microbiological interventions at soil plant interface …

MICROBIOLOGICAL INTERVENTIONS AT SOIL PLANT

INTERFACE TO INDUCE LEAD MOBILITY AND ITS

REMEDIATION

BY

Maria Manzoor

(NUST201490151PSCEE1814S)

A Dissertation Submitted in Partial Fulfillment of the

Requirement for the Degree of Doctor of Philosophy

IN

Environmental Science

Supervisor

Dr. Muhammad Arshad

Institute of Environmental Sciences and Engineering (IESE)

School of Civil and Environmental Engineering (SCEE)

National University of Sciences and Technology (NUST)

Islamabad, Pakistan

(2019)

In the name of ALLAH, the Most Gracious, the Most Merciful"

DEDICATION

This PhD work is dedicated to

My Parents

Mr and Mrs Manzoor Hussain

Without whom nothing would

have been achieveable

i

ACKNOWLEDGEMENTS

Firstly, I would like to deeply express my sincere gratitude to my highly regarded supervisor Dr.

Muhammad Arshad for the continuous support throughout my Ph.D. research, his patience,

motivation, knowledge, immense wisdom, munificent behavior, meticulous critique, and his

dignified doctrine that assisted me to achieve my study objectives. His guidance helped me

throughout research and writing of this thesis. He is the one who gave me international exposure

and help me build by international networks. It would have been difficult to accomplish this work

on time without his help and kind support.

I also desire to acknowledge the earnest cooperation and commendable support of my

distinguished GEC membres Dr. Imran Hashmi and Dr. Zeeshan Ali Khan for monitoring

research progress, insightful comments, encouragement, and guidance and also for the hard

questions which widen my research from various perspectives. My sincere thanks also go to Prof.

Jean Kallerhoff who is my external GEC member. She has broad vision in the field of

phytoremediation. It was indeed a great pleasure and honour for me to visit her lab and work under

her supervision. I am especially thankful to Prof. Lena Q Ma, Professor SWS, University of

Florida (UF), USA for being my foreign advisor. Her enthusiasum, willingness, intensity of

research and interests in developing new ideas and in-depth studies pushed me to learn different

aspects of plant microbe interactions in phytoremediation.

I greatly acknowledge NUST and especially, the NUST Rector for funding my entire research. I

also acknowledge HEC and Campus France for funding the PERIDOT research project and

providing me the opportunity to get training on advanced techniques in phytoremediation at Ecolab

Toulouse, France. A very special gratitude goes to HEC for helping and providing the funding for

six month visit at UF, USA under International Research Support Initiative Program (IRSIP), for

completing my PhD research. I pay my deeped regard to my research group at IESE and research

group at University of Florida (UF), USA for all cooperation and help through out my research. I

also admire and value the genuine encouragement, assistance and motivation provided by

respectable, IESE faculty and staff of environmental biotechnology laboratory, in the successful

completion of my research.

I would like to thank my family, especially my parents Mr Manzoor Hussain and Mrs Kaneez

Fatima for their continuous support and encouragement throughout my PhD. I am thankful to my

sister Alia Manzoor and brothers Aamir Manzoor and Adil Manzoor for their motivation and

support in this journey. I also greatly acknowledge the faithful companionship of Iram Gul and

Fasiha Safdar. At the end I also want to value all those people who have created quandaries and

become a source of physiological torment for me.

Maria Manzoor

ii

TABLE OF CONTENTS

LIST OF TABLES ...................................................................................................................................... VI

LIST OF FIGURES ................................................................................................................................... VII

LIST OF ABBREVIATIONS ..................................................................................................................... IX

ABSTRACT ................................................................................................................................................. X

Chapter 1 ...................................................................................................................................................... 1

INTRODUCTION ....................................................................................................................................... 1

1.1. BIOLOGICALLY ASSISTED PHYTOREMEDIATION – POTENTIAL APPROACH .................... 3

1.2. PROBLEM STATEMENT AND RESEARCH GAP............................................................................ 4

1.3. OBJECTIVES AND SCOPE OF STUDY ............................................................................................. 5

1.4. PRESENTATION OF THE WORK ...................................................................................................... 6

Chapter 2 ...................................................................................................................................................... 8

REVIEW OF LITERATURE .................................................................................................................... 8

2.1. LEAD CONTAMINATION AND ENVIRONMENTAL CONCERNS ............................................... 8

2.1.1. Lead Contamination ................................................................................................................ 8

2.1.2. Sources of Pb in the Environment ........................................................................................... 9

2.1.3. Ecological Impacts of Pb ...................................................................................................... 11

2.2. REMEDIATION TECHNOLOGIES .................................................................................................. 15

2.2.1. Phytoremediation techniques ................................................................................................ 16

2.2.2. Phytoextraction ..................................................................................................................... 18

2.2.3. Pb Uptake and Detoxification Mechanism in Plants ............................................................. 19

2.3. CHALLENGES AND FUTURE PROSPECTS IN PHYTOREMEDIATION ................................... 21

2.3.1. Challenges in Phytoremediation ........................................................................................... 21

2.3.2. Role of Synthetic Chelates and Environmental Concerns .................................................... 23

2.3.3. Role of Genetic Engineering in Phytoremediation ............................................................... 24

2.4. BIOLOGICALLY ASSISTED PHYTOREMEDIATION – A VIABLE OPTION ............................ 25

2.4.1. Plant-Microbial Interactions for Pb Phytoextraction ............................................................ 25

2.5. PRESENT STUDY .............................................................................................................................. 30

Chapter 3 .................................................................................................................................................... 32

SCREENING OF LEAD HYPERACCUMULATOR PLANT SPECIES ........................................... 32

A. SCREENING OF INDIGENOUS ORNAMENTAL PLANT SPECIES FOR Pb

ACCUMULATION POTENTIAL ............................................................................................................. 32

3.1. INTRODUCTION ............................................................................................................................... 32

3.2. MATERIALS AND METHODS ......................................................................................................... 34

3.2.1. Preliminary study .................................................................................................................. 34

3.2.2. Soil Sampling, Preparation and Characterization ................................................................. 35

3.2.3. Plant Growth Experiments .................................................................................................... 36

3.2.4. Harvesting and Plant Sample Analysis ................................................................................. 37

3.2.5. Pb Accumulation in Plants .................................................................................................... 38

3.2.6. Statistical Analysis ................................................................................................................ 38

3.3. RESULTS ............................................................................................................................................ 38

iii

3.3.1. Screening for Pb Accumulation Potential ............................................................................. 38

3.3.2. Lead Concentrations in Roots and Shoots of Selected Species ............................................ 40

3.3.3. Plant Biomass at Varying Pb Concentrations ....................................................................... 42

3.3.4. TF, EF and CF ....................................................................................................................... 42

3.3.5. Lead Uptake .......................................................................................................................... 44

3.4. DISCUSSION ...................................................................................................................................... 45

3.5. OUTCOMES AND PERSPECTIVES ................................................................................................. 49

B. LEAD PHYTOAVAILABILITY AND UPTAKE: RHIZOSPHERE STUDY ....................... 51

3.6. BACKGROUND ................................................................................................................................. 51

3.7. MATERIAL AND METHODS ........................................................................................................... 52

3.7.1. Soil and Pb Spiking ............................................................................................................... 52

3.7.2. Pre-Experimental Setup and Plant Acclimatization .............................................................. 52

3.7.3. Rhizosphere Experiment ....................................................................................................... 54

3.7.4. Soil and Plant Analysis ......................................................................................................... 54


3.8. RESULTS AND DISCUSSION .......................................................................................................... 55

3.8.1. Root Induced Rhizosphere Modifications ............................................................................. 55

3.8.2. Lead Concentrations in Shoots and Roots ............................................................................ 59


C. ORGANIC LIGANDS DERIVED LEAD SPECIATION USING SPECIATION MODEL . 65

3.10. INTRODUCTION ............................................................................................................................. 65

3.11. MATERIALS AND METHODS ....................................................................................................... 66

3.12. RESULTS AND DISCUSSION ........................................................................................................ 67

3.12.1. Effect of pH on Pb Speciation in Nutrient Solution ............................................................ 67

3.12.2. Effect of Organic Ligands on Solution pH ......................................................................... 67

3.12.3. Effect of Organic Acids on Pb Speciation in the Nutrient Solution .................................... 68

3.13. SUMMARY ....................................................................................................................................... 70

Chapter 4 .................................................................................................................................................... 71

PLANT-MICROBE INTERACTION IN PHYTOREMEDIATION OF LEAD ................................ 71

A. FUNGI-ENHANCED PLANT GROWTH AND PHYTOEXTRACTION OF LEAD:

TOLERANCE, PGP ACTIVITY AND PHYTOAVAILABILITY ...................................................... 71

4.1. INTRODUCTION ............................................................................................................................... 71


4.2.1. Soil Characterization ............................................................................................................. 73

4.2.2. Pb Tolerant Fungal Strains .................................................................................................... 74

4.2.3. Effect on Soil pH, Organic Matter and Pb Mobility ............................................................. 74

4.2.4. Plant Growth Promoting Activities of Fungal Strains .......................................................... 75

4.2.5. Culture Experiment ............................................................................................................... 77



4.3.1. Pb Tolerant Fungi.................................................................................................................. 77

4.3.2. Effect of Fungi on soil properties.......................................................................................... 79

4.3.3. PGP Assays ........................................................................................................................... 83

iv

4.3.4. Effect of Fungi on Pb Accumulation and Uptake ................................................................. 86


B. METAL TOLERANCE OF ARSENIC-RESISTANT BACTERIA AND THEIR ABILITY

TO PROMOTE PLANT GROWTH OF Pteris vittata IN Pb-CONTAMINATED SOIL .................. 91

4.5. BACKGROUND ................................................................................................................................. 91


4.6.1. Metal Tolerance and Metal Solubilization ............................................................................ 93

4.6.2. Metal Uptake and Metal Resistant Genes ............................................................................. 94

4.6.3. Plant Growth Promoting Hormones ...................................................................................... 95

4.6.4. Effect of Bacteria on P. vittata Growth Under Pb Stress ...................................................... 96



4.7.1. Bacterial Resistance to Pb ..................................................................................................... 97

4.7.2. Genes Involved in Metal Resistance in PG-12 ..................................................................... 99

4.7.3. Bacterial Pb Uptake and Solubilization .............................................................................. 101

4.7.4. Plant Growth Promoting Characteristics ............................................................................. 102

4.8. OUTCOMES AND PROSPECTS ..................................................................................................... 106

C. METAL TOLERANT BACTERIA ENHANCED PHYTOEXTRACTION OF LEAD BY

TWO ACCUMULATOR ORNAMENTAL SPECIES........................................................................ 107

4.9. CONTEXT ......................................................................................................................................... 107

4.10. MATERIALS AND METHODS ..................................................................................................... 108

4.10.1. Isolation and Characterization of Pb Resistant Bacteria ................................................... 108

4.10.2. Effect of Resistant Bacteria of Soil Pb Mobility ............................................................... 109

4.10.3. Molecular Characterization of Resistant Bacterial Strains ............................................... 110

4.10.4. PGP Characteristics of Bacteria ........................................................................................ 110

4.10.5. Influence of Resistant Bacteria on Pb Uptake ................................................................... 112

4.10.6. Statistical Analysis ............................................................................................................ 112

4.11. RESULTS AND DISCUSSION ...................................................................................................... 113

4.11.1. Isolation and Characterization of Pb Resistant Bacterial Strains ...................................... 113

4.11.2. Plant Growth Promoting Traits of Isolated Bacteria ......................................................... 117

4.11.3. Pb Mobilization by Resistant Bacteria .............................................................................. 119

4.11.4. Effect of Pb Resistant Bacteria on Plant Growth .............................................................. 120

4.11.5. Effect of Pb Resistant Bacteria on Pb Uptake ................................................................... 121

4.12. OUTCOMES AND PERSPECTIVES ............................................................................................. 123

Chapter 5 .................................................................................................................................................. 125

EFFECTS OF MICROBIAL CONSORTIUM ON Pb UPTAKE AND ENZYMATIC

ACTIVITIES ........................................................................................................................................... 125

A. EFFECT OF CO-INOCULATION ON PHYTOEXTRACTION OF Pb BY Pelargonium

hortorum ................................................................................................................................................... 125

5.1. INTRODUCTION ............................................................................................................................. 125


5.2.1. In Vitro Screening for Co-Inoculation of Bacteria and Fungi ............................................. 126

5.2.2. Effect of Co-inoculation on Pb Mobility ............................................................................ 127

v

5.2.3. Effect of Co-Inoculation on Pb Accumulation and Uptake ................................................ 127

5.2.4. Harvesting and Plant Analysis ............................................................................................ 128


5.3.1. Compatibility for Co-inoculation of Bacteria and Fungi .................................................... 128

5.3.2. Effect of Co-Inoculation on Soil Pb Mobility and Soil pH ................................................. 130

5.3.3. Plant Biomass and Pb Accumulation .................................................................................. 132 5.4. OUTCOMES AND PERSPECTIVES ............................................................................................... 136

B. EFFECTS OF BIOINOCULANTS ON SOIL ENZYMATIC ACTIVITIES IN Pb

CONTAMINATED SOIL ...................................................................................................................... 137

5.5. BACKGROUND ............................................................................................................................... 137


5.6.1. Soil Characterization ........................................................................................................... 138

5.6.2. Pb Resistant Bacteria .......................................................................................................... 139

5.6.3. Experimental Design ........................................................................................................... 139

5.6.4. Soil Enzymatic Assays ........................................................................................................ 140

5.6.5. Statistical Analysis .............................................................................................................. 140


5.7.1. Soil Characterization ........................................................................................................... 141

5.7.2. Effect of Increasing Pb Concentrations on Soil Enzymatic Activities ................................ 141

5.7.3. Correlation Analysis ........................................................................................................... 143

5.7.4. Microbial Biomass and Respiration .................................................................................... 144

5.7.5. Soil Enzymatic Activities .................................................................................................... 147

5.8. SUMMARY ....................................................................................................................................... 150

Chapter 6 .................................................................................................................................................. 152

CONCLUSIONS AND PERSPECTIVES ............................................................................................ 152

6.1. GENERAL DISCUSSION ................................................................................................................ 152

6.1.1. Pb hyperaccumulator selection ........................................................................................... 152

6.1.2. Plant microbe interactions for Pb phytoextraction .............................................................. 153

6.1.3. Soil enzymatic activities ..................................................................................................... 154

6.2. CONCLUSIONS ................................................................................................................................ 155

6.3. FUTURE PERSPECTIVES ............................................................................................................... 157

6.3.1. Interactive Effect of Multiple Metals and Nutrients in Real Field Soil .............................. 157

6.3.2. Chelators and Phytohormones along with Plant Microbial Interaction .............................. 158

6.3.3. Proteomics and Metabolomics and Gene Expression ......................................................... 159

REFERENCES ........................................................................................................................................ 161

ANNEXURE ............................................................................................................................................ 182

LIST OF PUBLICATIONS ................................................................................................................... 182

vi

LIST OF TABLES

Table 1.1: Lead regulatory standards in the environment. 1

Table 2.1: Heavy metal concentrations likely to exist in soil. 8

Table 2.2: Lead contamination in different areas of Pakistan. 9

Table 2.3: Pb induced phytotoxicity in crop plants. 12

Table 2.4: Pb phytoremediation techniques to decontaminate Pb in environment. 17

Table 2.5: Threshold metal concentration in plants. 18

Table 2.6: Lead hyperaccumulator plant species reported in littrature. 19

Table 2.7: Different studies reported in littrature for microbially enhanced lead uptake. 29

Table 3.1: Characteristics of soil used for research experiment. 36

Table 3.2: Classification of ornamental plants for Pb accumulating abilities. 39

Table 3.3: Pb accumulation characteristics and plant dry biomass. 43

Table 3.4: Composition of nutrient solution used in culture experiment. 53

Table 3.5: Biomass and Pb uptake factors after 15 day of culture experiment. 61

Table 4.1: Reduction in dry biomass, tolerance index (TI) of fungal strains. 83

Table 4.2: Pb uptake (mg) in plants treated with fungi at different soil Pb concentrations. 88

Table 4.3: Primers used to amplify efflux genes in metal resistant bacteria. 94

Table 4.4: Bacterial biomass reduction and tolerance index. 99

Table 4.5: Molecular identification of isolated lead tolerant bacterial strains. 116

Table 4.6: Plant growth promotion traits of bacterial isolates. 118

Table 4.7: Effect of bacterial inoculation on plant biomass. 121

Table 5.1: Total plant biomass (g) co-inoculated with bacteria and fungi. 134

Table 5.2: Physico-chemical characteristics of soil. Values are mean of three replicates. 141

Table 5.3: Correlation among and between soil enzymes and Pb concentration in soil. 143

Table 5.4: Effect of bio-inoculation on soil microbial activity in Pb contaminated soil. 145

Table 5.5: Effect of bio-inoculation on soil enzymatic activities in Pb contaminated soil. 151

vii

LIST OF FIGURES

Figure 1.1: Plant-microbe interaction at soil plant interface. 4

Figure 2.1: Sources and toxicological impacts of Pb in environment. 10

Figure 2.2: Effect of Pb on plant’s physiological activities. 11

Figure 2.3: Soil remediation techniques for Pb. 16

Figure 2.4: Pb uptake mechanism in plants. 20

Figure 2.5: Phytoremediation challenges and constrains. 22

Figure 2.6: Microbial interactions in response to Pb exposure 26

Figure 2.7: Experimental approach and design of study 30

Figure 3.1: Pb concentration in selected plants. 41

Figure 3.2: Pb uptake by selected ornamental plants. 44

Figure 3.3: Locally designed cropping device setup. 53

Figure 3.4: Root induced changes in rhizosphere. 56

Figure 3.5: Root induced changes in soil organic matter 58

Figure 3.6: Lead concentrations in plant parts after three week culture on Pb spiked soil. 60

Figure 3.7: Lead uptake and adsorption by plants. 63

Figure 3.8: Effect of pH on Pb speciation. 67

Figure 3.9: Effect of solution pH and OA on Pb speciation 68

Figure 3.10: Effect of OA conc. on Pb speciation. 69

Figure 4.1: Fungi tolerance to Pb. 78

Figure 4.2: Effect of fungal inoculation on Pb mobility. 79

Figure 4.3: Effect of fungal inoculation on PDA media pH and soil pH. 81

Figure 4.4: Change in organic matter (%) in soil treated with different fungal strains. 82

Figure 4.5: Effect of fungal treatment on Pb accumulation. 87

Figure 4.6: Growth of bacterial isolates on media containing 1 mM Pb. 98

Figure 4.7: Metal uptake, adsorption and solubilization by bacteria. 102

Figure 4.8: Effect of bacteria on P. vittata biomass, pH, Pb and P concentration 103

Figure 4.9: Effect of living (12L) and dead (12D) PG-12 cultures. 105

Figure 4.10: Pb resistance of isolated bacterial strains in LB media. 114

Figure 4.11: Phylogenetic tree showing bacterial identification. 115

viii

Figure 4.12: Effect of bacterial inoculation on water soluble Pb in soil. 120

Figure 4.13: Effect of bacterial inoculation on Pb uptake at different concentration of soil Pb. 122

Figure 5.1: Comparative analysis of antibacterial and antifungal activity. 129

Figure 5.2: Effect of co-inoculation on extractable Pb. 130

Figure 5.3: Effect of co-inoculation on soil pH. 131

Figure 5.4: Effect of co-inoculation on Pb uptake per plant. 135

Figure 5.5: Inhibitory effects of Pb on soil enzymatic activities. 142

Figure 6.1: Interactive effect of nutrients and heavy metals on phytoextraction of Pb. 158

Figure 6.2: Integrated application of plant-bacteria-chelates for phytoextraction of Pb. 159

Figure 6.3: Proteomic and metabolomics basis for Pb uptake and detoxification mechanism. 160

ix

LIST OF ABBREVIATIONS

Abbreviations Stands For

ACC 1-Aminocyclopropane-1-Carboxylate

ACGIH American Council of Government and Industrial Hygienists

ANOVA Analysis of Variance

ATSDR Agency for Toxic Substances and Disease Registry

CDC Centers for Disease Control and Prevention

CPSC Consumer Products Safety Commission

DOC Dissolved Organic Carbon

FDA Food and Drug Administration

GA3 Gibberellic Acid

IAA Indole-3-Acetic Acid

NCCP National Culture Collection of Pakistan

NIOSH National Institute of Occupational Safety and Health

OA Organic Acids

OM Organic Matter

OSHA Occupational Safety and Health Administration

PCR Polymerase Chain Reaction

PGP Plant Growth Promoting

PGPR Plant Growth Promoting Rhizo-bacteria

SPSS Statistical Package for the Social Sciences

TEL Tetraethyl Lead

US-EPA Environmental Protection Agency

x

ABSTRACT

Lead (Pb) is a toxic metal whose widespread use has caused extensive environmental

contamination and health problems through food chain contamination in many parts of the world.

Recently, phytoremediation has appeared as an effective and alternative solution to conventional

physiochemical techniques for removal of Pb from contaminated soil. However, lack of

understanding and information regarding Pb availability, speciation, uptake and translocation

mechanisms, suitable plant species for hyperaccumulating Pb, microbial association that interfere

phytoremediation process at plant soil interface are hindering its full-scale application. The aim of

the current research was to develop an integrated plant-microbial association system for enhanced

remediation of Pb contaminated soils using indigenous biological systems including plants and

microorganisms. In the first step, extensive screening of ornamental plants locally grown in

Pakistan was done for selection of Pb hyperaccumulator plant. Fortunately, two plants

Pelargonium hortorum and Mesembryanthemum criniflorum were selected based on significantly

higher Pb accumulation (>1000 mg Pb kg-1 in shoot dry biomass) and better translocation i.e.,

higher accumulation in shoot compared to root without significant (p<0.05) decrease in plant dry

biomass (up to 1500 mg kg-1 soil Pb conc.). The selected plants were further investigated for root

induced changes in rhizosphere during three-week culture in special cropping device fabricated

locally. Results indicated significant ability of P. hortorum to acidify rhizosphere soil (∆pH= -0.22

pH units) and increasing dissolved organic compounds (DOC) contents (1.4-1.7 –folds) that

induced Pb mobility in soil (1-2 –folds) compared to M. criniflorum and control soil.

Plant-microbial association studies for phytoremediation potential were performed in the

subsequent step. Indigenous Pb resistant bacteria were isolated from soil collected from battery

recycling units in industrial zones of Islamabad and Rawalpindi, Pakistan. Klebsiella

xi

quasipneumoniae (NCCP-1862), Klebsiella variicola (NCCP-1857), Pseudomonas beteli (NCCP-

1845), Microbacterium paraoxydans (NCCP-1848) and Bacillus tequilensis (NCCP-1860)

showed Pb tolerance and solubilization and plant growth promoting (PGP) activity. Plant-bacterial

interaction studies exhibited the potential of M. paraoxydans as efficient bio-inoculant for

increased Pb phytoextraction. Fungal-soil interaction studies showed the ability of Aspergillus

flavus, and Mucor spp. to increase the bioavailable fraction by lowering soil pH. Fungal-plant

interaction studies exhibited the potential of Mucor spp. as efficient bio-inoculant for enhanced Pb

uptake in P. hortorum (2.21 mg per plant) followed by A. flavus (1.85 mg per plant). In the later

step, multiple heavy metal accumulator plants (Pteris vittata) and associated rhizospheric bacteria

were studied for Pb phytoextraction in sterile conditions. The results showed decrease in Pb uptake

while improving plant growth in both inoculated and un-inoculated P. vittata and P. hortorum.

Amplification of metal efflux transporter gene fragments (pbrA, cadA2 and czcR) from

Pseudomonas sp. genomic DNA explained molecular mechanisms involved in Pb resistance and

detoxification in bacteria.

Finally, a novel integrated plant-microbial system was developed through series of experiments

by co-inoculating bacteria and fungi. Strong inhibitory effect of Pb on soil enzymatic activities,

microbial biomass and respiration and significant restoration by bio-inoculants were achieved. Co-

inoculation of bacteria and fungi significantly improve soil enzymatic activities. The outcome of

this detailed investigation provided optimized, efficient and integrated biological system for

enhanced remediation of Pb contaminated sites that could be considered as a potential alternative

to synthetic chelators and reduce the associated environmental concerns. The findings of the

present study may be helpful in developing a pilot scale treatment facility for contaminated soil in

industrial and urban soil.

1

Chapter 1

INTRODUCTION

Industrialization and urbanization all over the world, as well as in Pakistan, has led to release of

noxious effluents, which are inappropriate for soil, water and eventually for crop acquiesce (WHO,

2017). Heavy metals (HM) pollution of soil is a widespread problem throughout woprld that

threatens the quality of human and environmental health. Lead is one of the prominent examples

for anthropogenic environmental metal pollution. In natural soils, concentration of Pb is 10-100

mg kg-1 whereas in industrial zones, Pb concentration up to 39,250 mg kg-1 has been reported

(Greipsson et al., 2013; Arshad et al., 2008). Lead permissible limits in air, water and soil are given

in table 1.1.

Table 1. 1: Lead regulatory standards in environment (ATSDR, 2018, EPA, 2001).

Organizations Medium Limits EPA Soil (residential) 400 mg kg-1 (play areas) EPA Air (ambient) 0.15 µg/m

3 ACGIH Air (workplace) 50 µg/m

3 NIOSH Air (workplace) 50 µg/m3 OSHA Air (workplace) 50 µg/m

3 EPA Water (drinking) 15 µg L-1 FDA Drinking water 5 ppb CPSC Paint (0.009%) ACGIH Blood 30 µg dL-1 CDC Blood 5 µg dL-1 OSHA Blood 40 µg dL-1

These high concentrations of Pb in industrial sectors is attributed to activities including smelting

or ores and burning of fuels and recycling of batteries. A study by Memon et al. (2014) reported

high concentrations of Pb in soils and grasses near battery recycling complex Hyderabad Pakistan

and consequent toxicity and health impacts on animals. Similar Pb contamination has also been

2

reported by Afzal et al. (2014) in Gujranwala and consequent toxicity impacts on human

population. Pb toxicity leads to decreases in germination percentage, length and dry mass of root

and shoots disturbed mineral nutrition, reduction in cell division (Bashmakov et al., 2017; WHO,

2017; Hossain et al., 2012). Through agricultural products, these heavy metals may enter into the

food chain and can potentially cause human liver and brain damage (Kushwaha et al., 2018). It is

reported that Pb is one of the most persistent metals. The soil retention time of Pb is estimated to

be 150 to 5000 years (Sobolev & Begonia, 2008). It is potentially toxic even at low concentrations,

and concentration above 400–500 mg Pb kg-1 is considered a risk for agriculture production and

human health (US-EPA, 2001). In this context, there is urgent need for exploring the remediation

options for wide spread Pb contamination.

Physico-chemical techniques for Pb remediation such as soil excavation, landfilling, acid leaching

and electro-reclamation are not suitable for practical applications, because of their high cost,

physical disturbance of land, destruction of soil structure and production of secondary waste that

can destroy soil microflora. Biological treatment methods provide affordable alternative solution

to soil remediation, through phytoremediation strategies. The use of plants to decontaminate soils

offers an environment-friendly solution to soil remediation (Gul et al., 2019; Arshad et al., 2016,

2008). Arshad et al. (2008) reported three cultivars of scented Pelargonium species as Pb-

hyperaccumulator plants: they accumulated more than 1000 mg Pb kg-1 dry weight and produced

high biomass. The factors that limit phytoremediation efficiency include various external (soil)

and internal (plant physiological) processes that directly or indirectly affect Pb phytoextration.

Bioavailability is a serious limiting factor that lowers the phytoremediation efficiency. To solve

this problem, various organic and inorganic synthetic chelating agents like EDTA have been

extensively studied for improving the solubility of Pb in soils and consequent uptake by plants

3

(Gul et al., 2019; Zhang et al., 2016; Shahid et al., 2014). However, there are several environmental

concerns associated with the use of these synthetic chelates including low biodegradeability

(Pandey & Bhattacharya, 2018), leaching, ground water contamination and toxicity to soil

microbial diversity and enzymatic activities (Lu et al., 2017). Keeping in mind the environmental

concerns in using synthetic chelates, the current study was focused on investigating the potential

of bio-inoculants for enhancing the phytoremediation process.

1.1. Biologically Assisted Phytoremediation – Potential Approach

The fate of Pb in soils is directly and/or indirectly governe by soil microorganisms (bacteria and

fungi). These microorganisms and their extracellular enzymes are responsible for dissolution,

precipitation, complex formation and stabilization of Pb in soil. Different studies have explored

the functional ability of these bacteria and fungi for improved phytoextraction of Pb. Many soil

bacteria like Pseudomonas aeruginosa, Pseudomonas fluorescens, Ralstonia metallidurans,

Bacillus edaphicus, Bradyrhizobium sp., Ochrobactrum cytisi, Azotobacter chroococcum, Bacillus

megaterium and Bacillus mucillaginosus have been found efficient in increasing Pb uptake and

plant growth in different studies (Dary et al., 2010; Braud et al., 2009; Sheng et al., 2008b; Wu et

al., 2006). Similarly, many fungal strains have also been found to have promising effects on Pb

phytoextraction particularly saprophytic and mycorrhizal fungi including Glomus mosseae, Lewia

sp. and Mucor sp. (Loria et al., 2015; Deng et al., 2011; Punamiya et al., 2010).

In phytoremediation, the intrinsic ability of plant is responsible for rhizosphere modification and

uptake of Pb. Plants can modify the rhizosphere through excretion of root exudates. The

application of Pb tolerant, solubilizing and plant growth promoting microorganisms (bacteria and

fungi) can alleviate the toxicity of Pb by promoting plant growth under elevated soil Pb

4

concentration and increase the phytoabvailability and subsequent uptake by plant as illustrated in

figure 1.1.

1.2. Problem Statement and Research Gap

Although some related work has been done, but currently no treatment methods are being applied

in Pakistan. Conventional treatment methods are not cost effective and environmently acceptable.

Biologically assisted phytoremediation has the potential to remediate Pb contaminated soils.

However, there are certain short comings.

The identification of appropriate bacterial and fungal strains in the study area is needed.

For efficient phytoremediation system, indigenous plants and microbial population need to

be identified.

Pb

Pb

Pb

Pb

Pb

Pb Pb Pb

M+P

Bio chelation

P

Pb+2

Pb (Sulphate,

phosphate,

hydroxides) Pb

+2

Pb+2

Pb+2

Pb+2

Root exudates (Citric, oxalic, malic,

tartaric acids)

High pH

Solubilization

Induce root exudation Bio chelates Pb Siderophores Reduce pH

Lower pH

Increase DOC

Dissolution Pb

PGPR activity Phytohormones

production Reduce metal toxicity

Improve

growth

Figure 1. 1: Plant-microbe interaction at soil plant interface that induced Pb availability and

phytoextraction (Shahid et al., 2010; Arshad et al., 2016; Loria et al., 2015). P and M+P indicate

plant and microbial + plant interaction for phytoremediation of Pb.

5

These studies remain limited to particular plants and microorganism interactions that have

climatic and edaphic limitations.

Combinations of bacterial and fungal strains for the development of integrated biological

systems for enhanced phytoextraction are not available.

Plant microbe interactions at soil plant interface need to be studied in detail for improving

phytoremediation efficiency.

1.3. Objectives and Scope of Study

Based on the extent of the problem and study gaps, it was hypothesized that indigenous Pb

hyperaccumulator plant species, in combination with indigenous Pb tolerant and solubilizing

bacteria and fungi, could be more suitable for improved Pb phytoremediation and would reduce

environmental concerns. Keeping in mind the hypothesis and problem statement, the objectives

with stepwise experiments are as follows;

1. Screening of indigenous plant species capable of extracting high levels of Pb

Ornamental plant species were investigated for Pb hyperaccumulation potential in pot

experimental setup using Pb spiked soils. Twenty-one plant species were subjected to screening

for Pb uptake characteristics and biomass production. Selected plant species were then studied for

rhizosphere induced Pb phytoavailbility in cropping device setups.

2. Isolation and characterization of bacterial and fungal strains for Pb mobilization in

contaminated soil

Bacteria were isolated from Pb contaminated soils and characterized for Pb tolerance,

mobilization, plant growth promotion and Pb phytoextraction potential. Selected strains were

finally identified through 16SrRNA gene sequencing. Fungal strains, pre-isolated from heavy

metal-contaminated soils, were obtained and characterized in similar manner.

6

3. Effects of applying microbial consortium on Pb solubility and enzymatic activity.

Bacterial and fungal interaction on soil enzymatic activity and Pb solubility were studied in soil

incubation experiments. In last step, plant-microbe (bacteria+fungi) interaction for imoroved Pb

phytoextraction was studied in pot experimental setup.

1.4. Presentation of the Work

In view of understanding and describing the background of the scientific problem, objectives of

study, advances in research, methodology and experimental design, outcomes and conclusions of

study, the desertation have been divided in 5 different chapters. The first chapter provides the

background, need and scope of this study, highlighting specific objectives. The second chapter

covers in detail the ecological toxicity, available remediation techniques, challenges, recent

developments and short comings in microbially assisted phytoremediation techniques.

Methodologies are presented along with respective results and discussion. Results are divided in

two chapters. Chapter 3 covers experiments for screening of indigenous plant species capable of

extracting high levels of Pb, rhizosphere study of selected plants and role of organic acids in Pb

speciation. Chapter 4 is divided in three sections. The first section covers fungal-plant interactions.

It includes characterization of fungal strains for Pb tolerance, mobilization, plant growth

promotion and interaction for phytoextraction of Pb. The second section is about bacterial studies.

In this section, multiple heavy metal resistant bacteria were investigated for plant growth

promotion under Pb stress and the molecular mechanisms were studied through amplification of

heavy metal resistant genes. The strains improved plant growth under Pb stress but decreased the

Pb uptake by phytostabilizing Pb in roots and soil. Therefore, the study was repeated, and

indigenous bacteria were isolated and characterized for Pb tolerance, mobilization, plant growth

promoting characteristics and improving phytoextraction potential of plants. Results are presented

7

in section three. In chapter five, last objective is covered and work is divided in two sections. The

first section covers effects of co-inoculation of bacteria-fungi on Pb uptake by selected plant and

the second section covers impacts of microbial inoculation on soil enzymatic activity under Pb

stress. The last chapter presents conclusions and future perspectives, summarizing brief outcomes

of this study and outlining the possible directions for extention of this work.

8

Chapter 2

REVIEW OF LITERATURE

2.1. LEAD CONTAMINATION AND ENVIRONMENTAL CONCERNS

2.1.1. Lead Contamination

Development of industrialization and mechanization since beginning of 19th century has led to

increase in anthropogenic human activities that generated enormous number of toxic contaminants

including metals and metalloid, which ultimately are posing serious damage to ecological and

environmental health (WHO, 2017). Most commonly present heavy metals in the environment that

induce toxicity to biological systems are; lead (Pb), cadmium (Cd), chromium (Cr), copper (Cu),

mercury (Hg) and nickel (Ni). The average and acceptable metal concentrations in soil are given

in table 2.1. Among them, Pb remains one of the most common heavy metal in the surface soil

because of its increased use, high persistence and low mobility.

Table 2. 1: Heavy metal concentrations likely to exist in soil (mg kg−1 dry soil) (EPA, 2005;

Sezgian et al., 2004; WHO, 2017).

Metal(iod)s Concentration in

uncontaminated soil

Threadhold levels in

contaminated soil

Permissible limits in

plants

As 7-40 0.39-40 0.5

Cd 0.1-1 3 0.02

Cu 5.0-20 50 10

Ni 10.0-50 50 10

Pb 0.1-20 200 2

Zn 10.0-50 300 0.60

Lead is a wide spread heavy metal contaminant, considered as being a serious ecological concern

worldwide. It is ubiquitous in the environment besides being non-biodegradable, highly persistent,

with a low mobility and poor solubility. The predominant forms of Pb in soil are phosphates,

carbonates, oxides and hydroxides which are highly insoluble forms states of Pb in soil. However,

9

nitrates, chlorates and chlorides salts are merely soluble in water (WHO, 2001). Pb contamination

in differen region of Pakistan is given in table 2.2.

Table 2. 2: Lead contamination in different areas of Pakistan

Locations Pb (mg kg-1) References

Urban soils and road dusts

Islamabad 212 Ali & Malik, 2011

Islamabad (drain side) 203 Ali & Malik, 2011

Islamabad (green area) 209 Ali & Malik, 2011

Rawalpindi 146 Abbasi et al., 2013

Lahore 168 Siddique et al., 2011

SGV 450 Shi et al., 2008

CEQSS-II 300 Ni et al., 2009

Northern area

Kohistan region 103000 Muhammad et al., 2011

Pazang site 117 Muhammad et al., 2011

Lahor Site 1753 Muhammad et al., 2011

SGV 450 Shi et al., 2008

CEQSS-II 300 Ni et al., 2009

2.1.2. Sources of Pb in the Environment

The biggest and most profound source of Pb contamination is industrial, transportation and energy

sector (figure 2.2). It has wide industrial applications and mostly used in the form of tetraethyl lead

(TEL) ((CH₃CH₂)₄Pb). TEL was extensively used in gasoline in the past and its current application

in aviation fuel makes Pb as one of the most common and wide spread heavy metal contaminants

in soils (Kessler, 2013). Emissions from burning of fuels containing tertra ethyl lead and batteries

recycling process generated large quantity of fumes containing Pb. The Pb thereby travels large

distances and deposits on top soil at far proximal surroundings of industrial source resulting in

unacceptable increase of soil Pb concentrations (>200 ppm) (Greipsson et al., 2013). According to

an estimation, millions of hectares of area in urban and peri-urban area have been contaminated

with Pb and require immediate remediation (ATSDR, 2018; WHO, 2017; EPA, 2001).

10

Figure 2.1: Sources and toxicological impacts of Pb in environment (Chen et al., 2006; IARC, 2006; Fewtrell et al., 2004; US-EPA,

2001)

Pb2+

Persistence

Low Mobility

Sources of Pb contamination

Pb is toxic (>400–500 mg Pb kg-1 in soil)

1% of the global disease

IARC

Group 2B (organic Pb) Group 3A (Inorganic)

Pb contamination in soilPb toxicity in

plants -Slow growth rate

-Less biomass

-Yellowing of leaves

-Inefficient root

system

Pb toxicity in humans Neurological

Hematological

Cardiovascular

Reproductive

Kidney

78% Lead used in battery

50% Lead production by battery recycling

Metal plating and finishing

Battery industries

Smelting of ores

Urban soil

waste

Exhaust from

Automobiles

Additives in gasoline

Factory chimneys

11

2.1.3. Ecological Impacts of Pb

Heavy metals being non-biodegradable once come in soil remains there for long period of time

and becomes a continuous source of heavy metal toxicity. Therefore, contamination of

agricultural soil by Pb is a significant problem causing toxicity to plants animals and microflora.

2.1.3.1. Pb toxicity in plants

Lead is a major soil heavy metal pollutant that induces phyto-toxicity (Shahid, 2011). Pb enters

plants through root hairs in soil (Lasat, 2002) and or through air deposition (Uzu et al., 2010).

Lead exposure causes damage to cell membrane, impair seed germination, disturb cell division

and cell elongation, reduce root length, reduce transpiration, lower chlorophyll production,

induce oxidative stress and resulting production of reactive oxygen species (ROS) radical’s

including superoxide (O2-), hydroxyl (OH-), perhydroxyl (HO2 -), alkoxy (RO), as well as the

non-radicals hydrogen peroxide (H2O2) and singlet oxygen (O2)) (Anjum et al., 2015, Pourrut et

al., 2008) as summerised in figure 2.2.

Uptake of Cations

(K+, Ca

+, Mg

2+, Mn

2+,

Zn2+

, Cu2+

, Fe3+

)

Uptake of anions

Cell turgor pressure

and structure

Guard cell size

Stomatal

conductance

Abscisic acid level

Leaf area

Alteration in thylakoid

membrane composition

Chlorophyll II, plastoquinone,

carotenoids, NADPH activity,

oxidoreductase

Electron transport

Enzymatic activity of Calvin

cycle

Irregular shape

DNA damage

Micronucleus

Mitotic

irregularities

Chromosome

Electron transport

Proton transport

Enzymatic activities

of Kerb’s cycle

PPP

P

P

PPP

CELL DIVISION

PHOTOSYNTHESIS RESPIRATION

WATER REGIME

NUTRIENT UPTAKE

Figure 2. 2: Effect of Pb on plant’s physiological activities (Roy & McDonald, 2015; Pourrut et al.,

2011).

12

The uptake of Pb in edible plants is also a serious concern. Ahmad & Goni (2010) observed the

concentrations of Pb in vegetables grown in agricultural soils of Bangladesh in the range of 10-

26 mg kg–1 dry weight. Whereas, the acceptable tolerance level of Pb concentration in vegitables

is 5 mg Pb kg–1 dry weight and 10-20 mg Pb kg–1 dry weight given by FAO and WHO

(Sauerbeck, 1982). Moreover, once Pb is uptaken, it causes severe damage to plant physiological

and reproductive systems. Lead induced phyto-toxicity in crop plants is summarized in table 2.3.

Table 2.3: Pb induced phytotoxicity in crop plants.

Plants Pb conc. Pb induced toxicity References

Maize (Zea mays) 0, 25, 50,

100, 200,

500 mM

Decrease germination percentage, reduce

plant biomass & protein content

Hussain et

al., 2013

Scented Rice

(Meixiangzhan-2,

Xinagyaxiangzhan

and Basmati-385)

400, 800,

and 1200

mg kg-1

Reduced photosynthetic pigments

(chlorophyll contents and carotenoids) and

induced oxidative stress

Reduced yield of all rice cultivars

Ashraf et

al., 2017

Vicia faba 5 µM Induction of MDA and H2O2 content Shahid et

al., 2015

Water hyacinths

(Eichhornia

crassipes Mart.)

100, 200,

400, 600,

800, 1000

mg L-1

50% inhibition in plant growth at 1000 mg

L-1 Pb concentration

Decreased the chlorophyll content

Malar et

al., 2016

Wheat (Triticum

aestivum)

50 and 250

μM

36% and 89% higher MDA content

compared to control after 2 h of exposure

Induced ROC 80% and 206% over the

untreated control in response to 50 and 250

μM Pb

Kaur et al.,

2015

Vicia faba 5 µM Increased the activities of superoxide

dismutases (SOD), guaiacol peroxidase

(GPOX), ascorbate peroxidase (APX) and

glutathione reductase (GR)

Shahid et

al., 2014

Wheat (Triticum

aestivum)

2 mM Decrease in the activity of Rubisco and ATP

sulfurylase (ATP-S), chlorophyll and

nutrients content in Pb-treated plants.

Alamri et

al., 2018

2.1.3.2. Pb toxicity in human

Many crop plants can uptake these toxic and non-essential metal elements and thereby raising

the risk of food chain contamination with toxic heavy metals leading to wide health concerns of

13

human and animals (Roy & McDonald, 2015). The Centers for Disease Control and Prevention

(CDC) has stated that soil containing >50 mg kg-1 of Pb, poses serious risk to human health. Pb

can enter through dermal exposure, possible ingestion, inhailing, uptake by plants (CDC, 2010).

Detrimental effects of Pb are depicted almost in every organ of body but most frequently affected

and sensitive organs include nervous system, cardiovascular system, reproductive system and

excretory system. Pb poisoning is more common in children compared to adults. The

bioaccumulation of Pb in human body over time causes serious ill effects such as headaches,

short term memory loss, mental disorders, muscle and joint pains, gastro intestinal disorders,

food intolerance, fatigue, metabolic problems and mental confusions (Kushwaha et al., 2018).

2.1.3.3. Effect of Pb on soil microbial communities

Microorganisms differ in their ability to cope with heavy metal stress. Some microorganisms

have intrinsic ability to uptake heavy metals, resist the metal without any change in growth,

tolerate up to certain level, change the metal toxic state to less toxic through enzymatic activity

and chelation, however, some microorganisms can die out due to toxic effect of the same metal.

Therefore, the ability of microrganisms to behave differently under changing environmental

conditions tends to change the microbial community structure and diversity.

a. Microbial Community Structure and Diversity

Soil contaminated with heavy metals particularly with Pb have been repeatedly reported as

posing inhibitory effects on soil microbial community directly or indirectly by affecting their

structure and diversity. The culture independent techniques such as polymerase chain reaction-

denaturing gradient gel electrophoresis (PCR-DGGE) and phospholipid fatty acid (PLFA)

analysis are frequently and widely used techniques for analysis of soil microbial communities.

Shifts in soil microbial communities due to Pb contamination have been reported in a study

14

conducted at polluted site (Indiana Department of Transportation (INDOT), USA). PLFA

analysis indicated that soil containing less concentration of Pb and Cr were higher in mole

fractions of branched-chain PLFA and cyclopropane PLFA (bacterial origin), whereas at higher

concentration of Pb, and Cr and hydrocarbons, the PLFA of fungal origin (polyunsaturated

18:2w9,12) was significantly higher (Joynt et al., 2006). Microbial community diversity,

evaluated by DGGE analysis, also showes direct effect of Pb on microbial diversity and

abundance. Similarly, in another study the detrimental effects of low (1 mg kg-1) and high (500–

2000 mg kg-1) levels of Pb on soil microbial communities were investigated by DGGE

community analysis (Sobolev & Begonia, 2008). The sequencing results of denaturing gradient

gel electrophoresis bands indicated that Pb inhibited the growth of Acidobacteria, Ascomycota

and Chytridiomycota. The PCR data of 16S and 18S r RNA copies further revealed that Pb was

more toxic to fungi compared to bacteria (Chen et al., 2014). Qing et al. (2007) also studied

microbial diversity around Pb-Zn mine tailing through PCR-DGGE technique and observed

decrease in bacterial diversity with decrease in distance from Pb-Zn mine. Now a days, high

throughput sequencing analysis techniques are applied to assess the ecotoxicological effects of

Pb on soil microbial community structures. In a study conducted by Zhang et al. (2016), the soil

microbial community structure indices and miseq-pyrosequencing results clearly indicated

inhibition of microbial richness and diversity on exposure to decabromodiphenyl ether-Pb. A

recent study by Yu et al. (2019) also confirmed the detrimental effects of Pb soil microbial

diversity and composition. The study reported slight decrease in values of Ace, Chao1, Simpson,

and Shannon-Weaver indices in soil containing 400 mg kg-1 Pb. The community profiles

indicated presence of Actinobacteria (17.77–48.53%) and Proteobacteria (17.85–39.66%) as

15

dominant phylums in all experimental groups. However, at 400 mg kg-1 soil Pb concentration,

Bacteroidetes and Firmicutes were the most abundant phylum observed.

b. Soil enzymatic activities

The health of ecosystem in terms of environmental contamination from natural or anthropogenic

sources is expressed widely by estimating the soil enzymatic activity due do their hypersensitivity

to slight change in environmental conditions (Jaiswal & Pandey, 2018). Several studies have

confirmed the direct inactivation of enzymatic activity in soil upon heavy metal interaction with

sulphydral groups, and indirect by altering the composition and diversity of microbial community

by changing the favorable environmental conditions which are necessary to synthesizes enzymes

(Kandeler et al., 2000). The majority of reactions that takes place in the environment, particularly

in soil environment, includes decomposition, degradation, mineralization and immobilization are

catalyzed by enzymes and most of them are produced by active microbial communities (Jaiswal

& Pandey, 2018; Cui et al., 2013). Alkaline phosphatase (ALP) and dehydrogenase (DEH)

activities were significantly decreased at increasing levels of heavy metal, the decrease in ALP

and DEH activities were 13.1%–24.3% and 12.1%–18.2% in 500 mg kg-1 Pb treated soils,

respectively (Sardar et al., 2007).

2.2. REMEDIATION TECHNOLOGIES

Figure 2.3 summarizes various physical, chemical and biological approaches that are utilized for

remediation of Pb contaminated soil. None of these physiochemical treatment methods are

feasible and reduce Pb toxicity by just transforming the oxidation state of Pb and also have

adverse effects on soil physical, chemical and biological properties (Mohammed et al., 2013).

Considering environmental safety and remediation of Pb contaminated soil, biological treatment

methods offer wide range of treatment options that are more environment. Bioremediation

16

techniques are safer, environment friendly (Dubchak & Bondar, 2019) and low cost compared to

conventional techniques as reported by Blaylock et al. (1997), where 50–65% cost was saved for

1 acre of soil remediated using bioremediation techniques compared to conventional methods

(excavation and landfill). In the recent years, more interest has been shown in plant-based

remediation of toxic heavy metals owing to high metal accumulation properties and higher

biomass production in presence of metal contaminated soil.

Figure 2. 3: Soil remediation techniques for Pb.

2.2.1. Phytoremediation techniques

Phytoremediation is the ability of metal tolerant plants to remediate heavy metals from soil.

Plants use different strategies to cope with metal pollution. It is low cost, ecofriendly,

Pb remediation

Techniques

Physical methods

Incineration

Washing

Land excavation

Land filling

Chemical methods

Extractive metallurgy

Precipitation

Pyrometallurgy

Hydrometallurgy

Biometallurgy

Bioremediation

Phyto-remediation

Phytoextraction

Phyto-stabilization

Rhizofiltration

Micro-remediation

Bacteria

Fungi

Algae

Vermi remediation

17

nondestructive and natural technique to remove toxic heavy metals including Pb from soil. Metal

tolerant plants also known as metallophytes can be classified into three major categories (Baker

& Brooks, 1989): a) excluders, in which metal concentrations in the shoot are kept lower than

metal concentration in soil; b) accumulators, in this strategy, plants concentrate metals in above-

ground plant parts; and c) indicators, in which plants maintain a linear relationship between plant

and soil metal concentrations.

Table 2. 4: Pb phytoremediation techniques emploid to decontaminate Pb in environment.

Techniques Plants sp. Soil Pb conc. Plant characteristics References

Phytoextraction

Bidens pilosa Surrounding

Pb mines

(4881–5255

mg kg-1)

Shoot Pb conc. > 1000 mg

kg-1

TF > 1

Yongpisanphop

et al., 2017

Alcea aucheri Natural ore

deposit (> 500

mg kg-1)

Remediation of 204.12 kg

ha-1 Pb

Ravanbakhsh et

al., 2016

Colocasia

esculenta L.

0, 50, 200 and

400 μM.

1121 shoot conc. mg kg-1

mg kg-1

TF >1

Islam et al.,

2016

Colocasia

esculenta L.

0, 300, 600

and 1200 mg

kg-1

Shoots Pb conc. 7748 mg

kg-1

Islam et al.,

2016

Phytostabilization Thysanolaena

latifolia and

Mimosa

pudica

Pb mines

4881–5255

mg kg-1

Excluder

BF> 1 and TF < 1

Yongpisanphop

et al., 2017

Brachiaria

reptans L. &

Solanum

nigrum L.

2.0–29.0 mg

kg-1

BF >1

TF <1 for Pb

Malik et al.,

2010

Rhizofiltration Eichhornia

crassipes

(Mart.), and

Myriophyllum

aquaticum

(Vell.)

-

97.88 % of Pb removal Romero-

Hernández et

al., 2017

Carex

pendula

1, 5, 10 mg L-

1

Tolerance upto1600 mg

kg-1 Pb

Yadav et al.,

2011

18

More accumulation in root

compared to shoot Bioconcentration Factor=BF; Biotranslocation Factor=TF.

Here in this case, the internal tissue concentration reflects the external soil levels. Regarding Pb

contamination, the three major phytoremediation strategies, extensively employed, are

phytoextraction, phytostabilization and rhizofiltration (Pilon-Smits, 2005). Few case studies for

each type from literature have been summarized in table 2.4.

2.2.2. Phytoextraction

Phytoextraction is the intrinsic ability of plants to sequester high amounts of toxic heavy metal

though roots and transport and accumulate in above ground tissues. There is a certain group of

plants that can accumulate elevated metal concentration in aerial parts of plants without

compromising biomass loss. There plants are termed as hyperaccumulators. The threshold metal

concentration in plants for different metals in hyperaccumulator plant species and Pb

hyperaccumulators so far identified are given in table 2.5 and 2.6, respectively.

Table 2.5: Threshold metal concentrations in plants for different metals in hyperaccumulator

plant species.

Heavy metals Threshold levels

(mg kg-1)

Baker & Brooks (1989)

Revised levels

(mg kg-1)

Van der Ent et al. (2013)

Arsenic 1000 1000

Cadmium 100 100

Cobalt 1000 300

Copper 1000 300

Chromium 1000 300

Lead 1000 1000

Manganese 10,000 10,000

Nickel 1000 1000

Zinc 10,000 3000

Some plants accumulate higher concentrations of Pb in roots than in shoots. They limit the

translocation to shoots, and the strategy is termed as phytostabilization. Removal of heavy metals

19

from water using plants is termed as rhizofiltration (Anawar et al., 2008). This may involve

different mechanisms including absorption of metals in root cells by the process of

chemisorption, ion exchange, and complexation (Lasat, 2002), adsorption through complexation

with different functional groups of organic compounds present in mucilage and epidermal cells

(Sanchez-Galván & Olguín, 2009).

Table 2. 6: Some examples of Pb hyperaccumulator plant species reported in the litterature.

Hyperaccumulators Heavy metals Features References

Pelargonium species Pb >1000 mg kg-1 in shoot

TF >1

Arshad et al.,

2008

Alcea aucheri Pb, Cd >1000 mg kg-1 Pb in

shoot biomass

Remediation of 204.12

kg ha−1 Pb from soil in a

48 days period

Ravanbakhsh

et al., 2016

Cortaderia

hapalotricha

Pb and Zn >1000 mg kg-1 in shoot

TF >1

Bech et al.,

2016

Colocasia esculenta

L.

Pb 7748 mg kg-1 in shoot Islam et al.,

2016

2.2.3. Pb Uptake and Detoxification Mechanism in Plants

The figure 2.4 shows the schematic uptake of Pb in plants. Lead enters the plant through root

hairs in soil. Generally, the bioavailable Pb in soil is adsorbed on to root surface and is attached

to mucilage (carboxyl groups), uronic acid and polysaccharides of the rhizoderm cells (Seregin

et al., 2004). Once adsorbed, Pb may enter in roots passively and translocate along water channel.

Pb concentration gradient is never uniform along root cells (Seregin et al., 2004). It is observed

that the highest Pb concentrations are mostly found around root apices. The cells in root apex are

thin walled and the low rhizospheric pH facilitates Pb solubility and uptake (Seregin et al., 2004).

The uptake and translocation through biological membranes of both necessary (e.g Cu2+, Zn2+,

Mn2+) and unnecessary metals (e.g., Cd2+, Pb2+, Hg2+) are brought about by P-type ATPases

(Williams et al., 2000). Although Pb uptake is a non-selective and greatly depends on strong

20

negative membrane potential in rhizoderm cells as kept by H+/ATPase pump (Wang et al., 2007).

The main pathway by which Pb enters roots is the Ca2+ permeable channels as documented by

different researchers (Pourrut et al., 2008; Wang et al., 2007). However, transgenic plants also

showed other non-selective channels for Pb uptake. These include cyclic nucleotide-gated ion

channels (Pourrut et al., 2010; Kohler et al., 1999) and low-affinity cation transporters. Metals

that are absorbed by the plant roots, enters the xylem through passive and or slow diffusion

through cell walls of different cells. They are transported through the xylem to different parts of

plant where they are detoxified and accumulated (Lasat, 2002).

Xylem loading

Pb translocation

Upward

movement

Dissolved salts/ nutrients

Casparian strip-

block apoplas Pb

movement

Apoplast

movement

Pb uptake

in roots

Cell wall Sequestration in

cell wall Xylem unloading

Vacuole

Pb storage in

vacuole

Pb translocation to

shoot through

symplast pathway

Figure 2. 4: Pb uptake mechanism in plants.

21

Hyperaccumulator plants have evolved unique mechanisms to detoxify Pb inside plant tissue.

The mechanisms include highly selective Pb uptake, exudation of phytohormones, chelation with

specific ligands, metal binding to root surface, reduction and compartmentalization. Further, the

induction of antioxidants including non-protein thiol (NP-SH), cysteine, glutathione, ascorbic

acid, proline and enzymes (superoxide dismutase (SOD), ascorbate peroxidase (APX), guaiacol

peroxidase (GPX), catalase (CAT), and glutathione reductase (GR)) helps in reducing the Pb

stress and tolerance in plants (Anjum et al., 2015; Pourrut et al., 2008).

2.3. CHALLENGES AND FUTURE PROSPECTS IN PHYTOREMEDIATION

2.3.1. Challenges in Phytoremediation

Pb availability is one of the most important challenge that limits the phytoremediation efficiency

of specialized plants. Mostly encountered factors that limits phytoremediation efficiency are

elaborated in figure 2.5. Lead is normally bound to soil organic matter fractions or strongly

adsorbed on to mineral and soil particles. One of the major factor that determines the speciation

of Pb in soil is the pH. Low pH generally favors Pb solubilization and activity as free Pb2+ ion,

which reduces as pH tends to increase (Shahid, 2010). At high pH, Pb is either adsorbed,

precipitaded or complexed with hydroxyl ions and other soil particles and lower the available

fraction of Pb in soil. Soil pH influence negative surface affinity (CEC) of soil for metal ions

including Pb2+ (Wu et al., 2003), which results in Pb adsorption to soil particles. In soil plant

system pH interfere with phytoavailability of Pb through ion pairing and altering the solubility

of carbonates, hydroxides and phosphates and organic matter (Romero-Freire et al., 2015) which

ultimately reduces Pb availability and phytoextraction (Arshad et al., 2016).

22

Figure 2. 5: Phytoremediation challenges and constrains in past developments (Arshad et al.,

2016, 2008; Shahid et al 2014).

Organic matter also greatly influences fate of Pb in soil. Lead is generally adsorbed and

immobilized by soil organic matter fractions. Dissolved organic matter (DOM) like humic acid

can interact with Pb2+ making its unavailable for plant uptake. It is reported that humic substance

have greater Pb complexation ability than the essential nutrients (Ca, Fe and K) (Botero et al.,

2010). Whereas some studies also showed Pb dissolution is governed by DOM which increases

Pb solubility upon rise in pH by making soluble organo-Pb complexes (Shahid et al., 2012a). The

dual function of soil organic matter greatly depends on composition of organic matter.

Phytoremediation efficiency is directly related to ability of plant to sequester higher

concentration of Pb in plant tissue and ability to produce high biomass. It is observed that Pb

induced toxicity in plants at higher concentration and plant biomass reduced which ultimately

23

reduced the overall uptake of Pb and phytoremediation efficiency (Arshad et al., 2016, 2008;

Shahid et al., 2012a). In this regard, there is need to investigate potential additives that reduce

the Pb induced toxicity or support plant growth and biomass production in high metal

contaminated soils.

2.3.2. Role of Synthetic Chelates and Environmental Concerns

Synthatic chelates have been extensively studied for enhancing the Pb phytoavailability and

consequent uptake by plants. The most important chelates that successfully improved the

phytoextraction characteristics of treated plants include ethylenediaminetetraacetic acid (EDTA),

nitrilotriacetate (NTA), diethylenetriaminepentaacetic acid (DTPA), N-hydroxy

ethylenediaminetriacetic acid (HEDTA), ethylenediaminedisuccinate (EDDS) and citric acid.

Application of EDTA (3.148 mmol kg-1) increased shoot Pb concentration from 680.56 to

1905.57 mg kg-1 in Bidens maximowicziana (Wang et al., 2007). In another study, EDTA at 5

mmol kg-1 increased Pb uptake by 8.9– & 13.3–fold in two cultivars of Ricinus communis L.

(Zibo-3 & Zibo-9) compared to control plants (Zhang et al., 2016). Lu et al. (2017) also reported

1.69, 1.54, and 1.24–folds higher Pb phytoextraction in Zea mays L. when applied with 2.5 mmol

EDTA kg-1 soil. Similarly, EDDS (5mmol kg-1) also increased Pb uptake by 2.3 & 2.9–times for

Zibo-3 & Zibo-9, respectively in Ricinus communis L.

There are several environmental concerns associated with the use of these synthetic chelates

including Pb leaching to ground water, toxicity to plants, low plant biomass production, increased

soil acidity, low biodegradability of synthetic chelates, and toxic secondary metabolites

production may also cause damage to soil microbial and enzymatic activities. The most widely

used synthetic phytochelatin is EDTA, however, it has extremely low biodegradability (120-300

days half-life) (Pandey & Bhattacharya, 2018) and highly soluble in aqueous solution causing

24

leaching of Pb to ground water (Lu et al., 2017; Hartley et al., 2014). Toxic impacts on soil biota

(Kaurin et al., 2018) were also confirmed in another study, where soil microbial activity and

basal respiration were decreased upon application of EDTA and EDDS (Epelde et al., 2008).

Keeping in mind the environmental concerns in using synthetic chelates, the current study was

focused on studying the potential of bio-inoculants for enhancing the phytoremediation process.

2.3.3. Role of Genetic Engineering in Phytoremediation

There are currently two approaches being explored to develop genetically modified plants with

enhanced metal uptake characteristics. These include conventional (1) breeding and (2) genetic

engineering. Conventional breeding is mainly achieved through hybridization which involves

transfer of hyperaccumulator traits (Pb tolerance and high uptake potential) from less biomass

producing plants to low accumulator of non-accumulator and high biomass producing plants

(Bhargava et al., 2012). Transfer of metal resistant traits of T. caerulescens into B. juncea have

successfully been achieved through somatic cells-based hybridization technique (Iqbal et al.,

2015). However, constraints like sexual incompatibility between different taxa and other

anatomical factors, limit the development of hybrids with desired traits of enhanced

phytoextraction. To this end, genetic manipulation of plants through advanced techniques and

development of transgenic plants with improved metal accumulation and tolerance and metal

detoxification system proved to be a promising technique. Through genetic engineering, ideal

hyperaccumulator plants can be developed by choosing and selecting ideal traits like high metal

accumulation and high biomass production (Fasani et al., 2017).

The advances in phyto-technology through application of transgenic plants have improved

phytoextraction of Pb and other heavy metals (Cd, Cu, Zn) and metalloids (As, Se) through

induction of metal transporters, production of antioxidants, improved metal tolerance and defense

25

mechanism, production of metal detoxifying chelators-metallothioneins and phytochelatins

(Kotrba et al., 2009). Other environmental concerns include, increased bioavailability and

leaching of Pb, unrestricted invasiveness of transgenic plants and undesired genetic variability in

crop plants due to cross-pollination leading to possible human and animal exposure to heavy

metals though food chain contamination (increase metal accumulation in vegetable crops)

(Davison, 2005). The public acceptance is another barrier for field application of genetically

manipulated plants for phytoremediation purpose. Therefore, the current study was focused on

studying the potential of bio-inoculants for enhancing the phytoremediation process.

2.4. BIOLOGICALLY ASSISTED PHYTOREMEDIATION – A VIABLE OPTION

Within the group of microorganisms included in soil activities, there are the plant-associated

bacteria which can be endophytic or from rhizosphere and both provoke diverse consequences to

the plant, to the soil and to the destiny of Pb in soil. Among them, there are modifications for

solubility, bioavailability and transport of metal, reducing the soil pH and releasing biological

chelating compounds (Tak et al., 2013).

2.4.1. Plant-Microbial Interactions for Pb Phytoextraction

According to soil conditions, bacteria can produce and release different types of metabolites.

These can be such as organic acids, bio–surfactants and siderophores. Metabolites can modify at

the same time trace elements’ behavior and bioavailability; providing two possible responses to

increase the plant trace metal uptake and accumulation or to immobilize trace metals (Sessitsch

et al., 2013) as illustrated in figure 2.6. Metabolites may provoke the increase of metal mobility,

so the plant trace metal uptake is raised, and this process enhances the shoot biomass production

and raises the extraction of metals from soil.

26

2.4.1.1. Microbial interaction and detoxification mechanism

These Pb tolerant microbes have extensively been studied for bioremediation of metals. The

major mechanisms include; (1) stabilization; (2) sorption; (3) accumulation; (4) transformation;

(5) leaching and (6) microbially assisted chemisorption of metals (Patel & Kasture, 2014).

Among these, bioleaching is of major importance that enhances phytoremediation process when

coupled with hyperaccumulator plants. Many soil bacteria (Pseudomonas aeruginosa,

Pseudomonas fluorescens, Ralstonia metallidurans, Microbacterium paraoxydans (Braud et al.,

2009; Sheng et al., 2008a) and some fungi (Mucor spp. CBRF59; Glomus mosseae) have also

been found to significantly increase the availability of soil Pb (Deng et al., 2011; Punamiya et

al., 2010).

Figure 2. 6: Microbial interactions in response to Pb exposure

Bio-chelation of metals

Microbial

community

IAA, ACC deaminase,

GA3, Phosphatase,

nitrogenase,

sideophores

Function

Microbial

activity

Structure

Decomposition

Mineralization

C & N cycle

C & N input

C & N output

PGPR characteristics

pH alteration

Siderophore metal-complexes

Organic acids (oxalic acid,

malic acid and citric acid)

Uptake, adsorb,

detoxification (expression

of Pbr and Cad)

Pb

Pb

(1)

(2)(3)

27

Different studies have reported Pb detoxification mechanisms in bacteria (Jarosławiecka &

Piotrowska-Seget, 2014; Leedjärv et al., 2008). Lead efflux and precipitation are a two-

component Pb detoxification mechanism in bacteria (Hynninen et al., 2009). The major Pb

detoxification system in bacteria is led by pbr efflux system, which is surrounded by mer and czc

families on pMOL30 (Monchy et al., 2007). pbrA transports Pb from inside cytoplasm to

periplasm where released inorganic phosphate groups by pbrB precipitates Pb and prevents its

re-entry into cells. The export of Pb ions to the periplasm involves joint function of pbrA and

PIB ATPases, cadA and zntA and their functions are not limited to Pb only. In Pseudomonas

putida KT2440, the main efflux transporter identified for Cd and Pb is cadA2 (Hynninen et al.,

2009).

2.4.1.2. Organic acid release and Pb chelation

Plant associated microbes are able to produce low molecular weight organic acids. These

contribute differently in heavy metal solubility and mobilization of nutrients in the rhizosphere

(Rajkumar et al., 2012). Soil properties like sorption, metal complexation can modify the

behavior of organic acids (Arshad et al., 2016; Shahid et al., 2010; Sheng et al., 2008a). Most

frequently released organicacids by bacteria and fungi are oxalic acid, malic acid and citric acid,

gluconic acid and fumaric acid as the mean of carboxylates acids that can alter the pH and DOM

and could directly impact Pb availability for plant uptake. In-vitro assay indicated significant

production of citric (121 mg L-1) and oxalic acid (110 mg L-1) was observed by A. niger in the

presence of Pb (50 mg L-1), that results in lowering pH of medium and increasing extractable

fraction of Pb (Chandran et al., 2014). Mucor spp. have also been reported for production of citric

and oxalic acid (0.29 and 0.21 mg L-1, respectively) (Xiao et al., 2009; Wang & Chen, 2009)

which are well known chelators of Pb.

28

Organic acids as siderophores can form complexes with metals in soil solution (Rajkumar et al.,

2012; Sheng et al., 2008a). The soluble organo-metal complexes increase the mobility and uptake

of metals. Siderophores are the second most released metabolites from bacteria and can reach

several molecular structures (Sessitsch et al., 2013). These metabolites are involved in metal

chelation, pH alteration and oxidation/reduction reactions (Rajkumar et al., 2012). Moreover,

siderophores are “iron-carriers” and they are released under iron-limiting conditions such as soils.

Furthermore, they are known as iron chelators due to a strong tendency to form a complex with

iron. Hence in presence of trace elements bacteria induce the siderophore synthesis and guide to

form siderophore metal-complexes with Al, Cd, Cu, Ga, In, Pb and Zn (Rajkumar et al., 2012).

2.4.1.3. Plant growth promotion through PGPR activity

Different strains of Pseudomonas (Rajkumar & Freitas, 2008), Microbacterium (Sheng et al.,

2008b), Klebsiella (Farina et al., 2012), Enterobacter (Kumar et al., 2009) have been documented

for PGPR characteristics in metal contaminated soil. It has been documented that Pb resistant

bacteria with indole acetic acid (IAA), siderophores and 1-aminocyclopropane-1-carboxylate

(ACC) deaminase, siderophopre (Sheng et al., 2008), hydrogen cyanate (HCN), nitrogenase

activity and phosphate solubilization can promote plant growth, tolerate Pb and improve Pb

uptake in plants (Belimov et al., 2005) and can be used as potential bio-inoculants in

phytoremediation. Moreover, these compounds are involved in the protection of plants against

Ni, Pb and Zn toxicity (Zhang et al., 2010; He et al., 2009; Sheng et al., 2008a,b).

2.4.1.4. Examples of biologically assisted phytoremediation

Phytoremediation is a slow process compared to physicochemical remediation techniques. By

combining phytoextraction with soil augmentation can enhanced removal of soil contaminants

has been achieved. Various studies reported enhancement of plant biomass under stress by

29

associating with soil bacteria or plant growth promoting rhizobacteria (PGPR) and fungi are

listed in table 2.7.

Table 2. 7: Different studies reported in the litterature for microbially enhanced Pb uptake and

plant biomass.

Microorganisms Plants Metals Outcomes References

Bacterial assisted phytoextraction

Pseudomonas

aeruginosa,

Pseudomonas

fluorescens,

Ralstonia

metallidurans

Maize Pb, Cr Promoted plant growth,

increase bioavaiability and

uptake of Cr and Pb

Braud et

al., 2009

Bacillus edaphicus

Brassica

juncea

Pb Increased plant growth,

Increased Pb mobilization,

and uptake

Sheng et

al., 2008a

Bradyrhizobium sp.

750,

Pseudomonas sp.,

Ochrobactrum

cytisi

Lupinus

luteus

Cu, Cd,

Pb

Improved plant biomass,

nitrogen content and metal

uptake

Dary et al.,

2010

Pseudomonas spp. Centaurea

cyanus L

Pb Higher shoot Pb conc. in

inoculated plants

BCF: 5.33–5.63

TF: 1.09–1.2

Karimi et

al., 2018

Fungi assisted phytoextraction

Glomus mosseae vetiver

grass

Pb Increase Pb conc. in root

Increased translocation

Punamiya

et al., 2010

Glomus sp. (four

strains)

Hordeum

vulgare

and

Helianthus

annuus

Pb More shoot Pb conc. (40.4 mg

Pb kg-1) in inoculated than

non-colonized controls (26.5

mg Pb kg-1)

Arias et al.,

2015

Lewia sp. Dodonaea

viscosa

Pb 4.4–6.5 times more Pb in

roots

than in shoots

Improve Pb-phytostabilization

Loria et al.,

2015

Mucor sp. Brassica

chinensis

Pb, Cd Increased bioavailability of Pb

and Cd by 77% and 11.5-fold

Deng et al.,

2011

30

2.5. PRESENT STUDY

Based upon extensive literature survey, present study was planned to investigate the potential of

indigenous ornamentals along with microorgansims in order to facilitate Pb mobility and

ultimately to improve phytoremediation of contaminated soil. Specific research objectives

(section 1.3) were developed to address the gaps identified through literature survey. The

experimental approach followed to achieve the study objectives is demonstrated in figure 2.7.

Preliminary studies were initially conducted to develop baselines for designing experimental

conditions in later experiments. Industrial zones of Islamabad and Rawalpindi were selected as

study areas. Soil sampling was done for the quantification of Pb contamination and for isolation

of indigenous bacteria. In the 2nd step, screening of ornamental plants was done for selection of

Pb hyperaccumulator plant(s). This was followed by rhizospheric and physiological studies on

selected plant(s). In the next step, bacteria and fungi were evaluated as potential bio-inoculants

Preliminary study Soil characterization, Bacteria isolation

Fungal studies Pb resistance and solubilization

PGP characteristics

Bacterial studies Pb resistance and solubilization

PGP characteristics

Integrated phytoextraction of Pb Bacterial and fungal co-inoculation

Enhance Pb phytoextraction

Screening of ornamental

plants Selection of Pb hyperaccumulator

Rhizosphere study Root induced changes

Soil enzymatic activities Microbial application

1

2

3 5 4

6

7

Figure 2. 7: Experimental approach and design of study

31

for improving Pb phytoextraction. Finally, soil enzymatic activities were monitored on the

application of optimized integrated techniques for phytoextraction efficacy.

Soil sampling was performed to estimate Pb concentrations present around battery recycling sites

of Islamabad and Rawalpindi, Pakistan. For this purpose, soil samples were collected from eight

different locations randomly, and were combined to form a representative composite sample for

determination of Pb concentration in the study area. Samples were acid digested with 16 mL (1:4;

v/v) of HNO3 (65%) and HCl (37%) (Merck Millipore) (McGrath & Cunliffe, 1985). Extracts

were then analyzed for total Pb concentration by atomic absorption spectrophotometer (AAS),

(Model: GBC 932 plus, Australia). The sampled soil contained 1352 mg kg-1 of Pb. This value

served as the reference for choosing Pb levels (500, 1000, 1500 and 2000 mg kg-1) in later

experiments. The detailed methodology has been presented along with results in upcoming

chapters.

32

Chapter 3

SCREENING OF LEAD HYPERACCUMULATOR PLANT SPECIES

This chapter is divided in to three sections. The first section covers the screening of indigenously

grown ornamental plant species in Islamabad, Pakistan for Pb hyperaccumulation potential. In

the second section, root induced changes in rhizosphere that influence Pb phytoavailability was

studied using locally designed cropping device setup. In the third section, the effects of organic

ligands on Pb speciation and availability was studied using speciation model VISUAL minteq3.

Details of experiments are summarized in each part as follows.

A. SCREENING OF INDIGENOUS ORNAMENTAL PLANT SPECIES

FOR Pb ACCUMULATION POTENTIAL

3.1. INTRODUCTION

Contamination of soils with Pb is a serious environmental concern due to its wide spread

prevalence and very high persistence, with poor solubility in water except for nitrates, chlorates

and chlorides (WHO, 2001). It is highly toxic and is a potential risk for plants and human health

at concentrations above 400 Pb kg−1 in soil (US-EPA, 2001). High Pb concentrations directly

affect plant growth and development by disturbing important physiological processes like

photosynthesis, nutrient uptake (Hossain et al., 2012), enzyme and hormone production (Ali et

al., 2013), slow growth rates, less biomass and an inefficient root system (Sharma and Dubey,

2005). Concentrations above 1 mM Pb inhibited axial growth, decreased leaf area, water

absorption and biomass in Zea mays (Bashmakov et al., 2017). According to the International

33

Agency for Research on Cancer (IARC), Pb is classified as a possible human carcinogen (IARC,

2006).

High concentrations of Pb in soils is mainly attributed to anthropogenic activities including

industrial, transport, energy and power sectors (Prasad and Freitas 2006). Among these, battery

recycling is the major point source of Pb contamination, since it accounts globally for 50% of Pb

production (Afzal et al., 2014). In Pakistan, recycling of Pb batteries is a major industry with the

capacity to produce over thousands of metric tons of recycled Pb per month (Memon et al., 2014).

The recycling is carried out through open furnaces without the necessary infrastructure, which

results in the generation of excessive amounts of fumes that contaminate the soil environment

(Afzal et al., 2014). For sustainable and suitable solutions to these Pb contaminated sites, low

cost techniques need to be identified (Gregorio et al., 2000). For this purpose, the development

of appropriate technologies to assess the presence, the mobility and remediation of metals in soil

have been initiated during the past decades (Baker, 1981). Conventional treatment methods

(chemical and physical) are not feasible due to high cost, waste generation, secondary

contaminants and physical disturbance. Under this scenario, natural soil remediation using higher

plants has gained much importance (Robinson et al., 2003; Raskin and Ensley, 2000).

The technique termed as “phytoremediation” proved to be the best adaptable and low-cost

alternative (Kotrba et al., 2009). Members of the Brassicaceae and Fabaceae families were first

characterized for metal hyper-accumulating properties (Salt et al., 1998). Presently, more than

450 species (Prasad and Freitas, 2003; Maestri et al., 2010) across 45 families have been reported

to accumulate substantially high amounts of different heavy metals in their biomass. Other than

hyperaccumulators, many plants like torpedo grass (Gao et al., 2017), Zea mays (Bashmakov et

al., 2017), Phalaris arundinacea (Wiche et al., 2017) and Pelargonium sp. (Arshad et al., 2008)

34

can accumulate substantial amount of Pb, in their biomass. These plants can influence metal

uptake by modifying soil pH upon release of root exudates (Arshad et al., 2016).

Although 18 plant species have been reported as hyperaccumulators of Pb in literature, yet most

of them are not feasible for field applications (Liu et al., 2008; Estrella-G´omez, 2009). Most of

these plants are edible or exogenous to the environment. Heavy metals are likely to transfer into

the food chain and there are climatic and environment factors that limit efficiency of

phytoremediation system (Wei et al., 2008). Therefore, to avoid any risk of food chain

contamination and better adaptivity to soil and climate, the current study was focused on

assessing the potential of Pb phytoextraction by nonfood plants that easily grow in Pakistan. The

overall objective of this work was to determine potential of 21 ornamental species for Pb uptake,

translocation and sequestration in different plant parts (root and shoot) along with tolerance

capability through biomass variations upon exposure to different levels of Pb in soil.

3.2. MATERIALS AND METHODS

3.2.1. Preliminary study

Soil sampling was performed to estimate Pb concentration present around battery recycling sites

of Islamabad and Rawalpindi, Pakistan. For this purpose, eight soil samples were collected from

different locations randomly, and were combined to form a representative composite sample for

determination of Pb concentration. Samples were acid digested with 16 mL (1:4; v/v) of HNO3

(65%) and HCl (37%) (Merck Millipore) (McGrath & Cunliffe, 1985) purchased from local

vendor, Public Traders. Extracts were then analyzed for total Pb concentration by atomic

absorption spectrophotometer (AAS), (Model: GBC 932 plus, Australia). The sampled soil

35

contained 1352 mg kg−1 of Pb. This value served as the reference for choosing Pb levels in

concentration gradient experiment.

3.2.2. Soil Sampling, Preparation and Characterization

For culture experiments, uncontaminated top soils (0−15 cm) were collected from the vicinity of

National University of Science and Technology, Islamabad, Pakistan, air-dried, crushed and

passed through 2-mm sieve. The characteristics of this soil, used in culture experiment, are

presented in table 3.1. Soil pH is one of the most important parameter that determines the fate of

metal availability and transport to plant tissues. The pH of the soil was slightly alkaline (7.39)

(McLean, 1982). Total organic matter content was 0.42% (Walkey and Black, 1934). Soil texture

was clay loam, determined by saturation percentage method (Malik et al., 1984). The soil was

also analyzed for essential nutrients and trace elements. Total concentrations of Pb, nitrogen (N),

phosphorus (P), potassium (K), magnesium (Mg) and iron (Fe) in digested samples were 4.39,

0.31, 6.29, 740, 307.5 and 3095.5 mg kg−1, respectively.

For controlled experiments, uncontaminated soil was artificially spiked with Pb(NO3)2 (Merck

Millipore). Doses were selected keeping in view the level of Pb in field soil samples and

literature. The following five concentrations were prepared: Soil with no Pb (0), and soil with

increasing concentrations of Pb from 500, 1000, 1500 to 2000 mg Pb kg−1 of soil. To achieve the

desired Pb concentration levels, Pb as Pb (NO3)2 was added to the soil in solution form, mixed

and kept for two weeks to reach equilibrium. For uniform distribution and stabilization of Pb,

soil was regularly mixed and soil moisture was maintained around 60%. After two weeks, Pb

concentrations in each spiked level were determined analytically (McLaughlin 2001). For this

purpose, 0.5 g of each spiked soil sample was subjected to acid digestion and subsequent analysis

36

through atomic absorption spectrophotometer (AAS). Pb concentrations were found as 458, 921,

1434 and 1860 mg Pb kg−1 soil at 500, 1000, 1500 and 2000 mg Pb kg−1 soil spiking levels

indicating the metal recovery as 92.4%.

Table 3.1: Characteristics of soil used for research experiment.

3.2.3. Plant Growth Experiments

Twenty-one ornamental plant species listed in Table 1S were exposed to different concentrations

of Pb in culture experiments. Two factors were taken in to account for the choice of plants (a)

the literature related to Pb accumulating plants and (b) indigenous and most widely cultured

ornamental plants. Plants were taken from 15 different families including Asteraceae (5),

Brassicaceae (2) and Caryophyllaceae (2). Many plants from Geraniaceae (Pelargonium species)

(Arshad et al., 2008) and Brassicacease (Szczygłowska et al., 2011) have already been reported

in literature as hyperaccumulators of Pb. The seeds of these plants were obtained from Green

Implex (Seed Bank), Islamabad, Pakistan and were stored at 4°C. For germination, seeds were

soaked in water for 2 hours, surface-sterilized by 1% calcium hypochlorite for 10 minutes and

germinated at 25°C. Twenty seeds were sown in each pot containing 2 kg of air-dried soil. After

Sr.No.Parameters Values

1 Soil pH 7.39

2 EC (dS m-1

) 0.45

3 Texture Clay loam

4Organic matter content

(carbon %)0.42

5 Total nitrogen (%) 0.031

6 Total phosphorus (mg kg-1

) 6.29

7 Potassium (mg kg-1

) 740

8 Magnesium (mg kg-1

) 307.5

9 Iron (mg kg-1

) 3095.5

37

sowing, the soil was moistened by adding distilled water to maintain 75% of the soil saturation

percentage and pots were then kept in dark for germination. Upon germination, pots were placed

in open air with ambient light and allowed to grow for 3 weeks to produce seedlings with four to

five leaves each.

Seedlings of uniform size were selected for experimentations. Seedlings with 4-5 leaves were

transplanted to pots filled with soil spiked at four different levels of Pb. For control, experimental

pots with soil having no Pb were also set for each plant species. For each treatment, there were

three replicates. The plants were placed in a growth chamber with a 16 h and 8 h day-night regime

at 25°C. The pots were watered daily with distilled water to maintain moisture content at 65–

70% water-holding capacity with care to avoid heavy-metal leakage from the pots.

3.2.4. Harvesting and Plant Sample Analysis

To evaluate phytoextraction potential, the plants were exposed to Pb for 7 weeks (Thamayanthi

et al., 2013). After which, plants were carefully harvested from the pots, washed with tap water

until free of soil, then rinsed with distilled water and soaked in 50% nitric acid for 5 min to

remove any adsorbed Pb on root surface, rinsed again with distilled water and blotted with filter-

paper. Plants were then subdivided in to roots and shoots and the fresh weight was measured

immediately, and the dry weight after 48 h of desiccation in an oven at 60°C. The dried samples

were ground in a pestle mortar and stored in polythene bags. For acid digestion, 100 mg of the

powdered plant material was digested with HNO3/HClO4 (4:1) mixture. The digestion was done

on hot plate at 150°C for 2-3 hours and continued till a clear aliquot was obtained. These aliquots

were diluted with distilled water to make 50 mL final volume. Then all solutions were filtered

with Whatman# 42 before metal analysis with AAS.

38

3.2.5. Pb Accumulation in Plants

The accumulation characteristics of plants can be defined by three factors: Enrichment factor

(EF), Biotranslocation factor (TF) and Bioconcentration Factor (CF). EF is calculated as the ratio

of Pb content in shoots to Pb content in soil. TF indicates the ability of plant to translocate the

metal from root to aerial parts and is calculated as the ratio of the metal content in the shoots to

that in soils (Zu et al., 2005) whereas CF is defined as the capacity of plant roots to sequester Pb

from the surrounding soil environment. The formulas used to calculate these factors were;

TF = [Metal]shoot / [Metal]root …………… (Zu et al., 2005)

EF = [Metal]shoot / [Metal]soil ……………. (Zu et al., 2005)

CF = [Metal]root / [Metal]soil ……………... (Yoon et al., 2006)

3.2.6. Statistical Analysis

All treatments were replicated thrice and data were analyzed by performing one way Analysis of

Variance (ANOVA) and significance among different plants were determined by Least

Significant Difference (LSD) test in Statistical Package for the Social Sciences (SPSS) 16.0

software. All results are expressed as mean values with corresponding standard errors.

3.3. RESULTS

3.3.1. Screening for Pb Accumulation Potential

The ability of plants to uptake Pb in shoot is the most import characteristic in phytoremediation.

Pb concentration in above ground portion of all plants at different soil Pb levels is presented in

table 2. Results indicated varying ability of plants to accumulate Pb in above ground portion.

39

Based on Pb accumulation in above ground portion, all the plants were grouped into 3 classes

(table 3.2).

Table 3.2: Classification of ornamental plants for Pb accumulating abilities in shoot biomass

when exposed to different levels of Pb in concentration gradient experiment. Different letters

i.e. a-d, f-k, l-q, r-z indicates significance difference (p<0.05) in Pb accumulation by plant

species at 500, 1000, 1500 and 2000 mg Pb kg-1 soil, respectively.

Plant Species Pb conc. in spiked soil (mg kg−1)

500 1000 1500 2000

Class A (> 800 mg Pb kg−1 shoot biomass)

Dianthus barbatus 436.7c 626.0ghi 843.0m 414.3tuvw

Mesembryanthemum criniflorrum 699.0b 996.7f 1268.8l 841.5r

Pelargonium hortorum 1028.3a 776.2g 438.1mn 233.7t

Class B (400-800 Pb kg−1 shoot biomass)

Antirrhinum majus 524.5bc 776.8g 561.0no 373.7uvw

Brassica oleracea 267.3c 540.3hi 384.5o 117.4x

Calendula officinalis 580.7b 281.1jk 256.7pq 237.4wx

Dianthus caryophyllus 440.3c 452.6ij 600.8no 183.8x

Godetia grandiflora 365.5c 666.6gh 713.4mn 668.0s

Limonium sinuatum 574.3b 293.5jk 238.4pq 41.7z

Matthiola incana 325.0c 275.1jk 312.6p 480.4tu

Nemesia strumosa 130.5d 183.0k 485.3nop 195.7xy

Phlox drummondi 230.3cd 344.7j 443.7nop 339.0vwx

Tropaeolum majus 333.9c 379.7ij 432.7n 346.5wx

Viola wittrockiana 220.7d 312.0jk 415.3n 485.5tuv

Class C (< 400 Pb kg−1 shoot biomass)

Dhalia hortensis 141.5d 391.3ij 271.7pq 107.9x

Callistephus chinensis 127.8d 155.8jk 147.5q 115.5x

Gazania rigens 145.0d 108.8k 189.1q 74.1z

Petunia hybrida 62.1de 357.3j 99.8q 75.8z

Sage splendens 224.3d 225.2k 107.7pq 78.9z

Tagetes erecta 137.3d 181.3k 106.5pq 35.7z

Verbena hybrida 132.9d 356.6j 146.7pq 86.8y

Class A represents the highest accumulating plants with shoot Pb concentration >800 mg Pb kg−1,

B with average (400−800 mg Pb kg−1) and C with the lowest Pb accumulating abilities (< 400

mg kg−1). The %age abundance of Class A, B and C plants out of experimented 21 plants were

40

14.3%, 52.4% and 33.33%, respectively. In class A plants, significantly high Pb accumulation

(>1000 mg Pb kg−1 shoot biomass) was observed in Mesembryanthemum criniflorrum and

Pelargonium hortorum at different concentrations of Pb in soil. Mesembryanthemum

criniflorrum was the most significant accumulator of Pb in shoot dry biomass (996.7, 1268.8 and

841.5 mg kg−1 at 1000, 1500 and 2000 mg Pb kg−1 soil, respectively). It was interesting to note

that Mesembryanthemum criniflorrum’s potential to accumulate decreased at the highest

exposure level, probably due to activation of excluder strategy at 2000 mg Pb kg−1 of soil. At 500

mg kg−1 Pb concentration, Pelargonium hortorum accumulated the highest amount of Pb (1028.3

mg kg−1) in shoot biomass. In average Pb accumulating plants (class B), Antirrhinum majus and

Godetia grandiflora accumulated substantial amount of Pb 776.8 (at 1000 mg Pb kg−1 soil) and

713.4 mg kg−1 (at 1500 mg Pb kg−1 soil), respectively. At 2000 mg kg−1 Pb concentration, all the

plants had the lowest Pb accumulation. Overall, better accumulation was observed in

Mesembryanthemum criniflorrum. Other plants such as Brassica oleracea, Callistephus

chinensis, Dhalia hortensis, Gazania rigens, Limonium sinuatum, Petunia hybrid, Sage

splendens, Tagetes erecta and Verbena hybrid had low Pb concentrations in shoots, 117, 116,

108, 74, 42, 76, 79, 36 and 89 mg Pb kg−1, respectively along with low biomass production at

2000 mg Pb kg−1 soil. Therefore, these plants are not presented further for the sake of

simplification and better understanding.

3.3.2. Lead Concentrations in Roots and Shoots of Selected Species

Plants that performed better in primary screening for accumulation of Pb in roots and shoots are

presented in figure 1. Results indicate that all plant species within and between families differ in

their capacity to accumulate Pb in roots and shoots. Wide range of Pb accumulation was observed

41

in roots of different ornamental plants grown in soil with different Pb concentrations (figure

3.1a).

Figure 3. 1: Pb concentration in selected plants; (a) Pb concentration in roots; (b) Pb

concentration in shoots. Different treatments showing significant difference are indicated by

different letters i.e. a-c, g-j, m-p and w-z for 500, 1000, 1500 and 2000 mg Pb kg−1 soil,

respectively.

At treatments 500 and 1000 mg Pb kg−1 of soil, Calendula officinalis showed significant Pb

accumulation in roots, i.e. 1439 and 1170 mg kg−1, respectively. With increasing Pb

concentration up to 2000 mg Pb kg−1 soil, the capacity was reduced by 4.31–folds. At higher

concentrations, i.e. 1500 and 2000 mg Pb kg−1 of soil, Godetia grandiflora exhibited significant

c

a

d

b

ed

h

g

j

g

ii

n

o

no

m

n

no

xyz

x

w

wx

y

0

200

400

600

800

1000

1200

1400

1600

1800

Pb c

onc.

(mg

kg-1

)

Plant species

500 1000 1500 2000 mg kg-1

bcc

cdd

b

a

g

h

g

g

g

g

n

o

nn

m

ny

xy

y

wx

w

x

0

200

400

600

800

1000

1200

1400

1600

Pb c

onc.

(mg

kg-1

)

Plant species

500 1000 1500 2000 mg kg-1

(a)

(b)

42

Pb uptake in roots, 1180 and 1021 mg kg−1, respectively. Overall, the least Pb accumulation (<

100 mg kg−1) was observed in Gazania rigens, Limonium sinuatum, Sage splendens and Tagetes

erecta, Verbena hybrida at 2000 mg Pb kg−1 soil, respectively. Similarly, all plants showed

different capacity in transporting metal to shoots with increasing concentration of soil Pb (figure

3.1b). At 500 mg Pb kg−1, Pelargonium hortorum accumulated significantly high level (1028.3

mg kg−1) of Pb in shoot dry biomass. At 1000, 1500 and 2000 mg Pb kg−1 Mesembryanthemum

criniflorum accumulated 996.7, 1268.8 and 841.5 mg Pb kg−1, respectively. Dianthus barbatus

also accumulated substantial amount of Pb (up to 843 mg kg−1) in shoot biomass.

3.3.3. Plant Biomass at Varying Pb Concentrations

All the plants had the highest biomass at control (no Pb added) and by increasing the Pb

concentration from 500 to 2000 mg kg−1, the biomass was generally reduced with the highest

reduction by 2.27–folds for Brassica oleracea. However, a slight insignificant reduction was

observed in Tropaeolum majus (1.13–fold) and Pelargonium hortorum (0.8–fold). Results of

biomass production by selected plants at 2000 mg kg−1 are presented in table 3.3. Among

different experimented plants, Pelargonium hortorum and Tropaeolum majus produced

significantly higher biomass i.e. 0.78 and 0.71 g per plant, respectively at 2000 mg Pb kg−1 soil

followed by Mesembryanthemum criniflorrum (0.6 g per plant). However, Brassica oleracea and

Verbena hybrid produced significantly less biomass compared to the rest of plants. Also, their

biomass reduced sharply by increasing Pb concentrations (data not shown).

3.3.4. TF, EF and CF

For selection of suitable candidate for phytoremediation of contaminated soil, the plants were

analyzed for the properties including biotranslocation, enrichment and bioconcentration factor

43

for Pb in plant biomass. The performance of selected plants in terms of EF, TF and CF indices

are presented in table 3.3. Among the tested plants, Pelargonium hortorum, Matthiola incana,

Tropaeolum majus, Mesembryanthemum criniflorum and Dianthus barbatus had TF values

greater than 1 at 500 mg kg−1. With increase in soil Pb concentrations, TF values tended to be

lower than 1. In case of EF index analysis, Calendula officinalis, Pelargonium hortorum,

Limonium sinuatum, Mesembryanthemum criniflorrum and Antirrhinum majus had EF values

greater than 1.

Table 3.3: Pb accumulation characteristics and plant dry biomass of selected ornamental plants

exposed to 2000 mg kg−1 soil Pb concentration. Significance is calculated at P> 0.05 and

denoted by alphabets.

Plant Species Dry Weight

(g)

Pb Conc. in soil 2000 mg kg−1

EF TF CF

Antirrhinum majus 0.53de 0.2 0.9 0.2

Callistephus chinensis 0.56cd 0.1 0.2 0.3

Dianthus barbatus 0.56c 0.2 0.8 0.2

Dianthus caryophyllus 0.42f 0.1 0.5 0.2

Godetia grandiflora 0.63bc 0.3 0.7 0.5

Matthiola incana 0.47ef 0.2 1.5 0.2

Mesembryanthemum

criniflorrum 0.65b 0.4 1.0 0.4

Pelargonium hortorum 0.78a 0.1 1.7 0.1

Phlox drummondi 0.46f 0.2 0.6 0.3

Tropaeolum majus 0.71ab 0.2 1.0 0.2

viola wittrockiana 0.56cd 0.2 0.8 0.3 (EF=Enrichment factor; TF=Bio translocation Factor; CF=Bio concentration Factor)

Considering the CF values at 500 mg kg−1, only few plants including Calendula officinalis,

Petunia hybrida, Godetia grandiflora, Viola wittrockiana and Antirrhinum majus could attain

CF values greater than 1. A decrease in these values was observed with the increasing

concentrations of Pb in soil. Out of 21 ornamental plants, only 7 plant had TF values >1, while 5

plants had EF values >1 and only 5 plants had CF values >1. With increase in soil Pb

44

concentration, all the values for TF, EF and CF decreased to less than one. At the highest Pb

level, 2000 mg Pb kg−1 of soil, Matthiola incana, Mesembryanthemum criniflorum, Pelargonium

hortorum and Tropaeolum majus had TF >1 whereas all the plants had EF and CF values <1.

3.3.5. Lead Uptake

Pelargonium hortorum and Godetia grandiflora had significant uptake (0.62 and 0.70 mg per

plant) at 500 and 1000 mg Pb kg−1 soil. Whereas Mesembryanthemum criniflorum accumulated

high levels of Pb (0.79 and 0.50 mg per plant) along with the biomass produced at 1500 and 2000

mg Pb kg−1 soil respectively. Results related to uptake of Pb at 2000 mg Pb kg−1 by selected

plants are presented in figure 3.2.

Figure 3.2: Pb uptake by selected ornamental plants exposed to 2000 mg kg−1 soil Pb

concentration. Bars indicate means of three replicates and letters indicate significance

difference at p<0.05.

At the highest soil Pb concentration i.e. 2000 mg kg−1 Mesembryanthemum criniflorrum and

Godetia grandiflora showed the highest per plant uptake by 0.54 and 0.51 mg per plant,

respectively followed by Pelargonium hortorum with 0.32 mg per plant.

c

d

bcd

a a

b

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

Am

ou

nt

of

Pb

per

pla

nt

(mg)

Plant species

45

3.4. DISCUSSION

In the present study, there was great variation among all ornamental plants for their ability to

accumulate Pb in roots and translocation to shoots. The Pb concentrations in the roots of 21

ornamental plants exposed to different levels of Pb in spiked soil ranged from 55 mg kg−1

(Limonium sinuatum) at 2000 mg kg−1 Pb to as high as 1439 mg kg−1 at 500 mg Pb kg−1 of soil

in the roots of Calendula officinalis. Liu et al. (2008) also reported Calendula officinalis as Pb

accumulator and a potential candidate for remediation of urban soil contaminated with Cd and

Pb. In case of shoots, minimum and maximum Pb concentrations were 42 mg kg−1 (Limonium

sinuatum) at 2000 mg kg−1 Pb and 1269 mg kg−1 (Mesembryanthemum criniflorum) at 1500 mg

kg−1 Pb.

For selection of hyperaccumulator plants, certain standards are given in the literature. These

include four characteristics; (1) Plant should be able to accumulate Pb>1000 mg kg−1 in shoot

biomass (Wei et al., 2002; Kakar et al., 2011), (2) can accumulate 10−500 times more Pb in shoot

than ordinary plants (Shen and Liu, 1998), (3) TF, EF and CF values should be >1 and (4)

tolerance capability of plant at high metal contamination (Brown et al., 1994; Wei et al., 2002,

Nazir et al., 2011). Efficiency of phytoremediation is based upon efficient sequestration of total

amount of the metal from soil though extensive root system and translocating the metal from root

to above ground biomass of plant. Two most import factor in this regard are (1) metal

concentration or uptake efficiency of plant and (2) Total dry biomass of plant (Baker, 1981).

Considering these criteria, Pelargonium hortorum, Mesembryanthemum criniflorum and Godetia

grandiflora showed significantly high Pb accumulation in the plant biomass. In this study, plant

dry biomass, Pb uptake and translocation factor were mainly considered for identification of Pb

hyperaccumulators (Arshad et al., 2008). Pelargonium hortorum and Mesembryanthemum

46

criniflorum were able to satisfy the required characteristics of Pb hyperaccumulator. These

findings were only based upon pot experiments and soils spiked with Pb(NO3)2, the accumulation

behavior of selected plants could be different in soils contaminated over longer periods through

anthropogenic activities.

The accumulation characteristics of Pelargonium hortorum indicated that at 500 mg Pb kg−1 soil,

there was 7.24−fold increase in Pb as compared to other plants. The Pb concentration in shoot

reached 1028.3 mg kg−1, which is critical threshold value for a hyperaccumulator (Srivastava et

al., 2006). The concentration of Pb in total biomass produced by plant reached 0.6 mg per plant

which was significantly high among all other ornamental plants in 500 mg Pb kg−1 soil. At the

same time, TF and EF values were greater than 1.0 but CF was lower and only reached 0.47,

which means little amount of Pb was accumulated in plant as compared to the soil upon which it

was cultivated. As the concentration of Pb was increased in soil, TFs were still >1 whereas EFs

and CFs values of all the treatments were <1. Keeping in view these results, multiple hypothesis

can be built here. This might be because at higher concentration the plant growth was limited and

less biomass was produced. The Pb metal could be fixed at exchange sites and phytoavailable

amount might have been reduced (Petruzzelli et al., 2015). Some plants might have the activation

of excluder mechanisms that restrict the entry of metal into plant after certain level.

Many Pelargonium species have been reported in literature as Pb hyperaccumulators. Manshadi

et al. (2013) experimented five pelargonium species for phytoextraction of Pb and Cd and

revealed that Pelargonium hortorum, peltatum and citrosum exhibited best TFs for Pb. In all the

treatments, TFs values were higher than one for Pelargonium hortorum which demonstrated that

the plant was able to accumulate higher amounts of Pb in shoots than roots, therefore, it is suitable

for phytoremediation. Dan (2001) also worked with four different species of scented

47

Pelargonium to assess their ability for phytoextraction of Cd, Ni and Pb. The results showed that

Pelargonium hortorum was tolerant to high soil Pb concentration and accumulated >1000 mg

kg−1 in shoot biomass. Arshad et al. (2008) also tested six scented Pelargonium cultivars and

declared 3 plants as hyperaccumulators of Pb.

Mesembryanthemum criniflorum accumulated 1268.8 mg Pb kg−1 in shoots at 1500 mg Pb kg−1

soil. Uptake for this plant was 0.5 mg per plant, which was the most significant among all 21

plant species at the highest soil Pb contamination level (2000 mg kg−1). The values of TF and

EF were >1 at 500 and 1000 mg Pb kg−1 soil and <1 at 1500 and 2000 mg Pb kg−1 soil, whereas

CF was <1 in all the treatment levels. No work has been reported so far for Mesembryanthemum

criniflorum. However, another plant of the same genus, Mesembryanthemum crystallinum have

been found as accumulator of copper besides being halophyte (Thomas et al., 1998).

Many plants accumulate high concentrations of Pb in different plant parts but do not meet all the

four characteristics to be regarded as hyperaccumulator of Pb. Similar response was observed in

case of Godetia grandiflora. The concentration of Pb in root was higher than shoots. In roots,

Godetia grandiflora accumulated 1014, 1180, 1021 mg Pb kg−1 of dry root weight at 1000, 1500

and 2000 mg Pb kg−1 soil, respectively. Pb uptake values for this plant were0.7, 0.7 and 0.5 mg

per plant at 1000, 1500 and 2000 mg Pb kg−1 soil, respectively. Many plants accumulate more

Pb in roots than shoots (Shen et al., 2002) showing limited translocation to the above ground

biomass (Stoltz et al., 2002). TF, EF and CF values were <1 in all the treatment levels except 500

and 1000 mg Pb kg−1 soil where CF was >1. Liu et al. (2008) reported three ornamental plants,

Impatiens balsamina, Calendula officinalis and Althaea rosea as potential accumulators of Cd

and Pb for decontamination in urban areas. Of these plants, Althaea rosea accumulated <1000

mg kg−1 Pb in plant biomass (i.e. 344 and 890 mg kg−1 Pb in shoot and root, repectively) under

48

hydroponic conditions. Cui et al. (2013) also evaluated three ornamental plants for

hyperaccumulation of Pb and found Celosia cristata to accumulate >1000 mg Pb kg−1 dry

biomass, however TF, EF and CF were less than 1.

Indigenous plants have more vigor to tolerate the metal contamination in their natural habitat and

can accumulate high Pb concentration in their biomass (Sheng et al., 2008b). Our results

indicated that during the course of experiment, no phytotoxicity symptoms were observed in

Pelargonium hortorum, Tropaeolum majus, Mesembryanthemum criniflorum, Godetia

grandiflora, Dianthus barbatus and Viola wittrockiana even at the highest Pb concentration,

2000 mg Pb kg−1 soil. Correlation analysis of biomass produced and Pb uptake by above

mentioned six plant species gave a value of 0.61 (p< 0.01), indicating weak but positive

correlation among the two variables. It means that upon Pb uptake there was no significant

decrease in biomass of these plants.

The suitability of Plants for phytoremediation purpose depends on the qualities of

hyperaccumulators including fast growth rate, able to produce high biomass i.e. more than three

tons DW ha−1 y−1 (Schnoor, 1997) and can tolerate high levels of Pb without exhibiting any

toxicity symptoms (Schnoor, 1997; Ma et al., 2001). Plants tested in this study were evaluated

for biomass production per year considering the optimum planting density and number of cultures

performed per year. Only flower yield of Tagetes erecta is 30–60 tons/hectare annually (Lin et

al., 2015). Biomass production by Pelargonium hortorum was estimated to be 3.1 tones DW ha−1

y−1. Whereas Mesembryanthemum criniflorum is a seasonal plant with limited biomass

production and high Pb uptake potential.

For the current study, uncontaminated soil was spiked with highly soluble salt of Pb (lead nitrate).

Subsequently, these spiked soils were used to assess Pb phytoextraction potential of ornamental

49

plants. There are different advantages and limitations in using spiked soil approach. Working

with spiked soil allowed to control all other environmental variable that would affect the

phytoextraction process. Moreover, this experimental design allowed to assess the Pb tolerance

ability of these plants at different concentrations of Pb. At the same time, there are some

limitations of using spiked soil. In spiked soil, usually metal bioavailability is different (usually

higher than in aged contaminated soil). In aged soil with Pb contamination, a much lower

performance would be expected as the metal could be strongly bound to exchange sites and

in/organic fractions of soil. Overall, such experiments at lab scale could serve as indicator for

phytoextraction studies at field scale. Results of current study support this hypothesis and

highlight the potential of certain plant species to be used for metal removal at larger/field scale.

3.5. OUTCOMES AND PERSPECTIVES

Among 21 ornamental plants, Pelargonium hortorum and Mesembryanthemum criniflorum

accumulated >1000 mg Pb kg−1 shoot dry biomass at different soil Pb concentrations. These two

plants could be regarded as hyperaccumulators of Pb considering TF, EF and CF index and the

amount of biomass produced by each plant whereas Godetia grandiflora can be considered as

potential accumulator that can efficiently be used for phytoextraction of Pb contaminated soil.

These plants produced no phytotoxic symptoms even at 2000 mg kg−1 soil Pb contamination,

therefore, have great ability particularly in urban environment to remediate Pb contaminated site

while beautifying the environment. These experiments were conducted using spiked soil which

gave an insight about potential of ornamental plant species to accumulate substantial amount of

Pb in above ground tissues. However, phytoremediation potential of these plants in real

contaminated soil should be evaluated before field application. The changes at root soil interface

50

that may interfere Pb phytoavailability also needs to be investigated for understanding and further

development of this technique.

The experiment exhibited potential or ornamental plants for Pb phytoextraction abilities. Two

plants Pelargonium hortorum and Mesembryanthemum criniflorum showed Pb accumulator

characteristics and produced high biomass with no phyto-toxicity symptoms compared to other

plants reported in literature. Pb phytoextraction varied in different plants when grown on same

soil and Pb concentration gives an insight to plant induced changes in rhizosphere that facilitated

Pb solubility and uptake by plant roots. To study the phytoavailable fractions of Pb, as a result

of rhizosphere modification by cultivated plants, controlled experiments were conducted in the

glass house using special cropping devices (Uzu et al., 2009; Arshad et al., 2016), designed

locally. The device helped in separating plant roots from rhizosphere soil and only allowed root

exudates to modify physicochemical characteristics of soil to favor Pb phytoextraction. Detailed

methodology and results are summarised in the next section.

51

B. LEAD PHYTOAVAILABILITY AND UPTAKE: RHIZOSPHERE

STUDY

3.6. BACKGROUND

Lead (Pb) is one of the most abundantly found toxic heavy metals in soils and have no biological

function. It is ubiquitously distributed in soil as a results of anthropogenic activities 1000-fold

increase in Pb soil contamination is observed over the past years (Kushwaha et al., 2018). It is

potentially toxic to living systems and is considered as chemical of great concern in the new

European REACH regulations (EC 1907/2006; Registration, Evaluation, Authorization, and

Restriction of Chemicals). The in-situ decontamination of Pb contaminated soils by using

suitable hyperaccumulator plants is cost effective, environmental friendly and best alternative to

old and conventional physicochemical techniques (Gul et al., 2019; Manzoor et al., 2018; Arshad

et al., 2016, 2008). However, the efficiency of phytoremediation system greatly depends on Pb

phytoavailability, which is typically very low (<2.5%) (Wierzbicka et al., 2007), only 0.14 % of

total Pb in soil is in exchangeable fraction (Jena et al., 2013). Low availability and mobility of

Pb in soil limits the field application of phytoremediation system. Generally, Pb is found attached

to inorganic ions like HCO3-, CO3

2-, SO42- and Cl- or may complexed with organic ligands (amino

acids, fulvic acids and humic acids). Some faction of Pb is also found adsorbed on to soil particles

(Fe-oxides, organic matter and clay particles) (Shahid et al., 2010), and strongly bound to organic

and colloidal material (Kushwaha et al., 2018; Punamiya et al., 2010).

Different soil and biological factors controls Pb speciation and availability in soil. The soil factors

that directly interact with Pb speciation includes pH, soil texture, structure, organic matter,

organic colloids, iron oxides, cation exchange capacity (CEC), Pb concentration and other

https://www.sciencedirect.com/science/article/pii/S0147651317306498#bib158


https://www.sciencedirect.com/topics/earth-and-planetary-sciences/colloid

https://www.sciencedirect.com/topics/earth-and-planetary-sciences/iron-oxides

https://www.sciencedirect.com/topics/earth-and-planetary-sciences/cation-exchange-capacity

52

chemical additives in soil (Silveira et al., 2003). Whereas biological factors include root

exudation that alters the pH and dissolved organic carbon (DOC) contents of the rhizosphere soil

(Adejumo et al., 2018; Khoshgoftarmanesh et al., 2018). Therefore, studying the ability of plants

to modify its rhizosphere that favors Pb phyoavailability would further increase in developing

phytoremediation technology. In our previous study (Manzoor et al., 2018), two plants

Mesembryanthemum criniflorum and Pelargonium hortorum have been identified for

phytoextraction of Pb in study area. The following study have been designed to evaluate in detail

the ability of these plants to induce rhizosphere changes that favors Pb mobility and

phytoextraction.

3.7. MATERIAL AND METHODS

3.7.1. Soil and Pb Spiking

For rhizosphere experiment soil was collected (NUST nursery, Islamabad) and artificially spiked

(500, 1000, 1500 and 2000 mg kg-1) after air-drying (3 weeks) and sieving through a 2mm mesh.

The physicochemical characteristics of soils were the same as used in the previous study

(Manzoor et al., 2018). Soil pH, texture and organic matter was 7.39 and clay loam and 0.42%

respectively as determined by laboratory protocols.

3.7.2. Pre-Experimental Setup and Plant Acclimatization

For rhizosphere study, two plant species Mesembryanthemum criniflorum and Pelargonium

hortorum were selected based on previous study for screening of Pb hyperaccumulator plants.

Two months old seedlings of these plants were obtained from the local nursery (Islamabad

Nursery Ltd.). Plants were removed from pots, washed in running water carefully and placed in


53

hydroponic solution for acclimatization and development of new roots. After two weeks plants

were transferred to cropping devices designed locally (figure 3.3) (Arshad et al., 2016) Chaignon

& Hinsinger, 2003).

Figure 3. 3: Locally designed cropping device setup (a), Experimental setup for rhizosphere

study.

The devise helped in separating direct contact of soil and roots. The total of forty cropping

devices containing one device per plant were placed in container having 15 L of nutrient solution

to support root growth and contact with soil. The plants Mesembryanthemum criniflorum and

Pelargonium hortorum will be referred as Mesembryanthemum and Pelargonium hereafter. Each

treatment was replicated four times. The composition of nutrient solution is given in table 3.4.

Table 3. 4: Composition of nutrient solution used in culture experiment.

Chemicals Concentration (μM)

KNO3 5000 μM

Ca(NO3)2 5000 μM

KH2PO4 2000 μM

MgSO4 1500 μM

H3BO3 46 μM

MnSO4.H2O 9 μM

MoNaO4.2H2O 0.1 μM

CuSO4.5H2O 0.9 μM

ZnSO4.7H2O 15 μM

Fe–EDTA 180 μM

(a) (b)

54

Plants were allowed to grow in cropping device for two weeks prior to experiment for

development of root mat. During this period distilled water was used to maintain the level of

nutrient solution. The experimental units were placed in the glasshouse with a photoperiod of 14

h, temperature ranged between 26-21 °C.

3.7.3. Rhizosphere Experiment

After two weeks of root development, ten g of control and spiked soil was added in detachable

unit of cropping device (diameter 60 mm) to form 3 mm thick soil layer and soil was analyzed

for initial chemical properties. During the course of experiment soils were humidified through

filter paper dipped in nutrient solution. Containers were covered with aluminum foil to limit

evaporation loss. During this stage 0.2 strength Hoagland’s solution was used to favor Pb uptake

by reducing ion competition. Nutrient solution was added regularly to maintain enough level in

container to keep filter paper wet. Control soil with similar setting were placed to evaluate pH

change. After three weeks plants were harvested and analyzed for Pb concentration in root and

shoots. Soil was considered as rhizosphere soil and analyzed for physicochemical parameters.

3.7.4. Soil and Plant Analysis

Rhizosphere soil was analyzed for pH determination (AFNOR, 1994) immediately after

harvesting. Soil pH and Pb content was analyzed by extracting soil with 0.01 M CaCl2 (1:5 soil:

extractant on dry basis). The mixture was shaken for 30 minutes at 150 rpm and the pH was

determined from supernatant after 30 minutes. Solutions were then filtered for Pb determination

through AAS (Model: GBC 932 plus, Australia). DOC was analyzed through TOC analyzer.

After harvesting plants were washed thoroughly under running tap water and then roots were

immersed in 0.01 N HCL to determine adsorbed amount of Pb on to root cells ([Pb]ad) (Arshad

55

et al., 2016). After plants were placed in oven for drying at 65 °C. After 48 h, dry weights were

recorded and plants were ground to power form prior to mineralization with HNO3 and HClO4

(4:1). After complete digestion, clear aliquots were obtained and filtered for Pb determination

through AAS. TF and BF were calculated from the results (Manzoor et al., 2018).


Statistical analysis were performed in SPSS software. Data was analyzed though analysis of

variance ANOVA and least significant difference (LSD) tests.

3.8. RESULTS AND DISCUSSION

3.8.1. Root Induced Rhizosphere Modifications

a. Soil pH

Soil pH was measured by extracting soil (1:5 soil/extractant ratio) with CaCl2 (0.01 mM)

(expressed as pH CaCl2) and presented in figure 3.4(a). Changes in pH can be defined in terms

of ΔpH and calculated using following formula;

ΔpH = (final pH in treated soil – final pH of the control soil (C) ----------------------------- (Eq 1)

The negative and positive values of ΔpH indicated acidification and alkalination of the soil.

Significant (p<0.05) decrease in soil pH was observed in case of Pelargonium in 1500 and 2000

mg Pb kg-1 soil compared to Mesembryanthemum and control plants at all levels of soil Pb

concentration. There was no significant effect of nutrient solution on ΔpH in control soil.

Therefore the change in soil pH can be attributed to root derived chemical changes in soil.

56

Figure 3. 4: Root induced changes in rhizosphere pH (a) and available Pb fraction (b) in

rhizosphere soil at different soil Pb concentrations.

Pelargonium acidified the soil by -0.22 pH units CaCl2 extracted soil solutions at 2000 mg kg-1

soil Pb concentration. Mesembryanthemum could not significantly change soil pH irrespective

of Pb concentrations in soil. Change in soil pH depends on many factors. Plant genotype, amount

and composition of root exudates rhizo depositions, mineral and nutrients composition in soil,

bio geochemical processes and other environmental factors accounts for pH change in soil (Sun

et al., 2018). Khoshgoftarmanesh et al. (2018) working with Zinc fractionation found that

rhizosphere pH was lower than that of bulk soil facilitating bioavailability of zin of uptake in

Triticum aestivum.

b. Lead phytoavailable fractions in soils

Soil was extracted with 0.01 M CaCl2 for determination of labile fraction of Pb which is readily

available for plant uptake. The ability of plants to modify the labile fraction of Pb in soil are

given in figure 3.4 (b). Results indicates higher ability of Pelargonium to increase available

7.4

7.5

7.6

7.7

7.8

7.9

0 500 1000 1500 2000

pH

Soil Pb conc. (mg kg-1)

ControlMesembryanthemumPelargonium

ed

d

cc

e

d

c

b

a

0

30

60

90

120

0 500 1000 1500 2000

[Pb

] m

g k

g-1

[Pb] soil (mg kg-1)

(a) (b)

57

fraction of Pb compared to Mesembryanthemum at all levels of soil Pb concentrations.

Pelargonium increased Pb mobility 1-2 –folds more compared to Mesembryanthemum and

control soil. Maximum PbCaCl2 observed for Pelargonium was 94±5 mg kg-1 at 2000 mg Pb kg-1,

which is 2 –fold higher than Pb mobilized by Mesembryanthemum at the same soil Pb

concentration. Maximum Pb solubility induced by Mesembryanthemum was 48±5 mg kg-1 in soil

containing 2000 mg Pb kg-1 soil. Generally, soil acidification directly favors solubility and

mobilization of heavy metals. In different studies it was observed that exchangeable Pb, Cd and

Zn fractions were higher in rhizosphere soil compared to bulk soil (Adejumo et al., 2018; Zhan

et al., 2018; Khoshgoftarmanesh et al., 2018). The available fractions were increased due to

reduction in rhizosphere pH and exudation of greater amounts of DOC (Zhan et al., 2018).

Adejumo et al. (2018) reported genotype effect on increased Pb availability in rhizosphere soil

then bulk soil. Eleucine indica capable of lowering soil pH (5.0) and high DOC accumulated

significantly high Pb in shoot (8030 mg kg-1) compared to Chromolaena odorata which

accumulated least Pb in shoot (209 mg kg-1) owing to the highest values for rhizosphere pH.

c. Organic matter

Plants accounts for major contributor in soil organic matter content through root exudation, cell

debris, dry and dead plant tissue, mucilage and root turnover (Sun et al., 2018). Considerable

effect of plants were noticed on OM, TOC and DOC content at varying soil Pb concentrations

(figure 3.5a,b,c). Significant (p<0.05) increase in organic matter derivatives were observed for

Pelargonium up to 1000 mg Pb kg-1 soil compared to Mesembryanthemum. Maximum OM and

TOC (1.4% and 0.8%) in Pelargonium were obtained at 500 mg Pb kg-1 soil. Similarly, maximum

OM and TC observed in case of Mesembryanthemum were 1.0% and 0.6%, which were 1.4 times

lower than OM and TOC obtained Pelargonium at same soil Pb concentration (500 mg Pb kg-1

58

soil). With increase in Pb concentration, a general decrease in OM and TOC percentage was

observed for both plants.

Figure 3. 5: Root induced changes in soil organic after three weeks of plant soil contact. a) OM;

b) TOC; c) DOC

The decrease in OM and TOC in Mesembryanthemum was 1.8 times, whereas in Pelargonium

the decrease was 1.6 times when Pb concentration was increased from 500 to 2000 mg kg-1 soil.

Similar trends were noticed for DOC content in the soil solution. Highest significant (p<0.05)

increase in DOC was obtained at 500 mg Pb kg-1 soil by Pelargonium. Maximum DOC observed

in Pelargonium cultured soil was 121±11 mg L-1 which is 1.7 times more compared to

Mesembryanthemum at same soil Pb concentration. Similar findings were obtained by Adejumo

et al. (2018) while studying rhizosphere soil. More amount of DOM and carbohydrates functional

groups (C-O; 1100 -1000 and O-H; 3700–3600) were observed in rhizosphere soil compared to

de

cdd d

e

abca

ab

bcd

d

0.0

0.5

1.0

1.5

2.0

0 500 1000 1500 2000

OM

(%

)

MesembryanthemumPelargonium

decd d d

e

abca

abbcd

d

0.0

0.5

1.0

1.5

2.0

0 500 1000 1500 2000

TO

C (

%)

dcd d

dd

aba ab

abc

bcd

0

40

80

120

160

0 500 1000 1500 2000

DO

C i

n s

oil

(m

g L

-1)

Soil Pb conc (mg kg-1)

(a)

(c)

(b)

59

bulk soil (Adejumo et al., 2018; Khoshgoftarmanesh et., 2018) showing root induced changes in

rhizosphere that favors Pb mobility and uptake by plants (Zhan et al., 2018).

3.8.2. Lead Concentrations in Shoots and Roots

Concentrations of Pb in roots and shoots are given in figure 3.6. Results indicated that Pb

concentrations in both plants significantly differ. Many factors interact and define plant’s ability

to concentrate Pb in root and shoot tissue that might include genotype, total and bioavailable

fraction of Pb in soil medium, plant induce rhizosphere modifications and other environmental

factors (Arshad et al., 2008). Results indicated that with increase in soil Pb concentration, Pb

accumulation in root and shoots of both plants increased significantly, compared to control

plants. Among both plants, Pelargonium accumulated significantly (p<0.05) high concentrations

of Pb in both roots and shoots (1281±77 and 276±7 mg Pb kg-1 DW) at highest soil Pb

concentration level (2000 mg kg-1). These results are in accordance with those reported in

screening of ornamental plants for Pb accumulation presented by Manzoor et al. (2018).

Maximum Pb concentrations in root and shoot of Mesembryanthemum was 755±99 and 207±12,

and for Pelargonium was 1281±77 and 275±7 mg Pb kg-1 DW, respectively. Lower shoot

accumulation in this study may be due to limiting direct root soil contact in cropping device

setup.

Similar trend of lower shoot accumulation by Pb hyperaccumulator Attar and Concolor was

observed by Arshad et al. (2008) while studying rhizosphere soil. The maximum Pbshoot

accumulation recorded in Attar was 284 mg kg-1 at 1500 mg Pb kg-1 soil after 2 weeks of

exposure. Whereas in our case the maximum accumulation observed in Pelargonium was 276

mg kg-1 DW at 2000 mg Pb kg-1 soil. The difference lies in the fact that Pelargonium accumulates

60

less amount of Pb in shoot and root compared to Attar when studied on pot and field experiment

(Arshad et al., 2008; Manzoor et al., 2018).

a. Biomass and Pb uptake characteristics

Biomass of both plants after culture experiment is presented in table 3.5. Pelargonium exhibited

1-2 times more biomass (root and shoot) at all levels of soil Pb concentrations compared to

Mesembryanthemum. Pelargonium showed significantly high biomass of root and shoot (1.1±0.1

and 1.6±0.1 g DW) in soil containing 500 mg Pb kg-1 soil. Maximum root and shoot biomass

(0.8±0.1 and 1.2±0.1 g DW) of Mesembryanthemum was also obtained at 500 mg Pb kg-1 soil.

With increasing Pb concentration from 500 to 2000 mg Pb kg-1 soil, a 2.1 and 1.7 –folds decrease

in root and 1.5 and 1.6 –fold decrease in shoot biomass was observed for Mesembryanthemum

and Pelargonium, respectively. Contrary to this, no decrease in biomass of Pelargonium cultivars

(Attar and Concolor) was observed, irrespective of soil Pb concentrations (500 and 1500 mg Pb

kg-1 soil) (Arshad et al., 2008) indicating greater potential for Pb phytoextraction. The plant

Figure 3. 6: Lead concentrations in plant parts after three week culture on Pb

spiked soil.

61

biomass was significantly higher in 500 mg Pb kg-1 soil level, which indicates that Pelargonium

is Pb lover plant up to certain concentration of Pb in soil (500 mg kg-1), however with further

increase in Pb concentration, decrease in plant dry biomass was observed. The higher Pb uptake

with minimum decrease in dry biomass of Pelargonium could be due to higher Pb tolerance

ability and detoxification of Pb inside plant tissue (Arshad et al., 2008).

Table 3. 5: Biomass and Pb uptake factors after 15 day of culture experiment.

Parameters Mesembryanthemum Pelargonium

Soil [Pb] mg kg-1 500 1000 1500 2000 500 1000 1500 2000

TF 0.30 0.25 0.30 0.21 0.24 0.23 0.23 0.22

CFr 0.93 0.60 0.48 0.38 1.40 0.86 0.73 0.64

CFs 0.26 0.14 0.14 0.08 0.32 0.19 0.17 0.14

Biomassr (g) 0.78bc 0.58d 0.50ed 0.37e 1.14a 1.08a 0.84bc 0.67cd

Biomasss (g) 1.16bcd 1.20bcd 1.00de 0.76e 1.63a 1.49ab 1.33a-d 1.00de

TF, CFr & CFs corresponds to translocation factor, root concentration factor & shoot

concentration factor; Biomassr,s corresponds to biomass of root and shoot, respectively.

Results of TF and CF are given in table 3.5. Values of TF were higher for both plants at 500 mg

Pb kg-1 soil compared to increasing soil Pb concentrations. This indicates lesser translocation to

shoots when Pb concentration in the soil was raised. Bio-concentration factors (CF) were

calculated separately for root and shoot (CFr and CFs, respectively). Results (table 3.5) showed

that CFr values were higher than CFs values which depicts that more accumulation was observed

in roots of both plants compared to shoot. Reduction in TF, CFr and CFs values in

Mesembryanthemum and Pelargonium have previously been reported by Manzoor et al. (2018)

and can be attributed to several plant and soil factors. At higher soil Pb concentration blockage

of ion channels may occur, or Pb may attach and fixed on exchange sites, also adsorption or

binding of Pb on to carboxyl groups present on cell wall may reduce the overall Pb available and

translocation inside plant tissue (Petruzzelli et al., 2015; Pendergrass and Butcher, 2006).

62

Total Pb uptake by both plants was calculated by multiplying Pb concentration with biomass

obtained in respective soil Pb concentrations. The formula used for uptake calculation is as

follows;

Pb uptake (mg) = ([Pbshoot] x DWshoot) + ([Pbroot] x DWroot) -------------------------------- (Eq 2)

Lead uptake by Pelargonium was significantly (p<0.05) higher compared to

Mesembryanthemum at all levels of soil Pb concentration (figure 3.7a). Pelargonium uptake 2-3

times more Pb per plant compared to Mesembryanthemum. The maximum uptake in

Mesembryanthemum and Pelargonium was 0.6 and 1.3 mg plant-1 at 1500 mg Pb kg-1. The higher

uptake in Pelargonium could be due to the influence of different factors. Firstly, acidification of

rhizosphere pH. Pelargonium was able to lower the soil pH significantly compared to

Mesembryanthemum and control soil (figure 3.4a). It is well reported that at lower pH more Pb

is solubilized and available for plant uptake (Zhan et al., 2018). Secondly, it increased labile

fraction of Pb for plant uptake (figure 3.4b). Thirdly, Pelargonium increased soil organic matter

pool (OM, TOC and DOC) (figure 3.5a,b,c). DOC plays important role in Pb chelation, solubility

and increase Pb uptake by plant (Khoshgoftarmanesh et al., 2018). Last but not the least,

Pelargonium produced higher biomass (table 3.5) and exhibited higher [Pb]root and [Pb]shoot

compared to Mesembryanthemum at all soil Pb concentrations (figure 3.5), which are important

components of uptake calculation.

Apart from Pb uptake and accumulation, considerable amount of Pb has been found loosely

attached on cell wall of roots (Arshad et al., 2016; Uzu et al., 2009). This loosely attached Pb

also termed as [Pb]adsorbed was determined after extracting the adsorbed Pb fraction with 0.01N

HCl solution. Results given in figure 3.6b showed considerable amount of Pb adsorbed on roots

of both plants. With increase in soil Pb concentration, significant increase in [Pb]adsorbed was

63

observed for both plants. Significantly (p<0.05) higher (1-2 times) Pb was adsorbed on

Mesembryanthemum roots compared to Pelargonium at 1500 and 2000 mg Pb kg-1 soil

concentrations. Maximum adsorbed Pb concentration for Mesembryanthemum (351±51 mg Pb

kg-1 DWroot) and Pelargonium (237±17 mg Pb kg-1 DWroot) were observed at 2000 mg Pb kg-1

soil. Percentage Pbadsorbed was calculated by following formula;

% Pbadsorbed = [Pbadsorbed]/ [Pbroot] x 100 --------------------------------------------------------- (Eq 3)

Figure 3. 7: Lead uptake and adsorption by plants after three week of culture experiment. a)

Lead uptake, b) Pbadsorbed.

Results indicated that Pbadsorbed ranged for 3-18% Pelargonium and 10-48% for

Mesembryanthemum. This highest % Pbadsorbed and Pbadsorved (figure 3.7b) for

Mesembryanthemum could be reason for low Pb accumulation (figure 3.6), uptake (figure 3.7a)

and translocation (table 3.5) compared to Pelargonium. Lead adsorption can take place on

polysaccharides of the rhizodermal cells and carboxyl group of mucilage and uronic acid

(Petruzzelli et al., 2015; Pendergrass & Butcher, 2006). The binding of Pb to these exchange sites

limits the entry in plant tissue.

c

b b bb

c

aa a

a

0.0

0.5

1.0

1.5

2.0

0 500 1000 1500 2000

[Pb

] m

g p

er p

lan

t

[Pb] soil (mg kg-1)


e

dcd

ab

a

e

dcd

cdbc

0

100

200

300

400

500

0 500 1000 1500 2000

[Pb

] m

g k

g-1

[Pb] soil (mg kg-1)


(a) (b)

64


The study concluded that both plants have ability to induce rhizosphere changes during three-

week culture in cropping device. Results indicated great ability of Pelargonium to acidify

rhizosphere soil and increase DOC content in soil that may have influenced Pb mobility in soil

solution. Lead accumulation results showed greater uptake in Pelargonium hortorum then

Mesembryanthemum criniflorum at all levels of Pb in spiked soil. The results indicated influence

of root derived chemical changes in soil that impacted Pb speciation. Therefore, in next part

different organic acids and their possible interaction with Pb was studied using speciation model

MINTEQ 3. Results are summarized in next part.

65

C. ORGANIC LIGANDS DERIVED LEAD SPECIATION USING

SPECIATION MODEL

3.10. INTRODUCTION

Phytoavailability of Pb is one of the major factor that hampers phytoremediation afficieny. Low

availability and mobility of Pb in soils seriously limits the full scale application of

phytoremediation system (Arshad et al., 2016; Gul et al., 2019; Jena et al., 2013). In this regard

hyperaccumulator plant derived root exudates may play significant role in defining Pb speciation

and bioavailability of nutrients, minerals and soil contaminants. The organic acids in root

exudates readily makes soluble complexes with metal ion by reducing soil Ph and increasing soil

DOC and therefore reduce adsorption of metals onto soil particle and improve their uptake by

plant (Khoshgoftarmanesh et al., 2018). Greater release of organic acids including citric acid,

acetic acid, malic acid, tartaric acid and phytic acid in root exudates of hyperaccumulator plants

such as Pteris vittata and Pelargonium sp. have been repoted (Fu et al., 2017; Arshad et al.,

2016). The organic acids greatly influence the chemical forms of Pb thereby affects Pb

mobility/immobility, adsorption, bioavailability and toxicity (Shahid et al., 2012b). Lead

speciation in soil plant system is strongly influenced by root exudates and organic ligands present

in rhizosphere. These ligands greatly influence Pb speciation, fractionation and mobility in soil

solution. Therefore understanding the interaction and mechanism of Pb sorption/desorption in

presence of root derived organics acids is needed.

In this study major components of root exudated identified in many plants have been assessed

for their interations towards Pb speciation. Pb speciation in soil is determined analyticaly through

complex and time-consuming techniques including anodic stripping voltammetry, ion selective

66

electrodes, competitive ligand equilibration/adsorptive stripping cathodic voltammetry and

sorption onto C18 columns (Cobelo-Garcia and Prego, 2004). Nowadays new, advanced

computer based softwares like WHAM VI, VISUAL MINTEQ, CHEAQS, PHREEQC,

ORCHESTRA, ECOSAT and CHESS served as rapid alternatives for quick estimation of metal

speciation in different medium (soil & aqueous).


In this study, Visual Minteq ver 3.1 (Gustafsson, 2008; Shahid et al., 2012b) was used to

estimated Pb speciation in 0.2 X Hoagland solution containing 1.6mM Ca(NO3)2. 4H20, 2.4mM

KNO3, 0.4mM NH4H2PO4, 0.8mM Mg(SO4). 7H2O, 0.023mM H3BO3, 0.0045mM MnSO4. H2O,

0.0003mM CuSO4. 5H2O, 0.0015mM ZnSO4. 7H2O, 0.0001mM (NH4)6Mo7O24. 4H2O and

0.1mM FeSO4. This software is extensively used (cited in more than 400 research articles), most

appropriate and best fitted to chemical speciation studies of organic chelates such as EDTA and

LMWOAs (Shahid et al., 2012b). Four organic ligands (citric acid, oxalic acid, malic acid and

tartaric acid) mostly present in root exudates as reported in literature (Arshad et al., 2016; Shahid

et al., 2012b) were selected for this study. Insoluble salt of Pb as PbCO3 (1 mM) was used in the

speciation study, as carbonate and sulphate salts are most predominant forms of Pb in soil

(Arshad et al., 2008). Different pH range (4-10) and different concentrations of organic ligands

(0.1, 0.5, 1, 5 and 10 mM) were considered in the speciation study.

67


3.12.1. Effect of pH on Pb Speciation in Nutrient Solution

pH is considered as one of most important parameter controlling Pb availability and subsequent

uptake by plants (Arshad et al., 2016; Shahid et al., 2014, 2010). The effect of pH on Pb

speciation estimated through visual minteq software is shown in figure 3.8a. The results indicate

that in acidic conditions (pH 4-5) >80% Pb is available as Pb+2. Whereas in alkaline conditions

80% Pb is predominantly found as insoluble hydroxide (PbOH). The ions that interacts with Pb

speciation are carbonate ions (CO3-) followed by sulphate ions (SO42- ). Shahid et al. (2012) also

reported similar trend of pH effect on speciation on Pb in full strength Hoglands solution taking

PbNO3 as source of Pb. However the adsorption to inorganic ligands was more towards NO3- and

SO42-, which may be due to the different strength of nutrients and different source of Pb.

Figure 3. 8: Effect of pH on Pb speciation (a) and effect of OA in pH change in nutrient

solution (b).

3.12.2. Effect of Organic Ligands on Solution pH

Figure 3.8b shows the effect of organic ligands on solution pH. Results clearly indicates that in

the absence of organic acids the solution pH was raised from 7.1 to 7.8. The pH was strongly

0

20

40

60

80

100

4 5 6 7 8 9 10

Pb

(%

)

pH

Pb⁺²

Pb-NO₃

Pb-CO₃

PbSO₄

Pb-OH

Pb-PO₄

0

2

4

6

8

10

0.1 0.5 1 5 10

pH

OA Conc. (mM)

controlcitratemalateoxalatetartrate

(a) (b)

68

decreased in upon addition of all organic acids. Greater decrease in pH was observed up to 5 mM

concentration of organic acid. The decrease in pH by organic acids followed the decending order

citric acid > tartaric acid > malic acid > oxalic acid.

3.12.3. Effect of Organic Acids on Pb Speciation in the Nutrient Solution

The results from speciation models showed the binding capacity of organic acids to Pb at

different solution pH in descending order of malic acid >citric acid > tartaric acid > oxalic acid.

Figure 3. 9: Effect of solution pH and OA on Pb speciation in 0.2 strength Hogland solution; a)

citrate; b) malate; c) oxalate; d) tartrate. Calculations are made by Visual Minteq-3 software.

0

20

40

60

80

100

4 5 6 7 8 9 10

Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-citrate

0

20

40

60

80

100

4 5 6 7 8 9 10

Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-malate

0

20

40

60

80

100

4 5 6 7 8 9 10

Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-oxalate

0

20

40

60

80

100

4 5 6 7 8 9 10

Pb⁺² Pb-NO₃Pb-CO₃ PbSO₄Pb-OH Pb-PO₄Pb-tartrate

pH of nutrient solution

Pb

spec

iati

on

(%

)

(a) (b)

(c) (d)

69

Results indicates that application of 0.5 mM of malic, citric and tartaric acids chelated >80% of

Pb where as oxalic acid chelated < 80% of Pb. Lead availability as free radicle Pb+2 was more

in case of citric and malic acid addition compared to oxalic and tartaric acids (figure 3.9).

Similar trend was observed by Shahid et al. (2012), where highest chelation up to 90% was

observed in case of EDTA (5 μM EDTA) and much lower chelation (46%) was observed by

application of 100 μM citric acid in Hoglands solution. The effect of different concentrations of

organic ligands on Pb speciation was futher analysed and results are given in figure 3.10.

Figure 3. 10: Effect of OA conc. on Pb speciation in 0.2 strength Hogland solution; a) citrate;

b) malate; c) oxalate; d) tartrate. Calculations are made by Visual Minteq-3 software.

The results indicated that with increase in concentration of organic acids the complexation of Pb

to organic ligands was increased with highest increase in oxalic acid followed by tartaric acid >

0

20

40

60

80

100

120

0.1 0.5 1 5 10

Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-citrate

0

20

40

60

80

100

120

0.1 0.5 1 5 10

Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-malate

0

20

40

60

80

100

120

0.1 0.5 1 5 10

Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-oxalate

0

20

40

60

80

100

120

0.1 0.5 1 5 10

Pb⁺² PbNO₃ PbCO₃PbSO₄ Pb(OH)₂ PbPO₄Pb-tartrate

Conc. of organic ligands (mM)

Pb

spec

iati

on

(%

)

(a) (b)

(c) (d)

70

citric acid > malic acid. Similar findings were obtained by Shahid et al. (2018). The Pb

complexation with citric acid increased with increase in concentration of citric acid (0-1000 µM).

Gul et al. (2019) also worked with 5 different organic and inorganic ligands and found citric acid

as efficient Pb chelating agent after EDTA for dissolution of Pb in soil and subsequent uptake by

Pelargonium hortorum.

3.13. SUMMARY

The study concluded that organic ligands plays important role in Pb speciation in nutrient

solution. pH is the main factor controlled by concentration of organic acids that ultimately defines

Pb speciation and fractionation in nutrient medium. Organic acids form organo-metalic

complexes of different stability and solubility.

This study gave an insight and clear understanding of plant induced rhizosphere changes and

interaction of different organic acids (root exudates) for Pb availability in soil and nutrient

solution and subsequent phtoextraction. However, phytoremediation is a slow process that

requires more time for complete removal of Pb form contaminated soil. Synthetic chelates have

been found to induce Pb solubility but also accounts for ground water leaching and toxicity to

biological systems. Whereas, genetic engineering and gene manipulation includes high cost and

gene transfer. In this regard the use of biological agents for enhanced Pb mobility and subsequent

uptake by plants gives environmental friendly option to decontaminate Pb with greater

effeciency. Upcoming chapter is focused on studying plant-microbe interactions in

phytoremediation and comprises of four parts; (I) Fungal studies and (II) Bacterial studies, (III)

co-inoculation studies for Pb uptake and (IV) and soil enzymatic activities.

71

Chapter 4

PLANT-MICROBE INTERACTION IN PHYTOREMEDIATION OF

LEAD

Biological methods are natural, favorable, and suitable for phytoremediation of Pb contaminated

soil along with retaining soil biological health and nutrients turnover. In this chapter, the effects

of bioinoculants (bacteria and fungi) and their interactions for Pb availability in soil and

contribution in phytoextraction of Pb and soil enzymatic activities were studies. The chapter is

divided in 4 sections.

A. FUNGI-ENHANCED PLANT GROWTH AND PHYTOEXTRACTION OF LEAD:

TOLERANCE, PGP ACTIVITY AND PHYTOAVAILABILITY

Lead (Pb) is known for its low mobility and persistence in soils. The main aim of present study

was to explore potential of different fungal strains to promote phytoextraction of Pb-

contaminated soils.

4.1. INTRODUCTION

The long term ecological ramification due to continuous exposure of Pb in the environment has

increased interest in developing and improving the already existing remediation technologies.

Anthropogenic activities contribute to soil and water multi-metal contamination, of which Pb is

a major concern. Due to its high persistence, it is known as a threat to soil organisms, plants and

animals. Soils containing Pb above 1000 mg kg-1 may negatively impact microbial populations

thereby disturbing the major soil biogeochemical processes such as decomposition and

72

mineralization of nutrients which ultimately affect growth of inhabiting plants and animals

(Sahodaran & Ray, 2018).

The remediation of Pb-contaminated soils using Pb-hyperaccumulator plants is an area of

continuing consideration. More than 500 plant species comprising of 101 families have been

reported to accumulate heavy metals (Prasad & Freitas, 2003) of which Pb hyperaccumulators

(>1000 mg Pb kg-1 shoot biomass) including fragrant (Arshad et al., 2008), or ornamental species

of Pelargonium genus such as Pelargonium hortorum and, Mesembryanthemum criniflorum

(Manzoor et al., 2018), Bidens pilosa (Yongpisanphop, 2017) and Alcea aucheri (Ravanbakhsh,

2016) have been identified. In our previous work, certain accumulators belonging to ornamental

families have been identified for Pb phytoremediation (Manzoor et al., 2018; Arshad et al., 2016,

2008).

The efficiency of phytoremediation highly depends upon the available fraction of Pb that may be

phytoextracted. Lead is not available and is more often found in its bound form with soil and

organic matter and only 2% of it is in its bioavailable form (Smith et al., 2011). In order to

increase the efficiency of Pb phytoextraction, the use of chelating agents have gained much

importance for the past 50 years (Gul et al., 2019; Shahid et al., 2014). Synthetic chelators alter

the natural state of Pb and make it more bioavailable through increased dissolution (Gul et al.,

2019). Extensive research on the use of these chelators in the environment such as EDTA have

highlighted several concerns including slow biodegradability, persistence (Pandey &

Bhattacharya, 2018), leaching of the metallic elements to the ground water (Hartley et al., 2014),

and decreased soil flora and fauna (Kaurin et al., 2018).

Besides chelating compounds, biological organisms also offer wide range of properties that may

be utilized for increasing metal availability in soils. In the case of soil fungi, these excrete variety

73

of different extra cellular substances including enzymes and organic acids (gluconic acid, fumaric

acid, and citric acid) that may alter the pH and organic matter status and could directly influence

the bioavailability and speciation of Pb. Some of the fungi which have been studied for positive

effects on phytoremediation process are arbuscular mycorrhiza fungi (AMF) and species of the

genus Trichoderma. Different studies indicated AMF to increase uptake and sometimes decrease

Pb uptake and translocation in associated plants. Yang et al. (2015) reported two AMF species

(F. mosseae and R. intraradices) associated with R. pseudoacacia able to decrease Pb

concentration in shoot. There are reports that Trichoderma may stimulate plant growth by up to

300%, besides protecting them from various environmental stresses (Kavamura & Esposito,

2010). Penicillium simplicissimum has been reported to induce plant growth and activate multiple

defense signals under variety of biotic and abiotic stresses (Hossain et al., 2007).

Keeping in view that fungi may improve phytoremediation of Pb through modification of the soil

physicochemical characteristics, specific objectives of the current study were (a) to assess the

impacts of Pb tolerant fungi upon Pb soil mobility, (b) monitor plant growth promoting

characteristics of tested fungi and (c) their influence on phytoextraction of Pb by

hyperaccumulator plant species.


4.2.1. Soil Characterization

Soil sampling was done from industrial area located near battery recycling units in Islamabad

and Rawalpindi. The top 20 cm soil (represented upper layers O and A horizons) was collected

and analyzed for Pb concentration. It was found to be 1352 mg kg-1. For controlled experiment

soil was collected (NUST nursery, Islamabad) and artificially spiked (500, 1000, 1500 and 2000

74

mg kg-1) after air-drying (3 weeks) and sieving through a 2mm mesh. The physicochemical

characteristics of soil were the same as those used in the previous study (table 3.1) (Manzoor et

al., 2018). Soil pH, texture and organic matter were 7.39, clay loam and 0.42%, respectively as

determined by laboratory protocols. (Manzoor et al., 2018).

4.2.2. Pb Tolerant Fungal Strains

Fungal strains: Trichoderma harzianum, Penicillium simplicissimum, Aspergillus flavous,

Aspergillus niger and Mucor spp. were studied for their Pb tolerance. The strains were earlier

isolated from heavy metal contaminated industrial areas and were obtained from Fungal Culture

Bank, University of Punjab, Lahore, Pakistan. Their Pb tolerance was recorded at gradually

increasing concentrations of Pb(NO3)2. Potato dextrose agar (PDA) and potato dextrose broth

(PDB) were used as growth medium. For each concentration, fungi were incubated at 28 °C for

7 days. The metal concentration, where no significant change in fungal growth was observed by

measuring optical density, were compared to control (no Pb), was considered as the highest metal

concentration tolerated by the fungal strain.

4.2.3. Effect on Soil pH, Organic Matter and Pb Mobility

The biomass of fungi was harvested using sterilized water as explained by Deng et al., (2011).

Spore suspension at OD 570nm was adjusted to 0.5 OD. Then 1 mL of freshly prepared spore

suspension was added to 20 g autoclaved and previously Pb-spiked soil in petri dish plates (60

mm × 15 mm). Autoclaved distilled water was added to maintain 65% moisture content. Plates

were then wrapped with parafilm and placed in an incubator at 28 °C for 15 days. After

incubation, the soil was extracted with 0.01M CaCl2 extractant on a rotary shaker at 150 rpm

(Deng et al., 2011) for 2 hours. The filtrate was used to determine the pH and the amount of

75

available Pb in soil solution using an Atomic Absorption Spectrophotometer (AAS) (Model:

GBC 932 plus Australia) (AFNOR, 1994). Organic matter was determined through titration

method (Walkley & Black, 1934).

4.2.4. Plant Growth Promoting Activities of Fungal Strains

a. Indole acetic acid (IAA)

IAA producing ability of Pb tolerant fungi was examined by the method adopted from

Bhagobathi & Joshi (2009) with some modifications. Fungi was inoculated by loop full of spores

in PDB supplemented with a sterilized solution of 1% L-tryptophan in 50 mL Teflon tubes and

incubated at 28 °C for 4 days. After centrifugation (5000 rpm for 15 min), 2 mL supernatant of

fungal extract was mixed with 2 drops of ortho-phosphoric acid followed by addition of 4 mL of

Salkowsky reagent. The mixture was then incubated for 20 minutes for development of pink

color depicting IAA production by strains. Intensity of color developed was determined by

measuring absorbance through UV/Vis spectrophotometer (Specord 200 plus UV-VIS

Spectrophotmeter, Analytikjena, Germany) at a wavelength of 535 nm. Standard curve was used

to estimate the amount of IAA produced by individual fungi.

b. Phosphate solubilization

Qualitative and quantitative estimation of phosphorus solubilization ability of fungal isolates

were estimated using Pikovskaya agar and broth media (Pikovskaya, 1948). For quantitative

assays, isolates were cultured in 250 mL conical flask containing Pikovskaya broth medium and

placed in rotary shaker (150 rpm) for 7 days. After filtration with Whatman No. 42, filtrate (20

mL) was centrifuged for 15 minutes at 1000 rpm. Available phosphorus in the media was

determined by a colorimetric method using Barton’s reagent (Clesscerl et al., 1998). Absorbance

76

was noted at a wavelength of 693 nm, using a doubled beam spectrophotometer. Uninoculated

Pikovskaya broth medium was used as a control.

c. Gibberellic acid production

Fungi were inoculated in 100 mL conical flask containing 50 mL of PDB and placed in a shaking

incubator at 28 °C and 150 rpm. After 48 h, media were filtered, and samples were acidified to

pH 2.5 using 1N HCl. Samples were then extracted using liquid-liquid (ethyl acetate/NaHCO3)

extraction. Solvent was evaporated to 10 mL on a rotary evaporator for quantification of GA3

and absorbance was noted at 254 nm through spectrophotometer (UV/VIS). The amount of

gibberellic acid in the ethyl acetate phase was calculated from standard curve (Bilkay et al.,

2010).

d. Siderophore production

Siderophore production was determined using the protocol of Schwyn & Neilands (1987).

Freshly prepared Chrome azurol S (CAS) agar plates were point inoculated with test fungi and

incubated for 4 days. Development of orange or pink halo zones indicated siderophore production

and was expressed as mm of halo zone. Uninoculated plates (controls) were prepared and

incubated in the same manner. Quantification of siderophores was done in CAS- malt extract

(ME) broth media. Inoculated and uninoculated broth were placed in shaking incubator at 30 °C

and 120 rpm. After 3 days, fermented broth was filtered using Whatman no.1 filter paper and

analyzed colorimetrically using ferric per chloride assay method. Absorbance was measured at

630 nm (Aziz et al., 2016). Calculations were done by using following formula;

% Siderophore units = Ar − As × 100

Ar

Where Ar and As is the absorbance of reference (CAS reagent) and sample at 630 nm.

77

4.2.5. Culture Experiment

Pot experiments were setup by transplanting uniformly developed one-month old seedlings of

Pelargonium hortorum and Mesembryanthemum criniflorum in 1 kg pot containing soils spiked

with different levels of Pb (500, 1000, 1500 and 2000 mg kg-1). Selected fungal strains from Pb

solubilization assay were applied on to plants after acclimatization of 1 week. Fungal inocula

were prepared as described above. Plants were allowed to grow in the greenhouse under natural

day and light conditions. The moisture content was maintained at 60% by adding distilled water.

After 6 months, plants were harvested and analyzed for biomass and Pb accumulation properties.


Statistical analysis of data was carried out using the SPSS statistical package (version 20.0 for

Windows). All experimental data were analyzed using the one-way analysis of variance

(ANOVA). Significance difference (p< 0.05) was determined by least significant difference

(LSD) test and Duncan multiple range test.


4.3.1. Pb Tolerant Fungi

Tolerance of fungi to Pb was recorded up to 500 and 1000 mg L-1 on PDA and PDB, respectively.

Results indicated different Minimum Inhibitory Concentrations (MIC) values of Pb for tested

fungi. The MIC is the lowest inhibitory concentration of metal that affects visible growth of

tested organism. Radial hyphal growth rate revealed that most of tested fungi were characterized

by a high tolerance to Pb. On PDA at 500 mg L-1 (data not shown), the tolerance pattern was T.

harzianum> A. flavus> A. niger> Mucor sp.> P. simplicissimum, whereas on PDB, the tolerance

78

(1000 mg L-1) of fungi followed the sequence T. harzianum> A. niger> Mucor sp.> A. flavus> P.

simplicissimum (figure 4.1). The results of the present study showed that the highest significant

tolerance was exhibited by T. harzianum and A. niger. Minimum decrease in total dry biomass

production by 5.74% and the highest tolerance index of 0.94 was observed with A. niger (table

4.1).

Figure 4. 1: Fungi tolerance to Pb was expressed as the ratio of the absorbance in Pb

supplemented medium (Am) with respect to that of the control (Ac.) representing the growth

observed in PDB supplemented with 1000 mg L-1 of Pb .

Different studies reported A. niger, Penicillium sp. and Fusarium sp. as efficient tools for

decontamination of heavy metals including Pb, Cr, Zn, Ni and Cd (Iram et al., 2012; Bai &

Abraham, 2003). In a study conducted by Mohammadian et al. (2017), T. harzianum was more

tolerant to Cd, Pb and Cu metals with MIC value of 35-650 mg L-1. Similar findings were

obtained by Iskandar et al. (2011) where the highest Pb tolerance was showed by A. niger (500

mg L-1). Pb tolerance in A. niger have been found because of increased proline indicating metal

tolerance mechanism. Proline act as scavenger of hydroxyl radicals generated during Pb toxicity

inside cell wall (Chandran et al., 2014). The variation in fungal isolates to tolerate increasing Pb

aab

bb

b

0.0

0.5

1.0

1.5

Rati

o (

Am

/Ac)

Fungal strains

79

concentrations may be attributed to the inherent ability, defense response, detoxification

mechanism and other biochemical characteristics that vary from genome to genome (Baldrian &

Gabriel, 2002).

4.3.2. Effect of Fungi on soil properties

a. Effect of fungal treatment on soil Pb mobility

The results from soil incubation experiments showed that fungal strains vary in their ability to

modify Pb availability and thereby increase the Pb mobility. Figure 4.2 presents the effect of

each tested fungal strain on Pb mobility. It was observed that with increase in soil Pb

concentration from 500 to 2000 mg Pb kg-1 soil, solubility was increased by 5.2 –folds.

Figure 4. 2: Effect of fungal inoculation on Pb mobility with increasing soil Pb concentrations

(500, 1000, 1500 and 2000 mg Pb kg-1 soil). Control indicated no fungal inoculation. Pb

concentration in control soil (0 Pb mg kg-1) was < 3 mg kg-1. The graph is plotted by taking the

mean of three replicates per treatment. Bars marked with different letters are significantly

different at p<0.05.

At 2000 mg kg-1 Pb concentration, Mucor spp. and A. flavus were able to significantly (p<0.05)

increase Pb solubility by 1.8 and 1.6–folds, whereas T. harzianum and P. simplicissimum

j j

ij

c

ij

cd

ij ij

gh

b

hi

b

fghefg

ef

a

fgh

a

cd

hi

ef

b

cd

a

0

20

40

60

80

100

Control T.harzianum P.simplicissimum A.flavous A.niger Mucor spp.

Pb

Con

c. (

mg k

g-1

)

Fungal strains

500 1000 1500 2000 mg kg-1

80

decreased Pb solubility by 2.2 and 1.2–folds compared to the control soil (no fungi) at 2000 mg

Pb kg-1 soil. In a study conducted by Munawar & Irum (2014), the addition of the active mycelia

of A. niger and A. flavus increased the soil Pb chelation after 24 h of inoculation. A. niger was

more efficient in adsorbing Pb instead of releasing it in soil solution. Mucor spp. (CBRF59) have

also been found to significantly increase the availability of soil Pb by 77% (Deng et al., 2011).

The ability of A. flavus and Mucor spp. to increase Pb mobility may be due to production of

organic compounds. Most of the soil fungi secreted organic acids that form complexes with

metals and define metal speciation which served as chelating agents during the course of

incubation. Natural low molecular weight organic acids (NLMWOA) such as citric acid, oxalic

acid, or malic acid and humic substances (HS) belong to natural chelating agents. These

compounds play an important role in the metal solubility directly by changing soil pH and

indirectly by their effects on microbial activity, rhizosphere chemistry, and root growth dynamics

and directly, through acidification, chelation, precipitation, and oxidation-reduction reactions in

the rhizosphere (Evangelou et al., 2007). Number of studies have reported the ability of A. niger

to produce the NLMWOA in large quantities of which oxalic and citric acids contain 90% of the

total organic acid produced (Ousmanova & Parker, 2007).

b. Effect of fungal treatment on soil pH

Fungal ability to modify pH was monitored in broth (PDB) and soil. Inoculation of fungi in broth

culture and the corresponding changes in the pH of solution are presented in figure 4.3a. From

results, it is obvious that pH of broth slightly declined with increasing number of days. The pH

of freshly prepared broth was 5.6. Upon inoculation of fungi, clear change in pH of solution was

observed. Among the five strains, A. niger drastically lowered the pH on 2nd day of culturing

which continued up to 6th day. The highest significant effect in lowering pH on 6th day of

81

incubation was obtained by A. niger followed by A. flavus. Our results are in agreement with

previous studies reported in literature. A. niger lowered the pH of solution up to 4.17 besides

solubilizing phosphorus when growing on PVK medium (Reena et al., 2013). This wide change

in pH may be due to release of organic acids. Chandran et al. (2014) working with A. niger

observed production of citric (121 mg L-1) and oxalic acid (110 mg L-1) in PDB medium in the

presence of Pb (50 mg L-1), which could be a reason of media acidification by A. niger in current

study.

Figure 4. 3: Effect of fungal inoculation on PDA media pH (a); soil pH after incubation (b).

Graph is plotted by taking mean of three replicates.

Similar results had also been obtained in soil treated with different fungal inoculums (figure

4.3b). According to the results, a slight decrease in pH was observed in control soil with

increasing concentration of Pb and this change was not significant (P < 0.05). Reduction in soil

pH depicts that fungi may modify soil environment which may favor phytoremediation of Pb and

other heavy metals. The change in pH (ΔpH) as a result of fungal treatment was obtained by

subtracting pH obtained in control soil from pH obtained in fungal treated soil. Acidification of

3.0

4.0

5.0

6.0

7.0

0 2 4 6

pH

Days

ControlT.harzianumP.simplicissimumA.flavousA.niger 6.5

6.7

6.9

7.1

7.3

7.5

0 500 1000 1500 2000

pH

Soil [Pb] mg kg-1

(b) (a)

82

soil was indicated by negative values of ΔpH. Three strains including A. flavus, A. niger and

Mucor spp. lowered the soil pH (-0.15, - 0.05 and -0.13 ΔpH, respectively) whereas T. harzianum

and P. simplicissimum increased the soil pH (+0.08 and +0.11 ΔpH, respectively).

c. Effect of fungal treatment on soil organic carbon content

Fungi provide major contribution to soil organic matter since it plays important role in

decomposition of biomaterials added to soil. Increase in soil organic matter increases Pb

immobilization (Xu et al., 2018). The effect of five fungal strains upon soil organic matter is

presented in figure 4.4.

Figure 4. 4: Change in organic matter (%) in soil treated with different fungal strains. The

values are means of three replicates. Means marked with different letters are significantly

different at p<0.05.

The initial value (before treatments) of organic matter (OM) in control soil was 0.88% which

was significantly (p<0.05) reduced to 0.046% at 2000 mg kg-1 soil Pb concentration. Significant

increase in organic carbon was observed by A. flavus at increasing concentration of Pb in soil

when compared to other strains and control soil. The maximum values for increase in organic

carbon recorded were 1.68 and 1.36% for A. flavus and A. niger, respectively, at 500 mg kg-1 soil.

b

b-f

b-e

a

a

b-db-f

d-ge-i

b-e

bc

e-h

f-ie-i

g-i

c-g

b-e

c-e

hi

g-i

hi

g-i

i

f-h

0

0.4

0.8

1.2

1.6

2

Org

am

ic c

arb

on

(%

)

Fungal strains

500 1000 1500 2000 mg kg-1

83

Contrary to pH, with increase in soil Pb concentration, organic carbon decreased. This could be

due to Pb toxicity. Under elevated Pb concentration, there might be decrease in secretions of

sugars and weak organic acids which at the same time increased the pH of solution but decreased

the organic content.

4.3.3. PGP Assays

The potentials for plant growth promotion and biochemical enzyme activity of the selected fungal

strains were evaluated. The details are as follows.

Table 4. 1: Reduction in dry biomass, tolerance index (TI) of fungal strains after exposing to

1000 mg L-1 Pb in PDB media after 5 d and PGP activity. Letters indicate significance

difference at p value <0.05.

Sr # Fungal strains Reduction in

dry biomass

(%)

TI IAA

(µg mL-1)

P

solubilization

(µg mL-1)

Gibberellins

production

(µg mL-1)

Siderophores

production

(%)

1 A.niger 5.74 0.94 249±7.2a 27±1.9b 43±1.1a 61±1.3a

2 T.harzianum 12.87 0.87 99±3.2c 22±0.5bc 36±1.3b 38±3.8c

3 A.flavous 17.93 0.82 65±2.5d 8±1.2d 7±0.8d 49±2.6b

4 Mucor spp. 24.69 0.75 203±5.8b 17±1.9c 5±0.6d 28±5.1cd

5 P.simplicissimum 56.74 0.43 16±1.5e 58±2.2a 13±1.2c 25±2.6d

TI=Biomass in Pb supplemented medium/ Biomass in control

a. IAA production

Auxins play an important role in plant growth, reproduction, metabolism and responses to various

environmental cues including interactions between auxin homeostasis and heavy metal toxicity

(Waqas et al., 2012). The ability of tested fungal isolates for IAA production is presented in table

4.1. Among five strains, the highest IAA was recorded in A. niger (249 μg mL-1) followed by

Mucor spp. (203 μg mL-1). This agrees with the results of many investigators where the high

production of IAA was observed in A. niger (710 and 100 μg mL-1) (Usha & Padmavathi, 2013;

Bilkay et al., 2010) T. harzianum has also been reported for IAA production (52.57 μg mL-1) (Al-

84

Askar, 2016). IAA plays significant role in the phytoextraction of Pb by improving plant biomass

and contributing to Pb detoxification mechanisms in plants (Hac-Wydro et al., 2016). Auxins can

promote modification of membrane properties, thereby alleviating toxic effects of heavy metal

exposure. In the presence of lead, naphthalene acetic acid (NAA) has been found effective in

reducing heavy metal toxicity by protecting plants from membrane damage and disorganizing

(Hac-Wydro et al., 2016). In another study, IAA increased Pb accumulation into harvestable

tissue by 2800% over control plants (Lopez et al., 2005).

b. Phosphate solubilization

Phosphate induced Pb biomineralization is the main Pb detoxification mechanism in fungi and

considered as one of the most important and efficient bioremediation strategies. Many soil fungi

secrete organic ligands that effectively solubilize metal and liberate metal cations such as Pb. On

the other hand, there is group of phosphate solubilizing fungi (PSF) that interact with lead through

immobilization processes such as biomineralization of lead oxalates, phosphates and carbonates

(Povedano-Priego et al., 2017). In the present study, the phosphate solubilization potential of

tested fungi was monitored and given in table 4.1. Results indicated that P solubilization ability

of fungi ranged between 8 to 58 µg mL-1. P. simplicissimum greatly increased the soluble P in

culture medium (58 µg mL-1) followed by A. niger and T. harzianum (27 and 22 µg mL-1,

respectively). The least phosphate solubilization potential was observed in A. flavus (8 μg mL-1).

This is comparable to the P solubilized by P. simplicissimum (58.8 mg L-1) in a liquid medium

containing phosphate rock (Wakelin et al., 2004). P. simplicissimum is repeatedly reported as

efficient phosphate solubilizer in many studies. Even in saline conditions (3.5% NaCl), higher

number of spores and content of soluble P in the medium has been reported with P.

simplicissimum, followed by A. niger and A. japonicus (Xiao et al., 2011). Reena et al. (2013)

85

revealed A. niger as major phosphate solubilizer, while testing rhizospheric microbial community

of banana plant. A. niger formed clear halo zone (2.3 cm diameter) on LB agar and in broth assay

the phosphate solubilization activity 3.90 mg 25 mL-1 was recoded. Xiao et al. (2009) found

phosphate solubilizing ability of Mucor spp. as 89.65 mg L−1. In another study, A. niger and T.

harzianum showed solubilization activity of 1.67% and 0.32%, respectively depicting the ability

of these strains to solubilize P (Yasser et al., 2014). Comparing these results with pH changes in

incubation experiment, acidification of culture medium seemed to be the main mechanism for

phosphorus solubilization. However, acid production may not be the only reason for phosphate

release into the medium. There might be other factors including acidification either by proton

release coupled with ammonium assimilation or proton release from organic acid production.

Acid phosphatases and phytases secreted by these microorganisms also have an important role

in phosphate solubilization (Yasser et al., 2014).

c. Gibberellin production

All fungal strains could produce gibberellin. The highest GA3 production was recorded in A.

niger (43 µg mL-1) followed by T. harzianum (36 µg mL-1) and P. simplicissimum (13 µg mL-1)

as shown in table 4.1. A. flavus and Mucor spp. produced the least and insignificant amount of

GA3 when compared to control. In some other studies, Aspergillus species have been tested for

production of GA3 and it was found that ~60 µg mL-1 of GA3 was produced by A niger (Bilkay

et al., 2010). In another study, T. harzianum 1-SSR produced 34.80 μg mL-1 of GA3 depicting its

plant growth promoting ability (Al-Askar, 2016).

d. Siderophore production

86

Strains had different abilities to produce siderophores in both CAS agar and CAS broth media.

CAS agar assay confirmed siderophores producing ability of A. niger, A. falvous and P.

simplicissimum. The extent and color of halo zones after 4 days incubation varied among fungal

strains showing different type and quantity of siderophores produced by different fungi (data not

shown). The highest siderophore production was observed by A niger (4.4 cm) followed by A.

flavus (1.7 cm) and P. simplicissimum (0.3 cm). Negligible production of siderophores was

observed in T. harzianum and Mucor spp. Similar results were obtained in CAS broth. A. niger

was found to have significantly high siderophores production (61%) followed by A. flavus (49%)

(table 4.1). Our results are in agreement with several other investigations where A. niger (12 U

mL-1) and A. flavus str1 (10 U mL-1) showed higher siderophore production compared to other

tested fungi (Usha & Padmavathi, 2013). Siderophore production abilities of soil fungi depends

on several environmental factors including elevated iron concentration in the vicinity.

Siderophore production is influenced in the presence of organic acids produced from fungi. It is

well documented that citric, oxalic and malic acids and, other organic acids play important role

in CAS reagent reaction in presence of iron. These acids can react with CAS reagent in the same

manner as true siderophores, thereby, change the color of assay medium (Carson et al., 1992).

4.3.4. Effect of Fungi on Pb Accumulation and Uptake

Pb accumulation by Pelargonium hortorum and Mesembryanthemum criniflorum as a result of

fungal treatment is presented in figure 4.5. Results showed that fungal treatment improved the

Pb accumulation up to 1500 mg kg-1 Pb treatment with the highest significant accumulation in

Pelargonium hortorum treated with A. falvus. At the highest soil Pb treatment (2000 mg kg-1),

the Pb accumulation was significantly reduced in control plants which may be due to high toxicity

induced by increased concentrations of Pb in soil. However, plants treated with fungi showed

87

better performance with significant (P>0.05) accumulation in Pelargonium hortorum treated

with A. falvous followed by Mucor spp. In case of dry biomass production by each plant, A niger

sustained plant biomass with increasing concentrations of Pb in soil (data not shown).

Figure 4. 5: Effect of fungal treatment on Pb accumulation. Pb concentration in control soil (0

Pb mg kg-1) was < 2 mg kg-1. The values are means of three replicates. Means marked with

different letters are significantly different at p<0.05.

Results of Pb uptake per plant calculated from biomass and concentration of Pb in root and shoot

is given in table 4.2. Among two plants, Pelargonium hortorum was more efficient in

accumulating Pb in plant biomass. Total per plant Pb uptake in Pelargonium hortorum was 1.7–

folds higher than that in Mesembryanthemum criniflorum. This difference could be due to the

lesser biomass produced by Mesembryanthemum criniflorum. The reason lies in the fact that

Mesembryanthemum criniflorum is a seasonal plant and could only be grown for 4 months,

whereas Pelargonium hortorum is perennial showing higher biomass production. All fungal

isolates were found to increase Pb uptake in both plants. At 2000 mg kg-1 soil Pb concentration,

all strains equally increased Pb uptake in Mesembryanthemum criniflorum 2 –folds compared to

the control plants. In case of Pelargonium hortorum, the increase in Pb uptake was 3, 2 and 2–

m…lmn

e-h ghi

cde cd

klmjk

klmkl

cd

ab

cd

a

c-fbc

n

klm

ghi ghi d-g

cdef

ijkhijk

kl klm

cdee-h

cdec

fghc-g

0

500

1000

1500

Mc Ph Mc Ph Mc Ph Mc Ph

500 1000 1500 2000

Pb

acc

um

ula

tion

in

sh

oo

t (m

g

kg

-1)

Pb conc. in soil (mg kg-1)

Control

A. flavous

A. niger

Mucor Sp.

88

folds in plants treated with Mucor spp. A. flavus and A. niger, respectively. Highest significant

(p<0.05) uptake was observed in Pelargonium hortorum by Mucor spp. (2.21 mg per plant)

followed by A. flavus (1.85 mg per plant) in soil containing 500 mg Pb kg-1 soil.

Table 4. 2: Pb uptake (mg) in plants treated with fungi at different soil Pb concentrations.

Letters indicate significance difference at p value <0.05.

Treatments Pb concentrations in soil (mg kg-1)

500 1000 1500 2000

Mesembryanthemum criniflorum

Control 454no 752i-m 685j-n 342o

A. flavous 566m-o 890h-k 685i-n 602l-o

A. niger 574m-o 952h-j 685h-l 599l-o

Mucor Sp. 718i-n 979hi 685h-j 612k-o

Pelargonium hortorum

Control 955h-j 1465de 1623cd 593m-o

A. flavous 1060gh 1853bc 1614cd 1164f-h

A. niger 1405d-f 2142a 1951ab 1291e-g

Mucor Sp. 1295e-g 1769bc 1963ab 1342ef

Mucor spp. is well reported for plant growth improvement in Pb and other heavy metal

contaminated soil. In an experiment, Mucor treated Guizhou oilseed rape, the concentration of

Pb and Cd in plant tissues were increased by 117.6% and 63.5%, respectively, and decreased soil

Pb and Cd concentration by 60.6% and 27.1%, respectively (Zhu et al., 2015). This significant

(p<0.05) uptake by Mucor spp. treated plants may be attributed to the plant growth promoting

activities of Mucor spp. as confirmed by PGP assays (table 4.1). Mucor spp. was found to have

significant production of IAA (203 µgm L-1) and gibberellin (36 µgm L-1). Several studies have

reported the role of IAA and gibberellin in Pb chelation and uptake in plant tissues. In an

experiment conducted by Hadi et al. (2010), significantly high total Pb uptake in Zea mays L.

was found when plants were treated with combination of EDTA and gibberellin instead of EDTA

alone. Mucor spp. have also been reported for production of citric and oxalic acid (1.5 and 2.3

89

nmole L-1, respectively) (Wang & Chen, 2009; Xiao et al., 2009) which are well known chelators

of Pb. Our results from broth culture experiments also showed that Mucor spp. could lower the

pH of cultured PDB that favors solubility of Pb and uptake by plant. Mucor spp. have previously

been reported to adsorb Pb on outer cell wall which could facilitate metal uptake by plants. Pb

efflux mechanism in Mucor spp. could also increase the availability of Pb for plant uptake

(Velásquez & Dussan, 2009). A. flavus have also been found as an efficient Pb and Cr solubilizer

in mustard rhizosphere soil (Akhtar & Iram, 2016). This may be attributed to significant

production of gibberellin (43 µg mL-1) and siderophores (49%). Production of different organic

acids including maleic, tartaric, glutamic, acetic, lactic, succinic, citric and gluconic acids by A.

niger and flavus have been reported (Max et al., 2010). Meanwhile A. niger was also significant

phosphate solubilizer (27 µg mL-1) (table 4.1) which can immobilize or precipitate available Pb

in soil or can adsorb or accumulate and store inside the periplasm.


Among studied fungi, A. niger was most tolerant strain against Pb. Besides tolerance, the strains

have excellent abilities to modify soil physicochemical characteristics inducible for Pb chelation.

PGP assays also confirmed the plant growth promoting characteristics of these fungi.

Significantly high production of IAA and siderophores was observed in A. niger and GA3

production in A. flavus. Phytoextraction of Pb was improved in both plants upon fungal treatment.

However, Pelargonium hortorum was more efficient owing to high biomass production. Our

results suggested that in Pb-contaminated soil, Pelargonium hortorum treated with Mucor spp.

have greater potential to remediate Pb contaminated soil. The current study gave an insight of

fungal-plant interaction in phytoremediation of Pb. However, soil bacteria is another major

component that effects the speciation and availability of Pb at soil plant interface. Also, many

90

bacteria are known to be Pb resistant and contribute towards phytoextraction through PGP

activity. Keeping this in mind in next section, indigenous bacteria were isolated from field

contaminated soil and characterized for promoting phytoextraction ability of selected plants.

Details are in next section.

91

B. METAL TOLERANCE OF ARSENIC-RESISTANT BACTERIA AND THEIR

ABILITY TO PROMOTE PLANT GROWTH OF Pteris vittata IN Pb-

CONTAMINATED SOIL

In this part, preisolated bacteria from rhizosphere of metal hyperaccumulator Pteris vittata were

used for Pb phytoextraction by sporophytes of Pteris vittata in controlled conditions at soil and

water science department, University of Florida, USA. The Pb resistance mechanism of bacterial

strains were studied in detail and Pb resistant genes (PbrA, CadA2, ZntA & CzcR) were amplified.

But the strains did not help much in phytoextraction. Instead, the bacterial strains stabilized Pb

in soil and roots. Similar Pb phytostabilization was achieved when the bacteria were applied on

Pelargonium hortorum.

4.5. BACKGROUND

Soil contamination by heavy metals is a serious problem worldwide, causing adverse effects on

plant growth and human health. Heavy metals of major concern include As, Cd and Pb (Zhu et

al., 2014). Of these, Pb contamination in soils is of major environmental significance due to its

wide spread presence and toxicity to humans, especially to children (Ma et al., 1995). Lead

concentrations in soils range from 1 to 200 mg kg−1, averaging 15 mg kg−1 (Zimdahl and

Skogerboe, 1997). However, Pb concentrations in contaminated soils in shooting ranges can be

up to 17,850 mg kg-1 (Fayiga et al., 2011). According to USEPA, Pb levels in soils exceeding

400 mg kg-1 are hazardous and require remediation (OSWER, 1994).

Among soil remediation techniques, phytoremediation is environmentally-friendly and relatively

inexpensive. However, limited Pb bioavailability for plant uptake in soils hinders its

effectiveness (Arshad et al., 2008, 2016; Gul et al., 2019; Manzoor et al., 2018). Bacteria are

92

effective in solubilizing Pb from soils by secretion of extracellular enzymes and organic acids

(Drewniak et al., 2017). As such, microbes have been used to enhance Pb availability in soils

(Lors et al., 2004). Many bacteria are effective in enhancing plant metal uptake and plant growth.

For example, metal-resistant bacteria enhanced Pb accumulation in rapeseed (Brassica napus;

Sheng et al., 2008b), and Pb and Cd uptake in tomato (Solanum lycopersicum; Sarathambal et

al., 2017).

Ghosh et al. (2015ab) isolated 7 As-resistant bacteria from the rhizosphere of As-

hyperaccumulator Pteris vittata (PG-4, 5, 6, 9, 10, 12 and 16), which were tolerant to 10 mM As

and identified as Pseudomonas sp. by 16S rRNA sequencing. Among them, while PG-12 and 5

oxidized arsenite (AsIII) to arsenate (AsV), others reduced AsV to AsIII (Ghosh et al., 2015b).

In addition, they were effective in enhancing As and P uptake by P. vittata and tomato growth

under P-deficient conditions (Ghosh et al., 2015a; Han et al., 2016). This was probably due to

their ability in producing siderophores, ranging from 9.47 to 115 µM DFOM (deferroxamine

mesylate) equiv./OD of cells (Ghosh et al., 2015). Siderophores are low molecular weight, high

affinity Fe chelators, which are effective in solubilizing Fe from soils, thereby releasing the

associated As and P to enhance plant uptake.

Although bacteria-enhanced metal phytoextraction from soils has been reported, limited

information is available regarding the role of metal-resistant bacteria on Pb availability and plant

growth of P. vittata in Pb-contaminated soils. Rhizobacteria associated with P. vittata have been

characterized for their ability to deal with arsenic stress, P solubilization and plant growth

promotion (Huang et al. 2010; Ghosh et al., 2015ab), but little information is available about

their potential utility in soils contaminated with As and Pb. The objective of this study was to

93

characterize the metal resistance of these strains and to evaluate their ability in enhancing plant

growth of As-hyperaccumulator P. vittata grown in Pb-contaminated soil.


4.6.1. Metal Tolerance and Metal Solubilization

In this study, 6 As-resistant bacteria (PG-4, 5, 6, 9, 10, 12 and 16) from P. vittata rhizosphere

isolated by Ghosh et al. (2015a,b) were further characterized. Their ability to tolerate Pb in Luria-

Bertani (LB) liquid medium was examined by determining the minimum inhibition concentration

(MIC) of PbCl2. The bacteria were incubated in LB broth at pH 7.5 supplemented with 0.5-10

mM Pb concentrations in a shaker incubator at 28°C and 200 rpm. Optical density (OD) was

noted for all cultures at different intervals using a UV–vis spectrophotometer at 600 nm

(Beckman Coulter, DU® 730). In addition, their cross tolerance to Pb was tested (Naik and

Dubey, 2011). Their tolerance index was calculated by dividing the bacterial dry biomass

obtained in LB media supplemented with 1 mM Pb to that in the control after 24 h of incubation

at 28°C and 200 rpm.

After 24 h incubation, logarithmic phase cells were used for making bacterial inoculum at 0.1

OD600nm. To determine metal solubilization, inoculum at 2 mL was added in culture vials

containing 2.5 mg mL-1 insoluble PbCO3 and incubated in a shaker incubator at 28°C and 200

rpm. Uninoculated media were kept as a control to determine the influence of abiotic factors on

metal solubility and solution pH. After 24 h, spent media were harvested by centrifugation at

10,000 g for 15 min and filtered through 0.22 µm Millipore filter. Half of the filtrate was used

for pH determination and other half was used for Pb and Cd determination by inductively coupled

plasma-mass spectrometry (ICPMS; Perkin-Elmer Corp., Norwalk, CT; de Oliveira et al., 2017).

94

4.6.2. Metal Uptake and Metal Resistant Genes

For metal uptake, bacteria were incubated in culture tubes containing 2 mL LB liquid media at

28°C and 200 rpm. After 24 h, bacterial density was adjusted to 0.1 OD600nm and 1 mM PbCl2

was added. Cultures were incubated for 24 h, then cells were harvested by centrifugation at

10,000 g for 10 min. The supernatants were collected and filtered through 0.22 µm before

analysis. Bacterial pellets were washed by suspending once in LB liquid media and 2 times in

sterile deionized water prior to drying. After washing, bacteria pellets were re-suspended in 0.5

mM EDTA and vortexed for 5 sec, followed by centrifugation. This step was performed 3 times

to ensure removal of adsorbed metal on cell walls by EDTA. After which, bacterial pellets were

dried, and fresh and dry biomass were determined. Dried pellets were digested with HNO3/H2O2

using USEPA Method 3050B on a hot block (Environmental Express, Ventura, CA) and Pb and

Cd concentrations in bacteria were determined by ICP-MS.

Table 4. 3: Primers used to amplify efflux genes in metal resistant bacteria.

Serial

No. Genes Direction Sequences(5’ to 3’)

Fragment

size (bp) References

1 CadA2 Forward CCTGCTGCGCATCGAGATAA

178 Leedjärv et al., 2008;

Lee et al., 2001 Reverse GTTGGTGACGAACCAGGTGA

2 PbrA Forward CCTCGCCATCGATCACTACC 281 Permina et al., 2006; Monchy et al. 2007 Reverse GCACCAGTGCATCACGAATC

3 ZntA Forward CGTAGCGAAGGCAACTATCG 110

Permina et al., 2006;

Lee et al., 2001 Reverse AGCAGGGTACGGATTTCCTC

4 CzcR Forward TCAACCTGACGACCAAGGAG

201

Leedjärv et al 2008;

Jarosławiecka &

Piotrowska-Seget, 2014 Reverse CGCGAATGGTATGGATCAGC

bp= base pair

In addition, genomic DNA was extracted from bacteria using total DNA extraction kit

(Invitrogen). The amount of DNA eluted in samples was quantified by Nano DropTM 2000

95

(Thermo Scientific). The expression of specific genes coding for efflux proteins included pbrA,

cadA2, zntA, and czcR involved in metal resistance was tested using PCR. The details of

amplifications and primers used are given in table 4.3. The total reaction mixture for PCR was

20 µL per sample. The conditions were as follows: initial denaturation was done at 94°C for 2

min followed by 40 cycles of 94°C for 1 min, 60°C for 1 min, and 3 min at 72°C. A final extension

was done at 72°C for 7 min. PCR products were separated on 0.8 % (wt/v) agarose gels at 100 V

for 1 h in Tris-acetate-EDTA buffer. The gel was stained with ethidium bromide and Gel images

were captured by a Gel imaging system (Bio-Rad).

4.6.3. Plant Growth Promoting Hormones

The ability of the 7 bacterial strains for siderophores production and P solubilization was

examined by Ghosh et al. (2015). In this study, their ability to produce plant growth promoting

hormones including indole acetic acid (IAA) and gibberellic acid was determined (Bharucha et

al., 2013). Briefly, LB liquid media supplemented with 1% L-tryptophan were inoculated with

0.1 mL bacteria (OD600 nm=0.1) and incubated at 28°C and 200 rpm in a shaking incubator. After

24 h, cell-free supernatant was obtained by centrifugation (10,000 g for 15 min) and mixed with

2 mL of Salkowaski’s reagent (0.5 M FeCl3 in 35% H2SO4). The intensity of pink color was

determined by taking absorbance through spectrophotometer at 530 nm and amount of IAA was

calculated through standard curve.

Production of gibberellic acid was determined following Holbrook et al. (1961). Culture tubes

containing 10 mL of LB media was inoculated with 1 mL of bacteria at 0.1 OD600 nm and

incubated for 48 h at 28°C at 200 rpm. Bacterial cells were harvested by centrifugation (10,000

g for 15 min), and cell free supernatant was acidified to pH < 2.0 using 2 N HCl. Mixture was

then extracted with 15 mL ethyl acetate for three times to obtain 40 mL extract, which was

96

evaporated to 5 mL final volume. The amount of gibberellic acid was measured by colorimetric

method (Bharucha et al., 2013).

4.6.4. Effect of Bacteria on P. vittata Growth Under Pb Stress

P. vittata plants were germinated from spores under sterile conditions (Mathews et al., 2010).

Briefly, spores of P. vittata from Florida, USA were soaked in sterile water for 30 min, 70%

ethanol for 30 s and 10% NaClO for 30 min. They were then washed 3 times with autoclaved

distilled water and were incubated on LB agar plates at 30°C for 4 d. No bacterial growth

confirmed successful disinfection of spores. For germination, spores were incubated on sterile ½

Murashige and Skoog (MS) agar medium (0.8% at pH 5.7) in petri dishes. After 2 weeks of

germination, gametophytes were transplanted in fresh media and kept under sterile conditions to

develop sporophytes. Six-month old sporophytes with 2-3 fronds were used for this study.

Based on their metal tolerance and plant growth promoting characteristics, three bacterial isolates

PG-5, 12, and 13 were selected, with PG-2 as a control. P. vittata plants were transplanted from

MS media to pre-autoclaved GA-7 boxes containing sterile potting soil containing 1 mM PbCl2.

Soil was watered with 0.2 strength sterile Hoagland solution as needed. Bacterial inoculum was

prepared in LB liquid media for 16 h at 28°C and 200 rpm. Bacterial cells were harvested and

washed 3 times with phosphate buffer saline solution and resuspended in sterile distilled water.

One milliliter of bacterial suspension (OD600 nm=0.5) was applied to the roots of 5-month old P.

vittata plants. All treatments were carried out in a laminar flow hood and care was taken to keep

sterile conditions. Plants were allowed to grow in a lighted growth chamber for 1 month before

harvest. P. vittata roots were washed under running tap and distilled water before fresh and dry

biomass were recorded (Han et al., 2016). Plant biomass was digested with HNO3/H2O2 using

USEPA Method 3050B on a hot block (Environmental Express, Ventura, CA). Pb concentrations

97

in P. vittata were determined by ICP-MS. To investigate whether Pb immobilization was due to

an energy-dependent mechanism by living bacterial cells, a control experiment with dead

(autoclaved for 15 min at 120 °C and 15 psi) bacteria was included. Plant biomass and Pb

concentration were determined as above.


All experiments were performed in triplicate and the values are expressed as mean ± standard

deviation. Analysis of variance and Tukey's multiple comparison tests were done using SPSS

software, and least significant difference (LSD) was determined at P ≤ 0.05.


4.7.1. Bacterial Resistance to Pb

According to Ghosh et al. (2015ab), all 6 bacterial strains were As-resistant, with PG-12 and 5

being AsIII oxidizers and others being AsV reducers. In this study, they were tested for Pb

tolerance after 24 h growth in LB liquid media containing 1 mM Pb (figure 4.6A). In addition,

their biomass reduction and tolerance index (biomass produced with Pb to that in control) after

24 h growth was determined (table 4.4). The highest Pb tolerance was observed for PG-12

followed by PG-5 and PG-16 (figure 4.6 A; table 4.4).

Strain PG-12 identified as Pseudomonas was tolerant up to 10 mM As in LB media (Ghosh et

al., 2015a), displaying high As resistance. Among all strains, PG-12 showed the highest tolerance

to all metals followed by PG-5. For example, strain PG-12 showed minimal inhibitory

concentrations of 0.6, 5, 8, 10, and 10 mM Cd, Co, Cu, Pb, and Ni (table 4.4). Results from

98

biomass and tolerance index were also consistent (table 4.4). For example, no decrease in dry

biomass was observed in PG-12 after 24 h growth.

Figure 4. 6: Growth of bacterial isolates on media containing 1 mM Pb (A) after 24 h

incubation based on the ratio of OD in treated to control and PCR amplification of fragments of

metal resistant genes in PG-12 (B). Bars represent means of three replicates and standard error

and bars with same letters are not different at α = 0.05. Lane 1 has molecular weight markers

(100 bp ladder), and lanes 2, 3, 4 and 5 correspond to pbrA, cadA2, zntA and CzcR,

respectively.

Researchers have reported the ability of Pseudomonas to tolerate 3.2-8 mM Pb (Jebara et al.,

2015; Sinha and Mukherjee, 2009). Among bacteria, PG-2 was the most sensitive to Pb. The

(B)

(A)

99

negative effects of Pb on growth of P. putida, P. fluorescens and Enterobacter spp. were reported

(Vashishth and Khanna, 2015). Strain Pseudomonas (PG-12) showed high resistance to multiple

metals including As, Cd and Pb (table 4.4). Similar metal resistances in Pseudomonas has been

reported. Lin et al. (2016) reported high tolerance of P. aeruginosa against Cd (20 mM), Zn (28

mM) and Pb (5.8 mM). Raja et al. (2006) reported that Pseudomonas (BC15) sorbed 30-93% Ni,

Pb, Cd and Cr from wastewater within 48 h, showing its multiple metal resistances. Another

strain of Pseudomonas, i.e., P. fluorescens (JH 70-4), showed high Pb tolerance (9 mM) and

partial tolerance to As (8 mM), Cu (6 mM), Cd (0.9 mM), and Ni (6 mM) (Shim et al., 2014).

When comparing bacterial metal tolerance in literature, bacteria PG-12 showed high tolerance

against multiple metals, making it a suitable inoculant in soils contaminated with multiple metals.

Table 4. 4: Bacterial biomass reduction and tolerance index after growing for 48 h in LB media

with 1 mM Pb, and minimum inhibitory concentration (MIC) of Pb, Cd, Ni, Co and Cu, and

production of phytohormones in bacteria after growing on LB agar media for 24 h.

Bacteria

l strains

Biomass

reduction (%)

Tolerance

index1

Minimum inhibitory

concentration2

Phytohormone

(µg mL-1)3

Pb Pb Pb Cd Ni Co Cu IAA gibberellin

PG-12 0.0 1.0 10 0.6 10 5 8 b17.4±0.36 a3.54±0.09

PG-16 8.0 0.9 5 0.2 5 5 2 e2.40±0.06 e0.81±0.01

PG-5 8.3 0.9 8 0.2 10 4 2 d3.76±0.04 c2.06±0.30

PG-14 12 0.9 2 1 2 0.5 2 c6.27±0.04 d1.23±0.09

PG-13 18 0.8 3 1 5 0.5 5 a19.5±1.23 b3.22±0.10

PG-2 68 0.3 0.1 0.1 1 1 0.1 de3.32±0.19 d1.18±0.11 1 Tolerance index = biomass produced with Cd or Pb to that in control. 2 Lowest concentration of a chemical to prevent visible bacterial growth 3 Different letters indicate significant difference (p<0.05).

4.7.2. Genes Involved in Metal Resistance in PG-12

To better understand the mechanisms associated with metal tolerance, PCR-based amplification

of genes possibly responsible for bacterial metal resistance in strain PG-12 were tested, including

pbrA, cadA2, zntA and czcR. These genes are from different metal detoxification systems

100

encoding for efflux proteins. czcR encodes for regulatory protein for czcCBA metal efflux system

(Leedjarv et al., 2008). PCR reaction yielded three bands consistent with expected product sizes

for amplification of pbrA, cadA2 and czcR in PG-12 (figure 4.6 C). The results suggested that

high metal tolerance of PG-12 could be due to the presence of these efflux transporters. Other

studies reported that pbrA, cadA and czcCBA are responsible for Pb and Cd detoxification in

bacteria (Jarosławiecka, and Piotrowska-Seget, 2014; Leedjärv et al., 2008). Efflux and ion

precipitation are a two-component Pb detoxification mechanism in bacteria (Hynninen et al.,

2009).

For Pb tolerance, pbr efflux system is the major detoxification mechanism in bacteria surrounded

by mer and czc families (Monchy et al., 2007). pbrA transports Pb from inside the cytoplasm to

the periplasm where released inorganic phosphate groups by pbrB precipitates Pb and prevents

its reentry into cells. The export of Pb ions to the periplasm involved both pbrA and P-type

ATPases of the class IB (PIB ATPases). cadA and zntA and their functions are not limited to only

Pb ion. In Pseudomonas putida KT2440, the main efflux transporter identified for Pb and Cd

ions is cadA2. cadA2 functions with czcCBA1 for Pb detoxification in bacteria. czcCBA1 is

known for transporting Zn, Cd and Co ions from the periplasm to cell exterior in Pseudomonas

putida KT2440 and C. metallidurans CH34 (Leedjarv et al., 2008). czcCBA efflux system is also

responsible for Pb efflux system in C. metallidurans (Hynninen et al., 2009). The presence of

these three efflux transporter genes suggested their potential involvement in high tolerance of

PG-12 towards Pb, Cd and Zn.

101

4.7.3. Bacterial Pb Uptake and Solubilization

Bacterial isolates were further studied for their ability to tolerate Pb by determining their metal

sorption ability after 24 h culture in LB liquid media (figure 4.7A). Data showed that bacteria

had different ability in metal uptake. More Pb uptake inside bacteria was observed for all the

strains, consistent with metal tolerance data (table 4.4). A 5 –fold higher Pb accumulation inside

cells of PG-12 was observed than that sorbed on cell surface (193 vs. 41 µM). The efficiency of

Pseudomonas sp. for metal uptake is well known. The cell walls of G-negative bacteria contain

negatively-charged functional groups (carboxyl, phosphate, imidazole and amino groups), which

are responsible for metal sorption (Burnett et al. 2006). Chang et al. (1997) working with P.

aeruginosa observed similar behaviors for Pb, i.e., more Pb was taken up than sorption onto cell

surface (531 vs. 338 µM). The reason for high tolerance of PG-12 against Pb could be the

presence of several metal resistant genes (figure 1C). In particular, pbrA is a Pb-efflux protein

responsible for Pb detoxification and immobilization in cells. It is possible that PG-12 took up

Pb from medium and detoxified it inside the cell as inclusion and/or in plasma membrane.

In addition to metal uptake and sorption, selected bacteria were further investigated for their

ability to solubilize insoluble Pb and Cd. Results revealed that all bacteria were efficient in

solubilizing PbCO3 (figure 4.7B). The maximum Pb observed for PG-12 and PG-13 was 0.14%.

Strains PG-12 and PG-5 were efficient in siderophores production (115 and 73.2 µM equiv),

which may contribute to P solubilization (Ghosh et al., 2011; 2015a). Similar effect on Pb

solubilization was observed for P. fluorescens strain (Shim et al., 2014) wherein exchangeable

Pb decreased by 49% while organic- and sulfide-bound Pb increased by 31% in its presence.

Plant growth promoting bacteria including Pseudomonas, Bacillus, and Burkholderia are

102

efficient in P solubilization (Glick et al., 1995), which are consistent with a report, showing 84

and 65% phosphate solubilization by PG-12 and PG-5 from phosphate rock (Ghosh et al., 2015a).

Figure 4. 7: Metal uptake, adsorption and solubilization: (A) uptake and sorption, and (B)

solubilization by selected bacteria. Bacteria were grown in LB media with 1 mM PbCl2 (A) and

2.5 mg mL-1 insoluble PbCO3 (B) for 24 h. The values are means of three replicates. Means

marked with different letters are significantly different at p<0.05. Capital and small letters

indicates significance among individual parameters.

4.7.4. Plant Growth Promoting Characteristics

These bacteria are known for their siderophore production and phosphate solubilization (Gosh et

al., 2015a). To further study their plant growth promoting characteristics, their production of

indole acetic acid (IAA; 2.7-20 µg mL-1) and gibberellin (0.81-3.5 µg mL-1) was determined

(table 4.4). The results showed that among all tested strains, again PG-13 and PG-12 displayed a

higher production of IAA and gibberellin. IAA production in Pseudomonas has been reported in

the literature. For example, Malik and Sindhu (2011) isolated IAA-producing (18-31 μg mL-1)

Pseudomonas from the rhizosphere of Cicer arietinum and Vigna radiate. Ahmad et al. (2005)

reported high production of IAA (41-53 μg mL-1) by 5 Pseudomonas isolates. Pandya and Desai

(2014) found high gibberellin production by Pseudomonas monteilii (93 µg mL-1). In

(B) (A)

103

comparison, the production of IAA and gibberellin by PG-12 in this study was slightly lower

than those reported in literature. However, among all tested strains, PG-12 showed the highest

production of IAA and gibberellin, and PG-12 was also efficient in siderophore production and

phosphate solubilization (Ghosh et al., 2015ab), which may have contributed its ability in metal

uptake and solubilization (figure 4.7).

Figure 4. 8: Effect of bacteria on P. vittata biomass (A), potting media pH (b), and Pb (c) and P

(d) concentrations in the roots and shoots (R and S) of P. vittata grown in potting media

containing 1 mM Pb concentration. Bars indicates mean of three replicates and error bars show

standard errors. Letters indicates significant difference among treatments at p value <0.05.

Capital and small letters indicate significance among individual parameters.

1

2

3

4

5

6

7

8

(A)

(D)

104

Three bacteria with multiple metal tolerances (PG-5, 12, and 13) and one isolate with no

resistance (PG-2) were inoculated with P. vittata under sterile conditions to study their effect on

plant growth under Pb contamination (figure 4.8). Results showed that some strains influenced

plant biomass with or without Pb stress, with PG-12 being the most effective in improving plant

biomass (figure 4.8A). Under Pb stress, the increase in root and shoot biomass of P. vittata was

2-3 fold. On the other hand, PG-2, PG-5 and PG-13 did not improve plant growth in presence of

Pb. The increase in P. vittata biomass by PG-12 could be attributed to its metal resistance to Pb.

In addition, PG-12 was efficient in phosphate solubilization and siderophores production (Ghosh

et al., 2015a). Furthermore, PG-12 produced highest IAA and gibberellin among all strains (17

and 3.5 µg mL-1), all contributing to its effectiveness of promoting plant growth (table 4.4, figure

4.8).

Besides plant biomass, we also determined plant Pb and P uptake. Regardless the treatments,

more Pb was accumulated in the roots (128-262 mg kg-1) than shoots (10-29 mg kg-1; figure

4.8C), consistent with literature (Wan et al., 2014). Compared to the control, while root Pb

increased by 2-fold in PG-5 treatment and shoot Pb decreased by 3-fold in PG-12 treatment, little

changes in Pb concentrations were observed in other treatments. The decrease in Pb

accumulation may partially be explained by pH modification of the potting media (figure 4.8B).

While PG-12 increased, PG-5 lowered media pH by 0.4-0.5 pH units. It is known that Pb

availability increases at lower pH (Ma et al., 1997; Arshad et al., 2016). The increase in biomass

by 2-3 folds and decrease in Pb concentrations by 2-3 folds of P. vittata can also be attributed to

efflux transporters coded by pbrA and cadA2 genes. pbrA together with expression of pbrB is

responsible for phosphate-based Pb immobilization in bacterial cell, making it unavailable for

105

plant uptake (Hynninen et al., 2009; Jarosławiecka and Piotrowska-Seget, 2014). Similar to Pb,

more P was also accumulated in the roots (705-1406 mg kg-1) than shoots (551-1128 mg kg-1;

figure 4.8D). With or without Pb, PG-12 was the most effective in increasing plant P uptake.

While PG-5 and 13 also increased plant P uptake, control strain PG-2 showed little effect. A

similar increase in P uptake in tomato by PG-12, 5, and 13 was observed by Ghosh et al. (2015a).

The shoot and root P concentrations with PG-12 inoculation were 2–3 folds higher than the

control without bacterial inoculation (figure 4.8 D).

To test whether active PG-12 cells were required to improve plant growth under Pb stress, an

experiment was performed using P. vittata cultures grown in potting media inoculated with living

or dead (autoclaved) bacterial cultures. In addition, we tested the effect of adding IAA, equivalent

IAA amounts produced by PG-12. While both living and dead PG-12 were effective in enhancing

P. vittata growth (figure 4.9A), living PG-12 cells were 2-3 –folds more effective.

Figure 4. 9: Effect of living (12L) and dead (12D) PG-12 cultures, and IAA on plant biomass

(A) and Pb concentrations in P. vittata roots and shoots (B). The values are means of three

replicates with standard deviation shown as error bars. Means marked with different letter

codes are significantly different at p<0.05. Capital and small letters indicate significance among

individual parameters.

(A) (B)

106

Considering results of Pb accumulation in the roots and shoots of treated P. vittata plants (figure

4.9 B), it is evident that alive PG-12 significantly lowered Pb concentrations in P. vittata

compared to control without bacteria. In contrast, an increase in Pb concentration both in the

roots and shoots were observed in plants treated with dead PG-12 and IAA. The data showed that

the ability of Pb immobilization in bacterial cell is lost when bacteria were dead and energy

dependent mechanism inside cells was probably involved in reducing Pb uptake into plant tissue.

The effect of dead PG-12 cells was similar to that of added IAA. The higher plant biomass with

living PG-12 than IAA indicated that IAA was not the main reason for plant growth promotion

by PG-12. It was possible that PG-12 provided more P to plants (figure 4.8 D) by producing Fe

chelating compounds such as siderophores, which is supported by its significant siderophore

production and P solubilization ability (Ghosh et al., 2015ab).

4.8. OUTCOMES AND PROSPECTS

The current study indicated that As-resistant bacteria from P. vittata rhizosphere displayed

significant ability to resist multiple metals. Among the different strains tested, PG-12 was the

most effective in metal tolerance and plant growth promotion. Presence of pbrA, cadA2 and czcR

efflux transporters in PG-12 may support the involvement of metal efflux transporters in Pb and

Cd resistance. Besides metal resistance and ability in siderophores production and phosphate

solubilization, PG-12 also produced significant amount of plant growth hormones (IAA and

gibberellin) to support plant growth in Pb-contaminated soil. Bacterial strain PG-12 in

combination with P. vittata could be further tested for remediation of soils contaminated with

multiple metals, particularly As and Pb.

107

C. METAL TOLERANT BACTERIA ENHANCED PHYTOEXTRACTION OF LEAD

BY TWO ACCUMULATOR ORNAMENTAL SPECIES

For selection of Pb resistant and mobilizing bacteria, the activity was repeated, and indigenous

bacteria were isolated from contaminated soil collected from industrial zone of Islamabad and

Rawalpindi. The isolated strains were characterized for Pb tolerance, solubilization, PGPR and

Pb phytoextraction characteristics.

4.9. CONTEXT

Contamination of urban soil with lead (Pb) is a common heavy metal pollution in developing

countries. Pb has been used by humans for centuries but anthropogenic activities have increased

significantly in recent decades causing global contamination of biotopes and biocoenosis (Uzu

et al., 2010; Sahodaran & Ray, 2018). Lead being non-biodegradable and stable element, it poses

continuous threat to living biota. Pb is ranked 2nd among hazardous substances by the Agency

for Toxic Substances and Disease Registry (ATSDR, 2007). The Institute for Health Metrics and

Evaluation (IHME), based on 2015 data reported Pb responsible for 494,550 deaths, loss of 9.3

million disability-adjusted life years (DALYs), 12.4% of the global burden of idiopathic

developmental intellectual disability, 2.5% of the global burden of ischaemic heart disease and

2.4% of the global burden of stroke (WHO, 2017). It is therefore of immense need to remediate

Pb contaminated by developing environmentally safe technologies (Gul et al., 2019; Manzoor et

al., 2018; Arshad et al., 2016, 2008).

Currently, the biological approaches for safe removal of Pb from environment are gaining strong

status among environmentalists. Phytoremediation have been extensively studied and publically

accepted for safe removal of highly toxic metals (Gul et al., 2019; Manzoor et al., 2018; Arshad

108

et al., 2016; Kumar et al., 2009). Among different heavy metals, Pb phytoextraction is most

challenging task owing to most stable heavy metal. According to Wierzbicka et al. (2007) 2.4%.

Pb is soil is in soluble form and 0.14 % is in exchangeable form only of total Pb present in soil

(Jena et al., 2013). Different methods employed to enhance phytoremediation efficiency include

use of specialized hyperaccumulating plants (Arshad et al., 2008), application of chemicals such

as EDTA and organic acids to increase Pb availability for phytoextraction (Gul et al., 2019).

However, issue regarding cost, leaching and toxicity are associated with these synthetic chelators

(Lu et al., 2017; Pandey & Bhattacharya, 2018; Kaurin et al., 2018). Soil bacteria have also been

extensively studied for novel traits like Pb tolerance and detoxification (He et al., 2009),

siderophopre (Sheng et al., 2008b) and have been reported to stimulate phytoextraction of Pb

through biomass enhancement by PGP activity (Kumar et al., 2009; Rajkumar & Freitas, 2008)

but little is known indigenous soil bacteria to enhance Pb solubility and accumulation in Pb

hyperaccumulator plants. The main objectives of current study were to characterize Pb resistant

and mobilizing bacteria for PGP characteristics and investigate their potential to improve

phytoextration of Pb by Mesembryanthemum criniflorrum and Pelargonium hortorumin Pb

contaminated soil.


4.10.1. Isolation and Characterization of Pb Resistant Bacteria

Fresh soil samples collected from area around battery recycling sites of Islamabad and

Rawalpindi. These samples were used for isolation of bacteria. Isolation was done through serial

dilution method. Briefly, 1 g soil was serially diluted in sterile water and 200 µL of soil

suspension was spread on Luria–Bertani (LB) media containing 50 mg L-1 of Pb as PbNO3. Plates

109

were then incubated at 27 °C for 48 h for growth of Pb resistant colonies. Enumeration of bacteria

was done on colony counter. Apparently different colonies were picked and pure streaks were

done to get pure cultures. Isolated pure strains were preserved in glycerol (35%) for further

analysis. Isolated strains were studied for morphological characteristics by determining size,

shape, margin texture and ram staining was performed by standard methods (APHA, 2005).

Biochemical parameters studied included catalase, oxidase, Simmons citrate and Mannitol,

urease. Pb tollerance in bacteria was recorded by growing them on LB agar containing different

Pb concentrations ranging 100-800 mg L-1. Pb resistance was quantified in terms of bacterial

growth by measuring Optical Density (OD) at 600 nm and minimum inhibitory concentration

was noted for each strain.

4.10.2. Effect of Resistant Bacteria of Soil Pb Mobility

Batch experiments were performed to monitor the effects of bacteria on Pb mobility in soil.

Briefly 10 g of soil spiked with different concentrations of Pb were placed in glass petri-plates

and autoclaved at 121 °C for 40 min in order to study the effect of tested microbial strain only.

Autoclaved plates were then oven dried at 105 °C for 2 h. Meanwhile bacteria were inoculated

in liquid LB medium and incubated at 28 °C at 200 rpm for 16 h. Exponential phase cells were

harvested by centrifugation, washed twice with sterile distilled water. To prepare inocula,

bacterial pellet was again resuspended in sterile distilled water and adjusted optical density (600

nm) to 0.5. And 1 mL of this inocula were added to each pre-sterilized petri plates containing

soil. Soil without bacterial treatment was kept as control. Soil moisture was maintained at 60%

by adding sterilized distilled water. Plates were then covered by parafilm in order to conserve the

moisture during incubation. Plates were incubated at 28 °C for 15 days. After incubation plates

were dried in oven at 105 °C for 2 h to stop bacterial activity. Soil was then extracted with 0.01

110

M CaCl2 for available Pb in soil solution. Pb concentration in soil solution was finally determined

through extracted filtrates using atomic absorption spectrometer (AAS) (He et al., 2009).

4.10.3. Molecular Characterization of Resistant Bacterial Strains

Twenty-four hours fresh bacterial culture gown in LB agar were used for extraction of template

DNA. PCR tube containing bacteria was given heat shock (10 min at 95 °C) followed by

centrifugation in micro centrifuge (Eppendorf Minispin, Germany) (Ahmed et al., 2014). Clear

supernatant containing template DNA was amplified for 16S rRNA gene sequence through

conventional PCR using 9F; 5'-GAGTTTGATCCTGGCTCAG-3' and 1510R;

5’GGCTACCTTGTTACGA-3' as forward and reverse primers (Hayat et al., 2013). Reaction

conditions are described by Ahmed et al. (2014) and PCR was performed in thermocycler (Veriti,

Applied Biosystems). The amplification of 16S rRNA gene was confirmed with the help through

agorose gel (0.8% w/v) electrophoresis in 1X TBE and ethidium bromide (0.5 μg/mL). The

confirmed amplified product was then sent to MACROGEN (Seoul, Korea) for sequencing and

homology. GeneBank data base were matched with obtained 16S rDNA sequences using Ez

Taxon. Phylogenetic analyses were performed using bioinformatics software MEGA-7. For

sequence alignment and comparison CLUSTAL X and BioEdit were used, respectively.

Phylogenetic tree was then constructed by aligned sequences using the maximum likelihood

method (Ahmed et al., 2014).

4.10.4. PGP Characteristics of Bacteria

IAA production was measured following method of Bhagobathi & Joshi (2009). Bacteria were

cultured in LB broth containing 1% L-tryptophan at 27 °C and 200 rpm for 48 h. Cell free

supernatant (2 mL) was then mixed with 2 drops of concentrated orthophosphoric acid and 4 mL

111

of Salkowski’s reagent. Intensity of pink color developed was estimated by taking sample

absorbance at 530 nm. IAA production was determined through standard curve. For phosphate

solubilization, bacteria were cultured in Pikovskaya agar and broth media (Pikovskaya, 1948)

containing 0.5% calcium phosphate at 27 °C and 150 rpm for 24 h. Cell free supernatant obtained

by centrifugation at 10,000 rpm for 10 min was used for soluble phosphate determination by

colorimetric method using Barton’s reagent (Pande et al., 2017).

The ACC deaminase activity was recorded by estimating by enzymatic hydrolysis of ACC and

corresponding generation of α- ketobutyrate (Belimov et al., 2005). Briefly, bacterial strains

grown in DF salt minimal media were harvested at 10,000g for 10 min and resuspended in 1 mL

of 0.1 M Tris-HCL (pH 7.5). Cells were again centrifuged and resuspended in 600 µl of 0.1 M

tris-HCL (pH 8.5) and 5% toluene. After vortex, 100 µl cell suspension were incubated for 30

min at 27 °C after adding 10 µL of 0.5 M ACC and 100 µL of 0.1 M HCL (pH 8). After incubation

1 mL of 0.56 N HCL was added to reaction mixture, vortex and cell free supernatant was obtained

by centrifugation for 5 min at 14,000 g. In 500 µL of supernatant, 400 µL of 0.56 N HCl and 150

µL of 0.2% of 2,4-dinitrophenylhydrazine in 2 N HCl was added and mixture was incubated for

30 min at 27 °C. Finally, 1 mL of 2 N NaOH was added before taking absorbance at 540 nm.

The amount of α -ketobutyrate was determined through standard curve of α -ketobutyrate ranging

0.2 -1 mM (Belimov et al., 2005).

Siderophores production was assayed on chrome azurol S (CAS) agar plates by spot inoculating

bacterial strains (10 µL of 10-6 CFU/mL) followed by incubation. Appearance of orange-yellow

hallo around inoculated strains was considered positive indication for siderophores production

(Schwyn & Neilands, 1987). For quantitative estimation, bacteria grown in malt extract (ME)

112

broth medium at 27 °C and 150 rpm for 24 h. Bacterial cells were then harvested by centrifugation

(10,000 rpm for 10 min) and 0.5 mL of supernatant was then mixed with 0.5 mL of CAS reagent.

Finally, color intensity was determined by taking absorbance at 630 nm. Uninoculated succinate

medium containing CAS was used as reference. Siderophore units were calculated by formula

[(Ar - As)/Ar] x 100. Where Ar and As is absorbance of reference and sample at 630 nm

respectively (Aziz et al., 2016). Other functional characteristics including HCN production were

determined by methods of Lock (1948). Gibberellic acid production was quantified

colorimetrically following method of Holbrook et al. (1961).

4.10.5. Influence of Resistant Bacteria on Pb Uptake

Pot culture experiment was performed to study the influence of Pb resistant and solubilizing

bacterial strains on Pb uptake by Pelargonium hortorum and Mesembryanthimum criniflorum.

Soil used in pot experiments was same as used in previous study (Manzoor et al., 2018). Seeds

were surface sterilized and germinated in sterilized non-contaminated soil under controlled

conditions. Uniform seedlings (1 month old) were selected for transplanting in pots. Bacterial

inocula was prepared in same manner as described above. To each pot, 10 mL of bacterial inocula

was added. Three replicates were kept for each treatment. After 6 months the plants were

carefully removed from the pots, washed to remove adhere metal on surface of roots, cut in to

root shoots and dry weight was recorded. Plant samples were then acid digested (Nitric acid:

Hypochloric acid; 4:1) and analyzed for Pb concentration through AAS (Manzoor et al., 2018).


Statistical analysis of data was carried out using the SPSS statistical package (version 16.0 for

Windows). All experimental data was analyzed using the one-way analysis of variance

113

(ANOVA) with a 5% least significant difference (LSD test, P < 0.05) and Duncan multiple range

test.


4.11.1. Isolation and Characterization of Pb Resistant Bacterial Strains

A total of 30 strains were isolated from composite soil samples collected from around battery

recycling sites in Rawalpindi and Islamabad. All strains were able to grow in LB agar

supplemented with 100 mg L-1 Pb. Among isolates 40 strains, 20%strains were resistant, 17%

had moderate resistance, whereas remaining strains were not resistant at 800 ppm of Pb

concentration. However in both agar and fermented broth, five strains (NCCP-1862, NCCP-

1857, NCCP-1851, NCCP-1848 and NCCP-1860) showed maximum Pb resistance up to 800 mg

L-1. Bacterial Pb tolerance at 800 mg L-1 Pb concentration in broth is given in figure 4.10.

The strains with good and moderate resistance were then identified, results are given in table 4.5.

Phylogenetic analysis showing close relatives is given is figure 4.11. Of these strains 38% were

Klebsiella; 23% were Pseudomonas; 15.4% were Staphylococcus; and other 23% were from

Bacillus, Mycobacterium and Sporosarcina. The resistance among these strains followed the

sequence Klebsiella quasipneumoniae. (NCCP-1862) > Klebsiella variicola (NCCP-1857) >

Pseudomonas beteli (NCCP-1845) > Microbacterium paraoxydans (NCCP-1848) > Bacillus

tequilensis (NCCP-1860) > Pseudomonas hibiscicola (NCCP-1863) > Staphylococcus

saprophyticus subsp. Bovis (NCCP-1854) > Sporosarcina newyorkensis (NCCP-1855).

114

Figure 4. 10: Pb resistance of isolated bacterial strains in LB media. As/Ac indicates ratio of

absorbance in media supplemented with Pb (800 mg L-1) to that of in control (without Pb). Bars

present average of three replicates and error bars indicate standard deviation.

aa

ab ababc

bcc

c

0.7

0.8

0.9

1.0

1.1

Pb

tole

ran

ce (

As/

Ac)

Bacterial strains

115

Figure 4. 11: Phylogenetic tree showing the interrelationships of isolated lead tolerant strains

along with their close relatives inferred from 16SrRNA gene sequence. The rooted tree was

constructed using the maximum likelihood method contained in the MEGA5 software. Closely

related type species were presented in bold letters and the 3% bar shows sequence divergence.

Klebsiella sp. NCCP-1857





Klebsiella variicola DSM 15968T (CP010523) Klebsiella quasipneumoniae 07A044T

(CBZR010000040)

Pseudomonas sp. NCCP-1863

Pseudomonas hibiscicola ATCC19867T (AB021405)

Pseudomonas sp. NCCP-1845

Pseudomonas beteli ATCC 19861T (AB021406)

Sporosarcina sp. NCCP-1855

Sporosarcina newyorkensis 6062T (GU994085)

Staphylococcus sp. NCCP-1858

Staphylococcus saprophyticus subsp. bovis GTC843T (AB233327)

Bacillus sp. NCCP-1860

Bacillus tequilensis KCTC13622T (AYTO01000043)

100

100

100

76

100

98

100

53

100

32

51

62

2%

116

Strain ID Genus name Length of 16S

rRNA gene (nt)

Accession

Number

Closely related validly published

taxa

Similarity of

16S rRNA

(%)

No. of species >97% (>

98.2%) similarity of 16S

rRNA

NCCP-1838 Klebsiella sp. 1123 LC424405 Klebsiella variicola (CP010523) 99.29 > 25 (8)


NCCP-1844 Pseudomonas

sp.

1125 LC424407 Pseudomonas beteli (AB021406) 99.47 6 (4)


sp.

1125 LC424408 Pseudomonas beteli (AB021406) 99.73 9 (6)

NCCP-1848 Microbacterium

sp.

929 LC424409 Microbacterium paraoxydans NBRC

103076(T)

99.35 9 (6)


NCCP-1854 Staphylococcus

sp.

785 LC424411 Staphylococcus saprophyticus subsp.

bovis (AB233327)

100 > 25 (17)

NCCP-1855 Sporosarcina

sp.

1435 LC424412 Sporosarcina newyorkensis

(GU994085)

97.34 1 (1)


NCCP-1858 Staphylococcus

sp.

1127 LC424414 Staphylococcus saprophyticus subsp.

bovis (AB233327)

99.47 24 (7)

NCCP-1860 Bacillus sp. 1133 LC424415 Bacillus tequilensis (AYTO01000043) 99.65 20 (14)

NCCP-1862 Klebsiella sp. 1412 LC424416 Klebsiella quasipneumoniae subsp.

similipneumoniae (CBZR010000040)

98.73 > 25 (9)


sp.

1112 LC424417 Pseudomonas hibiscicola (AB021405) 99.46 12 (6)

Table 4. 5: Molecular identification of isolated lead tolerant bacterial strains based on 16S rRNA gene sequence and their accession

numbers published in DNA database.

117

Klebsiella was the most frequently isolated genera in this study and have been reported repeatedly

in various studied conducted in industrial areas of Pakistan. Aslam et al. (2016) isolated and

characterized whole genome of Klebsiella quasipneumoniae subsp. similipneumoniae MB373

because of its high resistance to range of different heavy metals and antibiotics and regarded as

effective bioremediator for heavy metal contamination. Similarly Bacillus tequilensis (Sunil et

al., 2015), Pseudomonas beteli (Jackson et al., 2012) and Microbacterium paraoxydans

(Panneerselvam et al., 2013) have previously been identified for resistance against Pb and other

heavy metals. Morphological characteristics of isolated strains were compared with that of

standard species by following Bergey’s Manual of Determinative Bacteriology (Holt et al.,

1994). Briefly, 62% strains were gram negative and rod-shaped bacteria with variable color size

and appearance. The biochemical properties of tested strains indicates that 15.4, 92.3, 62.5, 84.6,

76.9, 84.6, 69.2 and 92.3% bacteria were positive for oxidase, catalase, mannitol, urease, citrate,

acid production, MacConkey agar and nitrate-reductase tests, respectively (data not shown).

4.11.2. Plant Growth Promoting Traits of Isolated Bacteria

PGP assisted phytoremediation is now becoming important area of research. Results given in

table 4.6 indicates the ability of bacteria for plant growth-promoting traits. All bacteria were

capable of producing variable concentration of IAA. In presence of L-tryptophan in the growth

medium, Microbacterium paraoxydans, Klebsiella quasipneumoniae and Klebsiella variicola

produced higher amount of IAA (92.26, 91.61 and 88.17μg mL-1, respectively). For ACC

deaminase, P solubilization and GA3 production, the highest significant activity (p<0.05) was

recorded for Microbacterium paraoxydans (260.5 nmol alphaketobutyrate mg-1 h-1),

Pseudomonas beteli (117.5 µg mL-1) and Bacillus tequilensis (1.18 µg mL-1), respectively.

118

Highest siderophore production was recorded for Klebsiella quasipneumoniae (74%) followed

by Pseudomonas beteli (58%).

Different strains of Pseudomonas (Rajkumar & Freitas, 2008), Bacillus (Bal et al., 2013),

Microbacterium (Sheng et al., 2008b), Klebsiella (Farina et al., 2012), Enterobacter (Kumar et

al., 2009) have been found to have plant growth promoting activities. Among all bacteria studied

Microbacterium paraoxydans exhibited PGPR ability for all PGP assays and previously been

reported in many studies for PGPR characteristics. Microbacterium sp. was found to have IAA

production by 27.9 - 94.16 µg mL-1and ACC production by 28.5 - 961.84 mM α KB mg-1 h-1,

respectively (Sheng et al., 2008b, Bal et al., 2013). Microbacterium paraoxydans was reported

first time for phosphate solubilization (472.0 μg mL-1) by Kaur et al., (2011). Siderophore

production was also observed in Microbacterium paraoxydans by (Sheng et al., 2008b).

Table 4. 6: Plant growth promotion traits of bacterial isolates. Different letters indicate

significance difference (p<0.05) among PGP activity.

Strains

NCCP- HCN

NH

3

IAA

µg mL-1

Siderophore

production

ACC mM

αKB mg-1 h-1

P

solubilization

µg mL-1

GA3 μg

mL-1

1857 + + 88.2ab 28.7cde 86.5b 56.5cde 0.5cd

1851 - - 74.4d 24.0bcd 86.5b 42.3efg 0.5cd

1844 - + 17.6ef 58.0ab 43.8c 91.2b 0.4cd

1845 + ++ 22.8e 48.7abc 38.6c 117.5a 0.2d

1848 + + 92.3a 41.3abc 260.5a 23.9g 1.0ab

1840 + + 78.3d 44.0bcd 86.4b 37.3fg 0.3cd

1854 + + 13.1f 9.3ef 8.3d 62.2cd 0.1d

1855 + - 4.9g -- 9.8d 30.2fg --

1838 - + 85.2bc 28.7de 85.9b 45.9def 0.5cd

1858 + - 16.8ef 8.0ef 12.6d 33.8fg 0.1d

1860 + + 78.9cd 28.7abc 44.8c 23.9g 1.2a

1862 + - 91.6ab 74.0 a 86.3b 30.2fg 0.8bc

1863 + - 6.0g -- 33.3c 73.5c --

HCN= Hydrogen cyanide; NH3= Ammonia; IAA= Indole acetic acid; ACC= 1-

Aminocyclopropane-1-carboxylate deaminase; αKB = α-ketobutyrate; P= Phosphate; GA3=

Gibberellin

119

Rhizospheric Klebsiella variicola have also been characterized for IAA production ability

ranging from 4.52 and 84.27 µg mL-1 (Navarro-Noya et al., 2012; Kim et al., 2017) and phosphate

solubilization by 84.01 mg L-1 (López-Ortega et al., 2013). Phosphate solubilization and

siderophores production by Klebsiella was also confirmed qualitatively by (Farina et al., 2012).

Bacillus sp. also exhibited the highest IAA production (187.93 µg mL-1) in rhizosphericaly

isolated bacteria by Bal et al., (2013). In another study, IAA and P solubilization by Pseudomonas

beteli was found to be14.35 and 147.53 µg mL-1, respectively (Ehsan et al., 2016).

4.11.3. Pb Mobilization by Resistant Bacteria

Significant increase in water soluble Pb was observed in soil inoculated with Pb resistant bacteria.

Results of selected bacteria are presented in figure 4.12. Soil inoculated with Microbacterium

paraoxydans and Klebsiella quasipneumoniae significantly (p< 0.05) improved water soluble Pb

compared to the un-inoculated. Highest significsnt increase in water soluble Pb was obtained by

inoculation of Microbacterium paraoxydans (1.9 –folds) followed by Klebsiella

quasipneumoniae (1.5 –fold) at 2000 mg Pb kg-1 soil treated.

Similar observations have been made by Sheng et al. (2008b), where Pseudomonas fluorescens

(G10) and Microbacterium paraoxydans (G-16) in solution containing insoluble salt of Pb

(PbCO3) increased water soluble Pb by 6250 and 7540 mg Pb L-1, respectively after 60 h

incubation. In soil both bacteria increased water soluble Pb from 3.3 to 5.9 –folds (strain G10)

and from 3.2 to 5.6 –folds (strain G16) compared to control. This Pb solubilizing ability of

Microbacterium paraoxydans may be attributed to the biochemical properties of strain.

Siderophores produvtion (41.33%) (table 4.6) by Microbacterium paraoxydans may account for

Pb release in soil.

120

Figure 4. 12: Effect of bacterial inoculation on water soluble Pb in soil. Spiked soil at different

Pb concentrations was incubated with bacteria (0.5 OD600 nm). Mean values of three replicates

were used to compute this graph.

4.11.4. Effect of Pb Resistant Bacteria on Plant Growth

Plant growth promotion by PGPB in soil contaminated with heavy metals have been evidenced

in several studies (Sheng et al. 2008ab; Rajkumar and Freitas, 2008; He et al. 2009). In our study

the effects of Pb-resistant and solubilizing bacterial strains on dry weight of Pelargonium

hortorum and Mesembryanthemum criniflorrum are shown in table 4.7. Control plants of

Mesembryanthemum criniflorrum and Pelargonium hortorum had dry biomass of 1.21 and 2.30,

respectively. Biomass of both plants increased significantly (p <0.05) in absence and presence of

Pb in soil when inoculated with Pb resistant bacteria, compared to un-inoculated control plants.

At 2000 mg kg-1 soil Pb concentration the highest significant increase in plant biomass was

observed in increase in Microbacterium paraoxydans (NCCP 1848) inoculated plants. The

increase in biomass of Mesembryanthemum criniflorrum and Pelargonium hortorum was 1.5 and

1.6 –folds, compared to uninoculated plants at 2000 mg kg-1 soil Pb concentration. Ability to

improve plant growth and biomass under high soil Pb concentration have been found in many

0

20

40

60

80

100

500 1000 1500 2000

Wa

ter

solu

ble

Pb

co

nc.

(m

g k

g-1

)


Control

Klebsiella variicola

Microbacterium paraoxydans

Pseudomonas beteli

Bacillus tequilensis

Klebsiella pneumoniae subsp. Ozaenaevariicola

121

heavy metal resistant bacteria. Pb-resistant endophytic bacteria Pseudomonas fluorescens and

Microbacterium sp. increased root shoot biomass of Brassica napus by 23 to 37% and 12 to 39%

in 800 mg kg-1 of soil Pb (Sheng et al., 2008b).

Table 4. 7: Effect of bacterial inoculation on plant biomass at different concentration of soil Pb.

All values are mean of three replicates. Statistical significance is given at p<0.05.

Bacterial

treatments

Biomass (g) at varying soil Pb concentrations (mg kg-1)

0 500 1000 1500 2000

Mesembryanthemum criniflorrum

Control 1.21 1.13 1.01 0.83 0.58

NCCP-1857 1.10 0.99 0.87 0.68 0.51

NCCP-1848 1.64* 1.52 1.32 1.20 0.86*

NCCP-1845 1.19 1.12 1.05 0.87 0.56

NCCP-1860 1.18 1.11 1.10 0.87 0.73

NCCP-1862 1.41 1.34 1.18 1.03 0.84


Control 2.30 2.03 1.96 1.72 1.14

NCCP-1857 2.18 2.04 1.79 1.54 1.21

NCCP-1848 2.59 2.63 2.55 1.89 1.87*

NCCP-1845 2.57 1.88 1.77 1.38 0.85

NCCP-1860 2.11 1.91 1.61 1.46 0.88

NCCP-1862 2.93* 2.61 2.60 2.06 1.48

Treatment with such auxin (Kumar et al., 2009), gibberellin and siderophore (Sheng et al., 2008;

Farina et al., 2012) producing rhizobacteria promotes plant growth under Pb stress. Pseudomonas

sp. with ACC deaminase activity (Rajkumar & Freitas, 2008) have been reported to increase

Ricinus communis growth in Ni, Cu and Zn contaminated soil. The presence of specific PGP

traits suggests that these bacteria can promote plant growth by more than one mechanism.

4.11.5. Effect of Pb Resistant Bacteria on Pb Uptake

Microbially induced phytoextraction of heavy metals have been evidenced by numerous studies

(Yahaghi et al. 2018; Kim et al., 2017; Sheng et al., 2008b). To test effective contribution of

isolated strains in our study, five Pb resistant bacteria were selected on the basis of their Pb

122

solubilizing ability and PGP traits for possible effects on phytoextraction of Pb by

Mesembryanthemum criniflorrum and Pelargonium hortorum. As shown in figure 4.13, both

plants differe in Pb uptake. Pelargonium hortorum uptake significantly (p <0.05) higher amount

of Pb in per plant biomass. Microbacterium paraoxydans treated Pelargonium had highest

significant uptake (1.9 –fold) followed by Klebsiella quasipneumoniae (1.8 –fold) and Klebsiella

variicola (1.3 –fold). In contrast Pelargonium inoculated with Pseudomonas beteli had uptake

less than control plants which could be due to significantly high phosphate solubilization activity

of the bacteria (117.5 µg mL-1) (table 4.6).

Figure 4. 13: Effect of bacterial inoculation on Pb uptake in M. criniflorrum and P. hortorum at

different concentration of soil Pb. Bars presents mean values of three replicates and error bars

indicate standard error. Bars with different letter are statistically significant at p<0.05.

Phosphate induce Pb immobilization is well known and could be reason for reduce Pb uptake in

Pseudomonas beteli inoculated plants. Among all strains Microbacterium paraoxydans treated

Pelargonium plants had significantly higher uptakes at all levels of soil Pb concentration. Several

other studies have also reported similar role of heavy metal resistant bacteria for enhanced

phytoextraction of Pb. Pseudomonas fluorescens and Microbacterium spp. increased total Pb

ef def

l

f-if-i

i-l

noef fg

hikl

f-i e-h

bcd

mnba

c

ij

e-h

aab

def

fg

c

fg

l

cde

d-g

j-m

oh gh gh

ij

j-m i-l

klmlmn

cde cd def

jk

e-i

h-k

abc

g-j

0

1

2

3

500 1000 1500 2000 500 1000 1500 2000

Messembry Pelargonium

Pb

up

tak

e (µ

g p

er p

lan

t b

iom

ass

)


ControlNCCP-1857NCCP-1848NCCP-1845NCCP-1860

gh

123

uptake in shoots of Brassica napus from 4-5 and 3-5 –fold (Sheng et al., 2008b). Promising

effects of IAA and siderophores upon Pb phytoextraction have been reported in literature. It is

reported that IAA treatment increased Pb phytoextraction ability by improving over al plant

biomass. IAA have been found to improve Pb phytoextraction in Sedum alfredii Hance and Picris

divaricate by 234.7 and 37.3%, respectively, compared with control plants (Liu et al., 2007; Du

et al., 2011). Similarly siderophore producing bacteria Bacillus paralicheniformis have also been

found to increase Pb uptake in Brassica juncea by 4.6 times compared to non-inoculated plants

possibly because of improve Pb chelation and facilitating plants in uptake (Yahaghi et al., 2018).


The isolated bacterial strains had substantial plant growth promotion activities and may be used

for plant growth promotion in microbial assisted phytoextraction of Pb. Water soluble Pb was

increased by inoculation of Microbacterium paraoxydans and Klebsiella quasipneumoniae. In

particular, Microbacterium paraoxydans and Klebsiella quasipneumoniae directly increased the

Pb accumulation and uptake in both plants and indirectly by stimulating the growth and biomass

of plants under highest soil Pb concentration. From previous studies we found that

Mesembryanthemum criniflorrum because of annual plant accumulates less biomass and Pb

uptake compared to Pelargonium hortorum. Therefore, further studies were performed with

Pelargonium hortorum only. The individual bacterial and fungal studies helped in identifying Pb

resistant bacteria and fungi capable of promoting Pb phytoextraction. But in natural systems both

bacteria and fungi exist together, each having its own specific adaptations and role in the soil

complex plant-soil phytoextraction sytem. There is need to develop integrated plant-bacteria-

fungi sytem with better phytoextraction efficient and adaptation to different soil types. Therefore,

124

in next chapter, the selected plant, bacteria and fungi were investigatedfor Pb mobilization. Fungi

and bacteria were co-inoculated and the corresponding effects on Pb uptake were studied.

125

Chapter 5

EFFECTS OF MICROBIAL CONSORTIUM ON PB UPTAKE AND

ENZYMATIC ACTIVITIES

Improving phytoremediation efficiency in Pb contaminated soil through synthetic and bio-

inoculant have extensively been studied with different success and limitations. In this study

integration of plant bacteria and fungi have been investigated for development of integrated lead

(Pb) phytoremediation. Lead resistant and plant growth promoting bacteria and fungi were first

monitored for antagonistic activity. Further the co-inoculation studies were performed to analyze

the combined effect of bacteria and fungi on soil pH and available Pb fraction for enhanced

uptake by Pelargonium hortorum along with high biomass production.

A. EFFECT OF CO-INOCULATION ON PHYTOEXTRACTION OF Pb BY


5.1. INTRODUCTION

Phytoremediation of lead is a challenging task and interesting area of environmental research.

Lead being toxic and unavailable limits the efficiency of phytoremediation system (Shahid, 2011;

WHO, 2001). Different plants capable of phytoextracting more than 1000 mg Kg-1 of Pb in shoot

biomass have been reported (Gul et al., 2019; Manzoor et al., 2018; Arshad et al., 2016, 2008)

However the process takes long time for complete removal because of low availability of Pb

(<0.24%), less accumulation in above ground tissue and low biomass production (Jena et al.,

2013; Shahid, 2010; Wierzbicka et al., 2007). Different researchers have reported the ability of

soil bacteria to improve phytoremediation efficiency of hyper accumulators and non-

126

accumulators of Pb by inoculating with Pb resistant bacteria (Sunil et al., 2015; Panneerselvam

et al., 2013) and fungi (Mohammadian et al., 2017; Iskandar et al., 2011). The mechanism involve

therein might be the PGPR activity of to support plant growth (Zhang et al., 2010; He et al., 2009;

Sheng et al., 2008b), elevate Pb toxicity, provide nutrients, solubilize unavailable Pb though

exudation of organic acids (Deng et al. 2011; Punamiya et al., 2010).

Interactions among soil microbes in the rhizosphere have been studied for improvement of soil

fertility, nutrients availability including nitrogen (N), phosphorus (P), potassium (K), Iron (Fe)

and many more, soil structure and physicochemical properties and very positive synergistic

effects have been observed (Bandara et al., 2017; Seneviratne et al., 2015). Co-inoculating

bacteria and fungi have been regarded as better and sustainable technique that provided highly

valuable ecosystem services including improvement in soil enzymatic activities and nutrients

minrilization and availability to plants in heavy metal contaminated soil (Seneviratne et al.,

2015). However co-inoculating bacteria and fungi for enhanced phytoextraction of Pb

contaminated soil is not addressed. Therefore, the main objectives of this study was to investigate

the effect of co-inoculation of bacteria and fungi on Pb availability in soil and integrating plant-

bacteria-fungi for combined effect on maximizing phytoremediation of Pb in soil.


5.2.1. In Vitro Screening for Co-Inoculation of Bacteria and Fungi

Bacteria and fungi compatibility for co-inoculation was tested on agar plates using method of

(Shehata et al., 2016) with some modifications. Fungal and bacterial strains were cultured in PD

and LB broth at 25 °C for 2 days. The OD were adjusted to 0.5 by taking absorbance at 600 and

580 for bacteria and fungi respectively. About 100µL of each inocula were spread on LB and

127

PDA plates respectively. After solidifying 20µL of the bacteria and fungi were cross inoculated

in the center of LB and PDA plates and incubated at 25 °C for 3 days. After with zone of

inhibition was recorded for both bacteria and fungi. The antagonistic activity of bacteria and

fungi was also studied in broth cultures. Cell free extracts of bacteria and fungi (10 µL) were

cross added in LB and PDB and pre-inoculated with loop full of bacterial and fungal spores and

incubated at 25°C and 150 rpm for 24 hours. After which bacterial and fungal growth was

recorded by taking absorbance at 600 and 580 nm through UV/Vis spectrophotometer.

5.2.2. Effect of Co-inoculation on Pb Mobility

Bacteria and fungi were cultured in LB and PDA plates and inocula (OD 0.5) were prepared in

distilled water as described before. About 0.5 mL of each inoculum were co-inoculated in pre-

autoclaved soil spiked with different levels of Pb concentrations (500, 1000, 1500 and 2000 mg

kg-1) and incubated at 28 °C for 15 days. After which plates were oven dried at 105 °C for 2

hours to stop biological activity. Finally, available fraction was determined by extracting 5 g soil

with 0.01 M CaCl2 solution (1:5; soil:extractant). Filtrate was then analyzed for Pb concentration

through AAS.

5.2.3. Effect of Co-Inoculation on Pb Accumulation and Uptake

Pot culture experiment was conducted in control conditions to investigate the effect of co-

inoculating Pb mobilizing bacterial and fungal strains on Pb accumulation by Pelargonium

hortorum. Soil was prepared and artificially spiked at different Pb concentration levels (500,

1000, 1500 and 2000 mg kg-1) as describe in chapter 4. Uniform and 2 months old seeding’s with

4-5 leaved each plant were selected and transplanted in pot containing 1 kg of spiked soil. After

1 week of acclimatization 5 mL of each bacterial and fungal inoculum (OD adjusted to 0.5 in

128

distilled water) were co-inoculated to plants. Plants were then allowed to grow for 4 months. The

plants were placed green house with 16-8 hour and 25-20 °C day-night regime. The pots were

watered daily with distilled water to maintain moisture content at 65–70% of water-holding

capacity with great care to avoid heavy-metal seepage from the pots.

5.2.4. Harvesting and Plant Analysis

After the length of exposure, plants were harvested and washed under tap water to remove soil.

Great care was taken to minimize root damage during harvesting and washing. Roots were then

dipped in 0.1 N HCL to remove adsorbed Pb on root cell walls. Immediate after washing plants

were dived in root and shoot and fresh biomass was taken. Plants were then placed in oven for

drying at 65 °C for 2 days. After complete dry, root shoot samples were grounded to powder

form and digested with digested with HNO3/HClO4 (4:1) mixture. Clear aliquots obtained were

diluted to 50 mL and used for determination of Pb content through AAS. Pb concentration data

was then used to calculate Pb uptake and other attributes.


5.3.1. Compatibility for Co-inoculation of Bacteria and Fungi

Results from compatibility testing express as zone of inhibition are given in figure 5.1(a,b). It

was observer that more antibacterial effect of fungi was noticed compared to antifungal activity

expressed by tested bacterial strains. Figure 5.1(a) clearly indicates higher antibacterial activity

imposed by Mucor spp. on tested bacteria compared to A. flavus.

129

Figure 5. 1: Comparative analysis of antibacterial and antifungal activity of tested bacteria and

fungi; zone of inhibition against fungi and bacteria (a,b). Af, M, Kv, Mp and Kq corresponds to

A. flavus, Mucor spp., K. variicola, M. paraoxydans and K. quasipneumoniae, respectively.

Results with significant difference at p<0.05 are denoted by different letters.

In presence of Mucor spp. greater zone of inhibition was observed for K. quasipneumoniae

followed by K. variicola and lesser antibacterial effect was observed on M. paraoxydans. Similar

pattern with much lesser effect on zone inhibition was observed in case of A. flavus. Whereas no

significant (p<0.05) difference among bacterial strains was observed for antifungal activity

towards A. flavus and Mucor spp. The reduced bacterial growth in presence of Mucor spp. is in

agreement with the antibacterial effect of Mucor spp. reported in literature (Aziz et al., 2016;

Etcheverry et al., 2009). In a study, silver nanoparticles treated with extracts from Mucor hiemalis

significantly increased the antimicrobial characteristics of nanoparticles against Klebsiella

pneumoniae, Pseudomonas brassicacearum, Aeromonas hydrophila, Escherichia coli, Bacillus

cereus, and Staphylococcus aureus (Aziz et al., 2016). In another study antifungal activity of

Microbacterium oleovorans DMS 16091 was investigated on 3% maize meal extract agar against

two strains of A. flavus (MPVPA 2092, 2094) and three strains of F. verticillioides MPVPA (285,

a

b

a

ab

b

a

0

5

10

15

20

Kv Mp Kq

Zon

e of

inh

ibit

ion

(m

m)

Bacterial strains

Af

M

a aa aa a

0

5

10

15

Af M

Zo

ne

of

inh

ibit

ion

(m

m)

Fungal strains

KvMpKq

(b) (a)

130

289, and 294). Results indicated minimal antifungal activity of Microbacterium oleovorans

(Etcheverry et al., 2009).

5.3.2. Effect of Co-Inoculation on Soil Pb Mobility and Soil pH

The results of bioavailable Pb in co-inoculated soil with bacteria and fungi are presented in figure

5.2. Increase in available Pb was observed in all microbial interaction with least effect in soil

containing co-cultures of Mucor spp.+K. variicola. Highest significant increase in extractable Pb

fraction was observed when soil was co-inoculated with A. flavus+M. paraoxydans at all levels

of soil Pb concentrations. The increase in Pb availability was found to be 5 times more compared

to control soil (un-inoculated soil) at 2000 mg Pb kg-1 soil concentration. Much higher effect was

noticed in soil when bacteria were inoculated in combination with A. flavus compared to Mucor

spp.

Figure 5. 2: Effect of co-inoculation on extractable Pb. Bars indicates mean of three replicates.

Significant (p<0.05) difference among bacterial interactions are express by different letters.

o

k-n

h-k h-k

mno

j-mk-n

no

h-k

cd

d-g

k-n

efg

g-j

lmn

ghi

b

c

i-l

cde c-f

k-n

c

a

b

fgh

cd

d-g

0

40

80

120

160

Control Kv Mp Kq Kv Mp Kq

Af M

[Pb

] m

g k

g-1

Microbial strains

500 1000 1500 2000 mg Pb/kg soil

131

In case of Mucor spp. higher significant Pb solubilization was noticed when Mucor spp. was

inoculated along with M. paraoxydans. The increase in available Pb was found to be 3 –folds

compared to control soil at 2000 mg Pb kg-1 soil concentration. A 2 –folds increase in Pb

availability was observed in A. flavus + M. paraoxydans compared to Mucor spp. + M.

paraoxydans. The reason could be the antibacterial property of Mucor spp. towards M.

paraoxydans. It is could be possible that Mucor spp. limited bacterial growth as expressed by

zone inhibition assay (figure 5.1a) and reduced the overall functional ability of bacteria to

solubilize Pb.

Figure 5. 3: Effect of co-inoculation on soil pH; A. flavus co-inoculations with bacteria (a),

Mucor spp. co-inoculation with bacteria (b). Graph is plotted by mean values of three

replicates.

6.4

6.8

7.2

7.6

0 500 1000 1500 2000

pH

[Pb] soil (mg kg-1)

ControlKv+AfMp+AfKq+Af

6.4

6.8

7.2

7.6

0 500 1000 1500 2000

pH

[Pb] soil (mg kg-1)

ControlKv+MMp+MKq+M

(a) (b)

132

Change in pH induced by co-inoculation in soil after 15 days incubation is demonstrated in figure

5.3(a,b). The pH results were consistent with pH availability indicating that pH reduction was

the main factor that controls the Pb solubilization in inoculated soil. In control soil pH was

slightly decreased (from pH 7.4 to pH 7.0) by -0.4 pH units upon addition of Pb from 0 to 2000

mg kg-1. In inoculated soil the pH was decreased by all microbial inoculation at all levels of soil

Pb concentrations with higher decreased observed in soil containing A. flavus + M. paraoxydans

(figure 5.3a). The lowest soil pH (6.8) was observed at 2000 mg Pb kg-1 soil A. flavus + M.

paraoxydans. The acidity developed by individual fungi in their mono-inoculation was

marginally increased when co-inoculated (figure 5.3a,b). No significant effect on pH change

was observed in case of Mucor spp. Only small change in pH (-0.2 pH units) was observed in

Mucor spp. + M. paraoxydans application. Which shows the ability of M. paraoxydans to

decrease soil pH probably due to high tolerance of this strain to Pb and lowest antagonistic

activity with both fungi which contributed towards growth and proliferation of bacteria and

production of extracellular organic acids that lower the pH of soil medium.

5.3.3. Plant Biomass and Pb Accumulation

Plant biomass was significantly improved in all microbial treatments, results are given in table

5.1. A general decrease in biomass was observed in all inoculated and control plants upon

increasing soil Pb concentration. In control soil, plant biomass was significantly decreased (from

2.0 to 1.0 g) by 2 –folds as Pb concentration was increased from 0 to 2000 mg Pb kg-1 soil. Higher

biomass was observed in plants when Mucor spp. was co-inoculated with bacteria compared to

A. flavus. The increase in biomass was 1.2 to 1.9 –folds and 1.1 to 1.6 –folds with Mucor spp.

and A. flavus when inoculated along with bacteria in Pb spiked soil (0-2000 mg kg-1). Highest

significant (p<0.05) increase in plant biomass by was observed in control soil (without Pb

133

addition) co-inoculated with Mucor spp. + M. paraoxydans (M+Mp) with no significant decrease

up to 1000 mg Pb kg-1 soil concentration. Upon further increase in Pb contentration to 1500 and

2000 mg Pb kg-1 soil, a decrease by 1.2 and 1.3 –fold was observed, compared to M+Mp

inoculated plants in control soil. But still at highest level of soil Pb concentration (2000 mg kg-

1), M+Mp inoculated plants gained 2.3 –folds higher biomass compared to un-inoculated plants

at same level of Pb concentration.

Similar trend was observed in case of A. flavus + bacteria co-inoculated plants, with highest

biomass achieved in A. flavus + M. paraoxydans (Af+Mp) inoculated plants at all levels of soil

Pb concentrations. Af+Mp inoculated plants had 1.2 1.2, 1.1, 1.2 and 1.2 –folds less biomass at

0, 500, 1000, 1500 and 2000 mg Pb kg-1 soil compared to M+Mp inoculated plants. This indicated

higher plant growth promoting ability of Mucor spp. compared to A. flavus. Moreover the plant

growth potential was improved in the presence of M. paraoxydans. In individual studies

(Manzoor et al., 2018b) and results obtained in chapter 5 both Mucor spp. and M. paraoxydans

increased the root biomass by 1.4 and 2.0 –folds and shoot biomass by 1.5 and 1.6 –folds in

Pelargonium hortorum at 2000 mg Pb kg-1 soil concentration. This could be attributed to high

Pb tolerance of Mucor spp. (up to 1000 mg L-1) and M. paraoxydans (up to 800 mg L-1) and plant

growth promoting characteristics (IAA, GA3 and siderophopre production) (table 4.1 and 4.6).

Lead uptakes in Pelargonium hortorum at different levels of soil Pb concentration upon co-

inoculation of fungi and bacteria are given in figure 5.4. Results indicates that higher per plant

uptake was achieved in plants inoculated with Af+Mp followed by M+Mp at all levels of soil Pb

concentrations. Plants with Af+Mp had uptake values of 2.6-3.1 mg plant-1 at different soil Pb

concentrations. The Pb uptake was 1.9, 2.4, 2.7 and 4.8 folds higher in Af+Mp inoculated plants

compared to control at 500, 1000, 1500 and 2000 mg Pb kg-1 soil concentrations. In case of

134

Mucor spp., higher significant (p<0.05) per plant uptake was found when Mucor spp. was co-

inoculated with M. paraoxydans compared to K. variicola and K. quasipneumoniae and control

plants at all levels of soil Pb concentrations. Both these interactions have higher significant per

plant uptake. The Af+Mp inoculation have significantly improve Pb availability and subsequent

accumulation in root and shoot. Which is possible owing to production of low molecular weight

organic acids (NLMWOA) such as maleic, tartaric, glutamic, acetic, lactic, succinic, citric and

gluconic acids by A. flavus have been reported (Max et al., 2010). Usha & Padmavathi, (2013)

also indicated higher siderophopre production ability of A. flavus that might have improved the

Pb dissolution and availability and consequent plant uptake.

Table 5. 1: Total plant biomass (g) co-inoculated with bacteria and fungi at different levels of

soil Pb concentration. Values given are mean of three replicates. Letters indicated significant

different at p value < 0.05.

Microbial co-

inoculation

Pb conc. in soil (mg kg-1)

0 500 1000 1500 2000

Control 2.0h-k 1.9i-m 1.5mn 1.4n 1.0o

Af+Kv 2.1f-i 2.0h-l 1.9i-l 1.7j-n 1.4n

Af+Mp 2.5b-e 2.4c-f 2.5c-f 2.2f-i 2.0h-l

Af+Kq 2.3d-h 2.2d-i 2.3d-h 2.1g-k 1.6lmn

M+Kv 2.4d-g 2.3d-h 2.2f-i 2.0h-l 1.6k-n

M+Mp 3.0a* 2.8ab 2.8abc 2.5bcd 2.3d-g

M+Kq 2.8abc 2.5bcd 2.3d-h 2.2e-i 1.9h-l

Munawar & Iram (2014) also observed 30-35% dissolution of Pb after 24 hours incubation in

heavy metal contaminated soil collected from Multan, Pakistan. Similar Pb chelation by

Microbacterium paraoxydans have been reported by Sheng et al. (2008b), where Microbacterium

paraoxydans-G-16 strain increased water soluble Pb by 7540 mg Pb L-1 after 60 h incubation in

135

liquid growth medium containing insoluble salt of Pb (PbCO3). The bacterial strain also increased

water soluble Pb from 3.2- to 5.6 –folds compared to control. Both strains A. flavus and M.

paraoxydans also showed no growth retardation and antagonistic activity as determined in this

study (figure 5.1). Whereas Mucor spp. and M. paraoxydans have been observe to produce

significant amount (203 and 92.26 μg mL-1, respectively) of indole acetic acid (IAA) (table 4.1

& 4.6) that improves plant growth, metabolism and contributes to Pb detoxification mechanisms

in plants (Hac-Wydro et al., 2016). Microbacterium sp. was found to have IAA production by

27.9 and 94.2 µg mL-1 and ACC production by 28.5 and 961.84 mM α KB mg-1 h-1, respectively

(Sheng et al., 2008, Bal et al., 2013). Siderophore production was also observed in

Microbacterium paraoxydans by (Sheng et al., 2008b). Therefore, it is possible that the M+Mp

inoculation improve plant biomass (table 5.1) that ultimately improved per plant Pb uptake.

Which could be due to lesser antagonistic activity as observed in figure (5.1) and PGPR activity

of both strains.

Figure 5. 4: Effect of co-inoculation on Pb uptake per plant. Graph is plotted by taking mean

values of three replicates. Bars bearing different letters are significantly differ at p<0.05.

ij

f-i

b-e

e-h

g-j

a-d

c-f

ij

g-i

a

a-d

hij

abc

d-g

j

e-h

ab

a-d

1.6hij

abc

e-h

k

ij

abc

e-h

hij

a-d

e-h

0.0

1.0

2.0

3.0

4.0

Control Kv Mp Kq Kv Mp Kq

Af M

Pb

up

tak

e (m

g p

lan

t-1)

Microbial interactions

500 1000 1500 2000 mg kg-1

136


In this study fungi and bacteria, selected from preceding experiments, were tested for co-

inoculation and their effect on Pb bioavailable fraction in soil and uptake by plant. Compatibility

of co-inoculation was observed by investigating zone of inhibition and growth retardation in

presence of cell extracts. Results showed antibacterial activity of Mucor spp. against K.

quasipneumoniae followed by K. variicola. Synergistic effect of A. flavus and M. paraoxydans

was noticed for Pb solubilization and accumulation in root shoot of Pelargonium hortorum,

whereas as plant biomass was significantly improved with co-inoculated with Mucor spp. and M.

paraoxydans. Highest and significant per plant Pb uptake was noticed for both of these

inoculations when compared to single inoculations and control plants. Our results suggested that

in Pb-contaminated soil, Pelargonium hortorum inoculated with A. flavus + M. paraoxydans and

Mucor spp. + M. paraoxydans have greater potential to remediate Pb contaminated soil.

The study concluded the improvements in phytoextraction effecienct of Pb by P. hortorum when

bacteria and fungi were co-inoculated. There is still need to understand the microbial interaction

for soil enzymatic activity that could further help in understanding the microbial interaction soil

plant system for Pb uptake. In this regard, effect of bacteria and fungi on soil enzymatic activities

were studied in detail and presented in next section.

137

B. EFFECTS OF BIOINOCULANTS ON SOIL ENZYMATIC ACTIVITIES IN Pb

CONTAMINATED SOIL

Soil enzymes are important indicators of soil environmental quality. The focus of current study

was to evaluate the soil enzymatic activities inhibition at different levels of Pb contamination and

restoration by introducing Pb resistant bacteria.

5.5. BACKGROUND

Soil is fundamental and irreplaceable resource governing important biogeochemical cycles and

nutrients turnover for terrestrial plants productivity (Alef & Nannipieri, 1995). Soil microbiota

play an important role in sustaining soil health and fertility by secreting extracellular enzymes

that facilitates different reactions and metabolic processes by acting as biological catalysts. These

enzymes are of great agronomic significance, the important ecological processes mediated by

extracellular enzymes include decomposition, modifying organic carbon pool and mineralization

of N, P, K (Zaveri et al., 2016). Soil enzymes are extremely sensitive to external environmental

cues than other variables and are considered as potential indicator of soil quality and biological

changes, thereafter (Jodaugienė et al., 2010; Paz-Ferreiro et al., 2010). Any change in microbial

community diversity due to biotic or abiotic factors is directly reflected by change in soil

microbial and enzymatic activities (Dick et al., 1996). Therefore, enzymatic activities are

frequently used for determining the influence of various pollutants including heavy metals on

soil productivity (Shen et al., 2005). Lead is one of the most significant and ubiquities toxic heavy

metal. The natural concentration of Pb in normal agricultural soils ranges from 10 to 100 mg kg-

1 (Soon & Abboud, 1993) with direct or indirect flux of Pb through anthropogenic activities. Pb

is regarded as a chemical of great concern in the new European REACH regulations (EC

138

1907/2006; Registration, Evaluation, Authorization and Restriction of Chemicals). The elevated

level of Pb in soil may adversely affect soil biological properties by disturbing soil microbial

community, structure and diversity (Sardar et al., 2007). Increased Pb concentration in soil

inhibits enzymatic activities by interfering with normal biochemical properties of soil, shifting

microbial population and diversity (Moreno et al., 2002), denaturing the enzymes and protein by

interacting and blocking the active sites (Megharaj et al., 2003). Soil Pb exposure causes decrease

in total microbial count, microbial biomass carbon, soil dehydrogenase activity (Zaveri et al.,

2016; Khan et al., 2007; Jin-Yan et al., 2014), soil respiration, phosphatase, urease (Zaveri et al.,

2016; Khan et al., 2007) and related enzyme activities. Although a number of studies have

quantified the detrimental effect of Pb on soil enzymatic activities, yet all studies were focused

on lower levels of Pb in soil and no remediation techniques were employed to restore the negative

impacts by applying bio inoculants. Hence this study was undertaken to understand the extents

of enzyme inhibition at different application rates of Pb in soil along with application of Pb

resistant bacteria for reviving the enzymatic function of Pb contaminated soil.



Soil (0-15 cm) were collected from vicinity of National University of Science and Technology.

Soil was air dried, crushed in ball mill and sieved to achieve 2 mm particle size prior to use.

Prepared soil was then characterized for physiochemical properties (table 4.9) using standard

laboratory procedures.

139

5.6.2. Pb Resistant Bacteria

Three Pb resistant bacteria (tolerant up to 800 mg L-1 Pb) were obtained from Environmental

Biotechnology Laboratory, NUST, Pakistan. These strains were isolated from Pb contaminated

soil.

5.6.3. Experimental Design

Soil incubations experiment was performed for studying effect of increasing soil Pb

concentration on soil enzymatic activities. Uncontaminated soil obtained was artificially spiked

with four different levels of Pb (500, 1000, 1500 and 2000 mg kg-1). These levels were chosen

based on Pb contamination reported in contaminated soil around battery recycling sites in

Pakistan. Pb was added as solution of Pb(NO3)2. In total 20 treatments were placed in a

randomized complete block design with tri-replicates. Inocula were prepared as described in

section I and II. For co inoculation, 0.5 mL of each bacterial and fungal spore suspension (OD

set at 0.5) prepared in distilled water was added in petriplates containing pre-autoclaved and dried

soil (105 °C for 2 hours) after cooling. Moisture continent was maintained with sterile distilled

water at 60 % of soil saturation percentage. All work was done in laminar flow hood with greater

care in order to minimize contamination. Plates were then incubated at 28°C for 15 days and

analyzed for soil enzymatic activities and Pb availability as influenced by microbial inoculations.

Soil without Pb and bacterial/fungal strains were kept as control. Soil was jar filled and incubated

for four weeks at room temperature. Soil samples were collected after 1, 2, 3 and 4 weeks and

stored at -80 until analysis of soil enzymes.

140

5.6.4. Soil Enzymatic Assays

Soil enzymatic activities were measured with incubated soil samples. In order to simulate the

field conditions, enzyme assays were performed in un-buffered extracts solutions. Soil

respiration was determined by the amount of alkali (1 N NaOH) neutralization by CO2 evolved

in air tight jar (Ano et al., 2012). Microbial biomass carbon was estimated by rapid chloroform

fumigation extraction method (Witt et al., 2000). Soil dehydrogenase activity was estimated by

measuring the reduction of triphenyl tetrazolium chloride (TTC) to triphenyl formazan (TPF) and

expressed as mg TPF g-1 h-1 (Tan et al., 2017). Alkaline phosphatase (ALP) activity was analyzed

by photometric measurement of p-nitrophenyl phosphate in filtrate at 400 nm (Specord 200 plus

UV-VIS Spectrophotmeter, Analytikjena, Germany) (Tabatabai & Bremner, 1969). Urease

activity was determined by incubating soil with 10% urea solution and citric acid buffer (pH 6.7)

at 37 °C for 24 hours (Sebiomo et al., 2017). The intensity of blue color produced was estimated

by taking absorbance at 578 nm (Leilei et al., 2012). Catalase activity was determined by

following method of Burns (1978) and expressed as mL KMnO4 g-1 h-1. Soil IAA was estimated

by method of Sarwar et al. (1992).


All treatments were statistically analysed using SPSS 16 computer software. Difference among

means of treatments was determined using analysis of variance (ANOVA) and duncan multiple

range test with a significance level of p<0.05.

141



Physicochemical analysis of soil is presented in table 5.2. The results shows that the soil used in

experiment had slightly alkaline pH (7.81). Soil pH can effect soil enzymatic activities by

regulating or inhibiting enzyme activators and inhibitors by modifying soil chemical

environment, substrate concentrations and functional groups (Dick et al., 2000).

Table 5. 2: Physico-chemical characteristics of soil. Values are mean of three replicates.

Soil texture was clay loam and organic matter content of 0.47%. Generally positive influence of

OM on extracellular enzymes have been found (Katsalirou et al., 2010). Considerable amount of

nutrients were present that may influence and/or regulate various soil enzymatic activities in soil.

The total Pb concentration in soil was 2.33 mg kg-1.

5.7.2. Effect of Increasing Pb Concentrations on Soil Enzymatic Activities

Lower enzyme activities were detected in all Pb amended samples than in control (figure 5.5).

Mean values of all enzyme activities decreased with increasing Pb dose and incubation time in

Physico chemical parameters Values

Soil pH 7.81

EC (dS m-1

) 0.45

Texture Clay loam

Organic matter content (carbon %) 0.47

Total nitrogen (%) 0.04

Total phosphorus (mg kg-1

) 6.08

Potassium (mg kg-1

) 687

Magnesium (mg kg-1

) 298

Pb (mg kg-1

) 2.33

142

soil compared to control. A relatively higher decline was observed in soil respiration and DEH

activity by 2.8 and 2.5–folds, respectively at 2000 mg Pb kg-1 soil after 4 weeks of Pb exposure.

Figure 5. 5: Inhibitory effects of Pb on soil enzymatic activities during different time intervals.

(a) soil respiration; (b) microbial biomass; (c) dehydrogenase activity; (d) catalase activity; (e)

urease activity; (f) alkaline phosphatase activity. The error bars indicate standard error.

Soil respiration was significantly declined at all Pb levels and sampling intervals. The highest

decline was observed in soil treated with 2000 mg Pb kg-1 soil and no significant change in soil

respiration was observed with increase in incubation period depicting toxic concentration of Pb

that limits soil respiration. Microbial biomass carbon was affected by 500 mg Pb kg-1 soil even

after 4 weeks incubation whereas significant decrease was observed at 1000, 1500 and 2000 mg

Pb kg-1 soil at after two weeks of incubation by 1.2, 1.2 and 1.4–folds, respectively. Means values

of DEH activities were decreased sharply at each Pb treatment and sampling interval compared

to the control soil. Similar decrease in CAT activity was observed. DEH activity decreased 1.2,

0

100

200

300

400

500

600

0 1 2 3 4

CO

2-C

(m

g k

g-1

so

il)

Time (Weeks)

0 500 1000 1500 2000 mg/kg

0

0.1

0.2

0.3

0.4

0.5

0 1 2 3 4

DE

H (

mg

TP

E k

g-1

h-1

)

Time (Weeks)

0 500 1000 1500 2000 mg/kg

0

100

200

300

400

0 1 2 3 4

Mic

ro

bia

l b

iom

as

s (

µg

C g

-1

so

il)

Time (weeks)

0 500 1000 1500 2000 mg/kg

0

0.2

0.4

0.6

0.8

1

0 1 2 3 4

Urea

se

(µ

g N

H4-N

g-1

h-1

)

Time (weeks)

0 500 1000 1500 2000 mg/kg

0

2

4

6

0 1 2 3 4

AL

P (

mg

p-n

itro

ph

en

ol g

-1 h

-1

)

Time (weeks)

0 500 1000 1500 2000 mg/kg

0

1

2

3

4

5

0 1 2 3 4

CA

T (

KM

NO

4g

-1h

-1)

Time (weeks)

0 500 1000 1500 2000 mg/kg

(a) (b) (c)

(d) (e) (f)

143

1.4, 1.7 and 2.5–folds in soil treated with 500, 1000, 1500 and 2000 mg Pb kg-1, respectively.

Compared to control soil, the decline in urease activity was observed in all Pb treated soil till 3rd

week of incubation, after which no significant decline was noticed. Like CAT, microbial biomass

and urease, the ALP activity was slightly affected by 500 and 1000 mg Pb kg-1 soil up to 3 weeks.

However, by further increasing incubation period, ALP activity at 500, 1000, 1500 and 2000 mg

Pb kg-1 soil was decreased by 1.1, 1.2, 1.3 and 1.5–folds compared to 0 week. It is well

documented that the Pb reacts thiol groups of enzymes and generates mercaptides that inhibit and

inactivate the enzymatic activities (Sarwar et al., 1992). Different studies (Khan et al., 2007; Jin-

Yan et al., 2014; Tan et al., 2017) have reported that Pb may significantly inhibit soil urease

activity, FDA hydrolysis and reduce the number of microorganisms that produce enzymes.

5.7.3. Correlation Analysis

Table 5.3 shows the Pearson’s correlation coefficients between all enzyme activities and Pb

concentrations in soil. Between all enzymes, significantly (p<0.01) positive correlation was

observed except respiration and ALP, where weak insignificant (p>0.05) negative correlation

was observed with increasing Pb concentration in soil.

Table 5. 3: Correlation among and between soil enzymes and Pb concentration in soil.

**,*. Correlation is significant at the 0.01 and 0.05 level (2-tailed).

Pb Res DEH MB CAT Urease ALP IAA

Pb 1 -.702** -.498* -.741** -.627** -.582** -.522** -.767**

Res -.702** 1 0.011 0.291 0.096 0.089 -0.015 0.365

DEH -.498* 0.011 1 .919** .974** .980** .985** .906**

MB -.741** 0.291 .919** 1 .939** .922** .935** .971**

CAT -.627** 0.096 .974** .939** 1 .987** .964** .935**

Urease -.582** 0.089 .980** .922** .987** 1 .966** .926**

ALP -.522** -0.015 .985** .935** .964** .966** 1 .900**

IAA -.767** 0.365 .906** .971** .935** .926** .900** 1

144

Negative correlation was observed for all enzyme activities with increasing soil Pb

concentrations. Most significant negative correlation (p<0.001) was observed for soil respiration,

microbial biomass, CAT, urease, ALP and IAA in response to increasing Pb concentration in

soil. DEH also showed significant (p<0.05) negative correlation with increasing Pb

concentration.

5.7.4. Microbial Biomass and Respiration

Effect of bio-inoculants on soil microbial growth was quantified by determining soil respiration

(RES) and microbial biomass (MB) at different soil Pb concentrations (table 5.4). It was observed

that significant decrease in both parameters were observed when soil was subjected to elevated

Pb concentration. No significant decrease in soil respiration was observed up to 1500 mg Pb kg-

1 after which significant decrease in soil respiration by 1.6 –folds was observed at 2000 mg Pb

kg-1 soil, compared to control soil (without Pb addition).

All bacterial strains had positive influence on soil respiration activity. Particularly, Kq (K.

quasipneumoniae) was most significant (p<0.05) in improving soil respiration at all Pb levels

(table 5.4). Addition of fungi significantly improved soil respiration. Both A. flavus (Af) and

Mucor spp. (M) improved soil respiration at all soil Pb concentration compared to un-inoculated

soil. At 2000 mg Pb kg-1, soil the increase in soil respiration was 1.8 and 1.5 –folds upon A. flavus

and Mucor spp. inoculations. Interestingly, soil respiration was substantially increased when

fungi was co-inoculated with bacteria. With higher significant (p<0.05) effect on soil respiration

was observed in A. flavus and M. paraoxydans (Af+Mp) co-inoculation.

145

Table 5. 4: Effect of bio-inoculation on soil microbial activity in Pb contaminated soil.

Microbial

indicators

Pb conc.

(mg kg-1

)

Bio-inoculants

C Af M Kv Mp Kq Af+Kv Af+Mp Af+Kq M+Kv M+Mp M+Kq

RES 0 165c-h

202bd

198de

272c

330a

348a

216d

215d

210de

194ef

211cd

185c-h

500 168a-h

213b-g

194cd

263c

301ab

356a

211d-e

216d

207de

192de

211abc

179c-e

1000 161e-h

197cde

179dh

274bc

294bc

329ab

203de

215de

199def

176d-h

206d

166d-h

1500 148h

201cd

163d-h

245cd

284bc

312bc

204de

211d

193def

161e-h

205ab

160e-h

2000 104i

190d-g

155fgh

212d

246c

330ab

195de

208dc

190d-g

150h

203de

152gh

MB 0 241ab

240abc

235a-d

227c-f

237b-e

251ab

246ab

253a

246ab

230a-f

244ab

233a-e

500 221a-h

238a-d

223a-g

218d-h

223b-g

242ab

242ab

249ab

242ab

221a-h

238a-d

222a-g

1000 197c-h

223a-g

211a-h

191c-h

229c-h

232a-e

239a-d

246ab

231a-f

210a-h

239a-d

210a-h

1500 185g-h

212a-h

213a-h

216efg

223c-h

221a-g

220a-h

239a-d

224a-g

209a-h

235a-d

209a-h

2000 178h

208b-h

187f-h

197c-h

217d-h

230b-f

211a-h

226a-g

213a-h

195d-h

224a-g

190e-h

146

Highest significant (p<0.05) increase in soil respiration by A. flavus and M. paraoxydans was

1.3, 1.3, 1.3, 1.4 and 2.0 –folds compared to un-inoculated soil at 0, 500, 1000, 1500 and 2000

mg Pb kg-1 soil. Compared to single inoculation of A. flavus, in co-inoculation the respiration

was improved by 1.1 –folds at all soil Pb concentrations.

Similarly, microbial biomass was also negatively affected with increasing concentration of Pb in

soil (table 5.4). Microbial biomass in control soil (no Pb added) was (241±7 µg C g-1 soil) and did

not significantly decrease up to 500 mg Pb kg-1 soil. However with further increase in soil Pb

concentration, the significant decrease by 1.1, 1.2 and 1.4 –folds was observed in 1000, 1500 and

2000 mg Pb kg-1 soil. Like soil respiration, similar trend was obtained in case of microbial biomass.

No significant decrease in microbial biomass was noticed in soil treated with Kq (K.

quasipneumoniae) and Kv (K. variicola) at all soil Pb concentrations. In case of fungi, soil

microbial biomass by improved by 1.2 and 1.1 –folds (by A. flavus and Mucor spp., respectivesly)

at 2000 mg kg-1 soil Pb concentration. Compared to single inoculation, co-inoculation with bacteria

significantly improved microbial biomass at all soil Pb concentrations and no significant (p<0.05)

decrease in microbial biomass was observed with increasing concentrations of Pb in soil (0-2000

mg kg-1). Co-inoculating A. flavus and Mucor spp. with M. paraoxydans significantly (p<0.05)

improve microbial biomass by 1.3 –folds compared to un-inoculated soil at 2000 mg kg-1 soil Pb

concentration. This indicated strong positive interaction among A. flavus and M. paraoxydans for

growth enhancement and biological activity. Both strains also did not show any antagonistic

activity as determined in figure 5.1.

147

5.7.5. Soil Enzymatic Activities

Soil enzymes are extremely sensitive and one of most important indicator to monitor soil health as

affected by heavy metal contamination (Jaiswal & Pandey, 2018). Among all enzymes in soil

including oxidoreductases, hydrolases, isomerases, lyases and ligases. The dehydrogenases are the

major representative of oxidoreductases tightly linked with microbial redox reaction involving

decomposition of organic matter (Moeskops et al., 2010). Therefore, used as indicator of overall

soil microbial and enzymatic activities in soil. Results indicated decreased DEH activity upon

increasing soil Pb concentration from 500 to 2000 mg Pb kg-1 soil (table 5.5). At 500 mg Pb kg-1

soil, no significant decrease in DEH activity was observed, but upon further increase in soil Pb

concentration to 1000, 1500 and 2000 mg kg-1, the significant (p<0.05) decrease in DEH by 1.2,

1.3 and 1.7 –folds was observed in control soil (un-inoculated). However, the DEH activity was

signinificantly (p<0.05) improved by microbial treatment (table 5.5). In Mucor spp. and K.

quasipneumoniae inoculated soils, the DEH activity remained constant in all Pb amended soil and

no significant decrease in enzyme activity was observed with increasing soil Pb concentrations. At

2000 mg kg-1 Pb significant increase in DEH activity by 1.7 and 1.6 –folds was observed in K.

quasipneumoniae and Mucor spp. inoculated soils, compared to control soil (un-inoculated soil

containing Pb). However, unlike soil respiration and microbial biomass when Mucor spp. was co-

inoculated with K. variicola (M+Kv), no significant improvement in DEH activity was observed

compared to bacterial and fungal strains alone.

Soil urease (URE) activity also plays important role in maintaining soil fertility and nutrients

availability and like DEH, urease activity was also negatively affected with increasing soil Pb

concentrations (table 4.12). In control soil (no Pb and un-inoculated) the urease activity was

0.80±0.01 µg NH4-N g-1 h-1 and did not change with addition of 500 mg Pb kg-1 soil. However

148

with further increase in soil Pb concentration to 1000, 1500 and 2000 mg kg-1, significant (p<0.05)

decrease in urease activity by 1.2, 1.4 and 1.9 –folds was observed. Results from fungal inoculated

showed no change in urease activity across all Pb concentration indicating no effect on soil urease

activity. However, bacterial inoculation significantly improved soil urease activity at all levels of

soil Pb concentrations. Amoung three bacterial treatments, M. paraoxydans (Mp) signifinatly

improved soil urease activity by 1.6–folds at 2000 mg kg-1 soil Pb concentration. In case of co-

inoculation, the urease activity was reduced when A. flavus and Mucor spp. were inoculated along

with M. paraoxydans (Mp). Higher significant urease activity of 0.87±0.01 µg NH4-N g-1 h-1 was

observed in control soil (with no Pb) when co-inoculated with A. flavus and K. variicola (Af+Kv)

followed by A. flavus and K. quasipneumoniae (0.84±0.03 µg NH4-N g-1 h-1), showing the positive

effect of K. variicola and K. quasipneumoniae on soil urease activity. Overall, 1.1 to 1.3 –folds

increase in soil urease activity was observed when A. flavus was co-inoculated with K. variicola

and K. quasipneumoniae.

Alkaline phosphatase (ALP) activity showed similar response as urease activity (table 5.5). ALP

did not alter significantly up to 1000 mg Pb kg-1, however significant (p<0.05) decrease by 1.4 and

1.7 –folds was observed in ALP activity at 1500 and 2000 mg Pb kg-1 soil. Beside Pb toxicity to

soil microbial community and reduced enzymatic activity, decrease in soil pH upon Pb addition is

also a major factor in decreasing ALP activity. Chen et al. (2013) also found that decrease in soil

pH tends to decrease alkaline phosphatase but increase acid phosphatase activities. ALP activity

remain unchanged with bacterial and fungal inoculations, individual and in combinations.

Catalase is also an important soil enzyme that determine soil redox potential and plays important

role in nutrients mineralization and availability (Cui et al., 2013). The present results shows that

soil catalase activity remain unchanged up to 1000 mg kg-1 soil Pb concentration after which

149

decrease in activity by 1.2 and 1.5 –folds was observed at 1500 and 2000 mg Pb kg-1 soil (table

5.5). All fungal inoculation had no significant effect on soil catalase activity. Whereas, bacterial

strains significantly improved soil catalase activity in Pb amended soils. At 2000 mg kg-1 soil Pb

concentration, the catalase activity 3was significantly (p<0.05) improved by 1.3 –folds in soil

inoculated with K. quasipneumoniae. However in co-inoculation of K. quasipneumoniae with

fungal strains the catalase activity was slightly decreased. In co-inoculation, highest significant

catalase activity (4.37±0.3 KMNO4 g-1 h-1) was noticed in A. flavus and K. quasipneumoniae

(Af+Kq) inoculated soil containing no Pb. Hu et al. (2014) and Yang et al. (2016) also observed

significant negative correlation between Pb and urease and catalase activities.

Comparing all bacterial treatments at all Pb levels, K. quasipneumoniae had the highest positive

impact on soil enzymatic activities and was able to sustain them even at 2000 mg Pb kg-1 soil

concentration. K. quasipneumoniae inoculated soil had 2, 1.3, 1.7, 1.3 and 1.5–folds increase in

soil respiration, microbial biomass, DEH, CAT and urease activities at 2000 mg kg-1 after 15 days

incubation, respectively. Increased microbial biomass and soil respiration may be attributed to high

Pb tolerance of these strains (Aslam et al., 2009), and ability for enhanced activities of

dehydrogenase, catalase, urease, phosphate solubilisation by Klebsiella pneumoniae (Marçal et al.,

2009).

Similarly in case of fungal inoculation, Mucor spp. significantly improved dehydrogenase, urease,

and alkaline phosphatase activities. However in co-inoculations, the enzymatic activities was

slightly decreased when Mucor spp. was applied along bacterial strains, which may be due to

antibacterial properties of Mucor spp. (Aziz et al., 2016; Etcheverry et al., 2009). Our results are

in accordance with the previous studies that reported detrimental effects of Pb on soil enzymatic

activities through direct or indirect mechanisms (Hu et al., 2014; Cui et al., 2013; Khan et al.,

150

2007). Negative correlation of Pb and soil enzymes was also observed by Ahmad et al. (2012).

Addition of organic material can significantly improve the soil enzymatic activities as reported by

Yang et al. (2016), where urease activity was improved by 143% by addition of coarse rice straw

as a results improment in soil catalase activity was noticed. Wheras, ALP did not change

significantly. To the best of our knowledge, no study have been done on restoration of soil enzymes

through application of bio-inoculants. This is the first study reported on potential of these Pb

resistant strains on improving soil health and enzymatic activity along with phytoremediation in

Pb contaminated soil.

5.8. SUMMARY

Results indicated significant detrimental effect of Pb on soil microbial and enzymatic activities.

Individual inoculations were less effective compared to co-inoculations. In single inoculations

Mucor spp was more effective and showed significant improvement only in dehydrogenase

activity. However, in co-inoculation of fungi and bacteria dehydrogenase, urease and catalase

activities were significantly improved when co inoculated with K. variicola and K.

quasipneumoniae. No significant effect of bio-inoculations was noticed for alkaline phosphatase

activity. Results indicated co-inoculation of bacteria and fungi was more effective for improving

soil enzymatic activities in Pb contaminated soil and could be used to restore microbial activity in

Pb contaminated soil.

151

Table 5. 5: Effect of bio-inoculation on soil enzymatic activities in Pb contaminated soil. Table presents mean values of three

replicates. Values bearing different letter are significantly differ at p<0.05. Significance is denoted by *.

Enzyme

activities

Pb conc.

(mg kg-1

)

Bio-inoculants

C Af M Kv Mp Kq Af+Kv Af+Mp Af+Kq M+Kv M+Mp M+Kq

DEH

0 0.34a-d

0.36abc

0.38a*

0.39a*

0.38a*

0.38a*

0.35abc

0.35abc

0.35abc

0.36ab

0.36abc

0.35abc

500 0.34a-d

0.35a-d

0.34a-d

0.36ab

0.37a

0.35ab

0.34a-d

0.34a-d

0.32a-e

0.33a-d

0.35abc

0.34a-d

1000 0.28b-g

0.31a-f

0.33a-d

0.33abc

0.36bcd

0.36ab

0.34a-d

0.29a-g

0.32a-e

0.31a-f

0.32a-f

0.31a-f

1500 0.27c-h

0.29a-g

0.32a-f

0.32bcd

0.33bcd

0.33abc

0.34a-d

0.28b-g

0.31a-f

0.31a-f

0.30a-g

0.29a-g

2000 0.19h

0.21g-h

0.31a-f

0.25cd

0.25cd

0.33a-d

0.30a-f

0.23e-h

0.23f-h

0.29a-g

0.26d-h

0.27b-h

URE

0 0.80abc

0.81abc

0.78a-d

0.80abc

0.87a

0.85ab

0.87a

0.78a-d

0.84ab

0.81abc

0.81abc

0.78a-d

500 0.76a-d

0.72a-e

0.75a-d

0.73bcd

0.89a

0.89a*

0.79a-d

0.73a-d

0.78a-d

0.77a-d

0.72a-e

0.75a-d

1000 0.67c-f

0.68c-f

0.69c-f

0.69cde

0.83abc

0.82a-d

0.76a-d

0.68c-f

0.72a-e

0.73a-e

0.69c-f

0.71b-e

1500 0.55f-i

0.56f-i

0.55f-j

0.66d-f

0.79a-d

0.66cde

0.68c-f

0.54f-j

0.64d-g

0.56f-i

0.56f-i

0.58e-h

2000 0.42ij

0.42ij

0.46hij

0.42e-g

0.69cd

0.61c-f

0.51g-j

0.46hij

0.52g-j

0.51g-j

0.41j

0.50g-j

ALP

0 4.14ab

3.83a-e

4.04abc

3.90bcd

4.06bcd

4.11a-b

4.18ab

3.83a-e

4.04a-d

4.25a*

4.09ab

4.14ab

500 3.88a-e

3.67a-g

3.80a-f

3.74b-e

3.64b-f

3.95a-e

4.06ab

3.65a-h

3.71a-f

4.05abc

3.65a-h

3.91a-e

1000 3.57a-i

3.31d-i

3.49b-i

3.40d-j

3.27cde

3.61b-e

3.7a-f

3.31d-i

3.47b-i

3.79a-f

3.49b-i

3.55a-i

1500 2.94hij

2.93hij

3.09f-j

2.91e-j

2.76def

3.20d-j

3.32c-i

2.92ij

3.26e-i

3.51b-i

3.22e-i

3.22e-i

2000 2.43j

2.40j

2.85ij

2.65fj

2.64efj

2.76d-j

2.95g-j

2.4ij

2.85ij

3.09f-j

2.88ij

2.91ij

CAT

0 4.00a-e

4.03a-d

4.11abc

3.95bcd

3.92b-e

4.03a-d

4.03a-d

4.03a-d

4.37a*

4.11abc

4.00a-e

4.21ab

500 3.81a-g

3.73a-h

3.81a-g

3.92cd

3.95bcd

4.19bcd

3.73a-h

3.68a-h

3.95a-f

3.87a-g

3.81a-g

3.95a-f

1000 3.71a-h

3.6a-h

3.68a-h

4.05b-f

4.05abc

4.13abc

3.60a-h

3.49b-h

3.79a-g

3.79a-g

3.57a-h

3.84a-g

1500 3.25d-h

3.41b-h

3.17e-h

3.65d-j

3.87cde

3.84cde

3.41b-h

3.39b-h

3.65a-h

3.71a-h

3.28c-h

3.71a-h

2000 2.75hi

3.15fgh

3.15fgh

3.05fjh

3.57d-j

3.79c-f

3.15fgh

3.04gh

3.47b-h

3.33c-h

3.04gh

3.33c-h

152

Chapter 6

CONCLUSIONS AND PERSPECTIVES

It is well known that hyperaccumulator plants are a promising tool for remediation of soil

contaminated with lead. However, the efficiency of phytoremediation is limited owing to slow

process and low availability of Pb in soil. Advances in techniques included use of engineered

plants and synthetic phytochelatins with associated environmental concerns. In this study plant-

microbe interaction were focused as a viable option for enhanced phytoremediation of lead

contaminated soil. Lead resistant soil bacteria and fungi were investigated individually and in

combination to promote phytoextraction of lead in ornamental plant selected through screening of

indigenous ornamental plants through series of well-designed experiments. The key findings of

the research are concluded below.

6.1. GENERAL DISCUSSION

6.1.1. Pb hyperaccumulator selection

Results of screening activity indicated P. hortorum and M. criniflorum as hyperaccumulators of

Pb (shoot Pb conc. >1000 mg kg-1). This high Pb uptake could be attributed to rhizosphere

modifications by the two plants (results presented in chapter 3: section II). Both plants were able

to significantly modify rhizosphere pH and DOC content, which intern has increased water

extractable Pb concentration. Soil pH was significantly (p<0.05) decreased (ΔpH = -0.22 pH) and

dissolved organic carbon (DOC) content was significantly improved (by 1.7 –folds) in soil

cultivated with P. hortorum compared to M. criniflorum. It is well known that different soil factors

like pH, soil texture, structure, organic matter, organic colloids, iron oxides and cation exchange

153

capacity (CEC); and biological factors such as root exudation that alters the pH and dissolved

organic carbon (DOC) controls Pb speciation and availability in soil (Adejumo et al., 2018;

Khoshgoftarmanesh et al., 2018). Low pH generally favors Pb solubilization and activity as free

ion Pb2+ (Shahid, 2010). Whereas, some studies also showed Pb dissolution is governed by DOC

which increases Pb solubility upon decrease in pH by making soluble organo-Pb complexes

(Shahid et al., 2012a) therefore, plays important role in Pb chelation, solubility and increased Pb

uptake by plant (Khoshgoftarmanesh et al., 2018).

6.1.2. Plant microbe interactions for Pb phytoextraction

In next steps, the selected plants were further studied for plant-microbe interactions in

phytoremediation of Pb. Bio-inoculants (bacteria and fungi) were identified and studied for their

possible effects on improving Pb uptake and soil enzymatic activities. Results of Pb uptake

experiments showed that bacteria and fungi both had ability to improve Pb phytoextraction through

improving water extractable Pb fraction and plant biomass through PGPR activity. Plant associated

microbes are able to produce low molecular weight organic acids. Most frequently released organic

acids by bacteria and fungi are oxalic acid, malic acid and citric acid, gluconic acid and fumaric

acid as the mean of carboxylates acids that can alter the pH and DOC and could directly impact

Pb availability for plant uptake. In-vitro assay indicated significant production of citric (121& 0.29

mg L-1) and oxalic acid (110 & 0.21 mg L-1) in A. niger and Mucor spp., respectively, that results

in lowering pH of medium and increasing extractable fraction of Pb (Chandran et al., 2014; Xiao

et al., 2009; Wang & Chen, 2009). Our results showed that application of bacteria and fungi

increased the water extractable Pb by adjusting soil chemical properties (pH and DOC content).

Limited work has been done in littrature. Microbacterium paraoxydans (G-16), Mucor spp.

(CBRF59) have been found to significantly increase the availability of soil Pb (Sheng et al., 2008b;

154

Deng et al., 2011), but the relative effect on soil biochemical properties were not studied. In this

regards, our results greatly improve the mechanistic understanding of Pb dissolution upon

application of bioinoculants. And conclude that, the strains which greatly improved the overall

phytoextraction of Pb were effective in lowering soil pH by exudation of organic acids and plant

growth hormones particularly IAA and siderophores. Siderophores are the second most released

metabolites from bacteria (Sessitsch et al., 2013) and are involved in metal chelation, pH alteration

and oxidation/reduction reactions (Rajkumar et al., 2012). Similarly IAA (auxins) play important

role in plant growth, reproduction, metabolism and responses to various environmental cues

including interactions between auxin homeostasis and heavy metal toxicity (Waqas et al., 2012).

In a study, IAA increased Pb accumulation into harvestable plant part by 2800% over control

plants (Lopez et al., 2005).

6.1.3. Soil enzymatic activities

Promising effects on soil enzymatic activities were also observed upon application of

bioinoculants in Pb contaminated soil, which is a great advantage of using bio-inoculants instead

of synthetic chelators for improving phytoremediation efficiency. Until now, the most widely used

synthetic phytochelatin is EDTA. But it has several environmental concerns including extremely

low biodegradability (120-300 days half-life) (Pandey & Bhattacharya, 2018), highly soluble in

aqueous solution causing leaching of Pb to ground water (Lu et al., 2017; Hartley et al., 2014),

toxic impacts on soil biota (Kaurin et al., 2018), decreased soil microbial activity and basal

respiration upon application of EDTA and EDDS (Epelde et al., 2008). In contrast, the

bioinoculants identified in this study not only improve overall phytoextraction of Pb but also

restore the soil enzymatic and biological activity required for sustainable development of

technology and site remediation.

155

6.2. CONCLUSIONS

In the first phase twenty-one ornamental plants out of eleven different plant families were screened

for Pb hyperaccumulation potential in a concentration gradient experiment. Among all plants,

Pelargonium hortorum and Mesembryanthemum criniflorum accumulated >1000 mg Pb kg-1 shoot

dry biomass at different soil Pb concentrations. These two plants could be regarded as

hyperaccumulators of Pb considering TF, EF and CF index and the amount of biomass produced

by each plant. Pelargonium hortorum and Mesembryanthemum criniflorum were further

investigated for root induce rhizosphere modification for possible influence on bioavailable

fraction of Pb in soil. Both plants had the ability to induce rhizosphere changes for three weeks

culture in cropping device setup. Results indicated great ability of Pelargonium hortorum to

acidify rhizosphere soil and increasing DOC content that induces Pb mobility in soil. Pelargonium

hortorum acidified the soil by -0.1 pH units in CaCl2 extracted soil solutions at 2000 mg kg-1 soil

Pb concentration. Pelargonium hortorum increased Pb mobility 1-2 –folds more compared to

Mesembryanthemum and control soil. DOC was also 1.4 to 1.7 times more in soil cultured with

Pelargonium (121±11 mg L-1) compared to Mesembryanthemum at 500-1000 mg Pb kg-1 soil. For

further development of technology following perspectives should be considered.

In the next step the plants were then further investigated in plant-microbial association studies for

phytoremediation potential. Fungal interactions revealed the ability of A. flavus, and Mucor spp.

to increased bioavailable fraction of Pb by 1.6 and 1.8–folds compared to the control (no fungi).

A. flavus and Mucor spp. also lowered the soil pH by -0.14 and -0.13 units in spiked soil (2000 mg

Pb kg-1). A. flavus and Mucor spp. also showed significant production of siderophores (61±1 %)

and IAA (203±5.8 μg mL-1). Highest significant Pb uptake were obtained in Pelargonium

hortorum inoculated by Mucor spp. (2.21 mg per plant) and A. flavus (1.85 mg per plant).

156

Rhizospheric bacteria Pseudomonas spp. and multiple heavy metal accumulator plant (Pteris

vittata) were studied for Pb accumulation and plant growth enhancement in Pb contaminated

medium under sterile conditions. The results showed decreased in Pb uptake while improving plant

growth in both inoculated and un-inoculated Pteris vittata and Pelargonium hortorum.

Amplification of metal resistant gene fragments (pbrA, cadA2 and czcR) from Pseudomonas spp.

genomic DNA suggested that metal efflux may play a role in Pb resistance and detoxification in

bacteria. Indigenous bacterial were isolated from Pb contaminated soil collected from industrial

zone of Islamabad and Rawalpindi. Of these strains Klebsiella quasipneumoniae. (NCCP-1862),

Klebsiella variicola (NCCP-1857), Pseudomonas beteli (NCCP-1845), Microbacterium

paraoxydans (NCCP-1848) and Bacillus tequilensis (NCCP-1860) showed Pb tolerance (up to 800

mg L-1) and solubilization and PGPR activity. Significantly high IAA (92.26 μg mL-1) and ACC

deaminase activity (260.5 nmol alphaketobutyrate mg-1 h-1) was observed in Microbacterium

paraoxydans. Microbacterium paraoxydans treated Pelargonium had highest significantly high Pb

uptake (2.4 –fold) followed by Klebsiella quasipneumoniae (1.8 –fold) and Klebsiella variicola

(1.2 –fold). The increase uptake was directly related to increased Pb solubilization and

accumulation in root/shoot and indirectly by stimulating plant growth and biomass though PGPR

activity.

Finally, a novel integrated plant-microbial system was developed through series of experiments

by co-inoculating bacteria and fungi. The results indicated the strong inhibitory effects of Pb on

enzymatic activities, microbial biomass and basal respiration. This inhibitory effect of Pb have

previously been reported in many studies (Hu et al., 2014; Chen et al., 2013; Khan et al., 2007)

but not adequately addressed. Significantly restoration of soil enzymatic activities were achieved

in Pb contaminated soil by the application of bio-inoculants particularly when bacteria and fungi

157

were co-inoculated. Synergistic effect of A. flavus and M. paraoxydans was noticed for Pb

solubilization and accumulation, whereas biomass was significantly improved with Mucor spp.

and M. paraoxydans co-inoculation. Co-inoculation of bacteria and fungi significantly improve

soil enzymatic activities and Pb phytoextraction potential of Pelargonium hortorum compared to

single inoculations. Plant-microbe interaction served as promising technique for safe remediation

of Pb polluted soil, some of the perspective that would further increase the understanding and

development of technology are described bellow:

6.3. FUTURE PERSPECTIVES

6.3.1. Interactive Effect of Multiple Metals and Nutrients in Real Field Soil

These experiments were conducted using spiked soil, which gave an insight about potential of

ornamental plants and associated microbial associations to accumulate substantial amount of Pb

in above ground tissues. However, phytoremediation potential of these plants in real/field

contaminated soil should be evaluated before field application. The changes at root soil interface

due to the presence of several nutrients in soil like calcium (Ca), Iron (Fe), magnesium (Mg),

phosphorus (P) and zinc (Zn) may interfere Pb phytoavailability and compete for uptake also need

to be investigated for understanding and further development of this technique (figure 6.1). The

optimized biological system developed should also be studied for other heavy metals and mixed

heavy metal contaminated soil. Heavy metals may compete and reduce Pb uptake by plant.

Therefore, there is prior need of investigating the interactive effect of different nutrients and

heavymetals upon Pb uptake before field application. Natural chelating compounds (root exudates)

may also be studied for assisting phytoremediation of Pb.

158

Figure 6. 1: Interactive effect of nutrients and heavymetals on Phytoextraction of Pb.

6.3.2. Chelators and Phytohormones along with Plant Microbial Interaction

There is also great room for investigating the effect of naturally used organic and inorganic soil

amendments (Gul et al., 2019) and organic acids along wo=ith bioinoculants for improving overall

efficiency of phytoremediation system (figure 6.2). It is reported that citric acid is a major

component of root exudates and plays significant role in Pb dissolution and subsequent uptake by

plant (Gul et al., 2019; Shahid et al., 2012b). Gul et al. (2019) working with five different soil

amendments including citric acid, TiO2 NPs and ammonium nitrate, compost and EDTA found

that citric acid (10 mM) significantly improved Cd uptake (1.44 g per plant) by Pelargonoum

hortorum with a metal extraction ratio of 4.4% and can be used as a substitute of EDTA.

Many bacteria and fungi have been reported to reduce oxidative stress in plants upon exposure to

Pb through metabolic expressions (Waqas et al., 2012). Auxins and ACC deaminase plays

important role in plant growth and directly response to a biotic environmental stress including

ZnAs

CdCrPb

(As, Cd, Zn, Cr )

Pb

(Ca, P, Mg )

Ca

P

Nutrients

Ca, P, Mg

Metals

As, Cd,

Zn, Cr

Pb

159

heavy metal toxicity (Waqas et al., 2012). Similarly, there is need to study the possible interaction

of microrganisms and plant metabolic responses during phytoremediation process.

Phytoextraction of Pb by plants and microbial associations is a slower system compared to chelate

assisted phytoextraction of Pb. Higher Pb phytoextraction is achieved when soil is amended with

organic and/or inorganic soil amendments (Gul et al., 2019, Zhang et al., 2016, Shahid et al., 2014).

Integration of plant-microbe system with suitable soil amendments would further improve the

phytoremediation efficiency and reduce the time required for large scale phytoremediation of Pb

contaminated site. In this regard natural phyto-hormones and organic acids such as citric acid,

tartaric acid, malic acid, and oxalic acids (Chandran et al., 2014; Xiao et al., 2009; Wang & Chen,

2009) should also be studied in combination with plant-microbe system optimized in this study.

Figure 6. 2: Integrated application of plant-bacteria-chelates for phytoextraction of Pb.

6.3.3. Proteomics and Metabolomics and Gene Expression

Pbr efflux system is the major Pb detoxification mechanism in bacteria, which play significant

role in phosphate induced Pb immobilization in bacterial periplasm thereby, favors Pb stabilization

Pb accumulation

ΔpH

ΔDOC

Pb - OA binding

Plant metabolite

Citric, Malic,

Oxalic

Bacterial

metabolite

Growth regulators

Chelators (organic

and inorganic)

fertilizers

Improved phytoextraction

160

instead of Pb phytoextraction (Hynninen et al., 2009; Monchy et al., 2007). This indicates that

bioinoculants may greatly influence Pb speciation and phytoextraction. There is need to investigate

Pb regulating genes in bacteria and fungi that would further enhance the phytoavailability of Pb

for plant uptake while reducing the oxidative damage in plant tissue. Advance techniques should

be employed for exploring the pathway of metabolites produced in plant when exposed to lead and

microbial associations. Detailed and quantitative analysis of bioactive compound should further

be explored. These studied would lead to the identification of the protein and metabolic responses

that is responsible for Pb hyperaccumulation. However, there are studies wherein, exogenous

application of phytohormones and natural chelators improved the overall Pb phytoavailability and

extraction while improving plant biomass and reducing Pb leaching (Gul et al., 2019). Integration

of such natural compounds with the plant microbe system (optimized in this study) may further be

studied.

Figure 6. 3: Proteomic and metabolomics basis for Pb uptake and detoxification mechanism in

plant.

-Pb +Pb

↑ ↓ genes

expression

compared to

control

Metabolic

expressions/

plant/microbial

exudates

Enzymes Phytohormones

Metal detoxification

Physiological response

Oxidative response

MetabolomicsProteomic

161

REFERENCES

Abbasi M.N, Tufail M & Chaudhry M.M. (2013). Assessment of heavy elements in suspended

dust along the Murree Highway near Capital City of Pakistan. World App Sc J., 21(9): 1266-

1275.

AFNOR. (1994). Recueil de normes françaises. Qualité des sols, détermination du pH. AFNOR,

Paris, 63pp.

Afzal Z, Hamid A & Ahmad M. (2014). Workplace and ambient air monitoring of lead and other

emissions at lead acid battery recycling units and survey of health impacts on workers. J Bio

Env Sc., 5: 279-286.

Ahmad J.U & Goni M.A. (2010). Heavy metal contamination in water, soil and vegetables of the

industrial areas in Dhaka, Bangladesh. Environ Monit Assess., 166: 347-357.

Ahmad M, Hashimoto Y, Moon D.H, Lee S.S & Ok Y.S. (2012). Immobilization of lead in a

Korean military shooting range soil using eggshell waste: an integrated mechanistic approach.

J Hazard Mater., 209–210:392–401

Ahmed I, Kudo T, Abbas S, Ehsan M, Iino T, Fujiwara T & Ohkuma M. (2014). Cellulomonas

pakistanensis sp. nov., a moderately halotolerant Actinobacteria. Int J Syst Evol Microbiol.,

64(7): 2305-2311.

Ahmed M. (2014). Phosphate-solubilizing bacteria-assisted phytoremediation of metalliferous

soils: a review. 3 Biotech 5: 111–121. doi :10.1007/s13205-014-0206-0

Akhtar S & Iram S. (2016). Enhanced phytoremediation of heavy metal polluted soil with native

crops of Punjab, Pakistan. J Bio Env Sci., 8(4): 158-171.

Alamri S.A, Siddiqui M.H, Al-Khaishany M.Y, Nasir K.M, Ali H.M, Alaraidh I.A, Alsahli A.A,

Al-Rabiah H & Mateen M. (2018). Ascorbic acid improves the tolerance of wheat plants to

lead toxicity. J Plant Interact., 13(1): 409-419.

Al-Askar A.A. (2016). Bioactive compounds produced by Trichoderma harzianum 1-SSR for

controlling Fusarium verticillioides (Sacc.) Nirenberg and growth promotion of Sorghum

vulgare. Egypt J Biol Pest Co., 26(2): 379-386.

Alef K & Nannipieri P. (1995). Methods in applied soil microbiology and biochemistry. Academic.

Press, San Diego, USA.

Ali H, Khan E & Sajad M.A. (2013). Phytoremediation of heavy metals concepts and applications,

Chemosphere., 91(7): 869–881.

162

Ali S.M & Malik R.N. (2011). Spatial distribution of metals in top soils of Islamabad City,

Pakistan. Environ Monit Assess., 172(1-4): 1-16.

Anawar H.M, Garcia-Sanchez A, Kul Alam M.T & Rahman M.M. (2008). Phytofiltration of water

polluted with arsenic and heavy metals. Int J Environ Pollut., 33(2-3): 292-312.

Anjum N.A, Sofo A, Scopa A, Roychoudhury A, Gill S.S, Iqbal M, Lukatkin A.S, Pereira E,

Duarte A.C & Ahmad I. (2015). Lipids and proteins - Major targets of oxidative modifications

in abiotic stressed plants. Env Sci Pollut Res., 22: 4099–4121.

Ano A.O, Ubochi C.I & Nwokocha C.C. (2012). Effect of heavy metals (Cd, Ni and Pb) on soil

productivity: Organic carbon mineralization. Int J Phys Sci., 7(4): 573-577.

Arias M.S.B, Peña-Cabriales J.J, Alarcón A & Maldonado Vega M. (2015). Enhanced Pb

absorption by Hordeum vulgare L. and Helianthus annuus L. plants inoculated with an

arbuscular mycorrhizal fungi consortium. Int J Phytoremediat., 17(5): 405-413.

Arshad M, Merlina G, Uzu G, Sobanska S, Sarret G, Dumat C, Silvestre J, Pinelli E & Kallerhoff

J. (2016). Phytoavailability of lead altered by two Pelargonium cultivars grown on contrasting

lead-spiked soils, Soil Sediment Contam., 16(2): 581-591.

Arshad M, Silvestre J, Pinelli E, Kallerhoff J, Kaemmerer M, Tarigo A, Shahid, M, Guiresse M,

Pradère P & Dumat C. (2008). A field study of lead phytoextraction by various scented

Pelargonium cultivars. Chemosphere. 71(11): 2187-2192.

Ashraf U, Kanu A.S, Deng Q, Mo Z, Pan S, Tian H & Tang X. (2017). Lead (Pb) toxicity; physio-

biochemical mechanisms, grain yield, quality, and Pb distribution proportions in scented rice.

Front Plant Sci., 8: 259.

Aslam F, Yasmin A & Thomas T. (2016). Genome Sequence of Klebsiella quasipneumoniae

subsp. similipneumoniae MB373, an effective bioremediator. Genome Announce., 4: 1068-16.

ATSDR. (2007). Priority List of Hazardous Substances. Agency for Toxic Substances and

Diseases Registry. Available at:http://www.atsdr.cdc.gov/(accessed 10 Jan 2018).

ATSDR. (2018). Lead Toxicity. What Are U.S. Standards for Lead Levels? Available at:

https://www.atsdr.cdc.gov/csem/csem.asp?csem=34&po=8/(accessed 16 Jan 2018

Aziz N, Pandey R, Barman I & Prasad R. (2016). Leveraging the attributes of Mucor hiemalis-

derived silver nanoparticles for a synergistic broad-spectrum antimicrobial platform. Front

Microbiol., 7: 1984.

https://www.atsdr.cdc.gov/csem/csem.asp?csem=34&po

163

Aziz O.A, Helal G.A, Galal Y.G.M & Rofaida A.K.S. (2016). Fungal siderophores production in

vitro as affected by some abiotic factors. Int. J. Curr. Microbiol. App. Sci., 5(6): 210-222.

Bai S.R & Abraham E. (2003). Studies on chromium (VI) adsorption-desorption using

immobilized fungal biomass. Bioresource Technol., 87: 17-26.

Baker A.J. (1981). Accumulators and excluders‐strategies in the response of plants to heavy

metals. J Plant Nutr., 3(1-4): 643-654.

Baker A.J.M & Brooks R. (1989). Terrestrial higher plants which hyperaccumulate metallic

elements. A review of their distribution, ecology and phytochemistry. Biorecovery., 1(2): 81-

126.

Bal H.B, Das S, Dangar T.K & Adhya T.K. (2013). ACC deaminase and IAA producing growth

promoting bacteria from the rhizosphere soil of tropical rice plants. J Basic Microb., 53(12):

972-984.

Baldrian P & Gabriel J (2002). Intraspecific variability in growth response to cadmium of the

wood-rotting fungus Piptoporus betulinus. Mycologia., 94: 428-436.

Bandara T, Herath I, Kumarathilaka P, Seneviratne M, Seneviratne G, Rajakaruna N... & Ok Y. S.

(2017). Role of woody biochar and fungal-bacterial co-inoculation on enzyme activity and

metal immobilization in serpentine soil. J Soil Sediment., 17(3): 665-673.

Bashmakov D.I, Kluchagina A.N, Malec P, Strzałka K & Lukatkin A.S. (2017). Lead

accumulation and distribution in maize seedlings: relevance to biomass production and metal

phytoextraction. Int. J. Phytoremediation., 19(11): 1059-1064.

Bech J, Roca N, Tume P, Ramos-Miras J, Gil C & Boluda R. (2016). Screening for new

accumulator plants in potential hazards elements polluted soil surrounding Peruvian mine

tailings. Catena., 136: 66-73.

Belimov A.A, Hontzeas N, Safronova V.I, Demchinskaya S.V, Piluzza G, Bullitta S & Glick B.R.

(2005). Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian

mustard (Brassica juncea L. Czern.). Soil Biol Biochem., 37(2): 241-250.

Botero R.K & Joshi S.R. (2009). Promotion of seed germination of green gram and chick pea by

Penicillium verruculosum RS7PF, a root endophytic fungus of Potentilla fulgens L. J Adv

Biotechnol., 8(7): 16–18.

Bhargava A, Carmona F.F, Bhargava M & Srivastava S. (2012). Approaches for enhanced

phytoextraction of heavy metals. J Environ. Manage., 105: 103–120.

164

Bilkay I.S, Karakoç S & Aksöz N. (2010). Indole-3-acetic acid and gibberellic acid production in

Aspergillus niger. Turk J Biol., 34: 313-318.

Blaylock M.J, Salt D.E, Dushenkov S, Zakharova O, Gussman C, Kapulnik Y... & Raskin I.

(1997). Enhanced accumulation of Pb in Indian mustard by soil-applied chelating agents. Env

Sci Technol., 31(3): 860-865.

Botero W.G, Oliveira L.C.D, Rocha J.C, Rosa A.H & dos Santos A. (2010). Peat humic substances

enriched with nutrients for agricultural applications: Competition between nutrients and non-

essential metals present in tropical soils. J Hazard Mater., 177: 307–311.

Braud A, Jézéquel K, Bazot S & Lebeau T. (2009). Enhanced phytoextraction of an agricultural

Cr-and Pb-contaminated soil by bioaugmentation with siderophore-producing bacteria.

Chemosphere., 74(2): 280-286.

Carson K.C, Holliday S, Glenn A.R & Dilworth M.J. (1992). Siderophore and organic acid

production in root nodule bacteria. Arch Microbiol., 157(3): 264-271.

Chandran C.S, Shijith K.V, Vipin K.V & Augusthy A.R. (2014). Study on heavy metals toxicity

biomarkers in Aspergillus niger. IJAPBC., 3(2):458-464.

Chen J, He F, Zhang X, Sun X, Zheng J & Zheng J. (2014). Heavy metal pollution decreases

microbial abundance, diversity and activity within particle-size fractions of a paddy soil. FEMS

Microbiol Ecol., 87(1): 164-181.

Chen J, Liu X, Zheng J, Zhang B, Lu H, Chi Z, Pan G, Li L, Zheng J, Zhang X, Wang J, Yu X.

(2013). Biochar soil amendment increased bacterial but decreased fungal gene abundance with

shifts in community structure in a slightly acid rice paddy from Southwest China. Appl Soil

Ecol.,71: 33–44

Clesscerl L.S, Greenberg A.E & Eaton A.D. (1998). Standard Methods for the Examination of

Water and Wastewater, 20th Ed, APHA-AWWA-WEF, Washington, DC.

Cui H, Zhou J, Zhao Q, Si Y, Mao J, Fang G & Liang J. (2013). Fractions of Cu, Cd, and enzyme

activities in a contaminated soil as affected by applications of micro- and nanohydroxyapatite.

J Soils Sediments., 13: 742–752

Cui S, Zhang T, Zhao S, Li P, Zhou Q, Zhang Q & Han Q. (2013). Evaluation of three ornamental

plants for phytoremediation of Pb-contamined soil. Int J Phytoremediat., 15(4): 299-306.

Dan T.V. (2001). Phytoremediation of metal contaminated soils: metal tolerance and metal

accumulation in Pelargonium sp. PhD Dissertation, University of Guelph, Canada.

165

Dary M, Chamber-Pérez M.A, Palomares A.J & Pajuelo E. (2010). “In situ” phytostabilisation of

heavy metal polluted soils using Lupinus luteus inoculated with metal resistant plant-growth

promoting rhizobacteria. J Hazard Mater., 177(1-3): 323-330.

Das S, de Oliveira L.M, da Silva E & Ma L.Q. (2017). Arsenate and fluoride enhanced each other’s

uptake in As-sensitive plant Pteris ensiformis. Chemosphere., 180: 448-454.

Davison J. (2005). Risk mitigation of genetically modified bacteria and plants designed for

bioremediation. J Ind Microbiol Biotechnol., 32: 639–650.

Deng H, Ye Z.H & Wong M.H. (2004). Accumulation of lead, zinc, copper and cadmium by 12

wetland plant species thriving in metal-contaminated sites in China. Environ Pollut., 132(1):

29-40.

Deng Z, Cao L, Huang H, Jiang X, Wang W, Shi Y & Zhang R. (2011). Characterization of Cd-

and Pb-resistant fungal endophyte Mucor sp. CBRF59 isolated from rapes (Brassica chinensis)

in a metal-contaminated soil. J Hazard Mater., 185(3): 717-724.

Dick W.A, Chenga L & Wang P. (2000). Soil acid and alkaline phosphatase activity as pH

adjustment indicators. Soil Biol Biochem., 32: 1915-1919.

Du R.J, He E.K, Tang Y.T, Hu P.J, Ying R.R, Morel J.L & Qiu R.L. (2011). How phytohormone

IAA and chelator EDTA affect lead uptake by Zn/Cd hyperaccumulator Picris divaricata. Int

J Phytorem., 13(10): 1024-1036.

Ehsan M, Ahmed I, Hayat R, Iqbal M, Bibi N & Khalid N. (2016). Molecular Identification and

Characterization of Phosphate Solubilizing Pseudomonas sp. Isolated from Rhizosphere of

Mash Bean (Vigna Mungo L.) for Growth Promotion in Wheat. J Agric Sci Technol., 18(3):

775-788.

Epelde L, Hernández-Allica J, Becerril J.M, Blanco F & Garbisu C. (2008). Effects of chelates on

plants and soil microbial community: comparison of EDTA and EDDS for lead

phytoextraction. Sci Total Environ., 401(1-3): 21-28.

Epelde L, Lanzen A, Blanco F, Urich T & Garbisu C. (2015). Adaptation of soil microbial

community structure and function to chronic metal contamination at an abandoned Pb-Zn

mine. FEMS Microbiol Ecol., 91(1): 1-11.

Etcheverry M.G, Scandolara A, Nesci A, Ribeiro M.S.V.B, Pereira P & Battilani P. (2009).

Biological interactions to select biocontrol agents against toxigenic strains of Aspergillus

flavus and Fusarium verticillioides from maize. Mycopathologia., 167(5): 287-295.

166

Evangelou M.W.H, Ebel M & Schaeffer A. (2007). Chelate assisted phytoextraction of heavy

metals from soil. Effect, mechanism, toxicity, and fate of chelating agents. Chemosphere.,

68(6): 989-1003.

Farina R, Beneduzi A, Ambrosini A, de Campos S.B, Lisboa B.B, Wendisch V, Vargas L.K &

Passaglia L.M. (2012). Diversity of plant growth-promoting rhizobacteria communities

associated with the stages of canola growth. Appl Soil Ecol., 55: 44-52.

Fasani E, Manara A, Martini F, Furini A & DalCorso G. (2017). The potential of genetic

engineering of plants for the remediation of soils contaminated with heavy metals. Plant Cell

Environ., http://dx.doi.org/10.1111/pce.12963.

Fu JW, Liu X, Han YH, Mei H, Cao Y, De Oliveira LM, Liu Y, Rathinasabapathi B, Chen Y &

Ma LQ. (2017). Arsenic-hyperaccumulator Pteris vittata efficiently solubilized phosphate rock

to sustain plant growth and As uptake. J Hazard Mater., 15; 330:68-75.

Gao G, Zeng X, Li Z, Chen A & Yang Z. (2017). Variations in several morphological

characteristics and Cd/Pb accumulation capacities among different ecotypes of torpedograss

responding to Cd-Pb stresses. Int J Phytorem.,19(9): 844–861.

Ghosh P, Rathinasabapathi B & Ma L.Q. (2015a). Phosphorus solubilization and plant growth

enhancement by arsenic-resistant bacteria. Chemosphere., 134: 1-6.

Ghosh P, Rathinasabapathi B, Teplitski M & Ma L.Q. (2015b). Bacterial ability in AsIII oxidation

and AsV reduction: relation to arsenic tolerance, P uptake, and siderophore production.

Chemosphere., 138: 995-1000.

Ghosh S, Penterman J.N, Little R.D, Chavez R & Glick B.R. (2003). Three newly isolated plant

growth-promoting bacilli facilitate the seedling growth of canola, Brassica campestris. Plant

Physiol Bioch., 41(3): 277-281.

Glick B.R, Patten C.L, Holguin G & Penrose D.M. (1999). Biochemical and genetic mechanisms

used by plant growth-promoting bacteria. J Theor Biol., 190: 63–68.

Greipsson S, Tay C, Whatley A & Deocampo D.M. (2013). Sharp decline in lead contamination

in topsoil away from a smelter and lead migration in ultisol. World Environment, 3(3): 102-

107.

Guerinot M.L & Meidl EJ Plessner O. (1990). Citrate as a siderophores in Bradyrhizobium

japonicum. J Bacteriol., 172: 3298-3303.

http://dx.doi.org/10.1111/pce.12963

167

Gul I, Manzoor M, Silvestre J, Rizwan M, Hina K, Kallerhoff J & Arshad M. (2019).

EDTA−assisted phytoextraction of lead and cadmium by Pelargonium cultivars grown on

spiked soil. Int J Phytorem., DOI: 10.1080/15226514.2018.1474441.

Hadi F, Bano A & Fuller M.P. (2010). The improved phytoextraction of lead (Pb) and the growth

of maize (Zea mays L.): the role of plant growth regulators (GA3 and IAA) and EDTA alone

and in combinations. Chemosphere., 80(4): 457-462.

Han Y.H, Fu J.W, Chen Y, Rathinasabapathi B & Ma L.Q. (2016). Arsenic uptake, arsenite efflux

and plant growth in hyperaccumulator Pteris vittata: Role of arsenic-resistant bacteria.

Chemosphere., 144: 1937-1942.

Hartley N.R, Tsang D.C, Olds W.E & Weber P.A. (2014). Soil washing enhanced by humic

substances and biodegradable chelating agents. Soil Sediment Contam., 23(6): 599-613.

Hayat R, Sheirdil R.A, Iftikhar-ul-Hassan M & Ahmed I. (2013). Characterization and

identification of compost bacteria based on 16S rRNA gene sequencing. Ann Microbiol., 63(3):

905-912.

He L.Y, Chen Z.J, Ren G.D, Zhang Y.F, Qian M & Sheng X.F. (2009) Increased cadmium and

lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria. Ecotox

Environ Safe., 72(5): 1343-1348.

Holbrook A.A, Edge W.J & Baily F. (1961). Advances in Chemical Series. 28: 159-167.

Holt J.G, Kreig N.R, Sneath P.H.A & Staley J.T. (1994). Bergey’s Manual of Determinative

Bacteriology, 9th edn., Williams and Wilkins, Baltimore, USA.

Hontzeas N, Zoidakis J, Glick B.R & Abu-Omar M.M. (2004). Expression and characterization of

1-aminocyclopropane-1-carboxylate deaminase from the rhizobacterium Pseudomonas putida

UW4: a key enzyme in bacterial plant growth promotion. BBA – Proteins and Proteomics.,

1703(1): 11-19.

Hossain M.A, Piyatida P, da Silva J.A.T & Fujita M. (2012). Molecular mechanism of heavy metal

toxicity and tolerance in plants: central role of glutathione in detoxification of reactive oxygen

species and methyl glyoxal and in heavy metal chelation. J Bot., 2012: 21-37.

Hossain M.M, Sultana F, Kubota M, Koyama H & Hyakumachi M. (2007). The plant growth-

promoting fungus Penicillium simplicissimum GP17-2 induces resistance in Arabidopsis

thaliana by activation of multiple defense signals. Plant Cell Physiol., 48(12): 1724-736.

168

Hu X.F, Jiang Y, Shu Y, Hu X, Liu L & Luo F. (2014). Effects of mining wastewater discharges

on heavy metal pollution and soil enzyme activity of the paddy fields. J Geochem Explor., 147:

139–150

Hussain A, Abbas N, Arshad F, Akram M, Khan Z.I, Ahmad K, Mansha M & Mirzaei F. (2013).

Effects of diverse doses of Lead (Pb) on different growth attributes of Zea-Mays L. Agri Sci.,

4(5): 262.

Hynninen A, Touzé T, Pitkänen L, Mengin‐Lecreulx D & Virta M. (2009). An efflux transporter

PbrA and a phosphatase PbrB cooperate in a lead‐resistance mechanism in bacteria. Mol

Microbiol., 74(2): 384-394.

IARC. (2006). IARC Monographs on the Evaluation of Carcinogenic Risks to Human, Inorganic

and Organic Lead Compounds, International Agency for Research on Cancer (IARC), 87: 1-

519.

Iqbal M, Ahmad A, Ansari M.K.A, Qureshi M.I, Aref I.M, Khan P.R, Hegazy S.S, El-Atta H,

Husen A & Hakeem K.R. (2015). Improving the phytoextraction capacity of plants to scavenge

metal(loid)-contaminated sites. Environ Rev., 23: 44-65.

Iram S, Parveen K, Usman J, Nasir K, Akhtar N, Arouj S & Ahmad I. (2012). Heavy metal

tolerance of filamentous fungal strains isolated from soil irrigated with industrial wastewater.

Biologija., 58(3). https://doi.org/10.6001/biologija.v58i3.2527

Iram S, Zaman A, Iqbal Z & Shabbir R. (2013). Heavy metal tolerance of fungus isolated from

soil contaminated with sewage and industrial wastewater. Pol J Env Stud., 22(3): 691-697.

Iskandar N.L, Zainudin N.A & Tan S.G. (2011). Tolerance and biosorption of copper (Cu) and

lead (Pb) by filamentous fungi isolated from a freshwater ecosystem. J Environ Sci., 23(5):

824-30.

Islam M.S, Kashem M.A & Osman K.T. (2016). Phytoextraction efficiency of lead by arum

(Colocasia esculenta L.) grown in hydroponics. Open J Soil Sci., 6(07), 113.

Jackson V.A, Pulse A.N, Odendaal J.P, Khan S & Khan W. (2012). Identification of metal-tolerant

organisms isolated from the Plankenburg River, Western Cape, South Africa. Water SA, 38(1):

29-38.

Jaiswal D & Pandey J. (2018). Impact of heavy metal on activity of some microbial enzymes in

the riverbed sediments: Ecotoxicological implications in the Ganga River (India). Ecotoxicol

Env Safe., 150: 104-115.

https://doi.org/10.6001/biologija.v58i3.2527

169

Jarosławiecka A & Piotrowska-Seget Z. (2014). Lead resistance in micro-organisms.

Microbiology, 160(1): 12-25.

Jeffrey M & Achurch H. (2017). Save our Soil to Save the Planet. In: Global Soil Security

Springer, Cham. pp 389-395.

Jena V, Gupta S, Dhundhel R.S, Matić N, Frančišković-Bilinski S & Dević N. (2013).

Determination of total heavy metal by sequential extraction from soil. Int J Environ Sci

Technol., 3(1): 35.

Jin-Yan Y.A.N.G, Zhen-Li, H.E, Yang X.E & Ting-Qiang L.I. 2014. Effect of lead on soil enzyme

activities in two red soils. Pedosphere., 24: 817-826.

Joynt J, Bischoff M, Turco R, Konopka A & Nakatsu C.H. (2006). Microbial community analysis

of soils contaminated with lead, chromium and petroleum hydrocarbons. Microbial

Ecol., 51(2): 209-219.

Kakar S.U.R, Tareen R.B & Wahid A. (2011). Impact of municipal wastewaters of Quetta city on

some oilseed crops of Pakistan: Effects on biomass, physiology and yield of sunflower

(Helianthus annuus L.). Pak J Bot., 43(3): 1477-1484.

Kandeler E, Tscherko D & Bruce K.D. (2000). Structure and function of the soil microbial

community in microhabitats of a heavy metal polluted soil. J Biol Fert Soils., 32: 390-400.

Katsalirou E, Deng S. Nofziger D.L. Gerakis A & Fuhlendorf S.D. (2010). Spatial structure of

microbial biomass and activity in prairie soil ecosystems. Eu J Soil Biol., 46:181-189.

Kaur G, Kaur J, Dadhich S & Cameotra S.S. (2011). Phosphate solubilizing bacteria

Microbacterium paraoxydans isolated from the rhizospheric system of wheat (Triticum

aestivum). Transylv Rev Syst Ecol Res., 1(12): 149.

Kaur G, Singh H.P, Batish D.R, Mahajan P, Kohli R.K & Rishi V. (2015). Exogenous nitric oxide

(NO) interferes with lead (Pb)-induced toxicity by detoxifying reactive oxygen species in

hydroponically grown wheat (Triticum aestivum) roots. PLoS One., 10(9): e0138713.

Kaurin A, Cernilogar Z & Lestan D. (2018). Revitalisation of metal-contaminated, EDTA-washed

soil by addition of unpolluted soil, compost and biochar: Effects on soil enzyme activity,

microbial community composition and abundance. Chemosphere., 193: 726-736.

Kavamura V.N & Esposito E. (2010). Biotechnological strategies applied to the decontamination

of soils polluted with heavy metals. Biotechnol Adv., 28(1): 61-69.

Kessler R. (2013). Sunset for leaded aviation gasoline? Environ. Health Perspect. 121(2): a54.

170

Kim A.Y, Shahzad R, Kang S.M, Seo C.W, Park Y.G, Park H.J & Lee I.J. (2017). IAA-producing

Klebsiella variicola AY13 reprograms soybean growth during flooding stress. J Crop Sci

Biotechnol., 20(4): 235-242.

Knight B.P, McGrath S.P & Chaudri A.M. (1997). Biomass carbon measurements and substrate

utilization patterns of microbial populations from soils amended with cadmium, copper, or

zinc. Appl Environ Microb., 63(1): 39-43.

Kohler C, Merkle T & Neuhaus G. (1999). Characterisation of a novel gene family of putative

cyclic nucleotide- and calmodulin-regulated ion channels in Arabidopsis thaliana. Plant J.,

18(1): 97-104

Kotrba P, Najmanovaa J, Maceka T, Rumla T & Mackovaa M. (2009). Genetically modified plants

in phytoremediation of heavy metal and metalloid soil and sediment pollution. Biotechnol Adv.,

2: 799-810.

Kumar K.V, Srivastava S, Singh N & Behl H.M. (2009). Role of metal resistant plant growth

promoting bacteria in ameliorating fly ash to the growth of Brassica juncea. J Hazard Mater.,

170(1): 51-57.

Kushwaha A, Hans N, Kumar S & Rani R. (2018). A critical review on speciation, mobilization

and toxicity of lead in soil-microbe-plant system and bioremediation strategies. Ecotox

Environ Safe., 147: 1035-1045.

Lasat M.M. (2002). Phytoextraction of toxic metals. J Environ Qual., 31(1): 109-120.

Lee S.W, Glickmann E & Cooksey D.A. (2001). Chromosomal locus for cadmium resistance in

Pseudomonas putida consisting of a cadmium-transporting ATPase and a MerR family

response regulator. Appl Environ Microbiol., 67(4): 1437-1444.

Leedjärv A, Ivask A & Virta M. (2008). Interplay of different transporters in the mediation of

divalent heavy metal resistance in Pseudomonas putida KT2440. J Bacteriol., 190(8): 2680-

2689.

Leilei Z, Mingxin H & Suiyi Z. (2012). Enzymatic remediation of the polluted crude oil by

Rhodococcus. Afr J Microbiol Res., 6(6): 1213-1220.

Lin J.H, Lee D.J & Chang J.S. (2015). Lutein production from biomass: marigold flowers versus

microalgae. Bioresour Technol., 184: 421-428.

171

Liu D, Li T, Yang X, Islam E, Jin X & Mahmood Q. (2007). Enhancement of lead uptake by

hyperaccumulator plant species Sedum alfredii Hance using EDTA and IAA. Bull Environ

Contam Toxicol., 78(3-4): 280-283.

Liu J.N, Zhou Q.X, Sun T, Ma L.Q & Wang S. (2008). Growth responses of three ornamental

plants to Cd and Cd–Pb stress and their metal accumulation characteristics. J Hazard Mater.,

151 (1): 261-267.

Lock H. (1948). Production of hydrocyanic acid by bacteria. Physiol Plant., 1: 142-146.

López M.L, Peralta-Videa J.R, Benitez T & Gardea-Torresdey J.L. (2005). Enhancement of lead

uptake by alfalfa (Medicago sativa) using EDTA and a plant growth promoter. Chemosphere.,

61(4): 595-598.

López-Ortega M.D.P, Criollo-Campos P.J, Gómez-Vargas R.M, Camelo-Rusinque M, Estrada-

Bonilla G, Garrido-Rubiano M.F & Bonilla-Buitrago R. (2013). Characterization of

diazotrophic phosphate solubilizing bacteria as growth promoters of maize plants. Rev Colomb

Biotecnol., 15(2): 115-123.

Loria C.C.R, Peralta-Perez M.D.R, Buendia-Gonzalez L & Volke-SepulvedaT.L. (2015). Effect

of a saprophytic fungus on the growth and the lead uptake, translocation and immobilization

in Dodonaea viscosa. Int J Phytoremediat., 14: 518-529.

Lu Y, Luo D, Lai A, Liu G, Liu L, Long J.. & Chen Y. (2017). Leaching characteristics of EDTA-

enhanced phytoextraction of Cd and Pb by Zea mays L. in different particle-size fractions of

soil aggregates exposed to artificial rain. Environ Sci Pollut R, 24(2): 1845-1853.

Ma L.Q, Komar K.M, Tu C, Zhang W, Cai Y & Kennelley E.D. (2001). A fern that

hyperaccumulates arsenic. Nature., 409(6820) : 579-579.

Maestri E, Marmiroli M, Visioli G & Marmiroli N. (2010). Metal tolerance and

hyperaccumulation: costs and trade-offs between traits and environment. Environ Exp Bot., 68

(1): 1-13.

Malar S, Vikram S.S, Favas P.J & Perumal V. (2016). Lead heavy metal toxicity induced changes

on growth and antioxidative enzymes level in water hyacinths [Eichhornia crassipes (Mart.)].

Bot Studies., 55(1): 54.

Malik D.M, Khan M.A & Choudhry T.A. (1984). Analysis Manual of Soil, water and Plant. In:

Directorate of Soil Fertility and Soil Testing, Lahore, Pakistan.

172

Malik R.N, Husain S.Z & Nazir I. (2010). Heavy metal contamination and accumulation in soil

and wild plant species from industrial area of Islamabad, Pakistan. Pak J Bot., 42(1): 291-301.

Manshadi M, Ziarati P, Ahmadi M & Fekri K. (2013). Greenhouse study of cadmium and lead

phytoextraction by five Pelargonium spices. Intl J Farm & Alli Sci., 2(18): 665-669.

Manzoor M, Gul I, Silvestre J, Kallerhoff J & Arshad M. (2018). Screening of indigenous

ornamental species from different plant families for Pb accumulation potential exposed to

metal gradient in spiked soils. Soil Sediment Contam., 27(5): 439-453.

Marçal D, Rêgo A.T, Carrondo M.A & Enguita F.J. (2009). 1, 3-Propanediol dehydrogenase from

Klebsiella pneumoniae: decameric quaternary structure and possible subunit cooperativity, J

Bacteriol., 191:1143-1151.

Max B, Salgado J.M, Rodríguez N, Cortés S, Converti A & Dominguez J.M. (2010).

Biotechnological production of citric acid. Braz J Microbiol., 41: 862-875.

McGrath S.P & Cunliffe C.H. (1985). A simplified method for the extraction of the metals Fe, Zn,

Cu, Ni, Cd, Pb, Ni, Cr, Co, and Mn from soils and sewage sludge. J Sci Food and Agric., 36:

794-798.

McLaughlin M.J. (2001). Aging of metals in soils changes bioavailability. Environ Risk Assess.,

4, 1–6.

McLean E.O. (1982). Soil pH and lime requirement. In: Methods of soil analysis. Part 2 - Chemical

and microbiological properties. (2nd Ed.). A.L.R.H Miller & D.R Keeney (eds.) Agronomy, 9:

199-223.

Megharaj K.V.M, Sethunathan N & Naidu R. (2003). Bioavailability and toxicity of cadmium to

microorganisms and their activities in soil. Adv Environ Res., 8: 121-135.

Memon F, Narejo N.T, Abbasi A, Soomro A & Kunbhar K. (2014). Blood and offal tissue lead

levels of Goats, sheep and chickens farmed near battery recycling smelters of Hyderabad

Pakistan. Sindh University Research Journal-SURJ (Science Series), 46(4).

Meyers D.E, Auchterlonie G.J, Webb R.I & Wood B. (2008). Uptake and localisation of lead in

the root system of Brassica juncea. Environ Pollut., 153(2): 323-332.

Moeskops B, Buchan D, Sleutel S, Herawaty L, Husen E, Saraswati R, Setyorini D & De Neve S.

(2010). Soil microbial communities and activities under intensive organic and conventional

vegetable farming in West Java, Indonesia. Appl Soil Ecol., 45: 112-120.

173

Mohammed A, Oyeleke S.B, Ndamitso M.M, Achife C.E & Badeggi U.M. (2013). The impact of

electronic waste disposal and possible microbial and plant control. Int J Eng Sci., 2(10): 35-

42.

Monchy S, Benotmane M.A, Janssen P, Vallaeys T, Taghavi S, van der Lelie D & Mergeay M.

(2007). Plasmids pMOL28 and pMOL30 of Cupriavidus metallidurans are specialized in the

maximal viable response to heavy metals. J Bacteriol., 189(20): 7417-7425.

Muhammad S, Shah M.T & Khan S. (2011). Heavy metal concentrations in soil and wild plants

growing around Pb–Zn sulfide terrain in the Kohistan region, northern Pakistan.

Microchemical Journal, 99(1): 67-75.

Mukhopadhyay M & Mondal T.K. (2015). Effect of zinc and boron on growth and water relations

of Camellia sinensis (L.) O. Kuntze cv. T-78. Natl Acad Sci Lett., 38: 283-286.

Munawar S & Iram S. (2014). Chelating impact assessment of biological and chemical chelates on

metal extraction from contaminated soils. J Chem Soc Pak., 36(3): 548-555.

Navarro-Noya Y.E, Hernández-Mendoza E, Morales-Jiménez J, Jan-Roblero J, Martínez-Romero

E & Hernández-Rodríguez C. (2012). Isolation and characterization of nitrogen fixing

heterotrophic bacteria from the rhizosphere of pioneer plants growing on mine tailings. Appl

Soil Ecol., 62: 52-60.

Nazir A, Malik R.N, Ajaib M, Khan N & Siddiqui M.F. (2011). Hyperaccumulators of heavy

metals of industrial areas of Islamabad and Rawalpindi. Pak J Bot., 43(4), 1925-1933.

Ni Q, Bao Z, Yang D & Zhang T. (2009). Distribution of heavy metal contents of urban soils in

sanya, China in bioinformatics and biomedical engineering. 3rd International Conference on

Bioinformatics and Biomedical Engineering (ICBBE). pp. 1-5.

Ousmanova D & Parker W. (2007). Fungal generation of organic acids for removal of lead from

contaminated soil. Water Air Soil Poll., 179: 65-380.

Pande A, Pandey P, Mehra S, Singh M & Kaushik S. (2017). Phenotypic and genotypic

characterization of phosphate solubilizing bacteria and their efficiency on the growth of maize.

Genet Eng Biotechnol J., 15(2): 379-391.

Pandey S.K & Bhattacharya T. (2018). Effect of two biodegradable chelates on metals uptake,

translocation and biochemical changes of Lantana camara growing in fly ash amended soil.

Int J Phytorem., 20(3): 214-224.

174

Panneerselvam P, Choppala G, Kunhikrishnan A & Bolan N. (2013). Potential of novel bacterial

consortium for the remediation of chromium contamination. Water Air Soil Pollut., 224(12):

1716-1717.

Patel S & Kasture A. (2014). E (electronic) waste management using biological systems-overview.

Int J Curr Microbiol Appl Sci., 3(7): 495-504.

Permina E.A, Kazakov A.E, Kalinina O.V & Gelfand M.S. (2006). Comparative genomics of

regulation of heavy metal resistance in Eubacteria. BMC Microbiology., 6(1): 49.

Petruzzelli G, Pedron F, Rosellini I & Barbafieri M. (2015). The bioavailability processes as a key

to evaluate phytoremediation efficiency. In: Phytoremediation. Springer, Cham. 1: 31-43

Pikovskaya I. (1948). Mobilization of phosphorus in soil connection with the vital activity of some

microbial species. Microbiologia., 17: 362-370.

Pilon-Smits E. (2005). Phytoremediation. Annu Rev Plant Biol., 56: 15-39.

Pourrut B, Perchet G, Silvestre J, Cecchi M, Guiresse M & Pinelli E. (2008). Potential role of

NADPH-oxidase in early steps of lead-induced oxidative burst in Vicia faba roots. J Plant

physiol., 165(6): 571-579.

Pourrut B, Shahid M, Dumat C, Winterton P & Pinelli E. (2011). Lead uptake, toxicity, and

detoxification in plants. In: Reviews of Environmental Contamination and Toxicology.

Springer, New York, 213: pp 113-136.

Povedano-Priego C, Martín-Sánchez I, Jroundi F, Sánchez-Castro I & Merroun M.L. (2017).

Fungal biomineralization of lead phosphates on the surface of lead metal. Miner Eng., 106: 46-

54.

Prasad M.N.V & Freitas H.M.O (2006). Metal-tolerant plants: biodiversity prospecting for

phytoremediation technology. In: Trace elements in the environment: biogeochemistry,

biotechnology, and bioremediation. M.N.V Prasad, K.S Sajwan, R Naidu. 483-506 Boca Raton

(L, NY). CRC Press. pp 483-506.

Prasad M.N.V & Freitas H.M.O. (2003). Metal hyperaccumulation in plants: biodiversity

prospecting for phytoremediation technology. Electron J Biotechnol., 6(3): 285-321.

Punamiya P, Datta R, Sarkar D, Barber S, Patel M & Das P. (2010). Symbiotic role of Glomus

mosseae in phytoextraction of lead in vetiver grass [Chrysopogon zizanioides (L.)]. J Hazard

Mater., 177: 465-474.

175

Qing H.U, Qi H.Y, Zeng J.H & Zhang H.X. (2007). Bacterial diversity in soils around a lead and

zinc mine. J Environ Sci., 19(1): 74-79.

Rajkumar M & Freitas H. (2008). Influence of metal resistant-plant growth-promoting bacteria on

the growth of Ricinus communis in soil contaminated with heavy metals. Chemosphere., 71(5):

834-842.

Rajkumar M, Sandhya S, Prasad M.N.V & Freitas H. (2012). Perspectives of plant-associated

microbes in heavy metal phytoremediation. Biotechnol Adv., 30: 1562–1574.

Raskin I & Ensley B.D. (2000). Phytoremediation of toxic metals using plants to clean up the

environment. I Raskin B.D Ensley). John Wiley and Sons, New York, pp 247-271.

Ravanbakhsh M, Ronaghi A.M, Taghavi S.M & Jousset A. (2016). Screening for the next

generation heavy metal hyperaccumulators for dryland decontamination. J Environ Chem

Eng., 4(2): 2350-2355.

Reena T, Dhanya H, Deepthi M.S & Pravitha D.L. (2013). Isolation of phosphate solubilizing

bacteria and fungi from rhizospheres soil from banana plants and its effect on the growth of

Amaranthus cruentus L. J Pharm Biol Sci., 5(3): 6-11.

Robinson B, Green S, Mills T, Clothier B, van der Velde M, Laplane R, Fung L, Deurer M, Hurst

S, Thayalakumaran T & van den Dijssel C. (2003). Phytoremediation: using plants as

biopumps to improve degraded environments. Soil Res., 41(3): 599-611.

Romero-Freire A, Martin Peinado F.J, van & Gestel C.A.M. (2015). Effect of soil properties on

the toxicity of Pb: Assessment of the appropriateness of guideline values. J Hazard Mater.,

289: 46-53.

Romero-Hernández J.A, Amaya-Chávez A, Balderas-Hernández P, Roa-Morales G, González-

Rivas N & Balderas-Plata M.Á. (2017). Tolerance and hyperaccumulation of a mixture of

heavy metals (Cu, Pb, Hg and Zn) by four aquatic macrophytes. Int J Phytorem., 19(3): 239-

245.

Roy M, McDonald L.M. (2015). Metal uptake in plants and health risk assessments in metal-

contaminated smelter soils. L Degrad Dev., 26: 785-792.

Sahodaran N.K & Ray J.G. (2018). Heavy metal contamination in “chemicalized’ green revolution

banana fields in southern India. Environ Sci Pollut Res., DOI: 10.1007/s11356-018-2729-0.

Salt D.E, Smith R.D & Raskin I. (1998). Phytoremediation. Annu Rev Plant Physiol Plant Mol

Biol., 49: 643-668.

176

Sardar K, Qing C, Hesham A, Yue X & He J. (2007). Soil enzymatic activities and microbial

community structure with different application rates of Cd and Pb. J Environ Sci., 19(7), 834-

840.

Sarwar M, Arshad M, Martens D.A & Frankenberger W.T. (1992). Tryptophan-dependent

biosynthesis of auxins in soil, Plant and Soil., 147: 207-215.

Sauerbeck D. (1982). Which heavy metal contents in plants must not be exceeded in order to avoid

growth inhibitions? (Forsch. Special issue conference volume). pp: 108-129.

Schwyn B & Neilands J.B. (1987) Universal chemical assay for the detection and determination

of siderophores. Anal Biochem., 160: 47-56.

Sebiomo A, Banjo F.M, Ade-Ogunnowo F.E & Fagbemi F.T. (2017). Microbial population,

dehydrogenase and urease activities in soils polluted with spent engine and diesel oil. Afr J Sci

N., 4: 56-65.

Seneviratne M, Seneviratne G, Madawala H.M.S.P, Iqbal M.C.M, Rajakaruna N, Bandara T &

Vithanage M. (2015). A preliminary study of the role of bacterial–fungal co-inoculation on

heavy metal phytotoxicity in serpentine soil. Aus J Bot., 63(4): 261-268.

Seregin I.V, Shpigun L.K &Ivanov V.B. (2004). Distribution and toxic effects of cadmium and

lead on maize roots. Russ J Plant Physiol., 51(4): 525–533

Sessitsch A, Kuffner M, Kidd P, Vangronsveld J, Wenzel W.W, Fallmann K & Puschenreiter M.

2013. The role of plant-associated bacteria in the mobilization and phytoextraction of trace

elements in contaminated soils. Soil Biol Biochem., 60: 182-194.

Sezgin N, Ozcan H.K, Demir G, Nemlioglu S & Bayat C. (2004). Determination of heavy metal

concentrations in street dusts in Istanbul E-5 highway. Environ Int., 29(7): 979-985.

Shahid M, Arshad M, Kaemmerer M & Pinelli E. (2012a). Long-term field metal extraction by

Pelargonium: phytoextraction efficiency in relation to plant maturity. Int J Phytorem., 14: 493-

505.

Shahid M, Dumat C, Aslam M & Pinelli E. (2012b). Assessment of lead speciation by organic

ligands using speciation models. Chem Spec Bioavailab., 24(4): 248-252.

Shahid M, Dumat C, Pourrut B, Abbas G, Shahid N & Pinelli E. (2015). Role of metal speciation

in lead-induced oxidative stress to Vicia faba roots. Russ J Plant Physiol., 62(4): 448-454.

177

Shahid M, Pinelli E, Pourrut B & Dumat C. (2014). Effect of organic ligands on lead-induced

oxidative damage and enhanced antioxidant defense in the leaves of Vicia faba plants. Journal

of Geochemical Exploration., 144: 282-289.

Shahid M, Pinelli E, Pourrut B, Silvestre J & Dumat C. (2011). Lead-induced genotoxicity to Vicia

faba L. roots in relation with metal cell uptake and initial speciation. Ecotoxicol Environ

safe., 74(1): 78-84.

Shahid M. (2010). Lead-induced toxicity to Vicia faba L. in relation with metal cell uptake and

speciation. PhD thesis, INP-ENSAT, University of Toulouse, Toulouse-FRANCE.

Sharma P & Dubey R.S. (2005). Lead toxicity in plants. Braz J Plant Physiol., 17(1): 35-52.

Shehata H.R, Lyons E.M, Jordan K.S & Raizada M.N. (2016). Relevance of in vitro agar based

screens to characterize the anti-fungal activities of bacterial endophyte communities. BMC

microbiology., 16(1): 8.

Shen Z.G & Liu Y.L. (1998). Progress in the study on the plants that hyperaccumulate heavy metal.

Plant Physiol Com., 34: 133-139.

Shen Z.G, Li X.D, Wang C.C, Chen H.M & Chua H. (2002). Lead phytoextraction from

contaminated soil with high-biomass plant species. J Environ Qual., 31(6): 1893-1900.

Sheng X.F, Jiang C.Y & He L.Y. (2008a). Characterization of plant growth-promoting Bacillus

edaphicus NBT and its effect on lead uptake by Indian mustard in a lead-amended soil. Can J

Microbiol., 54(5): 417-422.

Sheng X.F, Xia J.J, Jiang C.Y, He L.Y & Qian M. (2008b). Characterization of heavy metal-

resistant endophytic bacteria from rape (Brassica napus) roots and their potential in promoting

the growth and lead accumulation of rape. Environ Pollut., 156(3): 1164-1170.

Shi G, Chen Z, Xu S, Zhang J, Wang L, Bi C & Teng J. (2008). Potentially toxic metal

contamination of urban soils and roadside dust in Shanghai, China. Environ Pollut., 156(2):

251-260.

Siddique N, Majid A, Chaudhry M & Tufail M. (2011). Determination of heavy metals in air

conditioner dust using FAAS and INAA. J Rad Nuclear Chem., 292(1): 219-227.

Smith E, Kempson I.M, Juhasz A.L, Weber J, Rofe A & Gancarz D. (2011). In vivo–in vitro and

XANES spectroscopy assessments of lead bioavailability in contaminated periurban soils.

Environ Sci Technol., 45(14): 6145-6152.

178

Sobolev D & Begonia M. (2008). Effects of heavy metal contamination upon soil microbes: lead-

induced changes in general and denitrifying microbial communities as evidenced by molecular

markers. Int J Environ Res Public H., 5(5): 450-456.

Sunil K.C.R, Swati K, Bhavya G, Nandhini M, Veedashree M, Prakash H.S, Kini K.R & Geetha

N. (2015) Streptomyces flavomacrosporus, A multi-metal tolerant potential bioremediation

candidate isolated from paddy field irrigated with industrial effluents. Int J Life Sci., 3(1): 9-

15.

Szczygłowska M, Piekarska A, Konieczka P & Namiesnik J. (2011). Use of brassica plants in the

phytoremediation and biofumigation processes. Int J Mol Sci., 12: 7760-7771.

Tabatabai M.A & Bremner J.M. (1969). Use of p-nitrophenyl phosphate for assay of soil

phosphatase activity. Soil Biol Biochem., 1: 301-307.

Tak H.I, Ahmad F & Babalola O.O. (2013). Advances in the application of plant growth-promoting

rhizobacteria in phytoremediation of heavy metals. In: Reviews of Environmental

Contamination and Toxicology. Springer, New York. 223: pp. 33-52.

Tan X, Liu Y, Yan K, Wang Z, Lu G, He Y & He W. (2017). Differences in the response of soil

dehydrogenase activity to Cd contamination are determined by the different substrates used for

its determination. Chemosphere., 169: 324-332.

Thamayanthi D, Sharavanan P.S & Jayaprasad B. (2013). Phytoremediation of lead contaminated

soil using ornamental plants (marigold and zinnia). J Environ Biol., 3(1): 32-34.

Thomas J.C, Malick F.K, Endreszl C, Davies E.C & Murray K.S. (1998). Distinct responses to

copper stress in the halophyte Mesembryanthemum crystallinum. Physiol Plant., 102(3): 360-

368.

Tong S, von Schirnding Y.E & Prapamontol T. (2000). Environmental lead exposure: a public

health problem of global dimensions. Bulletin WHO., 78(9): 1068-1077.

United States Environmental Protection Agency (USEPA). (1997). Cleaning up the nation’s waste

sites: markets and technology trends. EPA/542/R-96/005. Office of Solid Waste and

Emergency Response, Washington, DC.

Usha S & Padmavathi T. (2013). Effect of plant growth promoting microorganisms from

rhizosphere of Piper nigrum L. Int J Pharm Bio Sci., 4(1): 835-846.

Uzu G, Sobanska S, Sarret G, Munoz M & Dumat C. (2010). Foliar lead uptake by lettuce exposed

to atmospheric fallouts. Environ Sci Technol., 44(3): 1036-1042.

179

Van der Ent A, Baker A.J, Reeves R.D, Pollard A.J & Schat H. (2013). Hyperaccumulators of

metal and metalloid trace elements: facts and fiction. Plant and Soil., 362(1-2): 319-334.

Velásquez L & Dussan J. (2009). Biosorption and bioaccumulation of heavy metals on dead and

living biomass of Bacillus sphaericus. J Hazard Mater., 167(3):713-716.

Wakelin S.A, Warren R.A, Harvey P.R & Ryder M.H. (2004). Phosphate solubilization by

Penicillium spp. closely associated with wheat roots. Biol Fert Soils., 40(1): 36-43.

Walkley A & Black I.A. (1934). An examination of Degtjareff method for determining soil organic

matter and a proposed modification of the chromic acid titration method. Soil Sci., 37: 29-37.

Wang H, Shan X, Wen B, Owens G, Fang J & Zhang S. (2007). Effect of indole-3-acetic acid on

lead accumulation in maize (Zea mays L.) seedlings and the relevant antioxidant response.

Environ Exper Bot., 61(3) : 246-253.

Waqas M, Khan A.L, Kamran M, Hamayun M, Kang S.M, Kim Y.H & Lee I.J. (2012). Endophytic

fungi produce gibberellins and indole acetic acid and promotes host-plant growth during Stress.

Molecules., 17: 10754-10773.

Wei C, Chen T, Huang Z & Zhang X. (2002). Cretan brake (Pteris cretica L.): an arsenic-

accumulating plant. Acta Ecologica Sinica., 22(5): 777-778.

Wei S, da Silva J.A.T & Zhou Q. (2008). Agro-improving method of phytoextracting heavy metal

contaminated soil. J Hazard Mater., 150 (3), 662-668.

WHO. (2001). WHO Regional Office for Europe, Air Quality Guidelines, Lead, Copenhagen,

Denmark, 2nd edition, http://www.euro.who.int/document/aiq/6 7lead.pdf.

WHO. (2017). Lead poisoning and health. Date searched on:

http://www.who.int/mediacentre/factsheets/fs379/en/

Wierzbicka M.H, Przedpełska E, Ruzik R, Ouerdane L, Połeć-Pawlak K, Jarosz M, Szpunar J &

Szakiel A. (2007). Comparison of the toxicity and distribution of cadmium and lead in plant

cells. Protoplasma., 231(1-2): 99.

Williams L.E, Pittman J.K & Hall J.L. (2000). Emerging mechanisms for heavy metal transport in

plants. Bioch Biophy Acta., 1463: 104-126.

Wu L.H, Luo Y.M, Christie P & Wong M.H. (2003). Effects of EDTA and low molecular weight

organic acids on soil solution properties of a heavy metal polluted soil. Chemosphere., 50: 819-

822.

http://www.euro.who.int/document/aiq/6%207lead.pdf

http://www.who.int/mediacentre/factsheets/fs379/en/

180

Xiao C, Chi R, He H, Qiu G, Wang D & Zhang W. (2009). Isolation of phosphate-solubilizing

fungi from phosphate mines and their effect on wheat seedling growth. Appl Biochem Biotech.,

159(2): 330-342.

Xiao C, Chi R, Li X, Xia M & Xia Z. (2011). Biosolubilization of rock phosphate by three stress-

tolerant fungal strains. Appl Biochem Biotech., 165(2): 719-727.

Xu Z.M, Tan X.Q, Mei X.Q, Li Q.S, Zhou C & Wang L.L. (2018). Low-Cd tomato cultivars

(Solanum lycopersicum L.) screened in non-saline soils also accumulated low Cd, Zn, and Cu

in heavy metal-polluted saline soils. Environ Sci Pollut Res., 25(27): 27439-27450.

Yadav B.K, Siebel M.A & van Bruggen J.J. (2011). Rhizofiltration of a heavy metal (lead)

containing wastewater using the wetland plant Carex pendula. Clean–Soil, Air, Water, 39(5):

467-474.

Yahaghi Z, Shirvani M, Nourbakhsh F, De La Pena T.C, Pueyo J.J & Talebi M. (2018). Isolation

and characterization of pb-solubilizing bacteria and their effects on pb uptake by Brassica

juncea: implications for microbe-assisted phytoremediation. J Microbiol Biotechnol., 28(7):

1156-1167.

Yang X, Liu J, McGrouther K, Huang H, Lu K, Guo X, He L, Lin X, Che L, Ye Z & Wang H.

(2016). Effect of biochar on the extractability of heavy metals (Cd, Cu, Pb, and Zn) and enzyme

activity in soil. Environ Sci Pollut Res., 23(2): 974-984.

Yang Y, Han X, Liang Y, Ghosh A, Chen J & Tang M. (2015). The combined effects of arbuscular

mycorrhizal fungi (AMF) and lead (Pb) stress on Pb accumulation, plant growth parameters,

photosynthesis, and antioxidant enzymes in Robinia pseudoacacia L. PLoS One., 10(12): 1-24

Yasser M.M, Mousa A.S.M, Massoud O.N & Nasr S.H. (2014). Solubilization of inorganic

phosphate by phosphate solubilizing fungi isolated from Egyptian soils. J Biol Earth Sci., 4(1):

83-90.

Yongpisanphop J, Babel S, Kruatrachue M & Pokethitiyook P. (2017). Phytoremediation potential

of plants growing on the Pb-contaminated soil at the Song Tho Pb mine, Thailand. Soil

Sediment Contam., 26(4): 426-437.

Yoon J, Cao X, Zhou Q & Ma L.Q. (2006). Accumulation of Pb, Cu, and Zn in native plants

growing on a contaminated Florida site. Sci Total Environ., 368(2): 456-464.

181

Yu Q, Tian H, Yue K, Liu J, Zhang B, Li X & Ding Z. (2016). A P-loop NTPase regulates quiescent

center cell division and distal stem cell identity through the regulation of ROS homeostasis in

Arabidopsis root. PLoS genetics., 12(9): e1006175.

Yu S, Bai X, Liang J, Wei Y, Huang S, Li Y, Dong L, Liu X, Qu J & Yan L. (2019). Inoculation

of Pseudomonas sp. GHD-4 and mushroom residue carrier increased the soil enzyme activities

and microbial community diversity in Pb-contaminated soils. J Soil Sediment., 19(3): 1064-

1076.

Zaveri P, Patel R, Rana P, Shah B, Mahto N & Munshi N.S. (2016). Assessment of enzyme activity

and functional microbial diversity in coastal and desert soil ecosystems of Gujarat. J Enzymol

Metabol., 2: 1-9.

Zhang H, Guo Q, Yang J, Ma J, Chen G, Chen T & Shao C. (2016). Comparison of chelates for

enhancing Ricinus communis L. phytoremediation of Cd and Pb contaminated soil. Ecotoxicol

Environ Safe., 133: 57-62.

Zhang W, Chen L, Zhang R & Lin K. (2016). High throughput sequencing analysis of the joint

effects of BDE209-Pb on soil bacterial community structure. J Hazard Mater., 301: 1-7.

Zhang Y, He L, Chen Z, Zhang W, Wang Q, Qian M & Sheng X. (2010). Characterization of lead-

resistant and ACC deaminase-producing endophytic bacteria and their potential in promoting

lead accumulation of rape. J Hazard Mater., 186: 1720–1725.

Zhu S.C, Tang J.X, Zeng X.X, Wei B.J & Huang B. (2015). Isolation of Mucor circinelloides Z4

and Mucor racemosus Z8 from heavy metal-contaminated soil and their potential in promoting

phytoextraction with Guizhou oilseed rap. J Central South Uni., 22(1): 88-94.

182

ANNEXURE

LIST OF PUBLICATIONS

Maria Manzoor

PhD Candidate, IESE-SCEE, NUST

[email protected]

Journal Papers

1. Maria Manzoor, Iram Gul, Jerome Silvestre, Jean Kallerhoff, Muhammad Arshad (2018)

Screening of indigenous ornamental species from different plant families for Pb

accumulation potential exposed to metal gradient in spiked soils. Soil and Sediment

Contamination an International Journal, 27(5): 439-453. DOI:

10.1080/15320383.2018.1488238

2. Maria Manzoor, Rafia Abid, Bala Rathinasabapathi, Letuzia M. De Oliveira, Evandro da

Silva, Fenglin Deng, Christopher Rensing, Muhammad Arshad, Iram Gul, Ping Xiang,

Lena Q Ma (2019) Metal tolerance of arsenic-resistant bacteria and their potential to

promote plant growth in Pb-contaminated soil. Science of the Total Environment, 660: 18-

24. DOI: 10.1016/j.scitotenv.2019.01.013

3. Maria Manzoor, Iram Gul, Iftikhar Ahmed, Muhammad Zeeshan, Imran Hashmi, ilal

Ahmad Zafar Amin, Jean Kallerhoff, Muhammad Arshad (2019) Metal tolerant bacteria

enhanced phytoextraction of lead by two accumulator ornamental species. Chemosphere.

227: 561-569. DOI: 10.1016/j.chemosphere.2019.04.093

4. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad (2019) Fungi assisted

phytoextraction of lead: tolerance, plant growth promoting activities and phytoavailability.

Environmental Science and Pollution Research. DOI: 10.1007/s11356-019-05656-3

Conefercne Papers

1. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad. Screening of Native

Ornamental Species as Phytoremediation Technology for Pb Contaminated Soil; Species

Variation in Lead Uptake and Translocation. International Conference on Bio-approaches

for Environment and Sustainability (ICBES-2017), held on February 22nd - 23rd 2017 at

NUST Islamabad.

mailto:[email protected]

183

2. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad. Evaluating potential of

ornamental plants to grow in lead contaminated soil. The International Conference on

Environmentally Sustainable Development (ESDev-VII), held on August 19th - 21st 2017,

COMSATS Abbottabad.

3. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad, Lena Q. Ma. Lead

Availability and phytoextraction in Rhizosphere–plant system. Environmental Science

Forum 2017, held on November 3rd 2017 at University of Florida USA.

4. Maria Manzoor, Iram Gul, Jean Kallerhoff, Muhammad Arshad. 2018. Effect of different

levels of lead on soil enzymatic activity and restoration by resistant bacteria. 11th

International conference on sustainable energy & environmental protection (SEEPS 2018),

held on 08th - 11th May, 2018 Paisley, UK. (Paper Published)

5. Maria Manzoor, Iram Gul, Imran Hashmi, Muhammad Zeeshan Ali Khan, Jean Kallerhoff,

Muhammad Arshad. Enhanced phytoextraction of Lead by plant growth promoting (PGP)

bacteria. 5th International Conference on Environmental Horizon (ICEH-2019), held on

11th - 13th January 2019 at University of Karachi, Pakistan.

6. Maria Manzoor, Iram Gul, Imran Hashmi, Muhammad Zeeshan Ali Khan, Jean Kallerhoff,

Muhammad Arshad. Lead Availability and Phytoextraction in Rhizosphere-Plant System.

International Conference on Environmental Toxicology and Health (ESCON, 2019), held

on 25th - 27th February, 2019 at COMSATS University, Vehari Pakistan.

microbiological interventions at soil plant interface …

Documents