mir396-targeted short vegetative phase is required to

1

Running head: PHYL1 alters miR396/SVP regulation in flowering 1 2 Address correspondence to: 3

Shih-Shun Lin 4 Institute of Biotechnology, National Taiwan University, 81, Chang-5 Xing ST. Taipei, Taiwan 106 6 +886-2-33666023 7 [email protected] 8

9 Research Area: Genes, Development and Evolution 10 11

Plant Physiology Preview. Published on June 23, 2015, as DOI:10.1104/pp.15.00307

Copyright 2015 by the American Society of Plant Biologists

www.plantphysiol.orgon April 11, 2018 - Published by Downloaded from Copyright © 2015 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

MiR396-targeted SHORT VEGETATIVE PHASE is required to repress 12 flowering and is related to the development of abnormal flower symptoms by the 13 PHYL1 effector 14 15 Chiao-Yin Yang1, Yu-Hsin Huang1, Chan-Pin Lin1, Yen-Yu Lin, Hao-Chun Hsu, 16 Chun-Neng Wang, Li-Yu Daisy Liu, Bing-Nan Shen, and Shih-Shun Lin 17 18 Institute of Biotechnology, National Taiwan University, 81, Chang-Xing St., Taipei, 19 Taiwan 106 (C.-Y.Y., Y.-H.H., C.-P.L., Y.-Y.L., B.-N.S., S.-S.L.); Genome and 20 Systems Biology Degree Program, National Taiwan University, 1, Sec. 4, Roosevelt 21 Rd. Taipei, Taiwan 106 (S.-S.L.); Agricultural Biotechnology Research Center, 22 Academia Sinica, 128 Academia Rd, Sec. 2, Taipei, Taiwan 115 (S.-S.L.); 23 Department of Plant Pathology and Microbiology, National Taiwan University, 1, Sec 24 4, Roosevelt Rd., Taipei, Taiwan, 106 (C.-Y.Y., Y.-H.H., C.-P.L., Y.-Y.L.); Institute 25 of Ecology and Evolutionary Biology, Department of Life Science, National Taiwan 26 University, 1, Sec 4, Roosevelt Rd., Taipei, Taiwan, 106 (H.-C.H., C.-N.W.); 27 Department of Agronomy, National Taiwan University, 1, Sec. 4, Roosevelt Rd. 28 Taipei, Taiwan 106 (L.-Y.D.L.). 29 30 1These authors contributed equally to this work. 31 32 PHYL1 effector interferes with miR396-mediated SVP mRNA decay, resulting in the 33 up-regulation of SVP for abnormal flower development. 34 35



3

Financial source: This study was supported by the Ministry of Science and 36 Technology (NSC 97-2321-B-002-046; NSC-98-2313-B-002-047-MY3; NSC 100-37 2923-B-002-001-MY3; NSC 102-2313-B-002-068-MY3) and the National Taiwan 38 University (102R7602B2). 39 40 Corresponding author: Dr. S.-S. Lin; [email protected] 41 42



4

ABSTRACT 43 Leafy flowers are the major symptoms of Peanut witches’ broom (PnWB) 44

phytoplasma infection in Catharanthus roseus. The orthologs of the PHYL1 effector 45 of PnWB from other species of phytoplasma can trigger the proteasomal degradation 46 of several MADS-box transcription factors (MTFs), resulting in leafy flower 47 formation. In contrast, the flowering negative regulator genes-SHORT VEGETATIVE 48 PHASE (SVP) was up-regulated in PnWB-infected C. roseus plants, but most miRNA 49 genes were repressed expressions. Coincidentally, transgenic Arabidopsis plants 50 expressing the PHYL1 of PnWB gene (PHYL1 plants), which show leafy flower 51 phenotypes, up-regulate SVP of Arabidopsis (AtSVP) but repress a putative regulatory 52 microRNA (miRNA) of AtSVP - miR396. However, the mechanism by which PHYL1 53 regulates AtSVP and miR396 is unknown, and the evidence of miR396-mediated 54 AtSVP degradation is lacking. Here, we show that miR396 triggers AtSVP mRNA 55 decay using genetic approaches, a reporter assay, and high-throughput degradome 56 profiles. Genetic evidence indicates that PHYL1 plants and atmir396a-1 mutants have 57 higher AtSVP accumulation, whereas the transgenic plants over-expressing MIR396 58 display lower AtSVP expression. The reporter assay indicated that target site mutation 59 results in decreasing the miR396-mediated repression efficiency. Moreover, 60 degradome profiles revealed that miR396 triggers AtSVP mRNA decay rather than 61 miRNA-mediated cleavage, implying that the AtSVP caused miR396-mediated 62 translation inhibition. We hypothesize that PHYL1 directly or indirectly interferes 63 with miR396-mediated AtSVP mRNA decay and synergizes with other effects, e.g., 64 MTF degradation, resulting in abnormal flower formation. We anticipate our findings 65 to be a starting point for studying the post-transcriptional regulation of PHYL1 66 effectors in symptom development. 67



5

68 Keywords: PnWB phytoplasma, PHYL1, SVP, miR396, leafy flower, miRNA. 69 70



6

INTRODUCTION 71 Phytoplasmas are obligate bacteria without cell walls that infect numerous 72

plants, causing severe agricultural losses (Lee et al., 2000). The typical symptoms on 73 phytoplasma infected plants include witches’ broom, proliferative branches, leaf 74 yellowing, and small leaves (Lee et al., 2000). The flowers of infected plants exhibit 75 sterility, abnormal morphology, virescence, and phyllody (herein referred to as leafy 76 flower) (Himeno et al., 2011). Peanuts witches’ broom (PnWB) phytoplasma-infected 77 Catharanthus roseus plants exhibit leafy flower symptoms, which were classified into 78 5 stages depending on their severity as described previously (Yang, 1985; Liu et al., 79 2014). Stage 4 (S4) leafy flowers exhibited leaf vein patterning with phyllody petals 80 and intumescent ovaries (Fig. 1A) (Liu et al., 2014). 81

The draft genome sequence of the PnWB phytoplasma contains 13 chromosomal 82 contigs with 562,473 total bp and 421 protein-coding genes (Chung et al., 2013). 83 Chung et al. (2013) suggested that the 48 putative PnWB effectors are similar to 84 known pathogenicity effectors of phytoplasmas. In Aster yellow witches’ broom 85 (AYWB) phytoplasma, the secreted AYWB phytoplasma protein 54 effector (SAP54) 86 causes a leafy flower phenotype in transgenic Arabidopsis plants (SAP54 plants) 87 (MacLean et al., 2011). Moreover, the PHYL1 effector of Onion yellow phytoplasma 88 wild-type line (OY-W), a SAP54 ortholog, also manifested an identical leafy flower 89 phenotype in PHYL1 over-expressing plants (Maejima et al., 2014). 90

PHYL1 and SAP54 interact with MADS-domain transcription factors (MTFs) in 91 Arabidopsis, such as SEPALLATA3 (AtSEP3), APETALA1 (AtAP1), and 92 CAULIFLOWER (AtCAL) (MacLean et al., 2014; Maejima et al., 2014). These 93 MTFs are key regulators in floral development and were triggered SAP54/PHYL1-94 mediated ubiquitin/26S proteasomal degradation by interacting with the RADIATION 95



7

SENSITIVE23 (RAD23) family, resulting in interference in floral homeotic gene 96 expression levels (MacLean et al., 2014; Maejima et al., 2014). Consistently, the ap1 97 mutant, ap1/cal double mutant, and sep1/sep2/sep3/sep4 quadruple mutant manifest 98 various types of leafy flower, e.g., leaf-like sepals, secondary flowers, cauliflower-99 like inflorescences, or loss of floral meristem determinacy (Bowman et al., 1993; 100 Ditta et al., 2004; Gregis et al., 2006). These results suggest that phytoplasma 101 SAP54/PHYL1 is a key effector for triggering positive regulators of MTF degradation 102 to switch the phase transition of plants from the reproductive stage to the vegetative 103 stage. 104

In PnWB-infected C. roseus plants, the expression levels of SHORT 105 VEGETATIVE PHASES1 and 2 (CrSVP1 and CrSVP2) were up-regulated in S4 leafy 106 flowers (Liu et al., 2014). The SVP of Arabidopsis (AtSVP) is an MTF and functions 107 as a negative regulator of floral development as part of a complex with FLOWERING 108 LOCUS C (AtFLC) to control flowering time by negatively regulating FLOWERING 109 LOCUS T (AtFT) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 110 (AtSOC1) by directly binding their promoter sequences (Lee et al., 2007; Li et al., 111 2008; Jang et al., 2009; Irish, 2010). Moreover, AtSVP also interacts with other 112 components, such as AP1, and AGL24, during stages 1 and 2 of flower development 113 to repress floral homeotic genes that control petal, stamen and carpel identity (Gregis 114 et al., 2009). The svp mutant (svp-32) of Arabidopsis exhibits an early flowering 115 phenotype, whereas constitutive expression of AtSVP in Arabidopsis delays flowering 116 (Hartmann et al., 2000; Gregis et al., 2006; Lee et al., 2007). Moreover, transgenic 117 Arabidopsis expressing AtSVP orthologs from Actinidia spp. or rice showed leaf-like 118 sepals and secondary flower phenotypes (Trevaskis et al., 2007; Wu et al., 2012). In 119



8

addition to MTF down-regulation, phytoplasma might induce leafy flower symptoms 120 development via up-regulated SVP expression. 121

MTF plays a role in the regulation of gene expression, whereas microRNA 122 (miRNA) plays a role in post-transcriptional regulation. Whether phytoplasma 123 effectors alter the miRNA expression levels for symptom development is an 124 interesting question. MiRNAs regulate numerous transcription factors involved in 125 plant development through RNA cleavage or translation inhibition (Kidner and 126 Martienssen, 2005; Voinnet, 2009). In contrast to animal miRNAs, plant miRNAs 127 display a high degree of sequence complementarity to their target mRNAs and guide 128 cleavage of the target RNA via ARGONATUTE1 (AGO1) (Kidner and Martienssen, 129 2005; Voinnet, 2009). In animals, the imperfect miRNA/target pairwise region results 130 in translation inhibition and, consequently, decay of the target mRNA (Bazzini et al., 131 2012; Djuranovic et al., 2012). However, the mechanism of translation inhibition in 132 plants is not well known. 133

Chorostecki et al. (2012) proposed a predicted miR396 target site on the MADS-134 box region of the AtSVP mRNA. Nevertheless, the lack of direct evidence from 5′ 135 rapid amplification of cDNA ends (5'RACE) data left them unable to demonstrate 136 miR396-mediated AtSVP cleavage (Chorostecki et al., 2012). In contrast, the miR396-137 mediated GROWTH-REGULATING FACTOR (AtGRF) family of Arabidopsis 138 features a bulge between the 7th and 8th positions of miR396 that is highly conserved 139 among different plant species. The 5'RACE data indicated that the bulge structure did 140 not affect miR396-medaited AtGRFs cleavage. However, interaction along the 5′ 141 portion of the miRNA is the feature most relevant to its activity and cleavage 142 efficiency (Mallory et al., 2004; Schwab et al., 2005; Lin et al., 2009), and modifying 143 the pairing status of the 5′ portion of miR396 through mutagenesis alters the 144



9

efficiency of AtGRF2 cleavage (Debernardi et al., 2012). Moreover, Li et al. (2013) 145 demonstrated that a 5′ miRNA mismatch triggers miRNA-mediated target RNA 146 translation inhibition in Arabidopsis. These results suggest that mispairing of the 5′ 147 portion of the miRNA plays a role in modulating cleavage efficiency and translation 148 inhibition during target gene regulation. 149

We previously identified miR396 of C. roseus via whole-transcriptome analysis 150 and small RNA profiling by next-generation sequencing (NGS) (Chang, 2012; Liu et 151 al., 2014). There are 2 mismatches in the 5′ portion of the miR396 (4th and 5th 152 positions) on the pairwise region of miR396/CrSVPs (Chang, 2012). Therefore, this 153 study seeks to answer several questions: (1) whether CrSVP1/2 are targets of miR396; 154 (2) whether the regulation approaches differ between miR396/CrSVPs and 155 miR396/CrGRFs due to the 2 mismatches in the 5′ portion of the miRNA; (3) whether 156 the PHYL1 effector of PnWB also determines leafy flower phenotype in Arabidopsis; 157 and (4) whether the PHYL1 alters MTF and miRNA expression levels. 158

In this study, transgenic Arabidopsis expressing the PHYL1 gene of PnWB 159 (PHYL1 plant) was generated and showed identical leafy flower phenotype. The leafy 160 flowers of PHYL1 plants exhibited a lower miR396 expression level but higher AtSVP 161 and AtGRF1 expression levels compared with normal flowers of Col-0 plants. 162 Moreover, we demonstrated that miR396 triggers SVP down-regulation via mRNA 163 decay rather than cleavage based on degradome analysis. The mechanisms of PHYL1-164 altered miR396/SVP expression levels and miR396-mediated SVP down-regulation 165 were investigated. 166 167 RESULTS 168 Abnormal gene and miRNA expression in PnWB-infected C. roseus 169



10

Deep sequencing was used to compare the whole transcriptome with the small 170 RNA profiles of C. roseus healthy flower (HF) and Stage 4 (S4) PnWB-infected leafy 171 flowers (Fig. 1A). The floral homeotic gene expression levels were compared 172 between HF and S4 flowers. The expression levels of CrFT, CrPI, CrFYF, CrAP1.1, 173 CrAP3.1, and CrAP3.2, but not CrAP1.2, CrSOC1.1, and CrSOC1.2, which enhance 174 flowering, were repressed in the S4 flowers (Fig. 1B). In contrast, the expression 175 levels of CrSVP1 and CrSVP2 were increased in S4 flowers (Fig. 1B). CrAG and 176 CrAP2 were not differentially expressed between HF and S4 flowers (Fig. 1B). In 177 addition, we observed that most C. roseus miRNAs were significantly down-regulated 178 in the S4 flowers, with only the up-regulation of miR162, miR169, and miR398 179 observed (Fig. 1C). These results suggest that PnWB effectors or other bacterial 180 proteins might directly or indirectly alter either miRNA genes expression profile of C. 181 roseus plants (CrMIR genes) or the floral homeotic gene expression levels in PnWB-182 infected plants. 183

184 The PHYL1 effector of PnWB causes leafy and abnormal flower phenotypes as 185 well as represses miR396 expression in Arabidopsis 186

The SAP54 effector of AYWB causes leafy flower in transgenic Arabidopsis 187 (MacLean et al., 2011). We identified a PHYL1 effector gene in the PnWB genome 188 sequence (Chung et al., 2013) that shares 61.3% amino acid sequence similarity with 189 AYWB and 56% similarity with PHYL1 of OY-W (Fig. 2A) and determined whether 190 PHYL1 of PnWB can cause leafy flower and alter miRNA expression. PHYL1 plants, 191 which over-express the PHYL1 of PnWB, exhibit 2 types of leafy flowers (Fig. 2B) 192 and 3 types of abnormal flowers (Fig. 2C), depending on the severity of the abnormal 193 phenotype in the flowers. The type I leafy flower phenotype (LF-I) exhibits sepal 194



11

enlargement, petal shrinking and stigma elongation (Fig. 2B). The type II leafy flower 195 phenotype (LF-II) features a secondary flower growing out from the primary flower 196 (Fig. 2B). In some cases, a cauliflower-like inflorescence with narrow interspaces and 197 short pedicles results (Fig. 2B). Three types of abnormal flowers include asymmetric 198 petals, abnormal petal and stamen numbers (5-6 petals and 7-8 stamens) (AF-I), 199 swollen stigma (AF-II), and secondary flower growth (AF-III) (Fig. 2C). We assume 200 that various phenotypes occurred on PHYL1 plants because of the various expression 201 levels of PHYL1. 202

Interestingly, in PHYL1 and SAP54 plants, most miRNAs were up-regulated 203 compared with Col-0 plants, whereas miR156h, miR159, miR390, and miR396 were 204 repressed, indicating that both effectors have similar functions in CrMIR gene 205 regulation (Fig. 3A). However, PnWB infection inhibits most CrMIR genes (Fig. 1C). 206 We hypothesize that the other effectors of PnWB might be involved in repression of 207 CrMIR genes. Furthermore, PHYL1 and SAP54 have specificity in the repression of 208 particular miRNAs. Indeed, the northern blot data also indicated that the leafy flowers 209 of PHYL1 plants exhibited lower miR396 accumulation (0.57-fold) compared with 210 Col-0 plants (Fig. 3B). 211

212 Identification of the MIR396 gene of C. roseus plant 213

The hairpin structures of the miR396 precursor of C. roseus (DDS44007) and its 214 miRNA/miRNA* pairing positions (Fig. 4A). The miR396/miR396* duplex exhibits 215 a 2-nt overhang at the 3′ end (Fig. 4A). Remarkably, 14,256 reads of the mature form 216 of miR396 were obtained for the HF flowers, whereas only 1,482 reads of miR396* 217 were obtained (Fig. 4A). These results satisfy the general rule that less miRNA* than 218 the mature form of the miRNA is required in vivo because the miRNA* exhibits a 219



12

rapid turnover rate due to cleavage by AGO1 (Guo and Lu, 2010). Importantly, the 220 amount of miR396 was reduced (2,587 reds) in S4 flowers, which is consistent with 221 previous observations (Fig. 4A). In addition, the cDNA of the miR396 precursor was 222 cloned from the C. roseus flower by reverse transcription-polymerase chain reaction 223 (RT-PCR) for further investigation (data not shown), suggesting that the miR396 224 precursor exists in C. roseus plants. 225

226 The MADS-box domain of the SVP gene contains a potential miR396 target site 227

Based on sequence pairing, a putative miR396 target site was identified on the 228 MADS-box domain of the SVPs (Fig. 4B); however, the miR396-mediated cleavage 229 of SVP was not confirmed by 5′ RACE (Chorostecki et al., 2012). The target 230 sequences in CrSVP1 and CrSVP2 were highly conserved with that of AtSVP 231 (AT2G22540) of Arabidopsis, and 4 mismatches (the 4th, 5th, 19th, and 20th positions 232 of miR396) were identified in the pairwise region of miR396/CrSVP1 or 233 miR396/AtSVP (Fig. 4B). However, the pairwise region of miR396/CrSVP2 had an 234 extra G-to-A mismatch at the 7th position of miR396 (Fig. 4B). 235

MiR396 was down-regulated 0.06-fold in the S4 leafy flower compared with the 236 HF (Fig. 4C). Moreover, semi-RT-PCR results indicated that the levels of CrSVP1 237 were up-regulated 3.20- and 3.5-fold in the S4 leafy flower and healthy leaf (HL) 238 samples, respectively, compared with the HF (Fig. 4D). In addition, CrSVP2 was up-239 regulated 3.4- and 4.6-fold in S4 and HL, respectively (Fig. 4D). These data suggest 240 that PnWB infection alters the expression of CrSVP1/2 and miR396. 241

242 SVPs contain mismatch pairings at the target site in the 5′ portion of miR396 243



13

Alignment of the SVP genes revealed highly conserved miR396 target sites in 244 various species. Less than 5 mismatches were observed on these SVPs-miR396 245 pairwise regions, whereas 94% of MADS-box genes had more than 6 mismatches 246 spread throughout parallel regions of AtSVP, such as AGAMOUS-LIKE24 of 247 Arabidopsis (AtAGL24) and AtFLC (Fig. 5A and Supplementary Fig. S1). The AtGRF 248 gene family is also the target of miR396 (Jones-Rhoades and Bartel, 2004; Wang et 249 al., 2004; Debernardi et al., 2012). However, the AtGRFs-miR396 pairwise region 250 exhibits mostly complementary pairing that differs from SVPs-miR396 pairing (Fig. 251 5B). Thus, we assume the miR396-mediated degradation efficiency or approaches 252 between miR396/SVPs and miR396/AtGRFs might differ (Fig. 5A and B). 253

254 MiR396-mediated down-regulation of SVPs by transient expression 255

Different concentrations of agrobacteria carrying the MIR396a gene of 256 Arabidopsis (AtMIR396a) were transiently co-expressed with AtSVP in Nicotiana 257 benthamiana plants and were then analyzed via agroinfiltration to evaluate whether 258 miR396 can down-regulate AtSVP. The AtSVP gene was expressed using a CaMV 259 35S promoter to avoid side effects of endogenous transcription factors that are 260 regulated by miR396. The AtSVP RNA levels were decreased by increasing miR396 261 expression levels (Fig. 5C). Similar results were observed for the miR396-mediated 262 down-regulation of CrSVP1, CrSVP2, and AtGRF1 (Supplementary Fig. S2). No 263 CrSVP1 down-regulation occurred when amiRGFP4 was present (an artificial miRNA 264 that targets GFP gene was used as a negative control) (Supplementary Fig. S3). These 265 data indicate that miR396 directly triggers SVPs post-transcriptional down-regulation. 266

To further demonstrate the target gene down-regulation by miR396, a reporter 267 assay was used in this study. A DNA fragment (129 nts in length) that contains a 268



14

target site for AtSVP or AtGRF1 was fused at the 5'-end of the YFP gene to generate 269 SVP129-YFP and GRF1129-YFP constructs, respectively (Fig. 6A). Moreover, SVP129m-270 YFP is a mutant construct that has several mutations at the target site, resulting in 8 271 mismatches in the pairwise region of miR396 (Fig. 6A). The SVP129-YFP and 272 GRF1129-YFP constructs resulted in approximately 85% reduction of YFP 273 fluorescence when these constructs were co-expressed with miR396, whereas no 274 significant differences were observed regarding YFP fluorescence in the YFP negative 275 control with/without miR396 (Fig. 6B and C). In contrast, the SVP129m-YFP 276 construct resulted in approximately 40% reduction of YFP fluorescence when co-277 expressed with miR396 (Fig. 6B and C). Notably, the fluorescent spots are present in 278 nuclei (Fig. 6B). The reporter assay demonstrated that miR396 specifically down-279 regulated AtSVP and AtGRF1. 280

281 Flowering phenotypes of miR396 in loss- and gain-of-function 282

We used genetic approaches to examine gain-of-function and loss-of-function in 283 miR396-mediated SVP regulation. A T-DNA insertion mutant line, SALK064047, 284 was demonstrated to be an AtMIR396a mutant (atmir396a-1) in Arabidopsis (Bao et 285 al., 2014). T-DNA was inserted at the -450 bp promoter region of AtMIR396a 286 (AT2G10606) (Fig. 7A). The homozygous atmir396a-1 plants exhibited only 0.6-fold 287 miR396 expression levels compared with Col-0 plants (Fig. 7B). We assumed that 288 this expression represents a background signal of miR396b in atmir396a-1 plants 289 (Fig. 7B). The atmir396a-1 plants exhibit normal flower and flowering time 290 phenotypes, whereas the svp32 plants display early flowering (Fig. 7C and D). In 291 addition, atmir396a-1 plants exhibit 0.5- and 0.3-fold increased AtSVP and AtGRF1 292



15

expression, respectively; compared with Col-0 plants (Fig. 7E), indicating that lower 293 miR396 levels induce up-regulation of AtSVP and AtGRF1. 294

In contrast, transgenic Arabidopsis expressing CrMIR396 (CrMIR396 plant) 295 exhibit abnormal flowers with curved sepals and petals and enlarged stigmas, 296 consistent with transgenic Arabidopsis expressing AtMIR396a (AtMIR396a plant) 297 (Fig. 7C) (Liang et al., 2014). Two individual CrMIR396 plants (lines #8 and #27) 298 exhibited 4.6-fold and 3.5-fold increased miR396 expression compared with Col-0 299 plants. Furthermore, AtMIR396a plants exhibited a 1.9-fold increase in miR396 300 expression (Fig. 7B). CrMIR396 and AtMIR396a plants exhibited late-flowering 301 phenotypes that were correlated with the expression levels of miR396 (Fig. 7D). 302 Moreover, AtSVP and AtGRF1 were down-regulated in CrMIR396 and AtMIR396a 303 plants (Fig. 7E). AtGRF1 was down-regulated by more than 80% by the over-304 expression of miR396, while AtSVP was down-regulated by only 20-40% in MIR396 305 plants (Fig. 7E). These results indicated that CrMIR396 can generate miR396 and has 306 a genetic function similar to that of AtMIR396a in Arabidopsis plants. Moreover, 307 miR396 regulates AtGRF1 might more efficiently than AtSVP. 308

309 SVP orthologs from different species cause various flower phenotypes 310

Two orthologous SVP genes (CrSVP1 and CrSVP2) from C. roseus were over-311 expressed in Arabidopsis (CrSVP1 and CrSVP2 plants), and transgene over-312 expression was confirmed by RT-PCR (Supplementary Fig. S4). However, both 313 plants exhibited normal flower phenotype and flowering time (Fig. 7C and D). In 314 addition, the transgenic Arabidopsis expressing SVP2 gene of Actinidia spp. (AdSVP2 315 plants) exhibited enlarged sepals, small green petals, and a curving pistil mimicking 316 the leafy flower phenotype of PHYL1 plants (Fig. 7C); however, the flowering time of 317



16

the AdSVP2 plant was similar to that of Col-0 plants (Fig. 7D). In contrast, the AtSVP 318 plants showed asymmetric petals of an abnormal flower phenotype identical to 319 PHYL1 plants (Fig. 7C and 2C). In some cases, the severely abnormal flowers of 320 AtSVP plants had 5 petals with 8 stamens (Fig. 7C). These data suggested that the up-321 regulation of AtSVP causes an abnormal flower phenotype. The abnormal flower 322 phenotype in AtSVP plants is consistent with the AF-I type flower of PHYL1 plants, 323 which have 5-6 asymmetric petals and 7-8 stamens (Fig. 2C and 7C). 324

Two individual lines of AtSVP plants (#1 and #2) exhibited late flowering time 325 with 16 to 19 rosette leaves. Indeed, phylogenetic analysis revealed that AtSVP, 326 AdSVP2, CrSVP1, and CrSVP2 are in different groups based on 80% amino acid 327 similarity (Fig. 4E). Moreover, the C-terminal regions of these SVPs differ 328 (Supplementary Fig. S5). These results imply that the SVP genes in other species have 329 functions regarding flower phenotypes and flowering times that differ from those in 330 Arabidopsis. In addition, the abnormal flower phenotypes in AdSVP2 and AtSVP 331 plants suggest that over-expression of SVP may alter flower development. To confirm 332 this hypothesis, AtSVP expression was detected in PHYL1 plants. 333

334 SVP is up-regulated in the sepal and petals of PHYL1 plants 335

Because miR396 expression was reduced in PHYL1 plants, we evaluated AtSVP 336 and AtGRF1 expression in transgenic plants. Real-time RT-PCR analysis revealed 337 that AtSVP and AtGRF1 are up-regulated in the PHYL1 leafy flower (Fig. 8A). 338 Moreover, in situ hybridization data indicate strong accumulation of AtSVP signals in 339 the leafy flower tissue of PHYL1 plants, particularly in the basal part of the petals (Fig. 340 8B, panel ii), whereas few AtSVP signals were observed in the sepals of Col-0 plants 341 (Fig. 8B, panel i). The sense probe for AtSVP was used as a negative control for in 342



17

situ hybridization, which no signal was observed in flower buds of PHYL1 or Col-0 343 plants (Fig. 8B, panels iii and iv). These results support the hypothesis of miR396-344 mediated AtSVP expression in flower tissue. 345

346 MiR396 triggers SVPs decay 347

The pairwise 4th and 5th positions are reportedly critical for the efficiency of low 348 miRNA-guided cleavage of the target RNA (Lin et al., 2009). We assumed that the 2 349 mismatches at the 4th and 5th positions of pairwise region will yield differences in 350 cleavage between miR396/AtSVP and miR396/AtGRF1. To test this hypothesis, a 351 high-throughput degradome approach was used to analyze the mRNA degradation 352 products. Over-expression of miR396 yielded 22,705 degradome reads of degraded 353 3′-AtGRF1 fragments in the CrMIR396 plant, whereas only 800 degradome reads 354 were obtained from Col-0 plants (Fig. 9A). In addition, 3,744 degradome reads of 355 AtGRF1 were obtained from in xrn4-5 mutants, a 5′-to-3′ exoribonuclease mutant, 356 whereas approximately 500 degradome reads were detected in SAP54 plants (Fig. 357 9A). These data indicate that miR396-mediated AtGRF1 cleavage is dependent on 358 miR396 dosage and the cleaved 3′-AtGRF1 fragment is highly accumulated in xrn4-5 359 mutants. A 3- to 5-fold increase in AtGRF1 degradome reads was detected in 360 CrMIR396 and xrn4-5 plants compared with Col-0 plants (Fig. 9B). In addition, the 361 other AtGRF targets, AtbHLH74 and AtMMG4.7 (AT5G43060), which are also targets 362 of miR396, also produced significant degradome reads on the corrected target site 363 (Supplementary Fig. S6). These results indicate that miR396-mediated AtGRF1 364 cleavage at the target site. 365

While no degradome reads were detected for the target site of AtSVP in these 366 plants, approximately 280 various degradome reads (white arrowheads) were 367



18

identified at the rear position of the miR396 target site in CrMIR396 plants, 368 suggesting the presence of miR396-mediated AtSVP decay (Fig. 9C). Total 369 degradome reads of AtSVP were increased 5-fold in CrMIR396 plants compared to 370 Col-0 plants, but no significant reads were detected in either xrn4-5 or SAP54 plants 371 (Fig. 9C). Identical results were obtained for the degradome profile of C. roseus 372 flowers (Fig. 9E, panel i and ii). In total, 52 and 21 degradome reads were detected for 373 the rear positions of the target sites on CrSVP1 and CrSVP2, respectively, suggesting 374 the presence of miR396-mediated CrSVP1/2 decay. In contrast, 26 degradome reads 375 of CrGRF1 were detected in the target position (black arrowhead), indicating 376 miR396-mediated cleavage (Fig. 9E, panel iii). In addition, one predicted miR396 377 target gene (AT1G71350) exhibits mismatch pairing at the 5′ portion (Supplementary 378 Fig. S7). No significant miR396-cleaved degradome reads at the target site were 379 observed for the gene. However, AT2G31880 has approximately 5-fold more 380 degradation reads in CrMIR396 plants (Supplementary Fig. S7B and C). In contrast, 381 under the miR396 decreasing condition, AT2G31880 expression was increased 50% 382 in SAP54 plants, which suggests the presence of miR396-mediated AT2G31880 383 down-regulation (Supplementary Fig. S7D). In sum, based on the 5′ portion pairing 384 differences between miR396 and its targets, miR396-mediated SVP or AT2G31880 385 down-regulation might differ with GRF1 control. In addition, this phenomenon is 386 conserved in various plant species. 387

388 DISCUSSION 389

Multifunctional effectors are common in many pathogens. In addition to MTF 390 degradation, we demonstrated that PHYL1 effector can up-regulate SVP MTF 391 expression and alter miRNA expressions to switch the phase transition back to the 392



19

vegetative stage. In addition, we also provided evidence to show that miR396-393 mediated SVP mRNA decay. 394 395 The effectors of PnWB alter gene and miRNA expressions in host plants 396

The virescence and phyllody symptoms on phytoplasma-infected plants are 397 remarkable phenotypes. Phytoplasma infection alters the physiological and 398 morphological characteristics of the host cells to enhance pathogenic multiplication 399 and infection in the C. roseus plants (Sugio et al., 2011). To revert the reproductive 400 stage to the vegetative stage, PHYL1/SAP54 effectors suppress positive regulators of 401 flowering but enhance the expression levels of negative regulators, such as CrSVP1 402 and CrSVP2. However, CrSOC1.1, CrSOC1.2 and CrAP1.2, the orthologs of which 403 function as positive regulators in flowering in Arabidopsis, were not repressed by 404 PnWB. This phenomenon can be explained by two forces that originate from the 405 pathogen and host to counteract each other; they are abnormally co-expressed in the 406 floral meristem, resulting in leafy flower formation (Liu et al., 2014). 407

Rather than altering gene expression, the miRNA expression levels were also 408 altered during PnWB infection. Interestingly, the miRNA expression patterns in 409 PnWB-infected S4 leafy flowers differ in PHYL1 or SAP54 plants. We hypothesize 410 that the other effectors or bacterial proteins in PnWB directly or indirectly control 411 CrMIR gene expression, resulting in different miRNA expression patterns between 412 PnWB-infected plants and transgenic plants. Moreover, the PHYL1/SAP54 that 413 triggers MTFs degradation might alter abnormal miRNAs expression to cause a 414 synergistic effect, thereby resulting in the leafy flower phenotype. 415

Like SAP54 or PHYL1 of OY-M plants, PHYL1 of PnWB effector causes leafy 416 flowers in transgenic Arabidopsis plants. Moreover, the miRNA expression patterns 417



20

of PHYL1 plants (PHYL1 of PnWB) were also consistent with those of SAP54 plants. 418 SAP54 and PHYL1 of OY-M mediate AtAP1, AtSEP3, and AtCAL proteasomal 419 degradation (MacLean et al., 2014; Maejima et al., 2014); therefore, MTF degradation 420 might result in abnormal miRNA expression. These results indicated that these 421 effectors contain common motif(s) for triggering leafy flower formation and altering 422 miRNA expression. Furthermore, PHYL1 mediates the down-regulation of miR396 423 expression; however, it did not interfere with miR396 biogenesis in vivo. PHYL1 424 might trigger MTF degradation or altering the expression levels of other factors that 425 regulate miR396 expression. 426

In addition, the atmir396a-1 mutant exhibited AtSVP accumulation without 427 manifesting any abnormal flower phenotype. Our explanation for this observation is 428 that the functional redundancy of miR396b might play a role in regulating AtSVP. 429 Moreover, the 0.5-fold accumulation of the AtSVP relative levels in atmir396a-1 430 plants might not be sufficient to trigger the abnormal flower phenotype, whereas the 431 3-fold and 90-fold accumulation of AtSVP in PHYL1 and AtSVP plants, respectively, 432 that occur this phenotype (Fig. 8 and Fig. S4B). In contrast, AtMIR396a and 433 CrMIR396 plants did not show the same early flowering phenotype as the svp32 434 mutant, possibly because miR396 also regulates other genes; therefore, the synergistic 435 effect resulted in a milder late flowering. 436

437 The 5′ portion of miR396 determines target RNA degradation by miRNA 438 cleavage or mRNA decay 439

The degradome patterns indicated that miR396-mediated SVP and GRF1 440 degradation profiles differ because of the discrepant pairing on the 5′ portion of the 441 miRNA. The 5′ portion (i.e., the 4th and 5th positions) of the miRNA is critical for 442



21

miRNA-mediated cleavage, whereas the 19th and 20th positions are nonessential (Lin 443 et al., 2009). The 5′ mismatch of miRNA reduces the efficiency of target RNA 444 cleavage and may trigger mRNA decay (Lin et al., 2009; Bazzini et al., 2012; 445 Djuranovic et al., 2012), which may explain the failure to confirm the miR396 target 446 site of SVP by 5′ RACE (Chorostecki et al., 2012). Indeed, the degradome profiles 447 showed that CrSVP1, CrSVP2, and AtSVP have non-specific mRNA decay, whereas a 448 clear degradome pick was shown on the target site of CrGRF1 and AtGRF1. In 449 miRNA regulation of mRNA by translation repression in animal models, miRISC 450 bound of mRNA is typically degraded by another endogenous RNase system (Stefani 451 and Slack, 2008; Bazzini et al., 2012; Djuranovic et al., 2012). In plants, the miR398-452 mediated cleavage of the Cu/Zn SUPEROXIDE DISMUTASES (CSD1 and CSD2) 453 family, which exhibits a mismatch at the 4th position of miR398, demonstrated that 454 miR398 regulates CSD2 expression through translation repression (Sunkar et al., 455 2006; Li et al., 2013). Therefore, we hypothesize that SVP mRNA decay might be 456 triggered by miR396-mediated translation inhibition. 457

458 PHYL1-mediated MTFs degradation might interfere the hetero-dimer formation 459 of SVP complex 460

PHYL1/SAP54 interacts with the RAD23 family to trigger MTFs (AP1, SEP3, 461 and CAL) degradation, resulting in the formation of leafy flower phenotypes 462 (MacLean et al., 2014; Maejima et al., 2014). However, AtSVP interacts with AP1 or 463 other components to form different complexes that regulate floral gene expressions 464 (Gregis et al., 2009). Therefore, the lacking of AP1 in PHYL1/SAP54 plants might 465 prevent AtSVP from forming a hetero-dimer complex, thereby resulting in 466 misregulation during phase transition and floral organ identity. In addition, the 467



22

degrees of phyllody and virescence of SAP54 plants in the rad23 family mutant 468 background were reduced, especially in the rad23BCD triple mutant that has no 469 strong leafy flower formation in the presence of phytoplasma infection or SAP54 470 over-expression (MacLean et al., 2014). Interestingly, rad23BCD mutant plants have 471 shown the abnormal flower (5-6 petals) phenotype (MacLean et al., 2014) that 472 identical with AF-I flower of PHYL1 and AtSVP plants. Therefore, these data implied 473 that the gain-of-function of the AtSVP-AP1 complex might also affect the flower 474 formation while AP1 no degradation in rad23BCD mutant background (Fig. 10). In 475 addition, the SVP complex has species specificity with regard to interfere with the 476 flowering time and flower development in Arabidopsis because only AtSVP plants 477 show the late-flowering and AF-I type flowering phenotype in Arabidopsis, whereas 478 other SVP plants have normal flowering time and normal flowers (excepting AdSVP 479 plants), similar to Col-0 plants. 480

481 Working model for PHYL1 repression of miR396-mediated SVP regulation 482

We propose a model for PnWB repression of the miR396-mediated SVP 483 silencing pathway (Fig. 10). Multiple functions of PHYL1 trigger positive regulators 484 of MTFs (AtAP1, AtSEP3, and AtCAL) proteasomal degradation, resulting in leafy 485 flower formation. PHYL1-mediated MTF degradation also affects many floral 486 homeotic gene expression levels and miRNA expression levels, including the up-487 regulation of AtSVP and the repression of miR396. MiR396 regulates SVP through an 488 mRNA decay approach that might be triggered by translation inhibition. Therefore, 489 the down-regulation of miR396 by PHYL1 results in the up-regulation of SVP to 490 change the complex formation to repress flowering and cause an abnormal flower 491 phenotype. 492



23

493 CONCLUSION 494

This study provided evidence to demonstrate that PHYL1/SAP54 effectors can 495 change miRNA expression levels. In addition, we also demonstrated that miR396 can 496 down-regulate SVP, and the over-expression of AtSVP causes the abnormal flower 497 phenotype. In the future, we will explore how PHYL1 controls these miRNA gene 498 expression levels and examine symptom development with regard to the pathogen 499 effector-host factor interaction at the post-transcriptional level. 500

501 MATERIALS AND METHODS 502 Plant materials and phytoplasma infection. Arabidopsis seeds were surface-503 sterilized and chilled at 4 °C for 2 days prior to sowing on Murashige and Skoog 504 (MS) medium with or without suitable antibiotics for selection. One-week-old 505 seedlings were germinated on MS plates and transferred to soil. C. roseus and N. 506 benthamiana seeds were sown in soil. All seedlings and plants were maintained in a 507 growth chamber or greenhouse (16 hr light/8 hr dark, 20-25 °C). 508

Two-month-old C. roseus plants were inoculated with PnWB phytoplasma via 509 grafting. The PnWB-infected plants developed virescence symptoms 3-4 weeks post-510 grafting (wpg), whereas phyllody symptoms developed at 5-6 wpg. 511 512 Screening of atmir396a mutants of Arabidopsis. Mutant lines of atmiR396a-1 513 (SALK064047) for T-DNA insertion were obtained from The Arabidopsis 514 Information Resource (TAIR) (http://www.arabidopsis.org/). Genomic DNA (gDNA) 515 from 1-week-old seedlings was used for genotyping. The primers LP and RP were 516 used to detect the wild-type genome region of the AtMIR396a gene, whereas the 517



24

primers LBb3.1 and RP were used to detect the T-DNA insertion region. The primers 518 used for genotyping are listed in Supplemental Table S1. 519 520 Gene construction and transgenic plants. The genes AtSVP, CrSVP1, CrSVP2, 521 AtMIR396a, CrMIR396, and PnWB PHYL1 were identified based on the Arabidopsis 522 (TAIR) and C. roseus transcriptome databases (Chang, 2012; Liu et al., 2014). AtSVP 523 was cloned via RT-PCR amplification using the primers F-AtSVP and R-AtSVP. For 524 AtGRF1, the 5' end of AtGRF1 (792 nts) was cloned via RT-PCR amplification using 525 the primers F-AtGRF1 and R-AtGRF1-792. CrSVP1 was cloned via RT-PCR 526 amplification using the primers 51524_F and 51524_R. CrSVP2 was cloned via RT-527 PCR amplification using the primers 57797_F and 57797_R. AtMIR396a was cloned 528 via RT-PCR amplification using the primers F-AtMIR396a and R-AtMIR396a. 529 CrMIR396 was cloned via RT-PCR amplification using the primers 34004-29-F and 530 34004-235-R. The PHYL1 gene was identified from the PnWB genome sequence 531 (Chung et al., 2013) and amplified from the cDNA of PnWB-infected C. roseus by 532 RT-PCR with the primers FG-PHYL1-Pn and RG-PHYL1-Pn. PCR fragments were 533 cloned into the pENTR™/D-TOPO® vector (Invitrogen) according to the 534 manufacturer’s instructions to generate pENTR-CrSVP1, pENTR-CrSVP2, pENTR-535 CrMIR396, and pENTR-PHYL1. 536

For the miR396 target site mutation of AtSVP, the AtSVP cDNA was used as a 537 template for PCR-base mutagenesis with MAtSVPm2-118 and PAtSVPm2-70. The 538 PCR fragments were cloned into pENTR™/D-TOPO® vector to generate pENTR-539 AtSVPm. 540

For the reporter assay, the AtSVP129 and AtSVP129m DNA fragments (nts 1-129 541 of the 5'-end of either AtSVP or AtSVPm) were amplified by PCR from pENTR-542



25

AtSVP as well as pENTR-AtSVPm with F-AtSVP and MAtSVP-129 primers. In 543 addition, the GRF1129 DNA fragment was amplified by PCR from pENTR-AtGRF1 544 with PAtGRF1-731 and MAtGRF1-817 primers. These PCR fragments were cloned 545 into the pENTR™/D-TOPO® vector to generate pENTR-AtSVP129, pENTR-546 AtSVP129m, and pENTR-AtGRF1129. Gateway system procedures were used to 547 transfer these genes to a pBA-DC-YFP binary vector to generate pBA-AtSVP129-YFP, 548 pBA-AtSVP129m-YFP, and pBA-AtGRF1129-YFP. 549

These binary plasmids were transformed into an Agrobacterium tumefaciens 550 ABI strain for agroinfiltration or used for transgenic Arabidopsis transformation using 551 a floral-dip procedure (Zhang et al., 2006). The transformant lines were screened on 552 MS medium containing 10 μg/ml Basta (Sigma). 553

The artificial miRNA precursor that targets GFP gene (pre-amiR-GFP4) was 554 constructed based on the miR159 precursor of Arabidopsis via PCR mutagenesis 555 using the primers PamiR-FG and MamiR. The PCR product was cloned into a 556 pENTR™/D-TOPO® vector to generate pENTR-amiR-GFP4. Gateway system 557 procedures were used to transfer pre-amiR-GFP4 to a pBA-DC-HA binary vector 558 (Zhang et al., 2005) and generate pBA-amiR-GFP4. The primers used for cloning are 559 listed in Supplemental Table S1. 560

561 Transient expression via agroinfiltration. A. tumefaciens ABI strain containing 562 binary vector was incubated in LB medium containing 10 mM MES, pH 5.6, 40 563 μΜ acetosyringone, 100 μg/ml spectinomycin, and 50 μg/mL kanamycin at 28 °C for 564 16 hr. The Agrobacterium was suspended, the absorbance was adjusted to OD600 = 0.5 565 using an appropriate buffer (10 mM MgCl2 and 150 μΜ acetosyringone), and the 566 Agrobacterium was incubated at room temperature for 3 hr (Lin et al., 2013). Four 567



26

days after agroinfiltration (4 dpi), the infiltrated leaves of the N. benthamiana plants 568 were collected and analyzed by semi-RT-PCR and northern blot. 569

For the observation of reporter assay results, the YFP fluorescence in the 570 infiltrated leaf was monitored using Leica TCS SP5 II confocal laser-scanning 571 microscope (Joint Center for Instruments and Researches, College of Bioresources 572 and Agriculture, National Taiwan University) that was equipped with a multiline 573 argon laser with a filter set for YFP fluorescence [excitation filter Acousto-optic 574 Tunable filter 488, emission bandwidth 496 to 574 nm, PMT2 offset (-1.0)/gain 575 (895.0)]. All image were graphically arranged used Adobe Photoshop CS3 software 576 (Adobe Systems Inc., Mountain View, CA, USA.). 577

578 Total RNA extraction and small RNA detection. Total RNA was extracted from the 579 plant tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s 580 protocol. For small RNA northern blotting, 10 μg of total RNA was separated on a 581 15% polyacrylamide/1× TBE/8 M urea gel and transferred to a Hybond-N+ 582 membrane. The miR396-AS DNA probe (5′- CAGTTCAAGAAAGCTGTGGAA-3′) 583 and the amiRGFP4-AS DNA probe (5′- TACTCCAATTGGCGATGGCCC-3′) were 584 end-labeled with [γ-P32]ATP using T4 polynucleotide kinase (New England Biolabs). 585 Free radioisotopes were filtered out using a mini Quick Spin Oligo Column (Roche). 586 The membrane was hybridized with ULTRAhyb®-Oligo hybridization buffer 587 (Ambion) at 42 °C for 16 hr and the signal was detected using X-film (GE 588 Healthcare) at -80 °C for 16 hr. 589 590 Real-time RT-PCR, semi-RT-PCR and northern blot. For real time RT-PCR, 591 cDNA was first reverse transcribed from total RNA using oligo(dT)20 and the 592



27

SuperscriptTM III First Strand Synthesis System (Invitrogen). Real-time PCR was 593 performed using a LightCycler 480 instrument (Roche, Indianapolis, IN, USA) and 594 three sets of primers for AtSVP, AtGRF1, and AtUBQ expression detection. The 595 primers used for real-time RT-PCR are listed in Supplemental Table S2. For semi-596 RT-PCR detection, the primers F-CrSVP1_A and R-CrSVP1_C were used to detect 597 CrSVP1. The primers F-CrSVP2_A and R-CrSVP2_C were used to detect CrSVP2. 598 The primers F-AtSVP and R-AtSVP were used to detect AtSVP. The primers F-599 AdSVP2 and R-AdSVP2 were used to detect AdSVP2. The primers CrUBQc-F and 600 CrUBQc-R were used to detect CrUBQ. The primers NbActin-F1 and NbActin-R1 601 were used to detect NbActin. The primers AtUBQ-F1 and AtUBQ-R1 were used to 602 detect AtUBQ. The primers used for semi-RT-PCR are listed in Supplemental Table 603 S3. 604 605 Statistical analyses and deep sequencing. The AtSVP, AtGRF1 and AtUBQ 606 transcripts were quantified via a relative cycle threshold (Ct) method. All experiments 607 were performed with three independent replicates to compensate for possible loading 608 errors. The relative expression levels were calculated based on the ∆∆Ct value, and 609 each sample was normalized according to the expression level of AtUBQ. The 610 miR396 expression levels were normalized via U6 internal/loading controls, which 611 were quantified using ImageQuant 5.2 (GE Healthcare). The ∆∆Ct values were used 612 to explain the fold changes in the expression levels. 613

The small RNA profiles of the PHYL1 plant, SAP54 plant, HF and S4 flowers 614 were analyzed using Illumina Hiseq 2000 (Genomics BioSci & Tech Co.). The 615 degradome profiles of the Col-0, CrMIR396 plant, xrn4-5 mutant, SAP54 plant, and 616 HF of C. roseus plant were also analyzed using Illumina Hiseq 2000 (Genomics 617



28

BioSci & Tech Co.). The miRNA and degradome profiles were analyzed using CLC 618 Genomics Workbench 5.5.2 (CLC bio) and the ContigViews analysis platform 619 (www.contigviews.bioagri.ntu.edu.tw). The reads normalization for the miRNA and 620 degradome assay were calculated by the ratio of total reads across various samples to 621 Col-0 plants. The raw small RNA reads reported in this paper have been submitted to 622 the NCBI Short Read Archive (SRA) under accession number SRR1818286 (normal 623 flower of Col-0 plant), SRR1818303 (leafy flower of PHYL1 plant), and SRR1818289 624 (leafy flower of SAP54 plant). The raw degradome reads reported are available in 625 SRA under accession number SRR1821048 (flower of Col-0 plant), SRR1821008 626 (flower of CrMIR396 plant), SRR1821172 (flower of xrn4-5 mutant), SRR1821156 627 (leafy flower of SAP54 plant), and SRR1821217 (HF of C. roseus plant). 628

629 In situ hybridization. A digoxigenin (DIG)-labeled SVP RNA probe (1117-1416 bp) 630 was produced using an in vitro transcription kit (Roche) following the manufacturer’s 631 protocol. The embedded Col-0 and PHYL1 inflorescence tissues were sectioned to 8-632 µm thicknesses and hybridized with DIG-labeled RNA probes. The hybridization 633 signal was detected using an anti-DIG antibody conjugated to alkaline phosphatase 634 (AP) (Roche) with NBT/BCIP as the substrate. The results were examined under a 635 bright field microscope as purple dotted signals. The protocol followed that of a 636 previous study (Wang et al., 2008). 637

638 Supplemental Data 639

The following materials are available in the online version of this article. 640 Supplemental Figure S1. Alignment and comparison of the parallel position of 641

the miR396 target sites from MADS-box containing Arabidopsis genes. 642 www.plantphysiol.orgon April 11, 2018 - Published by Downloaded from

Copyright © 2015 American Society of Plant Biologists. All rights reserved.


29

Supplemental Figure S2. In vivo analysis of the miR396-mediated CrSVP1, 643 CrSVP2, and AtGRF1 cleavage efficiency by transient expression. 644

Supplemental Figure S3. In vivo analysis of the miR396-mediated CrSVP1 645 expression efficiency by transient expression. 646

Supplemental Figure S4. The detection of different SVP genes in various 647 transgenic plants. 648

Supplemental Figure S5. Amino acid sequence alignment of AtSVP, CrSVP1, 649 CrSVP2, and AdSVP2. 650

Supplemental Figure S6. Degradome analysis of Arabidopsis. 651 Supplemental Figure S7. Degradome data regarding the mismatches in the 5'-652

portion of the miR396 pairwise region. 653 Supplemental Table S1. Primers used in this study. 654 Supplemental Table S2. Primers for real-time RT-PCR. 655 Supplemental Table S3. Primers for semi-RT-PCR. 656

657 ACKNOWLEDGMENTS 658

We thank Dr. Erika Varkonyi-Gasic for providing the AdSVP2 transgenic 659 Arabidopsis seeds; Dr. Han Ning for AtSVP transgenic Arabidopsis seeds and Dr. 660 Saskia Hogenhout for SAP54 transgenic Arabidopsis seeds. This study was supported 661 by the Ministry of Science and Technology (NSC-98-2313-B-002-047-MY3; NSC 662 100-2923-B-002-001-MY3; NSC 102-2313-B-002-068-MY3) and the National 663 Taiwan University (104R7602B2) to S.-S. Lin. 664

665 LITERATURE CITED 666 Bao M, Bian H, Zha Y, Li F, Sun Y, Bai B, Chen Z, Wang J, Zhu M, Han N 667

(2014) miR396a-Mediated basic helix-loop-helix transcription factor bHLH74 668 www.plantphysiol.orgon April 11, 2018 - Published by Downloaded from



30

repression acts as a regulator for root growth in Arabidopsis seedlings. Plant 669 Cell Physiol. 55: 1343-1353 670

Bazzini AA, Lee MT, Giraldez AJ (2012) Ribosome profiling shows that miR-430 671 reduces translation before causing mRNA decay in zebrafish. Science 336: 672 233-237 673

Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR (1993) Control of 674 flower development in Arabidopsis thaliana by APETALA1 and interacting 675 genes. Development 119: 721-743 676

Chang TC (2012) Idenification of conserved microRNAs and their targets in PnWB 677 phytoplasma induced leafy flower of Cantharanthus roseus. National Taiwan 678 University 679

Chorostecki U, Crosa VA, Lodeyro AF, Bologna NG, Martin AP, Carrillo N, 680 Schommer C, Palatnik JF (2012) Identification of new microRNA-regulated 681 genes by conserved targeting in plant species. Nucleic Acids Res. 40: 8893-682 8904 683

Chung WC, Chen LL, Lo WS, Lin CP, Kuo CH (2013) Comparative analysis of 684 the peanut witches'-broom phytoplasma genome reveals horizontal transfer of 685 potential mobile units and effectors. PLoS One 8: e62770 686

Debernardi JM, Rodriguez RE, Mecchia MA, Palatnik JF (2012) Functional 687 specialization of the plant miR396 regulatory network through distinct 688 microRNA-target interactions. PLoS Genet. 8 689

Ditta G, Pinyopich A, Robles P, Pelaz S, Yanofsky MF (2004) The SEP4 gene of 690 Arabidopsis thaliana functions in floral organ and meristem identity. Curr. 691 Biol. 14: 1935-1940 692

Djuranovic S, Nahvi A, Green R (2012) miRNA-mediated gene silencing by 693 translational repression followed by mRNA deadenylation and decay. Science 694 336: 237-240 695

Gregis V, Sessa A, Colombo L, Kater MM (2006) AGL24, SHORT VEGETATIVE 696 PHASE, and APETALA1 redundantly control AGAMOUS during early 697 stages of flower development in Arabidopsis. Plant Cell 18: 1373-1382 698

Gregis V, Sessa A, Dorca-Fornell C, Kater MM (2009) The Arabidopsis floral 699 meristem identity genes AP1, AGL24 and SVP directly repress class B and C 700 floral homeotic genes. Plant J. 60: 626-637 701

Guo L, Lu Z (2010) The fate of miRNA* strand through evolutionary analysis: 702 implication for degradation as merely carrier strand or potential regulatory 703 molecule? PLoS One 5: e11387 704

Hartmann U, Höhmann S, Nettesheim K, Wisman E, Saedler H, Huijser P (2000) 705 Molecular cloning of SVP: a negative regulator of the floral transition in 706 Arabidopsis. Plant J. 21: 351-360 707

Himeno M, Neriya Y, Minato N, Miura C, Sugawara K, Ishii Y, Yamaji Y, 708 Kakizawa S, Oshima K, Namba S (2011) Unique morphological changes in 709 plant pathogenic phytoplasma-infected petunia flowers are related to 710 transcriptional regulation of floral homeotic genes in an organ-specific 711 manner. Plant J. 67: 971-979 712

Irish VF (2010) The flowering of Arabidopsis flower development. Plant J. 61: 1014-713 1028 714

Jang S, Torti S, Coupland G (2009) Genetic and spatial interactions between FT, 715 TSF and SVP during the early stages of floral induction in Arabidopsis. Plant 716 J. 60: 614-625 717



31

Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant 718 microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 719 14: 787-799 720

Kidner CA, Martienssen RA (2005) The developmental role of microRNA in plants. 721 Curr. Opin. Plant Biol. 8: 38-44 722

Lee IM, Davis RE, Gundersen-Rindal DE (2000) Phytoplasma: phytopathogenic 723 mollicutes. Annu. Rev. Microbiol. 54: 221-255 724

Lee JH, Park SH, Lee JS, Ahn JH (2007) A conserved role of SHORT 725 VEGETATIVE PHASE (SVP) in controlling flowering time of Brassica 726 plants. Biochim. Biophys. Acta. 1769: 455-461 727

Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, Ahn JH (2007) Role of SVP in the 728 control of flowering time by ambient temperature in Arabidopsis. Genes Dev. 729 21: 397-402 730

Li D, Liu C, Shen L, Wu Y, Chen H, Robertson M, Helliwell CA, Ito T, 731 Meyerowitz E, Yu H (2008) A repressor complex governs the integration of 732 flowering signals in Arabidopsis. Dev. Cell 15: 110-120 733

Li S, Liu L, Zhuang X, Yu Y, Liu X, Cui X, Ji L, Pan Z, Cao X, Mo B, Zhang F, 734 Raikhel N, Jiang L, Chen X (2013) MicroRNAs inhibit the translation of 735 target mRNAs on the endoplasmic reticulum in Arabidopsis. Cell 153: 562-736 574 737

Liang G, He H, Li Y, Wang F, Yu D (2014) Molecular mechanism of 738 microRNA396 mediating pistil development in Arabidopsis. Plant Physiol. 739 164: 249-258 740

Lin SS, Wu HW, Elena SF, Chen KC, Niu QW, Yeh SD, Chen CC, Chua NH 741 (2009) Molecular evolution of a viral non-coding sequence under the selective 742 pressure of amiRNA-mediated silencing. PLoS Pathog. 5: e1000312 743

Lin YY, Fang MM, Lin PC, Chiu MT, Liu LY, Lin CP, Lin SS (2013) Improving 744 initial infectivity of the Turnip mosaic virus (TuMV) infectious clone by an 745 mini binary vector via agro-infiltration. Bot. Stud. 54: 22 746

Liu LY, Tseng HI, Lin CP, Lin YY, Huang YH, Huang CK, Chang TH, Lin SS 747 (2014) High-throughput transcriptome analysis of the leafy flower transition 748 of Catharanthus roseus induced by peanut witches'-broom phytoplasma 749 infection. Plant Cell Physiol. 55: 942-957 750

MacLean AM, Orlovskis Z, Kowitwanich K, Zdziarska AM, Angenent GC, 751 Immink RG, Hogenhout SA (2014) Phytoplasma effector SAP54 hijacks 752 plant reproduction by degrading MADS-box proteins and promotes insect 753 colonization in a RAD23-dependent manner. PLoS Biol. 12: e1001835 754

MacLean AM, Sugio A, Makarova OV, Findlay KC, Grieve VM, Tóth R, 755 Nicolaisen M, Hogenhout SA (2011) Phytoplasma effector SAP54 induces 756 indeterminate leaf-like flower development in Arabidopsis plants. Plant 757 Physiol. 157: 831-841 758

Maejima K, Iwai R, Himeno M, Komatsu K, Kitazawa Y, Fujita N, Ishikawa K, 759 Fukuoka M, Minato N, Yamaji Y, Oshima K, Namba S (2014) Recognition 760 of floral homeotic MADS domain transcription factors by a phytoplasmal 761 effector, phyllogen, induces phyllody. Plant J. 78: 541-554 762

Mallory AC, Reinhart BJ, Jones-Rhoades MW, Tang G, Zamore PD, Barton 763 MK, Bartel DP (2004) MicroRNA control of PHABULOSA in leaf 764 development: importance of pairing to the microRNA 5' region. EMBO J. 23: 765 3356-3364 766



32

Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel D (2005) 767 Specific effects of microRNAs on the plant transcriptome. Dev. Cell 8: 517-768 527 769

Stefani G, Slack FJ (2008) Small non-coding RNAs in animal development. Nat. 770 Rev. Mol. Cell Biol. 9: 219-230 771

Sugio A, MacLean AM, Kingdom HN, Grieve VM, Manimekalai R, Hogenhout 772 SA (2011) Diverse targets of phytoplasma effectors: from plant development 773 to defense against insects. Annu. Rev. Phytopathol. 49: 175-195 774

Sunkar R, Kapoor A, Zhu JK (2006) Posttranscriptional induction of two Cu/Zn 775 superoxide dismutase genes in Arabidopsis is mediated by downregulation of 776 miR398 and important for oxidative stress tolerance. Plant Cell 18: 2051-2065 777

Trevaskis B, Tadege M, Hemming MN, Peacock WJ, Dennis ES, Sheldon C 778 (2007) Short vegetative phase-like MADS-box genes inhibit floral meristem 779 identity in barley. Plant Physiol. 143: 225-235 780

Voinnet O (2009) Origin, biogenesis, and activity of plant microRNAs. Cell 136: 781 669-687 782

Wang CN, Chen YJ, Chang YC, Wu CH (2008) A step-by-step optimization guide 783 for applying tissue specific RNA in-situ hybridization to non-model plant 784 species. Taiwania 53: 383-393 785

Wang XJ, Reyes JL, Chua NH, Gaasterland T (2004) Prediction and identification 786 of Arabidopsis thaliana microRNAs and their mRNA targets. Genome Biol. 5: 787 R65 788

Wu RM, Walton EF, Richardson AC, Wood M, Hellens RP, Varkonyi-Gasic E 789 (2012) Conservation and divergence of four kiwifruit SVP-like MADS-box 790 genes suggest distinct roles in kiwifruit bud dormancy and flowering. J. Exp. 791 Bot. 63: 797-807 792

Yang IL (1985) Host responses of peanut witches' broom disease. J. Agric. Res. 793 China 34: 464-468 794

Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative 795 regulator of ABA signaling by promoting ABI3 degradation. Genes Dev. 19: 796 1532-1543 797

Zhang X, Henriques R, Lin SS, Niu QW, Chua NH (2006) Agrobacterium-798 mediated transformation of Arabidopsis thaliana using the floral dip method. 799 Nat. Protoc. 1: 641-646 800

801 802



33

803 FIGURE LEGENDS 804 Figure 1. The leafy flower phenotypes of Peanut witches’ broom (PnWB) 805 phytoplasma infected Catharanthus roseus plants and PHYL1 effector transgenic 806 Arabidopsis. (A) The healthy flower (HF) and Stage 4 (S4) PnWB-infected leafy 807 flower symptoms are presented in the left and right panels, respectively. Bar, 1 cm. 808 The mRNA (B) and miRNA (C) expression of the HF and S4 in C. roseus flowers are 809 represented by the heatmap. Red indicates up-regulated expression; blue indicates 810 down-regulated expression. The values on the scale bar indicate the results of the log2 811 (S4/HF) formula. 812 813 Figure 2. The phytoplasma effectors trigger the leafy flower phenotype and interfere 814 with miRNA expression. (A) Alignment of orthologous amino acids of PHYL1. 815 AYWB: Aster yellows witch’s broom phytoplasma; OY-W: Onion yellows 816 phytoplasma wild-type. (B) The leafy flower phenotypes of PHYL1 and SAP54 plants. 817 The type I leafy flower is indicated as (LF-I), whereas the type II leafy flower is 818 indicated as (LF-II). Bar, 0.5 cm. (C) The abnormal flower phenotype of PHYL1 819 plants. The type I to III phenotypes are indicated as (AF-I), (AF-II), and (AF-III), 820 respectively. Bar, 0.5 cm. 821 822 Figure 3. The phytoplasma effectors interfere miRNA expressions and subcellular 823 localization. (A) MiRNA expression in flowers of Col-0, PHYL1, and SAP54 plants as 824 represented by a heatmaps. Red indicates up-regulated expression; blue indicates 825 down-regulated expression. The values on the scale bar indicate the results of the log2 826 (Col-0/PHYL1 or Col-0/SAP54) formula. (B) MiR396 detection in Col-0, PHYL1, and 827



34

svp32 plants by northern blot. U6 was used as a loading control. The numbers indicate 828 the relative expression of miR396 compared to Col-0 plants. 829 830 Figure 4. Characterization of MIR396, CrSVP1, and CrSVP2 in Catharanthus roseus. 831 (A) Illustration of the hairpin structure of the MIR396 precursors of C. roseus and 832 their paired sequences. The mature miR396 (solid line) and miR396* (dashed line) 833 are indicated on the precursor structure (upper panels). The pairing of the miR396 834 (black) and miR396* (gray) sequences are indicated in the lower panel. The numbers 835 indicate the deep-sequence reads of miR396 or miR396*. (B) Predicted targets of 836 miR396 in the MADS-box domain of SVP genes. The nucleotide (nt) sequences of the 837 CrSVP1 (DDS_51524), CrSVP2 (DDS_57797) and AtSVP (AT2G22540) targets were 838 aligned, and the paired regions with miR396 are indicated. In the SVP alignment, dots 839 indicate identical nts, whereas bold letters indicate the nts that are perfectly paired 840 between SVP and miR396. The translated SVP amino acids are presented below the 841 alignment. (C) Analysis of miR396 expression between healthy flower (HF flower) 842 and Stage-4 PnWB-infected leafy flower (S4 flower) by small RNA northern blot. 843 The small RNA loading quantity was adjusted to 200 ng using a 2100 Bioanalyzer 844 (Agilent Tech. Inc.). The numbers below indicate the relative fold change in the 845 expression of miR396 regarding the S4 flowers relative to the HF flowers. CrU6 846 small nuclear RNA was used as a loading control. (D) Semi-RT-PCR analyses of the 847 CrSVP1 and CrSVP2 expression levels in a HF flower, S4 flower, and healthy leaf 848 (HL). CrUBQ was used as an internal control. The numbers indicate the fold changes 849 in CrSVP1 and CrSVP2 expression in the S4 flower and HL samples relative to the 850 HF flower. (E) Phylogenetic tree of the SVP proteins. The genes sharing greater than 851 80% amino acid similarity are classified and shaded in gray. AtSOC1 is referred to as 852



35

an outgroup. The scale bar indicates a 0.1 divergence of amino acid substitutions per 853 site. The numbers indicate the percentage of 1,000 bootstrap replicates at the 854 appropriate nodes. 855 856 Figure 5. SVP contains variation pairing of the 5′ portion of miR396 with its target 857 genes. (A) Highly conserved miR396 target sites on the SVP genes of various species. 858 Alignment of the miR396 target sites in SVP genes of various species. The GenBank 859 accession numbers of the SVP genes are AtSVP (NM127820), AtAGL24 (NM118587), 860 AdSVP1 (JF838212), AdSVP2 (JF838213), AdSVP3 (JF838214), AdSVP4 (JF838215), 861 HvBM1 (AJ249142), HvBM10 (EF043040), OsMADS22 (AB107957), OsMADS47 862 (AY345221), BcSVP (DQ922945), and PtSVP (FJ373210). The AtAGL24 and AtFLC 863 (AT5G10140) were chosen as representative MADS genes for target site comparison. 864 The SVP nts that pair with the miR396 sequences are indicated by gray boxes. (B) 865 The miR396 target site alignment for GROWTH-REGULATING FACTORs (AtGRF1, 866 AT2G22840; AtGRF2, AT4G37740; AtGRF3, AT2G36400; AtGRF7, AT5G53660; 867 AtGRF8, At4G24150; AtGRF9, AT2G45480). Gray boxes indicate the nts of AtGRFs 868 paired with the miR396 sequences. (C) In vivo analysis of miR396-mediated AtSVP-869 HA efficiency by transient expression. The relative expression levels of AtSVP were 870 normalized to the NbActin level via real-time RT-PCR. The bars represent SEs (n=6). 871 The relative expression levels were significantly different from those in Col-0 plants 872 for each RNA sample, based on Student’s t test; * indicates P values < 0.05; ** 873 indicates P values < 0.01. The various percentages of miR396 were determined by a 874 small RNA northern blot. The U6 small nuclear RNAs were used as loading controls. 875 The various percentages of miR396 are indicated below the real-time RT-PCR and 876



36

northern data. The AtSVP-HA protein level was detected by western blotting with a 877 1:10,000 dilution of HA antibody. CDC2 was used as a protein loading control. 878 879 Figure 6. The reporter assay for miR396-mediated targeted down-regulation. (A) 880 Schematic of miR396 and its target site paring on the YFP gene. All of the constructs 881 were constructed on a binary vector under a 35S promoter. A YFP-only construct (i) 882 was used as a negative control. The SVP129-YFP construct (ii) represents 129 nts of 883 the 5'-end of the SVP gene containing the miR396 target site fused with the YFP gene. 884 The SVP129m-YFP construct (iii) represents 129 nts of the 5'-end of the SVP gene 885 containing a mutated miR396 target site fused with the YFP gene. The GRF1129-YFP 886 construct (iv) represents 129 nt of the 5'-end of the GRF1 gene containing the miR396 887 target site fused with the YFP gene. (B) The YFP reporter assay was analyzed using 888 confocal microscopy. Bar, 100 µm. The relative average YFP expression level (log2) 889 of the reporter assay as determined by confocal microscopy (n = 3). Relative YFP 890 expression levels were significantly different from that of the negative control 891 construct without miR396 present in each sample, based on Student’s t test; ** 892 indicates P values < 0.01; * indicates P values < 0.05. MiR396 was detected by 893 northern blot for each sample (2 replicates). U6 small nuclear RNA was used as a 894 loading control. 895 896 Figure 7. Characterization of miR396, SVPs and PHYL1 of PnWB in Arabidopsis 897 plants. (A) Diagrams of the atmir396a-1 mutant (SALK064047). The black arrows 898 indicate the gene regions for AT2G10605, AtMIR396a (AT2G10606), and 899 AT2G10608 and their translation directions. The T-DNA insertion site located at the 900



37

promoter region (450 bp upstream) of AtMIR396a. The left border (LB) and right 901 border (RB) are indicated at the 2 borders of the T-DNA. The primers LP, RP, and 902 LBb3.1 were used for genotyping via PCR. Bar, 150 bp. (B) Analysis of miR396 by 903 small RNA northern blot in Col-0, svp32 mutant, atmir396a-1 mutant, 2 independent 904 CrMIR396 (lines 8, and 27), and AtMIR396a over-expressing plants. U6 small RNA 905 was used as a loading control. The numbers below indicate fold changes in miR396 906 expression relative to the Col-0 plant. (C) CrSVP1, CrSVP2, atmir396a-1 and svp-32 907 (SALK072930C) mutant plants exhibited normal flower phenotypes. CrMIR396 and 908 AtMIR396a plants exhibited abnormal flower phenotypes. Plants with AdSVP2 or 909 AtSVP over-expression exhibited leafy or abnormal flower phenotypes, respectively. 910 Bar, 0.1 cm. (D) Evaluation of flowering time of various Arabidopsis mutant or 911 transgenic plants. The leaf number represents flowering time. The bars represent SEs 912 (n=20). (E) MiR396-mediated AtSVP and AtGRF1 regulation. AtSVP and AtGRF1 913 were detected by real-time RT-PCR. Relative expression levels were normalized to 914 the level of AtUBQ. The bars represent SEs (n=3). Relative expression levels were 915 significantly different from those of the Col-0 plants in each RNA sample, based on 916 Student’s t test; * indicates P values < 0.05; ** indicates P values < 0.01. 917 918 Figure 8. PHYL1 alters the expression of miR396 and its targets. (A) AtSVP and 919 AtGRF1 expression levels in Col-0, PHYL1, and svp32 plants were detected by real-920 time RT-PCR. The bars represent SEs (n=9). Relative expression levels were 921 normalized to the level of AtUBQ. Relative expression levels were significantly 922 different from those of the Col-0 plants in each RNA sample, based on Student’s t test; 923 * indicates P values < 0.05; ** indicates P values < 0.01. (B) Detection of SVP gene 924



38

expression in floral bud tissue by in situ hybridization. The buds of Col-0 (panel i) 925 and PHYL1 (panel ii) plants were sectioned and hybridized with an anti-sense probe 926 for SVP detection. The sense probe for AtSVP was used as a negative control (iii and 927 iv). The black arrows indicate the AtSVP signal at the sepal, and the red arrows 928 indicate the AtSVP signals at the basal part of the petal. Bar, 50 µm. se: sepal; pe: 929 petal; an: anther; st: stigma. 930 931 Figure 9. Degradome analysis of C. roseus and Arabidopsis. The degradome patterns 932 of AtGRF1 (A) and AtSVP (C) in flower buds of Col-0, CrMIR396, xrn4-5 mutant, 933 and PHYL1 plants. The fold changes in the degradome of AtGRF1 (B) and AtSVP (D) 934 in flower buds of Col-0, CrMIR396, xrn4-5 mutant, and PHYL1 plants. The fold 935 changes were significantly different from those of the Col-0 plants in each RNA 936 sample based on Student’s t test; * indicates P values < 0.01. (E) The degradome 937 patterns of CrSVP1, CrSVP2, and CrGRF1 in flowers of C. roseus. The black 938 arrowhead indicates the miR396 target site. The white arrowhead indicates the non-939 specific RNA degradation position. 940 941 Figure 10. Model for PHYL1-regulated miR396-mediated SVP expression in the 942 flowering pathway resulting in the abnormal flower phenotype. 943



Figure 1. The leafy flower phenotypes of Peanut witches’ broom (PnWB) phytoplasma infected Catharanthus roseus plants and PHYL1 effector transgenic Arabidopsis. (A) The healthy flower (HF) and Stage 4 (S4) PnWB-infected leafy flower symptoms are presented in the left and right panels, respectively. Bar, 1 cm. The mRNA (B) and miRNA (C) expression of the HF and S4 in C. roseus flowers are represented by the heatmap. Red indicates up-regulated expression; blue indicates down-regulated expression. The values on the scale bar indicate the results of the log2 (S4/HF) formula.



Figure 2. The phytoplasma effectors trigger the leafy flower phenotype and interfere with miRNA expression. (A) Alignment of orthologous amino acids of PHYL1. AYWB: Aster yellows witch’s broom phytoplasma; OY-W: Onion yellows phytoplasma wild-type. (B) The leafy flower phenotypes of PHYL1 and SAP54 plants. The type I leafy flower is indicated as (LF-I), whereas the type II leafy flower is indicated as (LF-II). Bar, 0.5 cm. (C) The abnormal flower phenotype of PHYL1 plants. The type I to III phenotypes are indicated as (AF-I), (AF-II), and (AF-III), respectively. Bar, 0.5 cm.



Figure 3. The phytoplasma effectors interfere miRNA expressions and subcellular localization. (A) MiRNA expression in flowers of Col-0, PHYL1, and SAP54 plants as represented by a heatmaps. Red indicates up-regulated expression; blue indicates down-regulated expression. The values on the scale bar indicate the results of the log2 (Col-0/PHYL1 or Col-0/SAP54) formula. (B) MiR396 detection in Col-0, PHYL1, and svp32 plants by northern blot. U6 was used as a loading control. The numbers indicate the relative expression of miR396 compared to Col-0 plants.



Figure 4. Characterization of MIR396, CrSVP1, and CrSVP2 in Catharanthus roseus. (A) Illustration of the hairpin structure of the MIR396 precursors of C. roseus and their paired sequences. The mature miR396 (solid line) and miR396* (dashed line) are indicated on the precursor structure (upper panels). The pairing of the miR396 (black) and miR396* (gray) sequences are indicated in the lower panel. The numbers indicate the deep-sequence reads of miR396 or miR396*. (B) Predicted targets of miR396 in the MADS-box domain of SVP genes. The nucleotide (nt) sequences of the CrSVP1 (DDS_51524), CrSVP2 (DDS_57797) and AtSVP (AT2G22540) targets were aligned, and the paired regions with miR396 are indicated. In the SVP alignment, dots indicate identical nts, whereas bold letters indicate the nts that are perfectly paired between SVP and miR396. The translated SVP amino acids are presented below the alignment. (C) Analysis of miR396 expression between healthy flower (HF flower) and Stage-4 PnWB-infected leafy flower (S4 flower) by small RNA northern blot. The small RNA loading quantity was adjusted to 200 ng using a 2100 Bioanalyzer (Agilent Tech. Inc.). The numbers below indicate the relative fold change in the expression of miR396 regarding the S4 flowers relative to the HF flowers. CrU6 small nuclear RNA was used as a loading control. (D) Semi-RT-PCR analyses of the CrSVP1 and CrSVP2 expression levels in a HF flower, S4 flower, and healthy leaf (HL). CrUBQ was used as an internal control. The numbers indicate the fold changes in CrSVP1 and CrSVP2 expression in the S4 flower and HL samples relative to the HF flower. (E) Phylogenetic tree of the SVP proteins. The genes sharing greater than 80% amino acid similarity are classified and shaded in gray. AtSOC1 is referred to as an outgroup. The scale bar indicates a 0.1 divergence of amino acid substitutions per site. The numbers indicate the percentage of 1,000 bootstrap replicates at the appropriate nodes.



Figure 5. SVP contains variation pairing of the 5′ portion of miR396 with its target genes. (A) Highly conserved miR396 target sites on the SVP genes of various species. Alignment of the miR396 target sites in SVP genes of various species. The GenBank accession numbers of the SVP genes are AtSVP (NM127820), AtAGL24 (NM118587), AdSVP1 (JF838212), AdSVP2 (JF838213), AdSVP3 (JF838214), AdSVP4 (JF838215), HvBM1 (AJ249142), HvBM10 (EF043040), OsMADS22 (AB107957), OsMADS47 (AY345221), BcSVP (DQ922945), and PtSVP (FJ373210). The AtAGL24 and AtFLC (AT5G10140) were chosen as representative MADS genes for target site comparison. The SVP nts that pair with the miR396 sequences are indicated by gray boxes. (B) The miR396 target site alignment for GROWTH-REGULATING FACTORs (AtGRF1, AT2G22840; AtGRF2, AT4G37740; AtGRF3, AT2G36400; AtGRF7, AT5G53660; AtGRF8, At4G24150; AtGRF9, AT2G45480). Gray boxes indicate the nts of AtGRFs paired with the miR396 sequences. (C) In vivo analysis of miR396-mediated AtSVP-HA efficiency by transient expression. The relative expression levels of AtSVP were normalized to the NbActin level via real-time RT-PCR. The bars represent SEs (n=6). The relative expression levels were significantly different from those in Col-0 plants for each RNA sample, based on Student’s t test; * indicates P values < 0.05; ** indicates P values < 0.01. The various percentages of miR396 were determined by a small RNA northern blot. The U6 small nuclear RNAs were used as loading controls. The various percentages of miR396 are indicated below the real-time RT-PCR and northern data. The AtSVP-HA protein level was detected by western blotting with a 1:10,000 dilution of HA antibody. CDC2 was used as a protein loading control.



Figure 6. The reporter assay for miR396-mediated targeted down-regulation. (A) Schematic of miR396 and its target site paring on the YFP gene. All of the constructs were constructed on a binary vector under a 35S promoter. A YFP-only construct (i) was used as a negative control. The SVP129-YFP construct (ii) represents 129 nts of the 5'-end of the SVP gene containing the miR396 target site fused with the YFP gene. The SVP129m-YFP construct (iii) represents 129 nts of the 5'-end of the SVP gene containing a mutated miR396 target site fused with the YFP gene. The GRF1129-YFP construct (iv) represents 129 nt of the 5'-end of the GRF1 gene containing the miR396 target site fused with the YFP gene. (B) The YFP reporter assay was analyzed using confocal microscopy. Bar, 100 µm. The relative average YFP expression level (log2) of the reporter assay as determined by confocal microscopy (n = 3). Relative YFP expression levels were significantly different from that of the negative control construct without miR396 present in each sample, based on Student’s t test; ** indicates P values < 0.01; * indicates P values < 0.05. MiR396 was detected by northern blot for each sample (2 replicates). U6 small nuclear RNA was used as a loading control.



Figure 7. Characterization of miR396, SVPs and PHYL1 of PnWB in Arabidopsis plants. (A) Diagrams of the atmir396a-1 mutant (SALK064047). The black arrows indicate the gene regions for AT2G10605, AtMIR396a (AT2G10606), and AT2G10608 and their translation directions. The T-DNA insertion site located at the promoter region (450 bp upstream) of AtMIR396a. The left border (LB) and right border (RB) are indicated at the 2 borders of the T-DNA. The primers LP, RP, and LBb3.1 were used for genotyping via PCR. Bar, 150 bp. (B) Analysis of miR396 by small RNA northern blot in Col-0, svp32 mutant, atmir396a-1 mutant, 2 independent CrMIR396 (lines 8, and 27), and AtMIR396a over-expressing plants. U6 small RNA was used as a loading control. The numbers below indicate fold changes in miR396 expression relative to the Col-0 plant. (C) CrSVP1, CrSVP2, atmir396a-1 and svp-32 (SALK072930C) mutant plants exhibited normal flower phenotypes. CrMIR396 and AtMIR396a plants exhibited abnormal flower phenotypes. Plants with AdSVP2 or AtSVP over-expression exhibited leafy or abnormal flower phenotypes, respectively. Bar, 0.1 cm. (D) Evaluation of flowering time of various Arabidopsis mutant or transgenic plants. The leaf number represents flowering time. The bars represent SEs (n=20). (E) MiR396-mediated AtSVP and AtGRF1 regulation. AtSVP and AtGRF1 were detected by real-time RT-PCR. Relative expression levels were normalized to the level of AtUBQ. The bars represent SEs (n=3). Relative expression levels were



significantly different from those of the Col-0 plants in each RNA sample, based on Student’s t test; * indicates P values < 0.05; ** indicates P values < 0.01.



Figure 8. PHYL1 alters the expression of miR396 and its targets. (A) AtSVP and AtGRF1 expression levels in Col-0, PHYL1, and svp32 plants were detected by real-time RT-PCR. The bars represent SEs (n=9). Relative expression levels were normalized to the level of AtUBQ. Relative expression levels were significantly different from those of the Col-0 plants in each RNA sample, based on Student’s t test; * indicates P values < 0.05; ** indicates P values < 0.01. (B) Detection of SVP gene expression in floral bud tissue by in situ hybridization. The buds of Col-0 (panel i) and PHYL1 (panel ii) plants were sectioned and hybridized with an anti-sense probe for SVP detection. The sense probe for AtSVP was used as a negative control (iii and iv). The black arrows indicate the AtSVP signal at the sepal, and the red arrows indicate the AtSVP signals at the basal part of the petal. Bar, 50 µm. se: sepal; pe: petal; an: anther; st: stigma.



Figure 9. Degradome analysis of C. roseus and Arabidopsis. The degradome patterns of AtGRF1 (A) and AtSVP (C) in flower buds of Col-0, CrMIR396, xrn4-5 mutant, and PHYL1 plants. The fold changes in the degradome of AtGRF1 (B) and AtSVP (D) in flower buds of Col-0, CrMIR396, xrn4-5 mutant, and PHYL1 plants. The fold changes were significantly different from those of the Col-0 plants in each RNA sample based on Student’s t test; * indicates P values < 0.01. (E) The degradome patterns of CrSVP1, CrSVP2, and CrGRF1 in flowers of C. roseus. The black arrowhead indicates the miR396 target site. The white arrowhead indicates the non-specific RNA degradation position.



Figure 10. Model for PHYL1-regulated miR396-mediated SVP expression in the flowering pathway resulting in the abnormal flower phenotype.



1

SUPPORTING INFORMATION

Figure S1. Alignment and comparison of the parallel positions of the miR396 target

sites in MADS-box containing Arabidopsis genes. The nts paired with the miR396

sequences are indicated by gray boxes. The asterisks indicate the 4 mismatches in the

pairwise region of the gene.



2

Figure S2. In vivo analysis of miR396-mediated CrSVP1, CrSVP2, and AtGRF1

cleavage efficiency through transient expression. The relative expression levels of

CrSVP1 (A), CrSVP2 (B), and AtGRF1 (C) were normalized to the NbActin level

determined by real-time RT-PCR. The bars represent SEs (n=6). The relative

expression levels were significantly different from those of the Col-0 plants in each

RNA sample, based on Student’s t test; * indicates P values < 0.05; ** indicates P

values < 0.01. The percentages of miR396 were analyzed using a small RNA northern

blot. The 5S rRNA and tRNAs were used as loading controls. The various

percentages of miR396 are indicated at below the real-time RT-PCR and northern

data.



3

Figure S3. In vivo analysis of miR396-mediated CrSVP1 expression efficiency

through transient expression. Agrobacterium carrying empty vector was used as a

negative control. CrSVP1 was detected via semi-RT-PCR. NbActin was used as an

internal control. The total RNA from 4-dpi agroinfiltrated leaves was analyzed to

detect expression. miR396 was analyzed using a small RNA northern blot. Artificial

miRNA (amiRGFP4) was used as a negative control for the miRNA. The 5S rRNA

and tRNAs were used as loading controls.



4

Figure S4. The detection of different SVP genes in various transgenic plants. (A)

Semi-RT-PCR analysis of the expression levels of various SVP genes in Arabidopsis.

AtUBQ was used as an internal control. The numbers below indicate the relative fold

change in AtSVP expression levels relative to the Col-0 plant (n=2). (B) Real-time

PCR analysis of expression levels of AtSVP gene in flower tissues of Col-0,

atmir396a-1, and AtSVP plants (n=3).



5

Figure S5. Amino acid sequence alignment of AtSVP, CrSVP1, CrSVP2, and

AdSVP2.



6

Figure S6. Degradome analysis of Arabidopsis. Fold change in the number of

degradome reads for AtGRF4 (A), AtGRF7 (C), AtbHLH74 (E), and AtMMG4.7 (G)

in flower buds of Col-0, CrMIR396, xrn4-5 mutant, and SAP54 plants. The fold

change were significantly different from those of the Col-0 plants in each RNA

sample, based on Student’s t test; * indicates P values < 0.01. The degradome patterns

of AtGRF4 (B), AtGRF7 (D), AtbHLH74 (F), and AtMMG4.7 (H) in flower buds of

Col-0, CrMIR396, xrn4-5 mutant, and SAP54 plants.



7

Figure S7. Degradome data regarding the mismatches in the 5'-portion of the miR396

pairwise region. (A) The miR396 target site on AT2G81880. The fold change in the

number of degradome reads for AT2G31880 (B) in flower buds of Col-0, CrMIR396,

xrn4-5 mutant, and SAP54 plants. The fold changes were significantly different from

those of Col-0 plants in each RNA sample, based on Student’s t test; * indicates P

values < 0.01. The degradome patterns of AT2G31880 (C) in flower buds of Col-0,

CrMIR396, xrn4-5 mutant, and SAP54 plants. (D) The comparison of AT2G31880

expression levels between Col-0 and SAP54 plants. The fragments per kilobase of

transcript per million mapped reads (FPKM) value was used to indicate the gene

expression levels that were determined by next-generation sequencing in flower tissue

of Col-0 and SAP54 plants.



8

Table S1. Primers used in this study

Primer name Sequence (5′ to 3′) LP TGATTATGGAATCAATCACGC RP AATTTCCTCCACCCAATTTTG LBb3.1 ATTTTGCCGATTTCGGAAC 51524_F CACCATGGCAAGAGAGAAAATTCA 51524_R TCATCCCGAGTAGGGTAAC 57797_F CACCATGGCGAGGGAGAAGATAA 57797_R TTAAAATGGCAGCCCTAGC 34004-29-F AGGGTTAGTGATATAGAAGG 34004-235-R CACCCCTTTGATCCTGTCCTTAT PamiR-FG CACCTTGATCTGTCGATGGA MamiR TTGACCCGGGATGTACTCCA FG-PHYL1-Pn CACCATGGATCCAAAACTTC RG-PHYL1-Pn CCTTTTAGTTTTTTTCATCA F-AtSVP CACCATGGCGAGAGAAAAGATTCAGA R-AtSVP ACCACCATACGGTAAGCCGAG F-AtGRF1 CACCATGGATCTTGGAGTTC R-AtGRF1-792 GGACACAGCAGCAGCGGTAG MAtSVPm2-118 CGCAGAGAACGGAGAGCTCTTCCGCGCGTTTAAAAAGCCCTC PAtSVPm2-70 CGAAGAAGAGGGCTTTTTAAACGCGCGGAAGAGCTCTCCG F-CrSVP1_B AAAGGCATAATTTACATTCA R-CrSVP1_B GTTTCTCATTTTCTTCCATG F-CrSVP2_B AAAGGCATAATTTACATTCA R-CrSVP2_B GTCGATTTTCTTCCACCAGT F-AtMIR396a CACCTCTTTCTCTATATTACGCTTTTGCCCCT R-AtMIR396a AGTGAGGGGCAAAAGCGTAATATAGAGAAA PAtGRF1-731 CACCGCTGTTCCCGATCAAAAGTACTGT MAtGRF1-817 AGAAGCGGCAGCAGCAGAAGCAGCGGC MAtSVP-129 GACATCGGCGTCGCAGAGAACGGAGAG



9

Table S2. Primers for real-time RT-PCR

Primer name Sequence (5′ to 3′) F-AtSVP469q GGAATGCAATTGATGGATGA R-AtSVP618q TCCTTCCTCGTACACAGCAG F-AtGRF1-1q CCGGACAGATGGAAAGAAAT R-AtGRF1-1q GGCGGCCTCTGTTAATATGT F-AtUBQq CACTTCACTTGGTCTTGCGT R-AtUBQq TATCCTGGATCTTGGCCTTC F-CrSVP1q GCAGGTGATGGAAGTAAGCA R-CrSVP1q GTGCTCCAGCTGAAGAAGAA F-CrSVP2q AAATGGCAAGGATTTGTGGT R-CrSVP2q CGTCGTTATCTGCCATTAGC F-NbACTINq AAACAGCAAAGACCAGCTCA R-NbACTINq GGAATCTCTCAGCACCAATG



10

Table S3. Primers for semi-RT-PCR

Primer name Sequence (5′ to 3′) F-CrSVP1_A ATGGCAAGAGAGAAAATTCA R-CrSVP1_C TCATCCCGAGTAGGGTAACC F-CrSVP2_A ATGGCGAGGGAGAAGATAAA R-CrSVP2_C TTAAAATGGCAGCCCTAGCT F-AtSVP ATGGCGAGAGAAAAGATTCA R-AtSVP CTAACCACCATACGGTAAGC F-AdSVP2 ATGGCGAGAGAGAAGATCAAGA R-AdSVP2 CAAATCCGTCACAAAAGCGTGTC CrUBQc-F AAAGCCAAAATCCAGGACAA CrUBQc-R CCCAGCAAAAATCAAACG NbActin-F1 AAAGACCAGCTCATCCGTGG NbActin-R1 TGTGGTTTCATGAATGCCAG AtUBQ-F1 CACTTCACTTGGTCTTGCGT AtUBQ-R1 TATCCTGGATCTTGGCCTTC



Parsed CitationsBao M, Bian H, Zha Y, Li F, Sun Y, Bai B, Chen Z, Wang J, Zhu M, Han N (2014) miR396a-Mediated basic helix-loop-helixtranscription factor bHLH74 repression acts as a regulator for root growth in Arabidopsis seedlings. Plant Cell Physiol. 55: 1343-1353

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bazzini AA, Lee MT, Giraldez AJ (2012) Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay inzebrafish. Science 336: 233-237


Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR (1993) Control of flower development in Arabidopsis thaliana byAPETALA1 and interacting genes. Development 119: 721-743


Chang TC (2012) Idenification of conserved microRNAs and their targets in PnWB phytoplasma induced leafy flower ofCantharanthus roseus. National Taiwan University


Chorostecki U, Crosa VA, Lodeyro AF, Bologna NG, Martin AP, Carrillo N, Schommer C, Palatnik JF (2012) Identification of newmicroRNA-regulated genes by conserved targeting in plant species. Nucleic Acids Res. 40: 8893-8904


Chung WC, Chen LL, Lo WS, Lin CP, Kuo CH (2013) Comparative analysis of the peanut witches'-broom phytoplasma genomereveals horizontal transfer of potential mobile units and effectors. PLoS One 8: e62770


Debernardi JM, Rodriguez RE, Mecchia MA, Palatnik JF (2012) Functional specialization of the plant miR396 regulatory networkthrough distinct microRNA-target interactions. PLoS Genet. 8


Ditta G, Pinyopich A, Robles P, Pelaz S, Yanofsky MF (2004) The SEP4 gene of Arabidopsis thaliana functions in floral organ andmeristem identity. Curr. Biol. 14: 1935-1940


Djuranovic S, Nahvi A, Green R (2012) miRNA-mediated gene silencing by translational repression followed by mRNAdeadenylation and decay. Science 336: 237-240


Gregis V, Sessa A, Colombo L, Kater MM (2006) AGL24, SHORT VEGETATIVE PHASE, and APETALA1 redundantly controlAGAMOUS during early stages of flower development in Arabidopsis. Plant Cell 18: 1373-1382


Gregis V, Sessa A, Dorca-Fornell C, Kater MM (2009) The Arabidopsis floral meristem identity genes AP1, AGL24 and SVP directlyrepress class B and C floral homeotic genes. Plant J. 60: 626-637


Guo L, Lu Z (2010) The fate of miRNA* strand through evolutionary analysis: implication for degradation as merely carrier strand orpotential regulatory molecule? PLoS One 5: e11387

Hartmann U, Höhmann S, Nettesheim K, Wisman E, Saedler H, Huijser P (2000) Molecular cloning of SVP: a negative regulator ofthe floral transition in Arabidopsis. Plant J. 21: 351-360


Himeno M, Neriya Y, Minato N, Miura C, Sugawara K, Ishii Y, Yamaji Y, Kakizawa S, Oshima K, Namba S (2011) Unique www.plantphysiol.orgon April 11, 2018 - Published by Downloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 55%5BVolume%5D AND 1343%5BPagination%5D AND Bao M%2C Bian H%2C Zha Y%2C Li F%2C Sun Y%2C Bai B%2C Chen Z%2C Wang J%2C Zhu M%2C Han N%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bao M, Bian H, Zha Y, Li F, Sun Y, Bai B, Chen Z, Wang J, Zhu M, Han N (2014) miR396a-Mediated basic helix-loop-helix transcription factor bHLH74 repression acts as a regulator for root growth in Arabidopsis seedlings. Plant Cell Physiol. 55: 1343-1353

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=miR396a-Mediated basic helix-loop-helix transcription factor bHLH74 repression acts as a regulator for root growth in Arabidopsis seedlings&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=miR396a-Mediated basic helix-loop-helix transcription factor bHLH74 repression acts as a regulator for root growth in Arabidopsis seedlings&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bao&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 336%5BVolume%5D AND 233%5BPagination%5D AND Bazzini AA%2C Lee MT%2C Giraldez AJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bazzini AA, Lee MT, Giraldez AJ (2012) Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish. Science 336: 233-237

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bazzini&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in zebrafish&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bazzini&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Development%5BTitle%5D%29 AND 119%5BVolume%5D AND 721%5BPagination%5D AND Bowman JL%2C Alvarez J%2C Weigel D%2C Meyerowitz EM%2C Smyth DR%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR (1993) Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 119: 721-743

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bowman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bowman&as_ylo=1993&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Idenification of conserved microRNAs and their targets in PnWB phytoplasma induced leafy flower of Cantharanthus roseus%2E%5BTitle%5D%29 AND Chang TC%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chang TC (2012) Idenification of conserved microRNAs and their targets in PnWB phytoplasma induced leafy flower of Cantharanthus roseus. National Taiwan University

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Idenification of conserved microRNAs and their targets in PnWB phytoplasma induced leafy flower of Cantharanthus roseus.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Idenification of conserved microRNAs and their targets in PnWB phytoplasma induced leafy flower of Cantharanthus roseus.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nucleic Acids Res%5BTitle%5D%29 AND 40%5BVolume%5D AND 8893%5BPagination%5D AND Chorostecki U%2C Crosa VA%2C Lodeyro AF%2C Bologna NG%2C Martin AP%2C Carrillo N%2C Schommer C%2C Palatnik JF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chorostecki U, Crosa VA, Lodeyro AF, Bologna NG, Martin AP, Carrillo N, Schommer C, Palatnik JF (2012) Identification of new microRNA-regulated genes by conserved targeting in plant species. Nucleic Acids Res. 40: 8893-8904

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chorostecki&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of new microRNA-regulated genes by conserved targeting in plant species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of new microRNA-regulated genes by conserved targeting in plant species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chorostecki&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Comparative analysis of the peanut witches%27%2Dbroom phytoplasma genome reveals horizontal transfer of potential mobile units and effectors%2E%5BTitle%5D%29 AND Chung WC%2C Chen LL%2C Lo WS%2C Lin CP%2C Kuo CH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chung WC, Chen LL, Lo WS, Lin CP, Kuo CH (2013) Comparative analysis of the peanut witches'-broom phytoplasma genome reveals horizontal transfer of potential mobile units and effectors. PLoS One 8: e62770

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chung&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative analysis of the peanut witches'-broom phytoplasma genome reveals horizontal transfer of potential mobile units and effectors.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative analysis of the peanut witches'-broom phytoplasma genome reveals horizontal transfer of potential mobile units and effectors.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chung&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Functional specialization of the plant miR396 regulatory network through distinct microRNA%2Dtarget interactions%2E%5BTitle%5D%29 AND Debernardi JM%2C Rodriguez RE%2C Mecchia MA%2C Palatnik JF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Debernardi JM, Rodriguez RE, Mecchia MA, Palatnik JF (2012) Functional specialization of the plant miR396 regulatory network through distinct microRNA-target interactions. PLoS Genet. 8

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Debernardi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Functional specialization of the plant miR396 regulatory network through distinct microRNA-target interactions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Functional specialization of the plant miR396 regulatory network through distinct microRNA-target interactions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Debernardi&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr%2E Biol%5BTitle%5D%29 AND 14%5BVolume%5D AND 1935%5BPagination%5D AND Ditta G%2C Pinyopich A%2C Robles P%2C Pelaz S%2C Yanofsky MF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ditta G, Pinyopich A, Robles P, Pelaz S, Yanofsky MF (2004) The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity. Curr. Biol. 14: 1935-1940

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ditta&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The SEP4 gene of Arabidopsis thaliana functions in floral organ and meristem identity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ditta&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Science%5BTitle%5D%29 AND 336%5BVolume%5D AND 237%5BPagination%5D AND Djuranovic S%2C Nahvi A%2C Green R%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Djuranovic S, Nahvi A, Green R (2012) miRNA-mediated gene silencing by translational repression followed by mRNA deadenylation and decay. Science 336: 237-240

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Djuranovic&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=miRNA-mediated gene silencing by translational repression followed by mRNA deadenylation and decay&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=miRNA-mediated gene silencing by translational repression followed by mRNA deadenylation and decay&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Djuranovic&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28AGL%5BTitle%5D%29 AND 24%5BVolume%5D AND SHORT VEGETATIVE PHASE%2C and APETALA1 redundantly control AGAMOUS during early stages of flower development in Arabidopsis%2E Plant Cell 18%3A 1373%5BPagination%5D AND Gregis V%2C Sessa A%2C Colombo L%2C Kater MM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gregis V, Sessa A, Colombo L, Kater MM (2006) AGL24, SHORT VEGETATIVE PHASE, and APETALA1 redundantly control AGAMOUS during early stages of flower development in Arabidopsis. Plant Cell 18: 1373-1382

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gregis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gregis&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28The%5BTitle%5D%29 AND 1%5BVolume%5D AND AGL24 and SVP directly repress class B and C floral homeotic genes%2E Plant J%2E 60%3A 626%5BPagination%5D AND Gregis V%2C Sessa A%2C Dorca%2DFornell C%2C Kater MM%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Gregis V, Sessa A, Dorca-Fornell C, Kater MM (2009) The Arabidopsis floral meristem identity genes AP1, AGL24 and SVP directly repress class B and C floral homeotic genes. Plant J. 60: 626-637

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gregis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gregis&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 21%5BVolume%5D AND 351%5BPagination%5D AND Hartmann U%2C H�hmann S%2C Nettesheim K%2C Wisman E%2C Saedler H%2C Huijser P%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hartmann U, H�hmann S, Nettesheim K, Wisman E, Saedler H, Huijser P (2000) Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis. Plant J. 21: 351-360

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hartmann&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular cloning of SVP: a negative regulator of the floral transition in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hartmann&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1


morphological changes in plant pathogenic phytoplasma-infected petunia flowers are related to transcriptional regulation of floralhomeotic genes in an organ-specific manner. Plant J. 67: 971-979


Irish VF (2010) The flowering of Arabidopsis flower development. Plant J. 61: 1014-1028Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Jang S, Torti S, Coupland G (2009) Genetic and spatial interactions between FT, TSF and SVP during the early stages of floralinduction in Arabidopsis. Plant J. 60: 614-625


Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14: 787-799


Kidner CA, Martienssen RA (2005) The developmental role of microRNA in plants. Curr. Opin. Plant Biol. 8: 38-44Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee IM, Davis RE, Gundersen-Rindal DE (2000) Phytoplasma: phytopathogenic mollicutes. Annu. Rev. Microbiol. 54: 221-255Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee JH, Park SH, Lee JS, Ahn JH (2007) A conserved role of SHORT VEGETATIVE PHASE (SVP) in controlling flowering time ofBrassica plants. Biochim. Biophys. Acta. 1769: 455-461


Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, Ahn JH (2007) Role of SVP in the control of flowering time by ambient temperature inArabidopsis. Genes Dev. 21: 397-402


Li D, Liu C, Shen L, Wu Y, Chen H, Robertson M, Helliwell CA, Ito T, Meyerowitz E, Yu H (2008) A repressor complex governs theintegration of flowering signals in Arabidopsis. Dev. Cell 15: 110-120


Li S, Liu L, Zhuang X, Yu Y, Liu X, Cui X, Ji L, Pan Z, Cao X, Mo B, Zhang F, Raikhel N, Jiang L, Chen X (2013) MicroRNAs inhibit thetranslation of target mRNAs on the endoplasmic reticulum in Arabidopsis. Cell 153: 562-574


Liang G, He H, Li Y, Wang F, Yu D (2014) Molecular mechanism of microRNA396 mediating pistil development in Arabidopsis. PlantPhysiol. 164: 249-258


Lin SS, Wu HW, Elena SF, Chen KC, Niu QW, Yeh SD, Chen CC, Chua NH (2009) Molecular evolution of a viral non-codingsequence under the selective pressure of amiRNA-mediated silencing. PLoS Pathog. 5: e1000312


Lin YY, Fang MM, Lin PC, Chiu MT, Liu LY, Lin CP, Lin SS (2013) Improving initial infectivity of the Turnip mosaic virus (TuMV)infectious clone by an mini binary vector via agro-infiltration. Bot. Stud. 54: 22


Liu LY, Tseng HI, Lin CP, Lin YY, Huang YH, Huang CK, Chang TH, Lin SS (2014) High-throughput transcriptome analysis of theleafy flower transition of Catharanthus roseus induced by peanut witches'-broom phytoplasma infection. Plant Cell Physiol. 55: 942-957

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon April 11, 2018 - Published by Downloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 67%5BVolume%5D AND 971%5BPagination%5D AND Himeno M%2C Neriya Y%2C Minato N%2C Miura C%2C Sugawara K%2C Ishii Y%2C Yamaji Y%2C Kakizawa S%2C Oshima K%2C Namba S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Himeno M, Neriya Y, Minato N, Miura C, Sugawara K, Ishii Y, Yamaji Y, Kakizawa S, Oshima K, Namba S (2011) Unique morphological changes in plant pathogenic phytoplasma-infected petunia flowers are related to transcriptional regulation of floral homeotic genes in an organ-specific manner. Plant J. 67: 971-979

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Himeno&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Unique morphological changes in plant pathogenic phytoplasma-infected petunia flowers are related to transcriptional regulation of floral homeotic genes in an organ-specific manner&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Unique morphological changes in plant pathogenic phytoplasma-infected petunia flowers are related to transcriptional regulation of floral homeotic genes in an organ-specific manner&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Himeno&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 61%5BVolume%5D AND 1014%5BPagination%5D AND Irish VF%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Irish VF (2010) The flowering of Arabidopsis flower development. Plant J. 61: 1014-1028

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Irish&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The flowering of Arabidopsis flower development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The flowering of Arabidopsis flower development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Irish&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 60%5BVolume%5D AND 614%5BPagination%5D AND Jang S%2C Torti S%2C Coupland G%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jang S, Torti S, Coupland G (2009) Genetic and spatial interactions between FT, TSF and SVP during the early stages of floral induction in Arabidopsis. Plant J. 60: 614-625

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic and spatial interactions between FT, TSF and SVP during the early stages of floral induction in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic and spatial interactions between FT, TSF and SVP during the early stages of floral induction in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jang&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Mol%2E Cell%5BTitle%5D%29 AND 14%5BVolume%5D AND 787%5BPagination%5D AND Jones%2DRhoades MW%2C Bartel DP%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol. Cell 14: 787-799

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jones-Rhoades&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Computational identification of plant microRNAs and their targets, including a stress-induced miRNA&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Computational identification of plant microRNAs and their targets, including a stress-induced miRNA&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jones-Rhoades&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Curr%2E Opin%2E Plant Biol%5BTitle%5D%29 AND 8%5BVolume%5D AND 38%5BPagination%5D AND Kidner CA%2C Martienssen RA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kidner CA, Martienssen RA (2005) The developmental role of microRNA in plants. Curr. Opin. Plant Biol. 8: 38-44

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kidner&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The developmental role of microRNA in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The developmental role of microRNA in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kidner&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annu%2E Rev%2E Microbiol%5BTitle%5D%29 AND 54%5BVolume%5D AND 221%5BPagination%5D AND Lee IM%2C Davis RE%2C Gundersen%2DRindal DE%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee IM, Davis RE, Gundersen-Rindal DE (2000) Phytoplasma: phytopathogenic mollicutes. Annu. Rev. Microbiol. 54: 221-255

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma: phytopathogenic mollicutes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma: phytopathogenic mollicutes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Biochim%2E Biophys%2E Acta%5BTitle%5D%29 AND 1769%5BVolume%5D AND 455%5BPagination%5D AND Lee JH%2C Park SH%2C Lee JS%2C Ahn JH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee JH, Park SH, Lee JS, Ahn JH (2007) A conserved role of SHORT VEGETATIVE PHASE (SVP) in controlling flowering time of Brassica plants. Biochim. Biophys. Acta. 1769: 455-461


http://scholar.google.com/scholar?as_q=A conserved role of SHORT VEGETATIVE PHASE (SVP) in controlling flowering time of Brassica plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A conserved role of SHORT VEGETATIVE PHASE (SVP) in controlling flowering time of Brassica plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genes Dev%5BTitle%5D%29 AND 21%5BVolume%5D AND 397%5BPagination%5D AND Lee JH%2C Yoo SJ%2C Park SH%2C Hwang I%2C Lee JS%2C Ahn JH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee JH, Yoo SJ, Park SH, Hwang I, Lee JS, Ahn JH (2007) Role of SVP in the control of flowering time by ambient temperature in Arabidopsis. Genes Dev. 21: 397-402


http://scholar.google.com/scholar?as_q=Role of SVP in the control of flowering time by ambient temperature in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Role of SVP in the control of flowering time by ambient temperature in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Dev%2E Cell%5BTitle%5D%29 AND 15%5BVolume%5D AND 110%5BPagination%5D AND Li D%2C Liu C%2C Shen L%2C Wu Y%2C Chen H%2C Robertson M%2C Helliwell CA%2C Ito T%2C Meyerowitz E%2C Yu H%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li D, Liu C, Shen L, Wu Y, Chen H, Robertson M, Helliwell CA, Ito T, Meyerowitz E, Yu H (2008) A repressor complex governs the integration of flowering signals in Arabidopsis. Dev. Cell 15: 110-120

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A repressor complex governs the integration of flowering signals in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A repressor complex governs the integration of flowering signals in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell%5BTitle%5D%29 AND 153%5BVolume%5D AND 562%5BPagination%5D AND Li S%2C Liu L%2C Zhuang X%2C Yu Y%2C Liu X%2C Cui X%2C Ji L%2C Pan Z%2C Cao X%2C Mo B%2C Zhang F%2C Raikhel N%2C Jiang L%2C Chen X%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Li S, Liu L, Zhuang X, Yu Y, Liu X, Cui X, Ji L, Pan Z, Cao X, Mo B, Zhang F, Raikhel N, Jiang L, Chen X (2013) MicroRNAs inhibit the translation of target mRNAs on the endoplasmic reticulum in Arabidopsis. Cell 153: 562-574

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MicroRNAs inhibit the translation of target mRNAs on the endoplasmic reticulum in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MicroRNAs inhibit the translation of target mRNAs on the endoplasmic reticulum in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 164%5BVolume%5D AND 249%5BPagination%5D AND Liang G%2C He H%2C Li Y%2C Wang F%2C Yu D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Liang G, He H, Li Y, Wang F, Yu D (2014) Molecular mechanism of microRNA396 mediating pistil development in Arabidopsis. Plant Physiol. 164: 249-258

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular mechanism of microRNA396 mediating pistil development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular mechanism of microRNA396 mediating pistil development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Molecular evolution of a viral non%2Dcoding sequence under the selective pressure of amiRNA%2Dmediated silencing%2E%5BTitle%5D%29 AND Lin SS%2C Wu HW%2C Elena SF%2C Chen KC%2C Niu QW%2C Yeh SD%2C Chen CC%2C Chua NH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lin SS, Wu HW, Elena SF, Chen KC, Niu QW, Yeh SD, Chen CC, Chua NH (2009) Molecular evolution of a viral non-coding sequence under the selective pressure of amiRNA-mediated silencing. PLoS Pathog. 5: e1000312

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular evolution of a viral non-coding sequence under the selective pressure of amiRNA-mediated silencing.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular evolution of a viral non-coding sequence under the selective pressure of amiRNA-mediated silencing.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lin&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Improving initial infectivity of the Turnip mosaic virus TuMV infectious clone by an mini binary vector via agro%2Dinfiltration%2E%5BTitle%5D%29 AND Lin YY%2C Fang MM%2C Lin PC%2C Chiu MT%2C Liu LY%2C Lin CP%2C Lin SS%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lin YY, Fang MM, Lin PC, Chiu MT, Liu LY, Lin CP, Lin SS (2013) Improving initial infectivity of the Turnip mosaic virus (TuMV) infectious clone by an mini binary vector via agro-infiltration. Bot. Stud. 54: 22

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Improving initial infectivity of the Turnip mosaic virus (TuMV) infectious clone by an mini binary vector via agro-infiltration.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Improving initial infectivity of the Turnip mosaic virus (TuMV) infectious clone by an mini binary vector via agro-infiltration.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lin&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell Physiol%5BTitle%5D%29 AND 55%5BVolume%5D AND 942%5BPagination%5D AND Liu LY%2C Tseng HI%2C Lin CP%2C Lin YY%2C Huang YH%2C Huang CK%2C Chang TH%2C Lin SS%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Liu LY, Tseng HI, Lin CP, Lin YY, Huang YH, Huang CK, Chang TH, Lin SS (2014) High-throughput transcriptome analysis of the leafy flower transition of Catharanthus roseus induced by peanut witches'-broom phytoplasma infection. Plant Cell Physiol. 55: 942-957

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=High-throughput transcriptome analysis of the leafy flower transition of Catharanthus roseus induced by peanut witches'-broom phytoplasma infection&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=High-throughput transcriptome analysis of the leafy flower transition of Catharanthus roseus induced by peanut witches'-broom phytoplasma infection&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1


MacLean AM, Orlovskis Z, Kowitwanich K, Zdziarska AM, Angenent GC, Immink RG, Hogenhout SA (2014) Phytoplasma effectorSAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependentmanner. PLoS Biol. 12: e1001835


MacLean AM, Sugio A, Makarova OV, Findlay KC, Grieve VM, Tóth R, Nicolaisen M, Hogenhout SA (2011) Phytoplasma effectorSAP54 induces indeterminate leaf-like flower development in Arabidopsis plants. Plant Physiol. 157: 831-841


Maejima K, Iwai R, Himeno M, Komatsu K, Kitazawa Y, Fujita N, Ishikawa K, Fukuoka M, Minato N, Yamaji Y, Oshima K, Namba S(2014) Recognition of floral homeotic MADS domain transcription factors by a phytoplasmal effector, phyllogen, induces phyllody.Plant J. 78: 541-554


Mallory AC, Reinhart BJ, Jones-Rhoades MW, Tang G, Zamore PD, Barton MK, Bartel DP (2004) MicroRNA control of PHABULOSAin leaf development: importance of pairing to the microRNA 5' region. EMBO J. 23: 3356-3364


Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel D (2005) Specific effects of microRNAs on the planttranscriptome. Dev. Cell 8: 517-527


Stefani G, Slack FJ (2008) Small non-coding RNAs in animal development. Nat. Rev. Mol. Cell Biol. 9: 219-230Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sugio A, MacLean AM, Kingdom HN, Grieve VM, Manimekalai R, Hogenhout SA (2011) Diverse targets of phytoplasma effectors:from plant development to defense against insects. Annu. Rev. Phytopathol. 49: 175-195


Sunkar R, Kapoor A, Zhu JK (2006) Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis ismediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell 18: 2051-2065


Trevaskis B, Tadege M, Hemming MN, Peacock WJ, Dennis ES, Sheldon C (2007) Short vegetative phase-like MADS-box genesinhibit floral meristem identity in barley. Plant Physiol. 143: 225-235


Voinnet O (2009) Origin, biogenesis, and activity of plant microRNAs. Cell 136: 669-687Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wang CN, Chen YJ, Chang YC, Wu CH (2008) A step-by-step optimization guide for applying tissue specific RNA in-situhybridization to non-model plant species. Taiwania 53: 383-393


Wang XJ, Reyes JL, Chua NH, Gaasterland T (2004) Prediction and identification of Arabidopsis thaliana microRNAs and theirmRNA targets. Genome Biol. 5: R65


Wu RM, Walton EF, Richardson AC, Wood M, Hellens RP, Varkonyi-Gasic E (2012) Conservation and divergence of four kiwifruitSVP-like MADS-box genes suggest distinct roles in kiwifruit bud dormancy and flowering. J. Exp. Bot. 63: 797-807


Yang IL (1985) Host responses of peanut witches' broom disease. J. Agric. Res. China 34: 464-468 www.plantphysiol.orgon April 11, 2018 - Published by Downloaded from


http://www.ncbi.nlm.nih.gov/pubmed?term=%28Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS%2Dbox proteins and promotes insect colonization in a RAD23%2Ddependent manner%2E%5BTitle%5D%29 AND MacLean AM%2C Orlovskis Z%2C Kowitwanich K%2C Zdziarska AM%2C Angenent GC%2C Immink RG%2C Hogenhout SA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=MacLean AM, Orlovskis Z, Kowitwanich K, Zdziarska AM, Angenent GC, Immink RG, Hogenhout SA (2014) Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependent manner. PLoS Biol. 12: e1001835

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=MacLean&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependent manner.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma effector SAP54 hijacks plant reproduction by degrading MADS-box proteins and promotes insect colonization in a RAD23-dependent manner.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=MacLean&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 157%5BVolume%5D AND 831%5BPagination%5D AND MacLean AM%2C Sugio A%2C Makarova OV%2C Findlay KC%2C Grieve VM%2C T�th R%2C Nicolaisen M%2C Hogenhout SA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=MacLean AM, Sugio A, Makarova OV, Findlay KC, Grieve VM, T�th R, Nicolaisen M, Hogenhout SA (2011) Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants. Plant Physiol. 157: 831-841

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=MacLean&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Phytoplasma effector SAP54 induces indeterminate leaf-like flower development in Arabidopsis plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=MacLean&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant J%5BTitle%5D%29 AND 78%5BVolume%5D AND 541%5BPagination%5D AND Maejima K%2C Iwai R%2C Himeno M%2C Komatsu K%2C Kitazawa Y%2C Fujita N%2C Ishikawa K%2C Fukuoka M%2C Minato N%2C Yamaji Y%2C Oshima K%2C Namba S%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Maejima K, Iwai R, Himeno M, Komatsu K, Kitazawa Y, Fujita N, Ishikawa K, Fukuoka M, Minato N, Yamaji Y, Oshima K, Namba S (2014) Recognition of floral homeotic MADS domain transcription factors by a phytoplasmal effector, phyllogen, induces phyllody. Plant J. 78: 541-554

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Maejima&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Recognition of floral homeotic MADS domain transcription factors by a phytoplasmal effector, phyllogen, induces phyllody&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Recognition of floral homeotic MADS domain transcription factors by a phytoplasmal effector, phyllogen, induces phyllody&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Maejima&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28EMBO J%5BTitle%5D%29 AND 23%5BVolume%5D AND 3356%5BPagination%5D AND Mallory AC%2C Reinhart BJ%2C Jones%2DRhoades MW%2C Tang G%2C Zamore PD%2C Barton MK%2C Bartel DP%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mallory AC, Reinhart BJ, Jones-Rhoades MW, Tang G, Zamore PD, Barton MK, Bartel DP (2004) MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5' region. EMBO J. 23: 3356-3364

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mallory&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5' region&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5' region&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mallory&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Dev%2E Cell%5BTitle%5D%29 AND 8%5BVolume%5D AND 517%5BPagination%5D AND Schwab R%2C Palatnik JF%2C Riester M%2C Schommer C%2C Schmid M%2C Weigel D%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schwab R, Palatnik JF, Riester M, Schommer C, Schmid M, Weigel D (2005) Specific effects of microRNAs on the plant transcriptome. Dev. Cell 8: 517-527

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schwab&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Specific effects of microRNAs on the plant transcriptome&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Specific effects of microRNAs on the plant transcriptome&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schwab&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat%2E Rev%2E Mol%2E Cell Biol%5BTitle%5D%29 AND 9%5BVolume%5D AND 219%5BPagination%5D AND Stefani G%2C Slack FJ%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Stefani G, Slack FJ (2008) Small non-coding RNAs in animal development. Nat. Rev. Mol. Cell Biol. 9: 219-230

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stefani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Small non-coding RNAs in animal development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Small non-coding RNAs in animal development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stefani&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Annu%2E Rev%2E Phytopathol%5BTitle%5D%29 AND 49%5BVolume%5D AND 175%5BPagination%5D AND Sugio A%2C MacLean AM%2C Kingdom HN%2C Grieve VM%2C Manimekalai R%2C Hogenhout SA%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sugio A, MacLean AM, Kingdom HN, Grieve VM, Manimekalai R, Hogenhout SA (2011) Diverse targets of phytoplasma effectors: from plant development to defense against insects. Annu. Rev. Phytopathol. 49: 175-195

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sugio&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Diverse targets of phytoplasma effectors: from plant development to defense against insects&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Diverse targets of phytoplasma effectors: from plant development to defense against insects&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sugio&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Cell%5BTitle%5D%29 AND 18%5BVolume%5D AND 2051%5BPagination%5D AND Sunkar R%2C Kapoor A%2C Zhu JK%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sunkar R, Kapoor A, Zhu JK (2006) Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell 18: 2051-2065

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sunkar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sunkar&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Plant Physiol%5BTitle%5D%29 AND 143%5BVolume%5D AND 225%5BPagination%5D AND Trevaskis B%2C Tadege M%2C Hemming MN%2C Peacock WJ%2C Dennis ES%2C Sheldon C%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Trevaskis B, Tadege M, Hemming MN, Peacock WJ, Dennis ES, Sheldon C (2007) Short vegetative phase-like MADS-box genes inhibit floral meristem identity in barley. Plant Physiol. 143: 225-235

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Trevaskis&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Short vegetative phase-like MADS-box genes inhibit floral meristem identity in barley&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Short vegetative phase-like MADS-box genes inhibit floral meristem identity in barley&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Trevaskis&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Cell%5BTitle%5D%29 AND 136%5BVolume%5D AND 669%5BPagination%5D AND Voinnet O%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Voinnet O (2009) Origin, biogenesis, and activity of plant microRNAs. Cell 136: 669-687

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Voinnet&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Origin, biogenesis, and activity of plant microRNAs&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Origin, biogenesis, and activity of plant microRNAs&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Voinnet&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Taiwania%5BTitle%5D%29 AND 53%5BVolume%5D AND 383%5BPagination%5D AND Wang CN%2C Chen YJ%2C Chang YC%2C Wu CH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang CN, Chen YJ, Chang YC, Wu CH (2008) A step-by-step optimization guide for applying tissue specific RNA in-situ hybridization to non-model plant species. Taiwania 53: 383-393

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A step-by-step optimization guide for applying tissue specific RNA in-situ hybridization to non-model plant species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A step-by-step optimization guide for applying tissue specific RNA in-situ hybridization to non-model plant species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets%2E%5BTitle%5D%29 AND Wang XJ%2C Reyes JL%2C Chua NH%2C Gaasterland T%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang XJ, Reyes JL, Chua NH, Gaasterland T (2004) Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets. Genome Biol. 5: R65

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Exp%2E Bot%5BTitle%5D%29 AND 63%5BVolume%5D AND 797%5BPagination%5D AND Wu RM%2C Walton EF%2C Richardson AC%2C Wood M%2C Hellens RP%2C Varkonyi%2DGasic E%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wu RM, Walton EF, Richardson AC, Wood M, Hellens RP, Varkonyi-Gasic E (2012) Conservation and divergence of four kiwifruit SVP-like MADS-box genes suggest distinct roles in kiwifruit bud dormancy and flowering. J. Exp. Bot. 63: 797-807

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Conservation and divergence of four kiwifruit SVP-like MADS-box genes suggest distinct roles in kiwifruit bud dormancy and flowering&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Conservation and divergence of four kiwifruit SVP-like MADS-box genes suggest distinct roles in kiwifruit bud dormancy and flowering&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wu&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1



Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3degradation. Genes Dev. 19: 1532-1543


Zhang X, Henriques R, Lin SS, Niu QW, Chua NH (2006) Agrobacterium-mediated transformation of Arabidopsis thaliana using thefloral dip method. Nat. Protoc. 1: 641-646



http://www.ncbi.nlm.nih.gov/pubmed?term=%28J%2E Agric%2E Res%2E China%5BTitle%5D%29 AND 34%5BVolume%5D AND 464%5BPagination%5D AND Yang IL%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Yang IL (1985) Host responses of peanut witches' broom disease. J. Agric. Res. China 34: 464-468

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Host responses of peanut witches' broom disease&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Host responses of peanut witches' broom disease&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=1985&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Genes Dev%5BTitle%5D%29 AND 19%5BVolume%5D AND 1532%5BPagination%5D AND Zhang X%2C Garreton V%2C Chua NH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang X, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation. Genes Dev. 19: 1532-1543

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The AIP2 E3 ligase acts as a novel negative regulator of ABA signaling by promoting ABI3 degradation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=%28Nat%2E Protoc%5BTitle%5D%29 AND 1%5BVolume%5D AND 641%5BPagination%5D AND Zhang X%2C Henriques R%2C Lin SS%2C Niu QW%2C Chua NH%5BAuthor%5D&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang X, Henriques R, Lin SS, Niu QW, Chua NH (2006) Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1: 641-646

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1


mir396-targeted short vegetative phase is required to

Documents