate potentials in VAAT-deficientNMJs was decreased, the amplitude of evoked endplate potentials and the size of the readily releasable pool of vesicles wereboth increased. Moreover, VAAT-deficient NMJs displayed aberrant short-term synaptic plasticity with enhanced synaptic depres-sion in response to high-frequency stimulation. Finally, the transcript levels of cholinergic receptor subunits in VAAT-deficientmuscles were increased, indicating a compensatory postsynaptic sensitization. Our results suggested that VAAT modulates NMJtransmission efficiency and, as such, may represent a novel target for treatment of disorders affecting motor neurons.

Introduction

The solute carrier family 10 member 4 (SLC10A4) is a synapticvesicular protein that is co-expressed at high levels with markers ofcholinergic and monoaminergic vesicles (Geyer et al., 2008; Burgeret al., 2011; Larhammar et al., 2014) and was recently designatedas vesicular aminergic-associated transporter (VAAT) because of itslocation in presynaptic vesicles of aminergic neurons and its modu-lation of amine neurotransmission (Larhammar et al., 2014). Werecently used an Slc10a4 knockout mouse (herein referred to asVaat KO) to study the functional and biological significance of thisprotein in central cholinergic neurotransmission (Zelano et al.,2013). These findings suggested a protective modulatory role forVAAT against susceptibility to cholinomimetic drugs in an inducedepilepsy model. Furthermore, Vaat KO mice displayed spontaneousepileptiform activity in the cortex as well as oscillatory activity inhippocampal slices. These and other findings, such as a possible role

for this protein in Alzheimer’s disease (Popova & Alafuzoff, 2013),have led to speculations regarding the function and clinical rele-vance of SLC10A4 (Borges, 2013). Thus, it now appears thatVAAT has, since its initial identification as a tentative membraneprotein, emerged as a significant player in the modulation of aminer-gic neurotransmission.Based on previous findings suggesting that VAAT regulates the

sensitivity of central cholinergic systems (Zelano et al., 2013), weset out to determine the structural, molecular and electrical prop-erties of cholinergic synaptic transmission in the absence of thisprotein. As central synapses are highly complex [being multiplymodulated and residing on neurons that are heavily innervated(Marder, 2012)], we sought to investigate the role of VAATusing the relatively less complex neuromuscular junctions (NMJs)in mice.Neuromuscular junctions are specialised synaptic structures con-

necting neurons to muscles with a particularly robust response uponaction potential activation. Their relatively stable and large pretzel-like synaptic structure differs from central cholinergic synapses inthat they have a one-to-one axon to muscle fibre connection. Thisconnective simplicity, robustness of transmission and physical acces-sibility confer upon the NMJ preparation numerous advantages for

Correspondence: K. Kullander, as above.E-mail: [email protected]

*K.P. and D.J.L. contributed equally to this work.

Received 18 January 2014, revised 14 October 2014, accepted 17 October 2014

© 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd

European Journal of Neuroscience, Vol. 41, pp. 316–327, 2015 doi:10.1111/ejn.12790

the study of the structural, molecular and electrophysiologicalaspects of cholinergic neurotransmission (Ribchester, 2009). Accord-ingly, the NMJ preparation has previously been used to assess therole of other vesicle-associated synaptic proteins, e.g. Syb1 (Liuet al., 2011), in neuronal signalling.Our findings indicate that the absence of VAAT disturbs

the structural and electrophysiological properties of NMJs. Wefurther show that the Vaat KO mouse displays postsynapticsensitization with elevated expression of neurotransmitter receptorsubunits.

Materials and methods

Mice

All mice were housed as approved by the animal care unit ofUppsala University and experiments were conducted according toSwedish guidelines and regulations, and European Union legislation(ethical permits C248/11 and C422/12).The Slc10a4 heterozygous mice (Slc10a4+/�) of 129/SvEvBrd

background (from Texas A&M Institute for Genomic Medicine, TX,USA) were inbred to C57BL/6 for at least three generations toobtain null mutants (Slc10a4 KO or Vaat KO) and wild-type (WT)littermates on a stable genetic background. Mice were genotyped forVaat using the following primer pairs: Vaat+/+_F, GGAAAGACATGGCTGACTCTG; Vaat+/+_R, CACGCGGTTGTATTTGTAGC;Vaat�/�_F, CAGGTAAAGGGACCACAGG; and Vaat�/�_R, ACA-CCGGCCTTGTATTTGTAGC.

Western blot

The striatal lysate was separated on 4–15% mini-PROTEAN�

TGXTM precast gel (Bio-Rad Laboratories AB, Sweden) at 120 Vfor 1 h and transferred to a nitrocellulose membrane (Bio-RadLaboratories AB) at 15 V for 30 min in a semi-dry electropho-retic transfer cell (Bio-Rad Laboratories AB). The membrane wasblocked with 3% bovine serum albumin in Tris-buffered saline-Tween� 20 for 1 h and incubated with primary antibody in thesame blocking solution for 2 h at room temperature (22 �C), fol-lowed by four washes in Tris-buffered saline- Tween (50 mM

Tris, pH 8, 150 mM NaCl, 0.05% Tween� 20). The membranewas then incubated with protein A–horseradish peroxidase conju-gate (Bio-Rad Laboratories AB) for 1 h at room temperature fol-lowed by washing in TBST and detection with luminol reagent.The antibody dilutions used in the western blot were as follows:rabbit SLC10A4, 1 : 1000 (HPA028835, Sigma) and mouse syn-aptophysin, 1 : 1000 (generous gift from the laboratory of Profes-sor Reinhard Jahn, Gottingen, Germany).

Quantitative real time-polymerase chain reaction

Total RNA isolated from the lumbar spinal cord and gastrocnemiusmuscle from WT (n = 12) and VAAT KO (n = 12) mice by the Tri-zol method (cat. no. 10296010, Life Technologies Ltd) was sub-jected to DNase I treatment (cat. no. EN0525, Fermentas) as per themanufacturer’s instructions. Using Superscript� II enzyme (cat. no.18064022, Invitrogen), 800 ng of RNA was reverse transcribed tocDNA, of which the equivalent of 8 ng RNA per reaction was takenas the template to run real-time polymerase chain reaction (PCR).The primers were designed using PRIMER3 PLUS software, whereverpossible (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3-plus.cgi) from adjacent exons in a gene to avoid any contaminatingamplification from traces of genomic DNA, and were verified by in-silico PCR (http://genome.ucsc.edu/cgi-bin/hgPcr?command=start),taking the mouse genome assembly released in Dec. 2011(GRCm38/mm10) and using University of California Santa Cruzgenes as the target. Primers were verified using cDNA from a WTsample for optimal annealing temperature. Real-time PCR was car-ried out in duplicate using a KAPATM SyBr� FAST qPCR Kit(KAPA Biosystems Inc., Woburn, USA) and iCyclerTM (Bio-Rad).The PCR efficiencies of primer pairs were calculated using the lin-ear regression method (LinRegPCR). The quantification cycle valuesthus obtained were normalised to the geometric mean of the twomost stable reference genes (Actb and Tubb5) out of five genestested on the geNorm algorithm (http://medgen.ugent.be/~jvdesomp/genorm/). The final comparisons between normalized quantificationcycle values were graphically plotted using GRAPHPAD PRISM©. A listof the primers used for real time-quantitative polymerase chain reac-tion (RT-qPCR) is given in Table 1.

Immunohistochemistry

The diaphragm or gastrocnemius muscles were dissected out fromthe animal and fixed in 4% formaldehyde in 0.1 M phosphate-buf-fered saline (PBS) (pH 7.4) overnight at 4 °C. The fixed tissue waswashed in PBS before undergoing a sucrose gradient of 10%, 20%and 30% sucrose in PBS for 20 min, 120 min and 16 h, respec-tively. Finally, the tissue was embedded in O.C.T. medium (Opti-mum Cutting Temperature compound, Tissue TEK�) andcryosectioned (20 lm) onto super-frost plus glass slides (Menzel,Germany). For immunostaining, the sections were rehydrated inPBS/0.5% Tween� (PBST) for 10 min, immersed in antibody dilu-ent (2% bovine serum albumin in PBST) for 2 h to saturate unspe-cific binding, and incubated with primary antibodies for 16–18 h at4 °C in the antibody diluent. After washing in PBST, secondaryantibodies diluted in PBST were applied for 1 h at room tempera-ture. Alexa Fluor� 488 a-bungarotoxin conjugate was added to thesame solution to label acetylcholine (ACh) receptors. Sections were

Table 1. Real time-quantitative polymerase chain reaction primers

Gene name Forward primer Reverse primer

Slc10a4 GGATAGCATTGCATCGTCAAAC ACCCCTGGACAATGTTGATGActb GATCTGGCACCACACCTTCT CCATCACAATGCCTGTGGTATubb5 AGTGCTCCTCTTCTACAG TATCTCCGTGGTAAGTGCChrna1 GGTGTTCTACCTGCCCACAG GCTCCACAATGACCAGAAGGChrnb1 TTCTACCTCCCACCAGATGC AGGTCTCAGGCACTTTGTCGChrnd TTAGCCTGAAGCAGGAGGAG TGACATCTTGGTGGTTGGTGChrne TTGCCCAGAAAATTCCAGAG AGGGGATGTAGCATGAGTCGChrng GGGACCCAAAAGACTACGAAG GAGAGCCACCTCGAAGACACP2X7 TGCACATGATCGTCTTTTCC CCTCTGCTATGCCTTTGACCP2Y1 TCAAGCAGAATGGAGACACG CTCACTCAGGTGGCACACAC

© 2014 Federation of European Neuroscience Societies and John Wiley & Sons LtdEuropean Journal of Neuroscience, 41, 316–327

Role of SLC10A4 at neuromuscular junctions 317

then washed in PBST and mounted in Mowiol� (cat. no. 81381,Sigma). The following dilutions of antibodies were used: rabbitSLC10A4, 1 : 1000 (HPA028835, Sigma); goat vesicular AChtransporter (VAChT), 1 : 100 (sc-7717, Santa Cruz); a-bungaro-toxin–Alexa Fluor� 488, 1 lg/mL (B13422, Invitrogen); donkeyanti-rabbit Alexa Fluor� 647, 1 : 500 (711-605-152, Jackson Immu-noResearch); and donkey anti-goat Rhodamine Red-X (RRX),1 : 500 (705-295-147, Jackson ImmunoResearch).The triangularis sterni (TS) muscle was processed for the whole-

mount staining of NMJs following the protocol of the laboratory ofProfessor R. Ribchester (Edinburgh University, Scotland) (Courtet al., 2009) with minor modifications. Briefly, the TS muscle wasdissected in PBS and fixed with 4% formaldehyde for 40 min. Thetissue permeabilization and primary and secondary antibody incuba-tion were carried out as described above but in PBS containing0.3% Triton� X-100 and 2% bovine serum albumin. All of thewashes were carried out in PBST. The antibodies used on TS mus-cle preparations were as follows: chicken neurofilament (200 kDa),1 : 50 000 (ab4680, Abcam); rabbit SLC10A4, as above; a-bunga-rotoxin–Alexa Fluor� 488, as above; and donkey anti-chicken RRX,1 : 400 (703-295-155, Jackson ImmunoResearch). The whole TSmuscle preparation was mounted with Mowiol.

Image analysis

Z-stacks of images at 0.35-lm optical slice depth were capturedusing an LSM 510 META confocal microscope (Zeiss) and a Plan-Apochromat 639/1.4 NA oil immersion objective (Zeiss) with thesame laser power settings and scanning mode for NMJs of bothgenotypes. The Z-stacks were further analysed using MATLAB(R2013b, Mathworks) including the Image processing toolbox andImageJ (1.48a) including various modules supplied by the Fiji distri-bution (Schindelin et al., 2012).The sets of three-dimensional (3D) images used for the branching

analysis were first denoised using a smoothing algorithm (Gaussiankernel, sigma = 1) and further transformed to a binary image apply-ing Otsu’s auto-threshold method. Following this step, the morphol-ogy was skeletonized using Fiji’s AnalyzeSkeleton module and theresulting branch network was pruned for loop cycles using the‘shortest branch’ option.The analysis of VAChT distribution over the NMJ was based on

a maximum-intensity projection of the Z-stack, following a denois-ing step using alternating morphological opening and closing algo-rithms to remove small elements and close holes. Afterwards, themedian of the VAChT distribution was obtained on the area thathad been kept dependent on the threshold intensity of the bungaro-toxin staining (representing the NMJ structure).

Motor behaviour

The forelimb grip strength test was performed on a grip strengthinstrument (Bio GS3, Bioseb In Vivo Research Instruments) as per themanufacturer’s instructions to measure acute muscle strength dis-played as the maximal peak force (in weight) developed by a mousein resistance to pulling it away from a wire grid (Brooks & Dunnett,2009). In a single move, female mice aged between 20 and 24 weeks(N = 14 per genotype) held at the tail tips were lowered onto a wiregrid attached to the instrument, allowing the forelimbs to get a grip,and then pulled away from the grid, all within the 3-s time period. Theforce exerted by the mouse to hang onto the grid was registered in theinstrument. The sequence was repeated five times per mouse andthe average score (in g) was plotted to compare between genotypes.

The hanging wire test was implemented to assess muscle tone andstrength as instructed by M. Putten (Leiden University, The Nether-lands) (http://www.treat-nmd.eu/downloads/file/sops/dmd/MDX/DMD_M.2.1.004.pdf), originally described by Raymackers et al.(2003), with some modifications. Briefly, a 1.8-mm-thick copper wirewas tied between two poles separated by 55 cm and elevated 35 cmfrom the home cage. Female mice aged between 20 and 24 weeks (set1) and between 60 and 65 weeks (set 2) (N = 12 per genotype foreach set) were suspended in the middle with their forepaws holdingthe wire. Use of the hindlimbs or tail to climb onto the wire was pre-vented by gently holding the tip of the tail so that the mice could onlyuse their forelimbs, but without applying pressure or pulling on thetail. However, the mice were allowed to walk along the wire with theirforelimbs. This technique prevented the mice from displaying theinappropriate behaviour of standing over the wire or using the strengthof the tail to gain balance. Mice were subjected to a 300-s hanging testand ‘falls’ and ‘reaches’ were scored. At the start, ‘fall’ was set to 10and ‘reach’ was set to 0, and for each ‘fall’ or ‘reach’ the elapsed timewas noted and the score was adjusted by reducing by 1 point per falland increasing by 1 point per reach. A 15-s composure period wasgiven after each fall, but for each reach the mouse was promptlyplaced back in the middle. Kaplan–Meier-like curves for the ‘falls’and ‘reaches’ were separately generated after calculating the averagescore for each genotype at any time point.

Electrophysiology

Intracellular recordings were carried out fibres from Vaat KO mice(n = 13) and their littermate controls (n = 11). The nerve–musclepreparation from adult mice for electrophysiology was performed aspreviously described (Ribchester, 2009, 2011). Flexor digitorum bre-vis muscles with nerves attached were acutely isolated in oxygen-ated (95% O2, 5% CO2) extracellular solution (137 mM NaCl, 5 mM

KCl, 5 mM HEPES, 1.3 mM MgCl2, 2.4 mM CaCl2, and 5 mM D-glucose, pH 7.3). Fibres were impaled with glass micropipettes(resistance 40–60 MO) filled with 2 M potassium acetate and 40 mM

KCl. Evoked endplate potentials (EPPs) were elicited by supra-threshold stimulation (10 V, 0.1 ms) of the nerve via a suction elec-trode. To prevent muscle contraction, l-conotoxin GIIIB (2 lM, Ba-chem) was added to the bath solution for 30 min prior to recording.Miniature endplate potentials (mEPPs) and EPPs were acquiredusing an intracellular amplifier (Multiclamp 700B) and digitisedwith Digidata 1440A (Molecular Devices, Sunnyvale, CA, USA).Data were analysed with pClamp 10 (Molecular Devices) and MiniAnalysis Program (Synaptosoft, Inc., Decatur, GA, USA). The meanamplitudes of the EPP and mEPP recorded at each NMJ were line-arly normalized to 70-mV resting membrane potential. The EPPamplitudes were corrected for non-linear summation (Martin, 1955)as follows: EPPCorrected = average peak EPP/[1 � average peakEPP/(Vm � Er)], where Vm is the resting membrane potential andEr is the reversal potential (taken as �5 mV). The quantal content(number of ACh quanta released in response to a single nerveimpulse) was estimated using the direct method, i.e. dividing themean amplitude of EPPs by the mean amplitude of mEPPs of thesame cell (Boyd & Martin, 1956; Wood & Slater, 2001).

Statistical analysis

The unpaired t-test was used for all of the experiments that involvedstatistical analysis. Data from the microstructural analysis of NMJsare presented as mean � SD, whereas data from electrophysiologyand RT-PCR analysis are presented as mean � SEM.


318 K. Patra et al.

Results

VAAT expression and role in the neuromuscular junction

We first set out to establish the expression of VAAT in NMJsand to verify the Vaat KO at the transcript and protein levels. Weperformed RT-qPCR to measure the Vaat transcript levels in thelumbar spinal cord from WT and KO mice (n = 12/genotype),which corroborated an absence of Vaat transcripts in the spinalcords of KO mice (Fig. 1A). Western blot performed on the stria-tal lysate confirmed the loss of a approximately 72-kDa prominentband, corresponding to glycosylated VAAT, whereas the level ofsynaptophysin, a 38-kDa common vesicular protein (Thomas et al.,1988), was similar in samples from KO and WT mice (Fig. 1B).Synaptic proteins are known to affect the bouton structure andpatterning of NMJs (Choi et al., 2013). We examined whether theloss of VAAT might lead to abnormal patterning of the NMJsover the muscle fibre, e.g. as was observed in the nicotinicgamma receptor subunit-deficient mice (Liu et al., 2008). For thispurpose, the TS muscle was immunolabelled with neurofilament tostain the axons (red) and bungarotoxin (green) to stain the AChreceptor clusters. At this macrostructural level, we did not observeany gross abnormalities in the distribution of NMJs (Fig. 1C). Wenext investigated NMJs at an individual level. Immunohistochemis-try experiments combining antibodies recognising VAAT andVAChT with bungarotoxin labelling demonstrated an overlappingdistribution of VAAT and VAChT in NMJs, starting from birth(Fig. 1D; Supporting Information Fig. S1). We calculated thePearson’s correlation coefficient between VAAT and VAChT im-munolabelling to be 0.87 (+1 is a perfect correlation). It was alsoapparent that individual NMJs lacking VAAT were mis-shapedcompared with NMJs from control WT mice (Fig. 1D). Althoughthe NMJs had an abnormal appearance, the relative VAChT distri-bution over the NMJ was found to be similar in controls andVAAT null mice, as measured by correlating the 3D expression

of the VAChT-immunopositive signal with bungarotoxin labeling(Fig. 1E).

Vaat knockout mice display fragmented endplate structure

The seemingly mis-shaped NMJs observed in the Vaat KO micecalled for a closer structural analysis of individual NMJs. We con-structed detailed 3D images of entire NMJs from WT (n = 87,three animals) and KO (n = 114, four animals) mice derived fromconfocal image stacks. The Z-stacks were analysed using MAT-LAB and ImageJ including modules supplied by the Fiji distribu-tion (Schindelin et al., 2012). The 3D analysis showed that thetotal volume was similar between KO and WT controls, whereasthe number of isolated acetylcholine receptor (AChR) clusters(islands) in a single endplate (Pratt et al., 2013) was significantlyincreased in the KO mice (P < 0.001, Supporting Information Fig.S2A). Several branch parameters were also different between WTand KO endplates; however, we noticed that the 3D analysis soft-ware overestimated the number of branch points as convolutionsand bulges were erroneously counted. To achieve a more reliablebranching analysis, the 3D images were denoised and transformedto a binary image (Fig. 2A and B). Next, the morphology wasskeletonized and the resulting branching network was pruned forloop cycles using the ‘shortest branch’ option (Fig. 2C). Our two-dimensional analysis confirmed that NMJ areas were similarbetween WT and KO mice (116.51 � 83.8 lm2 in WT vs.101.86 � 82.7 lm2 in KO; P = 0.3) and that the number ofislands increased in the KO mice (1.79 � 1.0 in WT vs.3.26 � 2.0 in KO; P = 2.39e�07) (Fig. 2D), such that 60% of KOendplates had three or more islands compared with 17% of theWT endplates. The endplate branching analysis showed that,whereas the total branch length per endplate was decreased in KOmice (153.8 � 47.2 lm in WT vs. 129.42 � 42.4 lm in KO;P = 0.0017), the average branch length was increased (8.1 � 1.9

WT

KO

Relative mRNA levels

TAAVxtB VAChT Merge

72

38

WT KOVAAT

Syp

Btx threshold intensity (%)

WT

KO20

60

100

VAC

hT v

olum

e (u

m3 )

0 20 40

WTKO

0.0 1.0A C

B

D E

Fig. 1. VAAT is expressed in NMJs and loss of VAAT results in abnormal NMJs. (A) Measurement of relative spinal cord mRNA levels confirms loss ofVaat mRNA in Vaat KO mice. (B) Western blot experiments show a VAAT-immunopositive band in striatal lysate from WT but not Vaat KO mice. Synapto-physin (Syp), a common synaptic vesicles protein, was used as a control. Molecular sizes (in kDa) are listed on the left. (C) Distribution of bungarotoxin (Btx)-positive NMJs (green) over the TS muscle reveal a normal NMJ patterning along the nerve (red, tomato-positive axons). Panels on the righthand side areenlarged images from the boxed areas. (D) In WT mice, VAAT (violet) co-localised with VAChT (red) in the NMJs (upper panel), whereas the Vaat KO NMJslacked VAAT-positive immunostaining (lower panel). Btx (green) was used to visualise the NMJs. (E) Graph showing VAChT distribution in the endplate as afunction of Btx labelling intensity (WT, blue; KO, red). Scale bars: 200 lm (C), 25 lm (inset C), 10 lm (D).



lm in WT vs. 9.24 � 2.7 lm in KO; P = 0.0037) (Fig. 2D).Moreover, and as expected given the other changes, the number ofendplate branches decreased in the KO mice compared with WTcontrols. In summary, endplates lacking VAAT had a similar sur-face area, whereas they were fragmented and had fewer branchescompared with controls.However, the endplate structure only represents the postsynaptic

receptor clustering. To investigate the effect of Vaat deletion on thepresynaptic axonal branching over the NMJ structures, we analysedthe branching patterns of axons stained with the 200-kDa neurofila-ment protein together with VAAT and bungarotoxin. 3D images ofWT (n = 47, three animals) and Vaat KO (n = 50, three animals)

animals were constructed from the Z-stacks using the IMAGEJ soft-ware as described above (Fig. 3). Branching analysis was performedas described earlier (Prakash et al., 1996), following the same defi-nitions for primary and secondary branches. Corresponding to ourprevious observation of VAChT distribution over the NMJs with orwithout VAAT, the axonal branching parameters, such as entrypoints, number of branches, average branch length and total branchlength, were similar between the genotypes (Table 2). However,although the AChR clusters in the Vaat mutant mice clearly hadneurofilament staining, the separated clusters seemed to be joined bynarrow [sometimes undetectable (* in Fig. 3)] axonal branches(Fig. 3, inset).

WT KO

10

20

30

40***

# of branches

Num

ber

WT KO

5

10

15

**Avg branch length

WT KO10

20

30

40

50

Max branch length

WT KO

100

200

300 **Total length

µm

µm µmµm

2

WT KO0

6

12 ***# of islands

Num

ber

WT KO0

100

200

300

400

Total area

A B C

D

WT

KO

ns

ns

Fig. 2. Microstructural analyses of individual NMJs in WT and Vaat KO mice. (A–C) 3D images obtained by maximum intensity projection of Z-stacks weredenoised and converted to binary images and skeletonized using Fiji modules of IMAGEJ software. The endplates of the KO mice showed a fragmented structurewith many unconnected ‘islands’. Upper panel: WT (n = 87, three mice); lower panel: KO (n = 114, four mice). (D) Box and whiskers plots from two-dimen-sional analysis of the endplate region with MATLAB and Fiji for: (upper panel) number of branches, average branch length (lm) and maximum branch length(lm), and (lower panel) total length of all branches, number of islands and total area (lm2). In the Vaat KO, the number of branches and total length are low,whereas average branch length and number of islands are significantly higher. Maximum branch length and total area of the endplate remain unchanged.**P < 0.01, ***P < 0.001. Individual measurement points in D are denoted (+). Scale bars: 10 lm (A).


320 K. Patra et al.

Vaat knockout mice exhibit normal motor abilities

The structural defects led us to hypothesise that the lack of VAAT fromNMJs could result in impaired motor function. We performed forelimbgrip strength and hanging wire tests to assess muscle force and generalmuscle tone. No difference was observed in the average weight of age-matched mice of both genotypes (Fig. 4A). In tests conducted on miceaged between 24 and 31 weeks old, we did not observe any significantdifferences in grip strength or hanging wire test score (data not shown).However, when the tests were repeated on mice aged between 59 and65 weeks, we found significant differences in their ‘fall’ and ‘reach’scores on the hanging wire test but no difference in the average peakforce applied in the grip strength test (Fig. 4B–D). Hanging wire testson the aged mice, where ‘falls’ and ‘reaches’ were plotted separately,revealed that the control mice tried to escape the situation and reach oneend of the wire, increasing their cumulative ‘reach’ score, whereas VaatKO mice remained on the wire, thus obtaining a lower cumulative‘reach’ score. This ‘reach’ attribute is not a conventional measure of gen-eral muscle tone (Raymackers et al., 2003). Thus, these results do notby themselves suggest a muscle-specific phenotype in Vaat KO animals.In addition, previous experiments relying on the motor abilities of theVaat KO mouse did not reveal any gross abnormalities in motor behav-iour (Larhammar et al., 2014).

Altered miniature endplate potential and evoked endplatepotential properties of neuromuscular synapses in Vaatknockout mice

Although the motor function abnormalities were mild, we reasonedthat the clear microstructural changes in NMJ architecture that we

had observed might manifest as altered synaptic transmission. Toinvestigate this possibility, we performed intracellular recordingsfrom flexor digitorum brevis muscle fibres (Ribchester et al., 2004)from both Vaat KO mice and their WT littermates.

Table 2. Axonal branching parameters (mean � SD)

Parameters WT KO

Nerve terminalEntry points 2.2 � 1.1 2.9 � 1.0Total number of branches 9.2 � 2.8 9.3 � 3.8Average branch length (lm) 12.7 � 2.6 11.8 � 3.0Total branch length (lm) 114.3 � 32.9 106.3 � 34.7

EndplateReceptor clusters 1.8 � 1.0 3.8 � 3.2

KOW

T

Btx NF VAAT Merge

**

Fig. 3. Axonal branching over the NMJs. NMJs of the TS muscles from WT (upper panel, N = 3, n = 47) and KO (lower panel, N = 3, n = 50) were co-stained with bungarotoxin (Btx) (green), anti-neurofilament (NF) (200 kDa) antibody (red) and anti-SLC10A4 antibody (grey) to analyse the axonal branchingpatterns. The postsynaptic receptor clusters in KO mice lacked integrity. The presynaptic nerve termini had normal branching, although it was sometimes lessdetectable (*), and connected the separate clusters (inset). Scale bars: 20 lm.

C

Grip strength

100

120

140

Wei

ght (

mg)

WT KO

BW

eigh

t (g)

WT

Body weight

KO0

10

20

30

A

Hanging wire

D

Scor

e

Time (s)

Reach

100 200 3000

1

2

3

4

Fall

WTKO

0 100 200 300

6

7

8

9

10

Time (s)

40 160

5

Fig. 4. Vaat KO and WT exhibit similar physical attributes and motor abili-ties. Grip strength test and wire hang test implemented to assess acute musclestrength and general muscle tone, respectively. (A) Body weights (in g) ofWT and Vaat KO aged between 24 and 31 weeks (n = 24 per genotype).(B) The average maximum peak force (in mg) applied resisting the swift pullfrom the grid on the grip strength meter (n = 14 per genotype). (C and D)Kaplan–Meier-like plots separately for ‘fall’ and ‘reach’ scores obtained fromthe hanging wire test performed on mice aged between 59 and 65 weeks(n = 12 per genotype) showing similar ‘fall’ scores but a decreased average‘reach’ score for the VAAT KO mice. Younger mice aged between 24 and31 weeks performed equally well on the hanging wire test (data not shown).



Miniature endplate potentials (the postsynaptic response to sponta-neous, action potential-independent transmitter release) are animportant index of synaptic function at the NMJ. To quantify theseevents, 60 s of membrane potential was recorded per flexor digito-rum brevis fibre and the properties of the resultant mEPPs wereanalysed. The frequency of mEPPs in Vaat KO mice proved to beindistinguishable from that of their WT littermates (1.48 � 0.15 Hz,n = 104 in WT vs. 1.66 � 0.14 Hz, n = 94 in Vaat KO, P > 0.05,Fig. 4A). In contrast, however, the amplitude of mEPPs in Vaat KOmice was significantly diminished (0.92 � 0.03 mV, n = 104 inWT vs. 0.82 � 0.03 mV, n = 94 in Vaat KO; P < 0.05), indicatinga decreased quantal size, i.e. a reduced amount of neurotransmittercontained within each quantum (Fig. 4B–D).To record action potential-dependent EPPs, we recorded flexor

digitorum brevis fibres while simultaneously stimulating the tibialnerve (which innervates the flexor digitorum brevis via the medialplantar nerve) with a suction electrode. The properties of EPPs werederived from analysis of the average waveform of 10 sequentialEPPs elicited at a frequency of 0.5 Hz. The EPPs of Vaat KO micehad a significantly larger amplitude (10.67 � 0.38 mV, n = 104 inWT vs. 13.39 � 0.38 mV, n = 76 in KO; P < 0.005; Fig. 5A andB) and slope from 10% to 90% (7.53 � 0.40 mV/ms, n = 104 in

WT vs. 10.93 � 0.47 mV/ms, n = 76 in KO; P < 0.005) whencompared with those recorded from their WT littermates (Fig. 5Aand B).As fibres from Vaat KO mice exhibited larger EPPs despite their

smaller quantal size, we supposed a change in the number of quantareleased per stimulus (or quantal content). An estimation of thisproperty was acquired by dividing a fibre’s EPP amplitude by itscorresponding mEPP amplitude. We found the value for Vaat KOsto be significantly larger than the calculated value for WT litter-mates (12.63 � 0.45, n = 87 in WT vs. 17.80 � 0.70, n = 71 inKO; P < 0.005; Fig. 5C and D).

Altered short-term synaptic plasticity and increased size ofreadily releasable pool in VAAT-deficient mice

To investigate a possible role for Vaat in the short-term synapticplasticity of the NMJ, we utilised paired-pulse and high-frequencytrain stimulus protocols delivered at frequencies of 30 and 60 Hz.At 30 Hz (33-ms interpulse interval), WT fibres exhibited paired-pulse facilitation of 6.51 � 1.35% (n = 66), a value not signifi-cantly different to that of KO fibres (4.14 � 0.88%, n = 51;P > 0.05). These results imply a constant initial release probability

WT KO

1.4±0.02Hz1.6±0.01Hz

ns

A

B

C D

0.98±0.03mV

0.75±0.03mV***

WT KO0.0

0.5

1.0

1.5

2.0

2.5

*

mEP

P am

plitu

de (m

V)

Fig. 5. Decreased spontaneous endplate potential amplitudes in Vaat KO. (A) Representative current-clamp recordings of WT and KO mEPPs. Scale bars:0.5 mV, 0.5 s. (B) Rise-aligned mEPPs (grey) from representative 60-s sweeps with average event superimposed in bold (black, control; grey, KO). Scale bars:0.4 mV, 4 ms. (C) Superimposition of the event averages in B. Note the reduced amplitude of events from Vaat KO. *** P < 0.005. Scale bars: 0.4 mV, 4 ms.(D) mEPPs are significantly smaller in the Vaat KO (0.74 � 0.03) when compared with WT controls (0.96 � 0.03). Boxes represent 25, 50 and 75 percentileswith superimposed mean � SEM and maximum and minimum values (control, n = 104; KO, n = 94; *P < 0.05).


322 K. Patra et al.

in the neuromuscular synapses of both KO and WT fibres (Fig. 6Aand B).We subsequently analysed the response of NMJs to repeated stim-

ulation. Fibres were subjected to 30 sequential supra-threshold(10.0 V) stimuli delivered at a frequency of 30 Hz with the ratio ofthe first EPP to subsequent EPPs (EPP1 : EPPn) taken as a measureof synaptic plasticity. After initial facilitation, synaptic responsesunderwent pronounced depression, rapidly reaching a plateau ofconstant amplitude in both KO and WT fibres. However, compara-tive analysis of the EPP1 : EPPn ratio across the full extent of thetrain revealed significant differences in synaptic depression begin-ning at stimulus seven and continuing intermittently until the end ofthe protocol [WT, n = 66 vs. Vaat KO, n = 51; grey dash indicatesP < 0.05; 11/30 events (37%); Fig. 7C and D].When the stimulus frequency was increased to 60 Hz, we saw a

more modest degree of paired-pulse facilitation that was again indis-tinguishable between WT and KO animals (2.57 � 1.69%, n = 34in WT vs. 1.80 � 1.84%, n = 34 in KO; P > 0.05; Fig. 7E and F).However, at this higher frequency, the synaptic depression observedduring the high-frequency train was enhanced, reaching statisticalsignificance at the fourth stimulus and remaining so for the rest ofthe train [WT, n = 34 vs. Vaat KO, n = 34; grey dash indicatesP < 0.05; 27/30 events (90%); Fig. 7G and H].In order to address the effect of Vaat KO on the readily releasable

pool of vesicles (the body of vesicles immediately available for syn-aptic release upon stimulation), we calculated the cumulative EPPamplitudes in response to the 30-Hz high-frequency train. As theEPP amplitude plateaued by the 20th event, we fitted the 20th–30thevent and, by linear regression, extrapolated the EPP amplitude attime zero (31.21 � 2.06 mV, n = 65 in WT vs. 33.54 � 1.67 mV,n = 51 in KO; P > 0.05). Dividing a fibre’s estimated EPP ampli-tude by the amplitude of its respective mEPP gives a value for the

readily releasable pool of vesicles (Schneggenburger et al., 1999).By this measure, the readily releasable pool of vesicles of neuro-muscular synapses from Vaat KO mice (44.41 � 2.54; n = 46) wassignificantly larger than that calculated for WT litter mates(34.32 � 2.49; n = 57; P < 0.005 vs. KO; Fig. 8A and B). Thesedata suggest that KO of Vaat results in an enhancement of the num-ber of vesicles easily mobilised upon nervous stimulation.

Loss of Vaat leads to upregulation of acetylcholine receptorsubunit levels in muscle

In order to assess any postsynaptic changes, we measured theexpression levels of ACh receptor subunits, which constitute a func-tional pentamer in adult mouse muscles. Although the mRNA levelsof subunits Chrnb1 and Chrne were similar in WT and KO mice,we observed an increase in the alpha1 and delta subunits in the cho-linergic nicotinic receptor complex (Chrna1 and Chrnd) in Vaat KOmice (Fig. 9A and B). Interestingly, the alpha subunits contain theprimary ACh ligand-binding sites at residues 190–193 (Karlin et al.,1987; Abramson et al., 1989) in close apposition to the neighbour-ing non-alpha subunits, whereas the delta subunit is known to regu-late binding affinity and channel gating (Sine & Claudio, 1991;Shen et al., 2008; Gupta et al., 2013). In the Vaat KO animals, theelevated transcript levels of the AChR subunits directly involved inACh binding along with the increased number of readily releasablevesicles (Fig. 9) imply compensation for less vesicular filling oftransmitter.

Discussion

In this study, we investigated the potential role of VAAT incholinergic neurotransmission at the murine NMJ by comparing the

Qua

ntal

con

tent

B

C D

12.6

±0.4

5

17.5

±0.3

7

EPP

Ampl

itude

(mV)

0

10

20

30***

WT KO

WT KO0

20

40

60 ***

A

Fig. 6. Increased EPP amplitudes in NMJs from Vaat KO mice. (A) Representative EPPs from KO and WT controls. Traces show 10 rise-aligned and superim-posed EPPs (grey), which have been sequentially triggered at a frequency of 0.5 Hz with greyscale coded averages (WT, black; KO, grey) superimposed. Scalebar: 2 mV, 4 ms. (B) EPPs from Vaat KO (13.39 � 0.38 mV) were significantly larger when compared with control (10.60 � 0.67 mV). Boxes represent 25,50 and 75 percentiles with superimposed mean � SEM and maximum and minimum values (WT, n = 104; KO, n = 76, P < 0.005). (C) Traces highlightingthe mEPPs and corresponding EPPs of representative control (black) and KO (grey) fibers, the ratio of which (EPP : mEPP) was used to calculate quantal con-tent. Scale bar: 1 mV, 1 ms. (D) Quantal content is enhanced at the NMJ of Vaat KO mice (17.50 � 0.37) when compared with control (12.63 � 0.45). Boxesrepresent 25, 50 and 75 percentiles with superimposed mean � SEM and maximum and minimum values (WT, n = 87; KO, n = 71, ***P < 0.005).



properties of these highly specialised synapses in VAAT null mutantmice with WT controls. We also investigated parameters related tolocomotion, including weight and muscle strength, which we foundto be similar between Vaat KO mice and controls. However, at themicrostructural level, NMJs lacking VAAT had fewer branch pointsand an increased number of disconnected islands. The electrophysio-logical properties of NMJs in VAAT-deficient mice were also chan-ged, with reduced mEPP amplitudes and increased EPP amplitudes.Furthermore, Vaat KO NMJs displayed aberrant short-term synapticplasticity with increased synaptic depression upon repeated stimula-tion and a larger readily releasable pool of vesicles. Finally,

cholinergic receptor subunits were found to have an increased levelof mRNA expression in the VAAT-deficient muscles, implying post-synaptic sensitization.The use of a constitutive Vaat KO is a potential caveat of this

study, as compensation for the loss of this protein during develop-ment may take place. Thus, it is possible that many traits of theVaat KO that were similar to their littermate controls, includingweight, motor behaviour, muscle strength and VAChT distribution,may be more strongly affected by acute silencing of VAAT. Itshould also be noted that the loss of VAAT occurs at all aminergicterminals and therefore [as serotonergic and dopaminergic

C

A B

30H

z

FE

WT

KO

D

KO

WT 6.00%

5.96%

0 10 20 300.6

0.8

1.0

1.2

Nor

mal

ised

am

plitu

de

Event Number

0 10 20 30

Event Number

Paire

d pu

lse

ratio

WT KO

WT KO

0.6

1.2

1.8 ns

2.70%

1.86%

WT

KO

WT

KO

G H

0.4

0.6

0.8

1.0

Nor

mal

ised

am

plitu

de

0.6

1.0

1.4 ns

Paire

d pu

lse

ratio

60H

z

Fig. 7. Reduced short-term synaptic plasticity of Vaat KO NMJs. (A) Representative traces of the membrane potential response of flexor digitorum brevis(FDB) muscle fibers from control (black) and KO (grey) mice to a paired-pulse protocol delivered at a frequency of 30 Hz. Scale bar: 5 mV, 5 ms. Correspond-ing relative facilitation is shown adjacent. (B) Paired-pulse ratio is unchanged in Vaat KO (5.96 � 0.88%, n = 51) when compared with WT controls(6.00 � 1.35%, n = 66). (C) Representative traces of the membrane potential response of muscle fibers from control (black) and KO (grey) mice to high-fre-quency stimulation (30 Hz). Scale bar: 5 mV, 50 ms. (D) Vaat KO show enhanced synaptic depression in response to high-frequency stimulation (30 Hz) (con-trol, n = 66; KO, n = 51, grey dash indicates P < 0.05). (E) Representative traces of the membrane potential response of FDB muscle fibers from control(black) and KO (grey) mice to a paired-pulse protocol delivered at a frequency of 60 Hz. Scale bar: 4 mV, 2 ms. Corresponding relative facilitation is shownadjacent. (F) Paired-pulse ratio is unchanged in Vaat KO (1.30 � 1.84%, n = 34) when compared with WT controls (3.00 � 1.69%, n = 34). (G) Representa-tive traces of the membrane potential response of muscle fibers from control (black) and KO (grey) mice to high-frequency stimulation (60 Hz). Scale bar:5 mV, 20 ms. (H) Vaat KO show enhanced synaptic depression in response to high-frequency stimulation (60 Hz) (control, n = 34; KO, n = 34, grey dashindicates P < 0.05). For histograms, boxes represent 25, 50 and 75 percentiles with superimposed mean � SEM and maximum and minimum values.


324 K. Patra et al.

modulation of motor neuron signalling is well documented (Cooper& Neckameyer, 1999; Perrier et al., 2013)] we cannot rule out thepossibility that the observed alterations are the consequence of hav-ing lost VAAT at aminergic sites upstream of the NMJ. However,with regard to the electrophysiological effects in particular, we con-sider this to be less likely.This study is, to our knowledge, the first description of the micro-

structural attributes of the NMJ in the absence of a presynapticvesicular protein of the cholinergic system. Previously, there havebeen studies on the effects of loss of the VAChT on the develop-ment and function of neuromuscular synapses. A partial loss of thisvesicular transporter protein results in myasthenic mice together withslight changes in cholinergic transmission; however, a detailedmicrostructural analysis of NMJs is missing (Prado et al., 2006; deCastro et al., 2009; Lima et al., 2010). The presence of VAAT inaminergic vesicles and its documented supportive role for transportof neurotransmitters into dopaminergic vesicles (Larhammar et al.,2014) indicate that VAAT may facilitate transport of ACh into NMJvesicles. The changes on the postsynaptic site, especially the rear-rangement of ACh receptor clusters found in the VAAT-deficientNMJs, are intriguing, although it is not clear if this is due to devel-opmental compensation or other mechanisms such as alterations inmuscle, skeletal receptor tyrosine kinase levels that mediate the for-mation and maintenance of endplate structure (Burden, 2011).Somewhat surprisingly, we did not observe changes in presynapticnerve terminal branching in KO mice compared with WT controls(Fig. 3, and Table 2). Axonal retraction is known to be associatedwith ageing and diseased endplate structures. However, an age-related effect on nerve terminal branching should not be ruled out at

this point; a thorough study on the effect of ageing on VAAT nullmice would address this question.At the microstructural level, NMJs lacking VAAT were clearly

affected, as shown by the fewer branch points and increased numberof disconnected islands. Similar disturbances of endplate arboriza-tion have been reported in, e.g. the mdx mouse [a model of Duch-enne’s muscular dystrophy (Pratt et al., 2013)] and neural celladhesion molecule deficient mouse (Rafuse et al., 2000). Interest-ingly, these reports demonstrate that microstructural disturbances ofthe NMJ do not necessarily alter neuromuscular synaptic transmis-sion. Unlike the examples above, microstructural alterations in theNMJs of Vaat KO mice were coincident with changes in their elec-trophysiological characteristics. However, electrical recordings frommyasthenic patients show decreased mEPP amplitudes coincidentwith altered synaptic clefts in the intercostal muscles (Albuquerqueet al., 1976). The observed reduction in mEPP amplitude could bedue to either decreased release of ACh or a reduction in postsynap-tic responsiveness. As we found that the postsynaptic site respondedwith an upregulation of receptors (Fig. 9), it is unlikely that thepostsynaptic responsiveness was decreased. We therefore find themost likely explanation of the decreased mEPP amplitude to be areduction in the amount of ACh released per vesicle.Given the smaller amplitude of mEPPs in the Vaat KO mouse,

one would expect correspondingly reduced amplitudes for EPPs, yetwe find the reverse – increased EPP amplitudes. Our data suggestthat this apparent paradox is most likely the result of a combinationof presynaptic and postsynaptic changes, i.e. the observed increasein the readily releasable pool of vesicles and the upregulation ofpostsynaptic receptors. Moreover, it is also likely that these changes

BA

0

100

200

300

31.2±2.1mV

33.5±1.7mV nsCum

ulat

ive

EPP

Ampl

itude

(mV)

0 5 10 15 20 25 30 WT KO—20

020406080

100

RR

P Si

ze

**

Fig. 8. Vaat KO mice have an enlarged readily releasable pool (RRP) of vesicles. (A) Mean cumulative EPP amplitudes in WT (black) and KO (grey). Tendata points from the 20th to the 30th stimulus were fitted by linear regression and back extrapolated to give an estimate of EPP at time zero (grey inset). Theestimated EPP amplitude was unchanged in Vaat KO mice (47.40 � 2.6 mV) when compared with WT controls (41.60 � 2.9 mV) (control, n = 65; KO,n = 51, P > 0.05). (B) Estimated EPP amplitude was divided by mEPP amplitude in order to give an estimate of the RRP. Vaat KO mice showed an enhancednumber of quanta (44.41 � 2.54) in the RRP when compared with WT controls (34.32 � 2.49) (control, n = 56; KO, n = 47, **P < 0.005). Boxes represent25, 50 and 75 percentiles with superimposed mean � SEM and maximum and minimum values.

Chrna1

Rel

ativ

e ex

pres

sion

Chrnb1 Chrnd Chrne P2X7 P2Y1

* WTVaat KO

Nicotinic ACh receptor subunits ATP receptors

ns

A

a1da1

eb1

B

Postsynapticmembrane

ACh molecule

Sodium ions0

1

2

Fig. 9. Transcript levels of mRNAs encoding ACh receptor (AChR) subunits. (A) Relative mRNA transcript levels of muscle-specific AChR subunits Chrna1,Chrnb1, Chrnd and Chrne along with two ATP receptors P2X7 and P2Y1 known to be expressed in skeletal muscle. We found a significant upregulation ofChrna1 (n = 12, P = 0.03) and a trend of upregulation of Chrnd (n = 12, P = 0.058). White bars, WT; grey bars, Vaat KO. *P < 0.05. (B) Schematic of a nic-otinic AChR embedded in the muscle endplate membrane, with the subunits named as a1, b1, d and e. ACh binding causes a change in the conformation of thesubunits and allows flow of Na+ ions into the muscle fibre.



to the readily releasable pool explain the more pronounced synapticdepression of NMJs lacking VAAT, as such synapses would bemore rapidly exhausted upon repeated stimulation.Although our data provide an explanation, other factors may con-

tribute to the increased EPP amplitude. ATP is known to be releasedfrom the NMJ (Meunier et al., 1975) and at millimolar concentra-tions negatively modulates ACh transmission, reducing the endplatecurrent amplitudes of evoked but not spontaneous events (Giniatullin& Sokolova, 1998). Furthermore, adenosine broken down from ATPin the synaptic cleft can initiate adenosine receptor-mediated modu-lation of ACh release, reducing the magnitude of synaptic depres-sion during repetitive activity (Redman & Silinsky, 1994).Accordingly, a reduction in synaptically released ATP could poten-tially enhance both evoked response and synaptic depression, predic-tions that are in line with our observations. Intravesicular ATP is animportant co-factor for vesicular ACh uptake; a disturbed ATPuptake mechanism would probably reduce the amount of ACh pervesicle. Such an occurrence could also explain both the reducedmEPP amplitude and [as ACh is an important factor for the develop-mental wiring of the NMJ (Pittman & Oppenheim, 1979; Oppen-heim et al., 2008)] the microstructural alterations observed. Moreinvestigations are needed to substantiate these speculations. To thisend, in RT-PCR experiments, we did not find any changes in thelevels of the two postsynaptic ATP receptors between the genotypes.However, we found a specific 40% reduction in the mRNA levelsof adenosine receptor A2A, a presynaptic purinergic receptor inmotor neurons (Supporting Information Fig. S2B). Other cellularevents involving protein kinase C and protein kinase A downstreamof presynaptic adenosine receptors (Cunha, 2001), as well as musca-rinic ACh receptors (Wright et al., 2009), may contribute to modu-lating cholinergic transmission in the absence of VAAT and shouldbe investigated.In conclusion, we interpret our findings such that the loss of

VAAT leads to a reduction in vesicular loading of the neurotrans-mitter ACh. This manifests itself as a reduced mEPP amplitude,which results in compensatory changes, part of which account forthe absence of a motor phenotype. These include an increased read-ily releasable pool of vesicles, altered NMJ architecture and changesin both presynaptic and postsynaptic receptors. These results high-light a novel and potentially important role for VAAT in cholinergicneurotransmission whose further study may provide a better under-standing of synaptic physiology and the treatment of neuromusculardisease (Ruff, 2011).

Supporting Information

Additional supporting information can be found in the online ver-sion of this article:Fig. S1. Immunohistochemistry of gastrocnemius muscle from postnatal day 2 (p2) and adult mice showing colocalization of VAChT(yellow) and VAAT (red) in the end plate region marked by Btx(green).Fig. S2. 3D analysis of the endplate regions revealed similar trendas in 2D analysis.

Acknowledgements

We thank J. Jonsson and S. Perry for critical reading of the manuscript, A.Raja for technical assistance and M. Blunder for providing mice. ProfessorR. Ribchester (Edinburgh University, Scotland) explained the flexor digito-rum brevis–tibialis and TS muscle preparations extensively used in thisstudy. The mouse antibody to synaptophysin was a generous gift from Pro-fessor Reinhard Jahn (Gottingen, Germany). This work was financed by

grants from the Swedish Medical Research Council, H�allsten and SwedishBrain Foundations. K.K. is a Royal Swedish Academy of Sciences ResearchFellow supported by a grant from the Knut and Alice Wallenberg Founda-tion. The authors declare no conflict of interest.

Abbreviations

3D, three-dimensional; ACh, acetylcholine; EPP, evoked endplate potential;KO, knockout; mEPP, miniature endplate potential; NMJ, neuromuscularjunction; PBS, phosphate-buffered saline; PBST, phosphate-buffered saline/0.5% Tween�; PCR, polymerase chain reaction; SLC10A4, solute carrier fam-ily 10 member 4; TS, triangularis sterni; VAAT, vesicular aminergic-associatedtransporter; VAChT, vesicular acetylcholine transporter; WT, wild-type.

References

Abramson, S.N., Li, Y., Culver, P. & Taylor, P. (1989) An analog of lopho-toxin reacts covalently with Tyr190 in the alpha-subunit of the nicotinicacetylcholine receptor. J. Biol. Chem., 264, 12666–12672.

Albuquerque, E.X., Rash, J.E., Mayer, R.F. & Satterfield, J.R. (1976) Anelectrophysiological and morphological study of the neuromuscular junc-tion in patients with myasthenia gravis. Exp. Neurol., 51, 536–563.

Borges, K. (2013) Slc10A4 - what do we know about the function of this“secret ligand carrier” protein? Exp. Neurol., 248, 258–261.

Boyd, I.A. & Martin, A.R. (1956) The end-plate potential in mammalianmuscle. J. Physiol., 132, 74–91.

Brooks, S.P. & Dunnett, S.B. (2009) Tests to assess motor phenotype inmice: a user’s guide. Nat. Rev. Neurosci., 10, 519–529.

Burden, S.J. (2011) SnapShot: neuromuscular Junction. Cell, 144, e821.Burger, S., D€oring, B., Hardt, M., Beuerlein, K., Gerstberger, R. & Geyer, J.(2011) Co-expression studies of the orphan carrier protein Slc10a4 and thevesicular carriers VAChT and VMAT2 in the rat central and peripheralnervous system. Neuroscience, 193, 109–121.

de Castro, B.M., De Jaeger, X., Martins-Silva, C., Lima, R.D.F., Amaral, E.,Menezes, C., Lima, P., Neves, C.M.L., Pires, R.G., Gould, T.W., Welch,I., Kushmerick, C., Guatimosim, C., Izquierdo, I., Cammarota, M., Rylett,R.J., Gomez, M.V., Caron, M.G., Oppenheim, R.W., Prado, M.A.M. &Prado, V.F. (2009) The vesicular acetylcholine transporter is required forneuromuscular development and function. Mol. Cell. Biol., 29, 5238–5250.

Choi, H.Y., Liu, Y., Tennert, C., Sugiura, Y., Karakatsani, A., Kroger, S.,Johnson, E.B., Hammer, R.E., Lin, W. & Herz, J. (2013) APP interactswith LRP4 and agrin to coordinate the development of the neuromuscularjunction in mice. eLife, 2, e00220.

Cooper, R.L. & Neckameyer, W.S. (1999) Dopaminergic modulation ofmotor neuron activity and neuromuscular function in Drosophila melanog-aster. Comp. Biochem. Phys. B., 122, 199–210.

Court, F.A., Hewitt, J.E., Davies, K., Patton, B.L., Uncini, A., Wrabetz, L.& Feltri, M.L. (2009) A laminin-2, dystroglycan, utrophin axis is requiredfor compartmentalization and elongation of myelin segments. J. Neurosci.,29, 3908–3919.

Cunha, R.A. (2001) Adenosine as a neuromodulator and as a homeostaticregulator in the nervous system: different roles, different sources and dif-ferent receptors. Neurochem. Int., 38, 107–125.

Geyer, J., Fernandes, C.F., Doring, B., Burger, S., Godoy, J.R., Rafalzik, S.,Hubschle, T., Gerstberger, R. & Petzinger, E. (2008) Cloning and molecu-lar characterization of the orphan carrier protein Slc10a4: expression incholinergic neurons of the rat central nervous system. Neuroscience, 152,990–1005.

Giniatullin, R.A. & Sokolova, E.M. (1998) ATP and adenosine inhibit trans-mitter release at the frog neuromuscular junction through distinct presynap-tic receptors. Brit. J. Pharmacol., 124, 839–844.

Gupta, S., Purohit, P. & Auerbach, A. (2013) Function of interfacial prolinesat the transmitter-binding sites of the neuromuscular acetylcholine receptor.J. Biol. Chem., 288, 12667–12679.

Karlin, A., DiPaola, M., Kao, P.N. & Lobel, P. (1987) Functional sites andtransient states of the nicotinic acetylcholine receptor. Soc. Gen. Phy., 41,43–65.

Larhammar, M., Patra, K., Blunder, M., Emilsson, L., Peuckert, C.,Arvidsson, E., R€onnlund, D., Preobraschenski, J., Birgner, C., Limbach,C., Widengren, J., Blom, H., Jahn, R., Wall�en-Mackenzie, A. & Kullander,K. (2014) SLC10A4 is a vesicular amine-associated transporter modulatingdopamine homeostasis. Biol. Psychiat., doi: 10.1016/j.biopsych.2014.07.017. [Epub ahead of print].


326 K. Patra et al.

Lima, R.D., Prado, V.F., Prado, M.A.M. & Kushmerick, C. (2010) Quantalrelease of acetylcholine in mice with reduced levels of the vesicular acetyl-choline transporter. J. Neurochem., 113, 943–951.

Liu, Y., Padgett, D., Takahashi, M., Li, H., Sayeed, A., Teichert, R.W., Oli-vera, B.M., McArdle, J.J., Green, W.N. & Lin, W. (2008) Essential rolesof the acetylcholine receptor gamma-subunit in neuromuscular synapticpatterning. Development, 135, 1957–1967.

Liu, Y., Sugiura, Y. & Lin, W. (2011) The role of synaptobrevin1/VAMP1in Ca2+-triggered neurotransmitter release at the mouse neuromuscularjunction. J. Physiol., 589, 1603–1618.

Marder, E. (2012) Neuromodulation of neuronal circuits: back to the future.Neuron, 76, 1–11.

Martin, A.R. (1955) A further study of the statistical composition of the end-plate potential. J. Physiol.-London, 130, 114–122.

Meunier, F., Israel, M. & Lesbats, B. (1975) Release of ATP from stimulatednerve electroplaque junctions. Nature, 257, 407–408.

Oppenheim, R.W., Caldero, J., Cuitat, D., Esquerda, J., McArdle, J.J.,Olivera, B.M., Prevette, D. & Teichert, R.W. (2008) The rescue of devel-oping avian motoneurons from programmed cell death by a selectiveinhibitor of the fetal muscle-specific nicotinic acetylcholine receptor. Dev.Neurobiol., 68, 972–980.

Perrier, J.F., Rasmussen, H.B., Christensen, R.K. & Petersen, A.V. (2013)Modulation of the intrinsic properties of motoneurons by serotonin. Curr.Pharm. Design, 19, 4371–4384.

Pittman, R. & Oppenheim, R.W. (1979) Cell death of motoneurons in thechick embryo spinal cord. IV. Evidence that a functional neuromuscularinteraction is involved in the regulation of naturally occurring cell deathand the stabilization of synapses. J. Comp. Neurol., 187, 425–446.

Popova, S.N. & Alafuzoff, I. (2013) Distribution of SLC10A4, a synapticvesicle protein in the human brain, and the association of this protein withAlzheimer’s disease-related neuronal degeneration. J. Alzheimers Dis., 37,603–610.

Prado, V.F., Martins-Silva, C., de Castro, B.M., Lima, R.F., Barros, D.M.,Amaral, E., Ramsey, A.J., Sotnikova, T.D., Ramirez, M.R., Kim, H.G., Ros-sato, J.I., Koenen, J., Hui, Q., Cota, V.R., Moraes, M.F.D., Gomez, M.V.,Guatimosim, C., Wetsel, W.C., Kushmerick, C., Pereira, G.S., Gainetdinov,R.R., Izquierdo, I., Caron, M.G. & Prado, M.A.M. (2006) Mice deficient forthe vesicular acetylcholine transporter are myasthenic and have deficits inobject and social recognition. Neuron, 51, 601–612.

Prakash, Y.S., Miller, S.M., Huang, M. & Sieck, G.C. (1996) Morphology ofdiaphragm neuromuscular junctions on different fibre types. J. Neurocytol.,25, 88–100.

Pratt, S.J., Shah, S.B., Ward, C.W., Inacio, M.P., Stains, J.P. & Lovering,R.M. (2013) Effects of in vivo injury on the neuromuscular junction inhealthy and dystrophic muscles. J. Physiol., 591, 559–570.

Rafuse, V.F., Polo-Parada, L. & Landmesser, L.T. (2000) Structural andfunctional alterations of neuromuscular junctions in NCAM-deficient mice.J. Neurosci., 20, 6529–6539.

Raymackers, J.M., Debaix, H., Colson-Van Schoor, M., De Backer, F.,Tajeddine, N., Schwaller, B., Gailly, P. & Gillis, J.M. (2003) Consequenceof parvalbumin deficiency in the mdx mouse: histological, biochemicaland mechanical phenotype of a new double mutant. NeuromuscularDisord., 13, 376–387.

Redman, R.S. & Silinsky, E.M. (1994) ATP released together with acetyl-choline as the mediator of neuromuscular depression at frog motor nerveendings. J. Physiol., 477, 117–127.

Ribchester, R.R. (2009) Mammalian neuromuscular junctions: modern tools tomonitor synaptic form and function. Curr. Opin. Pharmacol., 9, 297–305.

Ribchester, R. (2011) Quantal analysis of endplate potentials in mouse flexordigitoum brevis muscle. Curr. Protoc. Mouse Biol., 1, 429–444.

Ribchester, R.R., Thomson, D., Wood, N.I., Hinks, T., Gillingwater, T.H.,Wishart, T.M., Court, F.A. & Morton, A.J. (2004) Progressive abnormali-ties in skeletal muscle and neuromuscular junctions of transgenic miceexpressing the Huntington’s disease mutation. Eur. J. Neurosci., 20, 3092–3114.

Ruff, R.L. (2011) Endplate contributions to the safety factor for neuromuscu-lar transmission. Muscle Nerve, 44, 854–861.

Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M.,Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez,J.Y., White, D.J., Hartenstein, V., Eliceiri, K., Tomancak, P. & Cardona,A. (2012) Fiji: an open-source platform for biological-image analysis. Nat.Methods, 9, 676–682.

Schneggenburger, R., Meyer, A.C. & Neher, E. (1999) Released fraction andtotal size of a pool of immediately available transmitter quanta at a calyxsynapse. Neuron, 23, 399–409.

Shen, X.M., Fukuda, T., Ohno, K., Sine, S.M. & Engel, A.G. (2008) Con-genital myasthenia-related AChR delta subunit mutation interferes with in-tersubunit communication essential for channel gating. J. Clin. Invest.,118, 1867–1876.

Sine, S.M. & Claudio, T. (1991) Gamma- and delta-subunits regulate theaffinity and the cooperativity of ligand binding to the acetylcholine recep-tor. J. Biol. Chem., 266, 19369–19377.

Thomas, L., Hartung, K., Langosch, D., Rehm, H., Bamberg, E., Franke, W.W.& Betz, H. (1988) Identification of synaptophysin as a hexameric channelprotein of the synaptic vesicle membrane. Science, 242, 1050–1053.

Wood, S.J. & Slater, C.R. (2001) Safety factor at the neuromuscular junction.Prog. Neurobiol., 64, 393–429.

Wright, M.C., Potluri, S., Wang, X., Dentcheva, E., Gautam, D., Tessler,A., Wess, J., Rich, M.M. & Son, Y.J. (2009) Distinct muscarinic ace-tylcholine receptor subtypes contribute to stability and growth, but notcompensatory plasticity, of neuromuscular synapses. J. Neurosci., 29,14942–14955.

Zelano, J., Mikulovic, S., Patra, K., Kuhnemund, M., Larhammar, M., Em-ilsson, L., Leao, R. & Kullander, K. (2013) The synaptic protein encodedby the gene Slc10A4 suppresses epileptiform activity and regulates sensi-tivity to cholinergic chemoconvulsants. Exp. Neurol., 239, 73–81.



molecular and synaptic mechanisms

Documents