1

Phenotypic and genotypic characterization of some virulence factors in Pseudomonas aeruginosa strains isolated from

different clinical sources in Mansoura University Hospitals.

Dina Eid, , Wael El-Naggar, Rasha Barwa. and Mohammed A. El-Sokkary.

Microbiology Department, Faculty of Pharmacy, Mansoura University, Egypt.

Abstract The present study aims to determine the extent of production of some

virulence factors and antimicrobial resistance of P. aeruginosa isolated from different clinical sources in Mansoura University Hospitals. In addition, this research was done to characterize five bacterial genes that encode virulence determinants on both chromosomal and plasmid DNA using PCR technique.

Ninety eight isolates of P. aeruginosa from diverse clinical sources were employed. . Isolates were mainly recovered from endotracheal tube parts, urine, burns and wounds. In this study, the susceptibility to 10 antimicrobials was determined and analyzed among isolates. The antimicrobial susceptibility test showed that amikacin and imipenem were the most active antibiotics against tested isolates. All isolates were resistant to amoxicillin- clavulanic acid, cefadroxil, cefotaxime and cefepime, they manifested different degrees of sensitivity to the rest antimicrobials.

The phenotypic detection of virulence factors revealed that pyocyanin was produced by all isolates, but higher amounts were produced by urine isolates. High percent of haemolysis was manifested by 77% of isolates, where urine and burn isolates exhibited higher hemolysis percent. Regarding total protease and staphylolytic activity, 82% of isolates were positive protease producers where higher protease and staphylolysis activity were noticed among blood and endotracheal isolates. Most of isolates (92.8%) were positive lipase producers and both wound and endotracheal isolates were shown to have higher production levels. Strong biofilm formation was observed for 18% of isolates and the highest level of biofilm production was noticed for endotracheal isolates as twelve out of twenty six gave OD >0.2. For genotypic detection, it was observed that among the fifty tested isolates, 100% were positive for toxA, aprA and lasB genes. A high percentage constituting of 74% and 94% were positive for exoS and exoU genes respectively. Plasmid extraction showed that 93% of tested isolates contained plasmids and the tested virulence genes were harbored by most of them (toxA, lasB and

2

exoU genes were carried by 92% of tested isolates while aprA and exoS genes were carried by 84.6% and 61.5% respectively).

The present study confirmed previous observations that the virulence of P. aeruginosa is multifactorial and resistance to antimicrobials was not generally associated with the level of production of the pathogenicity factors. Plasmid studies confirmed their crucial role in the horizontal transfer of virulence.

Introduction: Pseudomonas aeruginosa is an opportunistic pathogen that causes

severe infections in cystic fibrosis patients, burn patients, and immunocompromized hosts. The reason for this bacterium to have such a wide range of attacking mode is due to the presence of several virulence factors. Virulence of P. aeruginosa is multifactorial and has been attributed to cell-associated factors like alginate, lipopolysaccharide , flagellum, pilus and non-pilus adhesins as well as with exoenzymes or different virulence factors like proteases, pyocyanin, exotoxin A, exoenzyme S, hemolysins (rhamnolipids and phospholipase C) and siderophores (Mittal et al., 2009).

Pyocyanin is the principal phenazine produced by P. aeruginosa and it has been shown to contribute to the unusual persistence of P. aeruginosa infections. Pyocyanin toxicity is largely due to its ability to engage in oxidation-reduction reactions that deplete cells of NADH, glutathione, and other antioxidants. The redox activity of pyocyanin generates oxidants such as superoxide and peroxides (Parsons et al., 2008).

Two hemolysins, phospholipase C and rhamnolipid, produced by P. aeruginosa, synergistically act to break down lipids and lecithin. Both may contribute to tissue invasion by their cytotoxic effects (Van Delden and Iglewski, 1998).

P. aeruginosa secretes several proteases; including lasB elastase, lasA elastase and alkaline protease; that play a role in the pathogenic interaction between bacterium and host. LasB elastase is a zinc metalloprotease that acts on a number of proteins including elastin. LasB elastase is highly efficient, with a proteolytic activity approximately 10 times that of P. aeruginosa alkaline protease and an activity toward casein approximately four times that of trypsin (Galloway, 1991).

Elastase A (LasA), also known as staphylolysin, is a zinc metalloprotease that has both low elastolytic and high staphylolytic activities (Kessler et al., 1997).

The alkaline protease (AprA), also known as aeruginolysin, is one of the secreted zinc-dependent metallo-endopeptidase of P. aeruginosa. It

3

was shown that AprA cleaves a large number of physiological substrates in vitro such as fibrin, fibrinogen, different complement factors, especially C3 (Matsumoto, 2004).

The capacity of P. aeruginosa to form biofilms is an important requirement for chronic colonization of human tissues and for persistence in implanted medical devices. These microbial communities then develop unique characteristics and properties that protect them from external influences, most significant of which is the enhanced resistance of bacteria within the biofilm to antibiot ics and host defenses (Mah and O’Toole, 2001).

Pseudomonas exotoxin A is the most toxic substance in P. aeruginosa (Liu, 1974). It belongs to a family of enzymes termed mono-ADP-ribosyltranferases, Its importance for the toxicity of the bacterium became apparent in the study by Iglewski and Kabat (1975). They discovered that exotoxin A catalyzes the ADP ribosylation of the eukaryotic elongation factor 2 (eEF-2), leading to inhibition of protein synthesis and cell death (Wolf and Elsasser-Beile, 2009).

The type III secretion system (TTSS) of P. aeruginosa is a complex pilus-like struc-ture allowing the translocation of effector proteins from the bacteria, across the bacterial membranes and into the eukaryotic cytoplasm through a needle-like appendage forming a pore in the eukaryotic membrane. There are four known toxins, variably expressed in different strains and isolates of P. aeruginosa: ExoY, ExoS, ExoT and ExoU.

ExoS is a bifunctional cytotoxin with two active domains, a C-terminal ADP-ribosyltranferase domain and an N-terminal GTPase-activating protein (GAP) domain. The pathogenic role of ExoS is mainly attributable to the ADP-ribosyltranferase activity leading to disruption of normal cytoskeletal organization, although GAP activity also plays a similar role (Kipnis et al., 2006).

ExoU possesses phospholipase A2-like activity with broad substrate specificity (Sitkiewicz et al., 2007). The extensive tissue destruction induced by ExoU combined with the modulation of the host inflammatory response, particularly its ability to induce localized immunosuppression, probably explains its prominent role in the pathogenesis of severe acute P. aeruginosa infections (Engel and Balachandran, 2009).

The present study aimed to detect phenotypically some virulence factors and determine whether the level of virulence factors produced by P. aeruginosa varied within the type of infection and resistance to antimicrobials. Moreover, genotypic detection of some other virulence determinants on both chromosomal and plasmid DNA was also performed.

4

Materials and Methods I- Clinical strains: Ninety eight clinical P. aeruginosa strains were recovered from endotracheal tube part and aspirate (26 isolates), urinary tract infections (18 isolates), burns (16 isolates) , wound (13 isolates), blood (6 isolates), ear swabs (5 isolates), sputum (5 isolates), cerebrospinal fluid (3 isolates) and others (3 isolates) from patients in Mansoura University Hospitals (MUH), Mansoura, Dakahlia governorate, Egypt. The specimens were immediately processed using standard procedures according to Blair et al. (1970) and were identified according to Sutter (1968) and Govan (1996). II- Antimicrobial susceptibility testing: All isolates were screened for susceptibility to ten antimicrobial discs namely; amikacin (30 µg), gentamicin (10 µg), amoxicillin/clavulanic acid (30 µg), cefotaxime (30 µg), cefadroxil (30 µg), cefepime (30 µg), levofloxacin (5 µg), ofloxacin (5 µg), imipinem (10 µg) and azithromycin (15 µg) using the standard disc diffusion method of NCCLS (2003) All discs were supplied from Bioanalyse Company, Turkey. III- Phenotypic detection of virulence factors: 1) Pyocyanin assay:

Pyocyanin was removed from the supernatant fraction of P. aeruginosa isolates grown in King’s A liquid medium for 24 hrs (King et al., 1954). A five ml volume of supernatant was mixed with a 3 ml chloroform layer. A volume of 1 ml of 0.2 M HCl was added to this layer and the pyocyanin-rich organic layer was extracted. The amount of pyocyanin within the collected sample layer was determined through measuring the absorbance at 520 nm. Microgram quantities of pyocyanin were calculated by multiplying the absorbance at 520 nm by 17.072 (Ralli et al., 2005).

2) Hemolysin assay: Cells were grown in nutrient broth for about 48 hrs at 28°C with shaking and the enzymatic activity of the culture supernatant was assessed. Human erythrocytes were washed 3X with saline and resuspended in 10 mM Tris HCl (pH 7.4)-160 mM NaCl (hemolysin assay buffer) to a final concentration of 2% (v/ v). A volume of 600 µl of a 2% suspension of erythrocytes was combined with 600 µl of supernatant and this mixture was incubated for 2 hr at 37°C. Control experiments for spontaneous lysis or complete lysis were carried out without hemolysin and with 0.2% sodium dodecyl sulfate, respectively. The suspension was centrifuged at

5

10,000 rpm for 8 min at 4°C, and released hemoglobin was assessed by determining absorbance at 540 nm. The percentage (%) of cells lysed was calculated as follows: % = [(X-B)/ (T-B)] × 100 where B (baseline) is a negative control consisting of 600 µl nutrient broth and 600 µl of a 2% suspension of erythrocytes, T is a positive control corresponding to the total lysis and X is absorbance of tested sample (Nakazawa et al., 1987 and Rossignol et al., 2008). 3) Proteases enzymes studies a- Screening for proteases activity:

Protease producing strains were detected by inoculating 5% skimmed milk agar plates with the isolates. After incubation for 24 hrs at 37oC, Proteolysis was shown as a clear zone around the growth (Sokol et al., 1979). b- Total proteases assay

The method of Snell et al. (1978) was adopted with a little modification. The method is based on the diffusion of protease from wells cut in casein agar medium and its subsequent digestion of casein as detected by clear zone around the well. Supernatants from Brain Heart Infusion (BHI) cultures were dropped in wells cut in 12 cm casein agar plates which then were incubated for 24 hrs at 37oC. The diameters of clear zones around wells were measured to the nearest mm using a caliper.Protease activity of tested strains was calculated from the calibration curve constructed by plotting arbitrary units against the diameter of clear zones in mm of two fold serial dilutions of the highest protease producing strain's aliquot. c- Staphylolytic assay:

The staphylolytic activity of the Pseudomonas extracellular proteases was determined by measuring the percent of lysis of a Staphylococcus aureus cell suspension. A modified method of Kessler et al. (1993) was carried out. Staphylococcus aureus strain (S 25) obtained from department of microbiology, faculty of pharmacy, Mansoura University was cultured in nutrient broth overnight at 37°C, centrifuged. The pellet, was resuspended in 0.02 M Tris-HC1, pH 8.5, boiled for 10 min and diluted with the same buffer to an OD595 of 0.8. The assay was carried out at 37°C by adding 200 µl enzyme aliquots to 800 µl heat-killed cells. Staphylolysis was determined by measuring the change in OD595 after 90 min and percent of lysed cells was calculated. 4) Lipase assay

Qualitative assays of lipase activity were performed by plating solid bacterial cultures on tween agar plates. Lipase-releasing colonies were identified by the formation of precipitates of water-insoluble fatty acids from hydrolyzed tween surrounding them.

6

Lipase activity was assayed by a colorimetric method. A stock solution of p-nitrophenyl palmitate (p-NPP) was prepared in HPLC grade of isopropanol. The reaction mixture contained 75 µl of p-NPP stock solution, 5µl of supernatants from BHI culture and 0.1 M Tris buffer (pH 8.5) to make a final volume of 3 ml. The reaction mixture was incubated at 37 oC for 10 min then chilled at -20 oC for 8 min to stop the reaction. The absorbance of released p-nitrophenol was measured at 410 nm (Kumar et al., 2005).

Lipase activity of tested strains was calculated from the calibration curve constructed by plotting arbitrary units against absorbance of two fold serial dilutions of the highest lipase producing strain's supernatant. 5) Biofilm Formation: Microtiter plate assay was used to determine biofilm formation according to Stepanovic et al. (2000) and Abdi-Ali et al. (2006). Briefly, cells from overnight culture on trypticase soy agar supplemented with 0.25% glucose were suspended in trypticase soy broth + 0.25 % glucose and adjusted at OD600 of 0.25. One-hundred µl of the suspension was then used to inoculate 96-wells of flat bottomed polystyrene microtiter plate, at least in triplicate, and incubated (18 hr, 37 °C) without shaking. After the bacterial cultures were poured out, wells were 3times washed with PBS, fixed in the air (15 min) and stained with 0.1 % crystal violet solution (20 min). The unbound dye was removed by rinsing 3times with PBS. After drying the plates (15 min), crystal violet was solubilized by 150 μl per well of 33% (V/V) of glacial acetic acid (10 min). The optical density of each well was measured at 492 nm using a microtiter plate reader. For each strain, the mean OD of the three wells was calculated (ODT). The cut-off OD (ODc) was defined as three standard deviations above the mean OD of the negative control wells. IV- Genotypic detection of some virulence factors: 1) Genomic DNA extraction: The genomic DNA of 50 of highly virulent P. aeruginosa isolates were prepared using QIA amp® DNA mini kit Cat. No. 51304 supplied by Qiagen Inc. according to the manufacturer's instructions for bacteria 2009. DNA was eluted by adding 50 µl Qiagen EB buffer (10 mM Tris-HCl, pH 8.5) and visualized by electrophoresis on horizontal gels containing 1% agarose and Fermentas 100bp DNA ladder.

2) Plasmid DNA extraction: The plasmid content of 14 isolates was prepared using QIAprep Spin Miniprep DNA purification system Kit cat. No. 27106 supplied by Qiagen protocol 2009. Plasmid DNA was eluted by addition of 50 µl buffer EP (10 mM Tris HCl, pH 8.5) or water to the center of each QIAprep spin column.

7

3) PCR detection of specific gene sequences Virulence genes (toxA, lasB, aprA, exoS and exoU) were detected and amplified using the following reaction: 3µl DNA extract, 1µl of forward primer (10 µM), 1 µl of reverse primer (10 µM) (Table 1), 12.5 µl of DreamTaq™ Green PCR master mix and 7.5 µl of nuclease-free water.

The PCR conditions were started with initial denaturation step at 95°C for 2 min, followed by 35 cycles of denaturation at 95°C for 30 sec, annealing temperature (65 ºC for toxA, 60 ºC for apr , lasB, exoS and exoU) for 40 sec, and extension at 72°C for 1 min and final extension at 72°C for 5 min.

Table (1): Specific amplification primer sets for the tested virulence genes among P. aeruginosa isolates.

Gene

name Type Sequence

toxA Fw 5`…GACAACGCCCTCAGCATCAACAGC

Rv 5`…CGCTGGCCCATTCGCTCCAGC

lasB

Fw 5'… TCATCACCGTCGACATGAAC

Rv 5`… TGCCCTTCTTGATGTCGTAG

aprA Fw 5`…AGTTGTCGCTGCAATCCTGG

Rv 5`…AGCTCATCACCGAATAGGCG

exoS Fw 5'… AGGCATTGCCCATGACCTTG

Rv 5`… ATACTCTGCTGACCTCGCTC

exoU Fw 5'… CTAGAAGAGAAAGGCATGCTCG

Rv 5`… CTATGCGTGGGAGTACATTGAG

Fw: forward primer Rv: reverse primer

The generated amplicons were visualized on 1.2% agarose gel electrophoresis stained with ethidium bromide and illuminated under UV transilluminator.

Results I- Antimicrobial susceptibility testing:

A total of 98 isolates of P. aeruginosa were isolated from specimens collected from different clinical sources. It was observed that all isolates were resistant to amoxicillin- clavulanic acid, cefadroxil, cefotaxime and cefepime. On the other hand, they showed different levels of resistance to the other 6 antimicrobials. Where 48 strains were resistant to gentamicin,

8

46 strains were resistant to ofloxacin, 36 strains were resistant to levofloxacin. A number of 29 strains were resistant to azithromycin, 21 strains were resistant to imipenem and 14 strains were resistant to amikacin.

II-Phenotypic detection of virulence factors:

The isolates were investigated for their possession of virulence factors including pyocyanin production, hemolysin production, proteases (total proteases and staphylolytic activity of elastase A), lipase production and biofilm formation.

In the present study, the range for production of each virulence factor was arbitrarily selected and isolates were categorized as low or high producer (Table 2). A wide range of pyocyanin was produced. An amount more than 100 µg / ml was produced by five strains, while a similar number produced amounts less than 1 µg / ml. It was noticed that the highest level (≥ 40 µg / ml) of pyocyanin production was produced by 6 urine isolates which gave amounts that ranged between 86 µg / ml and 131.5 µg / ml. Regarding other sources, lower production levels were noticed. The level of pyocyanin expressed by the number of the strains was higher in the group of strains resistant to azithromycin and ciprofloxacin (in comparison with the sensitive strains) (Table3). On the average, most isolates in this study produced high percent of hemolysis. A number of seventy six strains produced more than 50% hemolysis including twenty strains that produced complete (100%) hemolysis. This included four endotracheal isolates, five burn isolates, four blood isolates, three urine and three wound isolates. Regarding the isolation site, a high level of hemolysis (≥ 50%) was produced by 94% of urine isolates, 93 % of burn isolates, 87.5 % of blood isolates and 84 % of wound isolates.

9

Table (2): Distribution of different production level of virulence factors among different clinical sources.

Percent of strains producing high level of different virulence factors Clinical source

(Number) Biofilm (OD ˃

0.2)

Lipase ≥20 unit

Staphylolysis ≥20%

Total protease ≥18 units

Haemolysis ≥ 50%

Pyocyanin ≥ 40

µg/ml

46 57.7 38.5 38.5 57.7 30 (26) Endotracheal

22.2 16.7 0 11.1 94.4 33.3 (18) Urine

12.5 37.5 12.5 31.3 93.3 25 (16) Burn

30.8 76.9 15.4 23 84.6 23 (13) Wound

25 37.5 50 62.5 87.5 37.5 (8) Blood

16.7 16.7 16.7 16.7 50 33.3 (6) Ear

0 20 20 20 60 0 (5) Sputum

0 33.3 33.3 0 100 33.3 (3) CSF

Table (3): Relationship between resistance and/ or sensitivity to

antimicrobials and virulence factors production.

Percent of strains producing Number of strains

Antibiotic Biofilm (OD

˃ 0.2) Lipase ≥ 20 units

Total protease ≥18 units

Haemolysin≥ 50%

Pyocyanin≥ 40 µg/ml S,I R

25 21.4 41.6 42.8 84.5 71.4 75 92.9 27.3 35.7 84 14 Amikacin

32 16 40 74.5 78 87.5 76 79.1 26 31.25 50 48 Gentamicin

9.6 50 48.3 30.5 80.6 86.1 75.8 80.5 27.4 30.5 62 36 Levofloxacin

33.3 14.8 49 34 80.3 85.1 78.4 76.5 27.4 29.7 51 47 Ofloxacin

24.3 25 41 45 80.7 90 80.7 65 26.9 35 78 20 Imipenem

26 20.6 40.5 44.8 82.6 82.7 79.7 72.4 20.2 48.2 69 29 Azithromycin

R: resistant S: sensitive I: intermediate

In the present study, 17 isolates did not show proteolysis on skimmed milk ager. It was observed that a high level of protease activity (≥ 18 units) was manifested by higher number of blood and endotracheal

10

isolates followed by burn isolates. On the other hand, other sources exhibited lower protease activity.

The majority (65%) of isolates manifested low levels of staphylolytic activity (≤ 10% staphylolysis). Higher staphylolytic activity (≥ 20% staphylolysis) was detected in twenty two strains as compared to the rest of tested strains.

The level of staphylolysis varied with the site of isolation. Ten out of twenty six endotracheal isolates produced high staphylolytic activity that ranged between 23% and 53%. A number of 4 blood isolates exhibited a range of 25% to 41% staphylolysis. Regarding lipase activity, only 5 isolates were negative lipase producers. It was observed that 76.9% of wound and 57.7% of endotracheal isolates showed higher lipase activity (≥ 20 units) . High percentage of strains resistant to gentamicin was high lipase producer. As indicated in figure (1), thirty nine strains exhibited moderate adherence (0.115 < OD ≤ 0.229) while only eighteen strains were strong adherent (OD > 0.229). The remaining forty one strains were either weak or non-adherent. Regarding the source, the highest level of biofilm production was produced by endotracheal isolates as twelve out of twenty six gave OD > 0.2. On the other hand, no strong adherence was detected in sputum or CSF isolates. High percentage of strains in the groups sensitive to gentamicin (32%) and/ or ofloxacin (33.3%) and resistant to levofloxacin (50%) was strong biofilm producer (in comparison with the sensitive strains).

Fig. (1): Level of biofilm formation by P. aeuruginosa isolates

11

II- Genotypic detection of some virulence genes: toxA, apr , lasB, exoS and exoU genes were amplified from genomic DNA of 50 highly virulent P. aeruginosa isolates. PCR detection of toxA, apr and lasB genes showed that they were harbored by chromosomal DNA of all tested isolates with amplicon size of 390 bp, 315 bp and 490 bp respectively as shown in figure (2).

Fig. (2): Agarose gel electrophoresis of a) toxA gene amplicones. Lanes from 1 to 15 represent isolates No. 27, 32, 40,

42, 43, 47, 48, 54, 55, 58, 59, 61, 65, 66 and 67 respectively. Lane C was negative control. Lane M was 100 bp DNA marker

b) apr gene amplicones. Lanes from 1 to 16 represent isolates No. 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 15, 17, 21, 22, 23 and 25 respectively. Lane C was negative control. Lane M was 100 bp DNA marker.

c) lasB gene amplicones. Lanes from 1 to 11 represent isolates No. 14, 15, 17, 21, 22, 23, 25, 88, 92, 93 and 94 respectively. Lane C was negative control. Lane M was 100 bp DNA marker

a)

c)

390 bp

315 bp

490 bp

b)

12

Regarding exoS gene, only 37 isolates gave amplicon size of 372 bp. On the other hand, only three isolates did not harbor exoU gene (fig. 3). Of the 50 P. aeruginosa isolates examined, 13 contained the exoU(amplicon size of 274 bp) but not the exoS gene, 34 isolates contained both genes, and only 3 isolates contained the exoS but not the exoU gene.

The plasmid DNA was isolated from 14 highly virulent P. aeruginosa isolates. Only one strain (No. 93) did not harbor any plasmid. Screening for the presence of the studied virulence genes on the isolated plasmids of these strains displayed the presence of toxA gene on all of them (Data not shown).

Concerning apr gene, it was harbored by 10 strains while lasB and exoU genes were harbored by 12 strains. For exoS gene, 8 strains were found to carry it on their plasmids (Data not shown).

Fig. (3): Agarose gel electrophoresis of a) exoS gene amplicones. Lanes from 1 to 15 represent

isolates No. 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 15, 17, 21 and 22 respectively. . Lane C was negative control. Lane M was 100 bp DNA marker.

b) exoU gene amplicones. Lanes from 1 to 15 represent isolates No. 27, 32, 40, 42, 43, 47, 48, 54, 55, 58, 59, 61, 65, 66 and 67 respectively. Lane C was negative control. Lane M was 100 bp DNA marker.

a)

b)

372 bp

274 bp

13

Discussion P. aeruginosa is a major cause of nosocomial infections. This

organism shows a remarkable capacity to resist antibiotics, either intrinsically (because of constitutive expression of β-lactamases and efflux p ump s, co mb ined with lo w p ermeab ility o f the o uter-membrane) or following acquisition of resistance genes (e.g., genes for β -lactamases, or enzymes inactivating aminoglycosides or modifying their target), over-expression of efflux pumps, decreased expression of porins, or mutations in quinolone targets. Worryingly, these mechanisms are often present simultaneously, thereby conferring multiresistant phenotypes. Susceptibility testing is therefore crucial in clinical practice (Mesaros et al., 2007). Poor sensitivity to cefalosporins was observed as all isolates were resistant to amoxicillin- clavulanic acid, cefadroxil, cefotaxime, cefepime. A comparable level of resistance to cefotaxime but a different response to cefepime was found by Hoštacka et al. (2006).

In our study, a notable resistance (20%) of P. aeruginosa was observed against imipenem. For fluorouinolones, 47% of the isolates were resistant to ofloxacin and 36% were resistant to levofloxacin. A similar result to that of imipenem, but a higher percent of resistance to ofloxacin and levofloxacin (69% and 62% respectively) was reported by Javiya et al. (2008) and Olayinka et al. (2009). The resistance to imipeneme, especially in P. aeruginosa, results from reduced levels of drug accumulation or increased expression of pump efflux (Gupta et al., 2006).

Among the aminoglycosides, amikacin has the highest activity against P. aeruginosa (86%), which was in accordance with Smitha et al. (2005) and Javiya et al. (2008). A comparable level of resistance of our isolates to gentamicin (48 %) was also found by Hoštacka et al., 2006. Resistance patterns of the current isolates to the 10 tested antimicrobials indicated that these isolates are multiple resistant. This could be explained by the extensive use of these antimicrobials in the treatment of P. aeruginosa infection (McGowan, 2006)

P. aeruginosa produces several extracellular products that after colonization can cause extensive tissue damage, bloodstream invasion, and dissemination (Van Delden and Iglewski, 1998). It was noticed that isolates of the same source varied greatly in the amount produced of each studied virulence factors. So, we based our discussion on the number of isolates from each source giving high production level.

Pyocyanin production by P. aeruginosa suppresses the acute inflammatory response by pathogen-driven acceleration of neutrophil apoptosis and by reducing local inflammation, and that this is advantageous for bacterial survival (Allen et al., 2005). Our study revealed that all P. aeruginosa isolates produced pyocyanin pigment

14

on King’s A medium at different amounts. This results support the work achieved by Essar et al., (1990) and Ra'oof and Latif (2010), who found that P. aeruginosa isolates which were used in their researches produced different amounts of pyocyanin. In the present study, a positive association was found only between pyocyanin as expressed by the higher number in the groups of strains resistant to aminoglycosides, quinolones, imipenem and azithromycin.

All of the strains tested produced RBCs hemolysis, a result similar to that of Ra'oof and Latif (2010). This may be attributed to production of two hemolysins. One of the hemolysins is a heat-labile phospholipase C and the other is a heat-stable glycolipid. Both hemolysins are produced during stationary phase. The proposed physiological role of these hemolysins in the organism is to act cooperatively with alkaline phosphatase in liberating inorganic phosphate from phospholipid (Berka et al., 1981). Poor association between resistance to antimicrobials and hemolysins production was noticed as high percentages of both sensitive and resistant strains produced hemolysins. However, aminoglycosides showed a positive association between resistance and high hemolysin production , where a high percentage in the resistant groups gave an elavated production level.

In the present study, the majority of urinary tract isolates produced a higher level of haemolysis than other sources which is in accordance with the results revealed by Berka et al. (1981) and Mittal et al. (2006), who indicated a direct association between haemolysin production and renal colonization.

Regardless of whether measured as total protease or elastase A activity, the frequency of protease production as well as the number of high level producers were elevated in the groups of strains isolated from blood, endotracheal aspirates and burn when compared with the protease production by strains isolated from other sites. This result was in accordance with Woods, et al. (1986) and Furuya et al. (1993).

Biofilms are resistant to antimicrobial agents as well as to host defense mechanisms and hence are difficu lt to eradicate. Biofilms contribute towards pathogenicity of P. aeruginosa as these often lead to persistent and recurrent infections (Mittal et al., 2009). Biofilm formation was determined using microtitre plate assay. Our data revealed that higher number of endotracheal isolates produced substantially more biofilms compared with isolates of other sources. Fricks-Lima et al. (2011) reported a similar result concerning high biofilm production by intubated patients.

Lipases of microbial origin are known to be very useful in a palette of industrial applications. But it becomes more obvious that extracellular lipases also play a role during microbial infections (Stehr et al., 2003). It

15

was found that high production level was observed for 76.7% and 57.7% of wound and endotracheal isolates respectively. This may explain the important role of this enzyme in P. aeruginosa colonization of human skin and the respiratory tract which is correlated with an increase in lung destruction of patients suffering from cystic fibrosis (Stehr et al., 2003).

Our data indicates that the resistance to antibiotics was not always associated with changes in the production of the pathogenicity factors such as hemolysins and biofilm. A positive association between aminoglycosides resistance and pyocyanin, hemolysins and lipase production was noticed as high percentage in the resistant group exhibited high production levels of these virulence factors. Another association between resistance and / or sensitivity to quinolones with pyocyanin, protease and lipase production also was noticed. A similar result was reported by Hoštacka et al. (2006).

We used PCR to assess the prevalence of five virulence genes among 50 of highly producer isolates. All isolates investigated in this study possessed toxA, aprA and lasB genes. These findings were in accordance with those from comprehensive studies carried out by Khan and Cerniglia (1994), who used toxA amplification to detect a low level of P. aeruginosa from environmental and clinical samples. Lanotte et al. (2004) and Bradbury et al. (2010) reported that these genes (toxA, aprA and lasB) to be universally present.

In contrast, the exoS and exoU genes were variable traits. exoS gene was detected in 37 isolates (74 %), while exoU gene was detected in 47 isolates (94%). This result partially differs from those of Feltman et al. (2001), who revealed that 72% of examined isolates contained the exoS gene and only 28% contained the exoU gene.

The results reported by Bradbury et al. (2010) and Feltman et al. (2001) demonstrated low prevalence (5 %) of the exoU+ exoS+ genotype in the population tested. Unlikely, our results revealed that 68% of examined isolates harbored both exoS and exoU genes. The difference between the current results and those previously reported may be attributed to the different environmental and geographical sources.

To assess the relation between plasmids and virulence genes, plasmid extraction from the selected isolates was carried out and analyzed on 1% agarose gel. Except for one, all isolates were harboring plasmids. Almost all of studied virulence genes were harbored by these plasmids. toxA, lasB and exoU genes were carried by 92% of tested isolates while aprA and exoS genes were carried by 84.6% and 61.5% respectively.

According to previous studies, it is well known that most Gram negative bacteria are harboring plasmids (Helling et al., 1981, Parkhill et al., 2001 and Vivre et al., 2004). It is well known that plasmids are major

16

vectors for the dissemination of both antibiotic resistance and virulence determinants among bacterial populations (Martínez and Baquero, 2002).

In conclusion, the present study confirmed previous observations that the virulence of P. aeruginosa is multifactorial and relative contribution of each of the many exoproducts implicated in virulence of P. aeruginosa may vary depending on the site and type of infection. Resistance to antimicrobials by P. aeruginosa isolates was not generally associated with the level of production of the pathogenicity factors. The presence of virulence genes (toxA, aprA and lasB) were found to be highly conserved across the genome of P. aeruginosa, regardless of the secretion system to which their products belonged. While a small number (26% and 6%) of individual isolates did show absence of some of the specific virulence factor genes tested (exoS and exoU respectively), no pattern was observed with regard to the source of their isolation.

The high percentage of plasmids carrying many virulence genes of P. aeruginosa may confirm their crucial role in horizontal transfer of virulence.

Finally, further investigations are required to determine the post antibiotic effect as well as the influence of successive subculturing on sub-bacteriostatic concentration of chemical agents and antimicrobials on virulence factors production. As we learn more about pathogenesis and the mechanisms used in different sites of infection, evidence will accumulate to better direct drug discovery efforts towards these targets.

References

• Abdi-Ali, M. Mohammadi-Mehr, Y. Agha Alaei, (2006): Bactericidal activity of various antibiotics against biofilm-producing Pseudomonas aeruginosa. International Journal of Antimicrobial Agents; 27: 196–200.

• Allen, L., Dockrell, D. H., Pattery, T., Lee, D. G., Cornelis, P., Hellewell, P. G. and Whyte, M. K. B. (2005): pyocyanin production by Pseudomonas aeruginosa induces neutrophil apoptosis and impairs neutrophil-mediated host

defenses in vivo. The J. of Immunol. ; 174: 3643-3649.

• Berka, R. M., Gray, G. L. and Vasil, M. L. (1981): Studies of Phospholipase C (Heat-Labile Hemolysin) in Pseudomonas aeruginosa. Infection and Immunity; 34(3): 1071-1074.

• Blair, J.E., Lennette, E.H. and Truant, J.P. (1970): Manual of clinical microbiology. American society for microbiology, Bethesda, M.D. pp: 300–303.

• Bradbury, R. S., Roddam, L. F., Merritt, A., Reid, D. W. and Champion, A. C. (2010): Virulence gene distribution in

17

clinical, nosocomial and environmental isolates of Pseudomonas aeruginosa. J. of Med. Microbiol.; 59: 881–890.

• Engel, J. and Balachandran, P. (2009): Role of Pseudomonas aeruginosa type III effectors in disease. Current Opinion in Microbiology; 12: 61–66.

• Essar, D.W., Eberly, L., Hadero, A. and Crawford, I.P. (1990): Identification and characterization of genes for second anthranilate synthase in Pseudomonas aeruginosa: interchangeability of the two anthranilate synthases and evolutionary implications. J. of bacteriol.; 172 (2): 884-900.

• Feltman, H., Schulert, G., Khan, S., Jain, M., Peterson, L. and Hauser, A. R. (2001): Prevalence of type III secretion genes in clinical and environmental isolates of Pseudomonas aeruginosa. Microbiol. ; 147: 2659–2669

• Fricks-Lima, J., Hendrickson, C. M., Allgaier, M., Zhuo, H., Wiener-Kronish, J. P., Lynch, S.V. and Yang, K. (2011): Differences in biofilm formation and antimicrobial resistance of Pseudomonas aeruginosa isolated from airways of mechanically ventilated patients and cystic fibrosis patients. Int. J. of Antimicrob. Agents; 37: 309-315.

• Furuya, N., Hirakata, Y., Tomono, K., Matsumoto, T., Tateda, K. Kaku, M. and Yamaguchi, K. (1993): Mortality rates amongst mice

with endogenous septicemia caused by Pseudomonas aeruginosa isolates from various clinical sources. J. Med. Microbiol.; 39: 141-146.

• Galloway, D. R. (1991): Pseudomonas aeruginosa elastase and elastolysis revisited: recent developments. Molecular Microbiology. 5:2315-21.

• Govan, J. R. W. (1996): Pseudomonas aeruginosa, Stronotrophomonas, Burkholderia. Mackie and McCartney practical Medical Microbiology. 14th ed., vol. I Churchill- Livingstone, New York, P: 413- 424. • Gupta, E., Mohanty, S., Sood,

S., Dhawan, B., Das, B. K., Kapil, A. (2006): Emerging resistance to Carbapenems in a tertiary care hospital in North India. Indian J Med Res.;124: 95–98.

• Helling, R. B., Kinney, T. and Adams, J. (1981): The maintenance of plasmid-containing organisms in populations of Escherichia coli. J. Gen. Microbiol.; 12: 129-41.

• Hostacká A, Majtán V, Hybenová D. (1995): Antimicrobial efficacy of quaternary bisammonium salts and the effect of their sub-MICs on Pseudomonas aeruginosa virulence factors. Folia Microbiol.; 40(3):283- 287. • Iglewski, B.H. and Kabat, D.

(1975): NAD-dependent

18

inhibition of protein synthesis by Pseudomonas aeruginosa toxin. Proc. Natl. Acad. Sci.USA; 72: 2284–2288.

• Javiya, V. A., Ghatak, S. B., Patel, K. R. and Patel, J. A. (2008): Antibiotic susceptibility patterns of Pseudomonas aeruginosa at a tertiary care hospital in Gujarat, India. Indian J. Pharmacol.; 40(5): 230–234.

• Kessler, E., Safrin, M., Olson, J. C. and Ohman, D. E. (1993): Secreted LasA of Pseudomonas aeruginosa is a staphylolytic protease. J Biol Chem.; 268:7503-7508. • Kessler E, Safrin M, Abrams

WR, Rosenbloom J, Ohman DE. (1997): Inhibitors and Specificity of Pseudomonas aeruginosa LasA. J. Biol. Chem.; 272:9884-9889.

• Khan, A. A. and Cerniglia, C. E. (1994): Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxinA gene using PCR. Applied and Environmental Microbiology; 60: 3739-3745.

• King, E. O., Ward, M. and Pianey, D. (1954): Two simple media for the demonstration of pyocyanin fluorescin .J.Lab.Clin.Med.; 44: 301.

• Kipnis, E., Sawa, T. and Wiener-Kronish, J. (2006): Targeting mechanisms of Pseudomonas aeruginosa pathogenesis.

Médecine et maladies infectieuses; 36: 78–91

• Kumar, S., Kilon, K., Upadhyay, A., Kanwar, S.S. and Gupa, R., (2005): Production, purification and characterization of lipase from thermophilic and alkaliphilic Bacillus coagulans BTS-3. Protein Expression and Purification; 41: 38-44.

• Kurachi, M. (1958): Studies of the biosynthesis of pyocyanin (II). Bull Inst Chem Res., Kyoto University. 36, 174-87.

• Lanotte, P., Watt, S., Mereghetti, L., Dartiguelongue, N., Rastegar-Lari, A., Goudeau, A. and Quentin, R. (2004): Genetic features of Pseudomonas aeruginosa isolates from cystic fibrosis patients compared with those of isolates from other origins. J. of Med. Microbiol.; 53: 73–81

• Liu, P.V. (1974): Extracellular toxins of Pseudomonas aeruginosa. J. Infect. Dis.; 130(Suppl.): 94–99.

• Mah, T. F. and O’Toole. G. A. (2001): Mechanisms of biofilm resistance to antimicrobial agents. Trends Microbiol.; 9:34–39.

• Martínez, J. L., and Baquero, F. (2002): Interactions among Strategies Associated with Bacterial Infection: Pathogenicity, Epidemicity, and Antibiotic Resistance. Clinical Microbiology Reviews; 15: 647–679.

• Matsumoto, K. (2004): Role of bacterial proteases in pseudomonal and serratial

19

keratitis. Biol. Chem.; 385:1007-1016.

• McGowan, J. E., Jr. (2006): Resistance in non-fermenting Gram-negative bacteria: Multidrug resistance to the Maximum. Amer. J. Med., 119(6A): 529-536.

• Mesaros N., Nordmann, P., Ple´siat, P., Roussel-Delvallez, M., Van Eldere, J., Glupczynski, Y., Van Laethem, Y., Jacobs, F., Lebecque, P., Malfroot, A., Tulkens, P. M. and Van Bambeke, F. (2007): Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millennium. Clin. Microbiol. Infect.; 13: 560–578. • Mittal, R., Aggarwal, S.,

Sharma, S., Chhibber, S. and Harjai, K. (2009): Urinary tract infections caused by Pseudomonas aeruginosa: A minireview. J. of Infect. and Public Health; 2: 101—111.

• Mittal, R., Khandwaha, R. K., Gupta,V., Mittal, P.K. and Harjai, K. (2006): Phenotypic characters of urinary isolates of Pseudomonas aeruginosa & their association with mouse renal colonization. Indian J. Med. Res.; 123: 67-72

• Nakazawa, T., Yamada, Y. and Ishibashi, M. (1987): Characterization of hemolysin in extracellular products of Pseudomonas cepacia. J.Clin. Microbiol., 25:195-198.

• NCCLS, (2003): Performance standards for antimicrobial disk susceptibility tests, 8th ed. Approved standard M2-A8. National Committee for Clinical Laboratory Standards, Wayne, Pa.

• Olayinka, A. T. , Olayinka, B. O. and Onile, B. A. (2009): Antibiotic susceptibility and plasmid pattern of Pseudomonas aeruginosa from the surgical unit of a university teaching hospital in north central Nigeria. International Journal of Medicine and Medical Sciences; 1(3): 079-083.

• Parkhill, J., Dougan, G., and James, K. D. (2001): Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413:848-52.

• Parsons, J. F., Greenhagen, B. T., Shi , K., Calabrese, K., Robinson, H. and Ladner, J. E. (2008): Structural and functional analysis of the pyocyanin biosynthetic protein PhzM from Pseudomonas aeruginosa. Biochem.; 46(7): 1821–1828.

• Ralli, P. and O’Donovan. G. A. (2005): Impaired virulence factor production in a dihydroorotate dehydrogenase mutant (pyrD) of Pseudomonas aeruginosa. Dissertation Prepared for the Degree of Doctor of Philosophy, North Texas University, Denton, Tex.: 22-23

• Ra'oof, W. M. and Latif, I. A. (2010): In vitro study of the

20

swarming phenomena and antimicrobial activity of pyocyanin produced by Pseudomonas aeruginosa isolated from different human infections. Eur. J. of Sci. Research; 47: 405-421

• Rossignol, G., Merieau, A., Guerillon, J., Veron, W., Lesouhaitier, O., Feuilloley, M. G. and Orange, N. (2008): Involvement of a phospholipase C in the hemolytic activity of a clinical strain of Pseudomonas fluorescens. BMC Microbiol.; 8:189- 203.

• Sitkiewicz, I., Stockbauer, K. E. and Musser, J. M. (2007): Secreted bacterial phospholipase A2 enzymes: better living through phospholipolysis. Trends Microbiol.; 15: 63-69.

• Smitha, S., Lalitha, P., Prajna, V. N. and Srinivasan, M. (2005): Susceptibility trends of Pseudomonas species from corneal ulcers. Indian J Med Microbiol.; 23:168–71.

• Snell, K., Holder, I., Leppla, S.

and Sealinger, S. B. (1978): Role of exotoxin and protease as possible virulence factor in experimental infections with Pseudomonas aeruginosa. J. Infec. Immun.; 16: 839-845.

• Sokol, P. A., Ohman, D. E. and Iglewski, B. H. (1979): A more sensitive plate assay for detection of protease production by Pseudomonas aeruginosa. J. of clin. microbiol.; 9 (4): 538-540.

• Stehr, F., Kretschmar, M., Kröger, C., Hube, B. and Schäfer, W. (2003): Microbial lipases as virulence factors. J. of Molecular Catalysis B: Enzymatic; 22: 347–355.

• Stepanovic', S., Vukovic, D., Dakic, I., Savic B. and Svabic-Vlahovic, M. (2000): A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods, 40: 175-179.

• Sutter, V. (1968): Identification of Pseudomonas species isolated from hospital environment and human sources. Appl. Microbiol., 16: 1532-1538.

• Van Delden, C. and Iglewski, B. H. (1998): Cell-to-Cell Signaling and Pseudomonas aeruginosa Infections. Emerging Infectious Diseases; 4: 551-560

• Wolf, P. and Elsasser-Beile, U. (2009): Pseudomonas exotoxin A: From virulence factor to anti-cancer agent. International J. of Med. Microbiol. 299: 161–176

• Woods, D., Schaffer, D. S., Rabin, H. R., Campbell, G. D. and Sokol, P. A. (1986): Phenotypic comparison of Pseudomonas aeruginosa strains isolated from a variety of clinical sites. J. of Clin. Microbiol.; 24: 260-264.

21

تحديد الخواص الظاهرية والوراثية لبعض عوامل الضراوة لعترات السودوموناس مصادر اكلينيكية مختلفة من مستشفيات جامعة معزولة من ارويجينوزا ال

المنصورة.

رشا بروة و محمد عادل السكرى و وائل النجار و دينا عيد

جامعة المنصورة.–قسم الميكروبيولوجي - كلية الصيدلة

مقارنة لبعض عوامل الضراوة وتكوين الطبقة الحيوية الميكروبية البحث دراسة هذا يتناوللبكتيريا السودوموناس اوريجينوزا التى تم عزلها من مصادر اكلينيكية مختلفة من مستشفٮات جامعة المنصورة عن طريق التحديد الظاهري لكل العترات و بالطريقة الجينية لتحديد الجينات المسئولة عن

البعض األخر لبعض من تلك العترات األكثر ضراوة. عتره من السودوموناس اوريجينوزا تشمل عينات مأخوذة من أجزاء من 98 و لقد تم عزل

والجروح و األذن و الدم والبصاق و السائل النخاعى األنبوب الداخلى للقصبة الهوائية و البول و الحروق . و مصادر أخرى

وفي هذه الدراسة تم دراسة حساسية العترات المعزولة لعدد عشر مضادات ميكروبية باستخدام طريقة االنتشار من قرص المضاد الميكروبي. و بينما كان األميكاسين و اإلميبينم االكثر فاعلية, كانت كل

العزالت مقاومة لألموكساسيلين- حمض الكالفيوالنيك و سيفادروكسيل و سيفوتاكسيم والسيفيبيم. أما باقي المضادات فقد أظهرت نسبا متفاوتة في درجات الحساسية.

و لقدأثبتت نتائج التحديد الظاهري لعوامل الضراوة أن كل العزالت قد أنتجت صبغة البيوسيانين عزلة نسبة عالية من تكسير كرات 76ولكن العترات المعزولة من البول اعطت كميات أكبر.و كذلك أعطت

الدم الحمراء . و فيما يتعلق بانتاج البروتياز الكلى و النشاط المحلل للمكور العنقودى فقد كانت النتائج عزلة و لوحظ أن أعلى نشاط لذلك كان من بين العزالت المفصولة من الدم و القصبة 81ايجابية فى

الهوائية. و كانت معظم العزالت ايجابية بالنسبة النتاج انزيم الليباز حيث كانت العزالت المفصولة من كال من الجروح و القصبة الهوائية أعلى انتاجية. وأظهرت النتائج أن تكوين الطبقة الميكروبية الحيوية كان

عزلة وأن أعلى مستوى من تكوينها كان بواسطة عزالت القصبة الهوائية.18ملحوظا بقوة فى 50كذلك تم التعرف على الجينات المسئولة عن بعض عوامل الضراوة األخرى لخمسة جينات فى

) وأظهرت النتائج بالنسبة PCRعزلة من العزالت األكثر ضراوة بطريقة تفاعل البلمرة المتسلسل ( المسئول عن انتاج انزيم البروتياز (aprA) و A المسئول عن انتاج البروتين الخارجى (toxA)لجين

% وبالنسبة إلى جين 100 انها متواجدة بنسبة B ) المسئول عن انتاج انزيم االلستيز (lasBالقاعدى و )exoS) المسئول عن انتاج (exoenzyme S ( % وجين74) فقد تواجد بمعدلexoU المسئول عن (

عزلة 14% .و لقد أظهر استخالص البالزميدات من 94) كان متواجدا بنسبة exoenzyme Uانتاج ( منها و كذلك كانت الجينات المختبرة موجودة فى غالبيتها.13وجود تلك الجينات فى

وأكدت هذه الدراسة المالحظات السابقة بأن ضراوة السودوموناس اوريجينوزا متعددة العوامل والمساهمة النسبية لكل من النواتج الخارجية الضالعة في هذه الضراوة قد تختلف حسب الموقع ونوع

و أن الدراسات الخاصة بالبالزميدات تؤكد الدور الهام فى االنتقال األفقى لعوامل الضراوة.العدوى.