microbial ecology of the skin in the era of metagenomics and … · microbial ecology of the skin...

Microbial Ecology of the Skin in the Era ofMetagenomics and Molecular Microbiology

Geoffrey D. Hannigan and Elizabeth A. Grice

Department of Dermatology, University of Pennsylvania, Perelman School of Medicine,Philadelphia, Pennsylvania 19104

Correspondence: [email protected]

The skin is the primary physical barrier between the body and the external environmentand is also a substrate for the colonization of numerous microbes. Previously, dermatol-ogical microbiology research was dominated by culture-based techniques, but significantadvances in genomic technologies have enabled the development of less-biased, culture-independent approaches to characterize skin microbial communities. These molecularmicrobiology approaches illustrate the great diversity of microbiota colonizing the skinand highlight unique features such as site specificity, temporal dynamics, and interper-sonal variation. Disruptions in skin commensal microbiota are associated with the pro-gression of many dermatological diseases. A greater understanding of how skin microbesinteract with each other and with their host, and how we can therapeutically manipulatethose interactions, will provide powerful tools for treating and preventing dermatologicaldisease.

The skin acts not just as a protective physicalbarrier between the body and the external

environment; it is itself an environmental sub-strate, harboring a rich and diverse commu-nity of microorganisms (the microbiome).The human microbiome includes the bacteria,fungi, viruses, archaea, and microeukaryotesthat inhabit the various body environments,such as the gut, oral cavity, and skin (Griceand Segre 2012). In recent years, it has becomeincreasingly apparent that the microbiome in-teracts extensively with the human body andplays roles in immune system developmentand function, disease etiology and pathology,cancer development, and defense against path-ogens.

The skin is a complex ecosystem that main-tains topographically distinct microbial pop-ulations, as well as distinct environmentalniches. Overall, the surface of the skin is coolerthan the core body temperature, is slightly acid-ic, and squames are continuously shed from theskin surface as a result of terminal differentia-tion (Fuchs and Raghavan 2002). These attri-butes undoubtedly select for specific microbiotaadapted to these unique conditions. The geog-raphy of the skin includes sebaceous areas (in-cluding face and back), moist areas (includingtoe/finger web space and arm pit), dry areas(including forearm and buttock), and sites con-taining varied densities of hair follicles, skinfolds, and skin thicknesses. A critical function

Editors: Anthony E. Oro and Fiona M. Watt

Additional Perspectives on The Skin and Its Diseases available at www.perspectivesinmedicine.org

Copyright # 2013 Cold Spring Harbor Laboratory Press; all rights reserved; doi: 10.1101/cshperspect.a015362

Cite this article as Cold Spring Harb Perspect Med 2013;3:a015362

1

ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org

Harbor Laboratory Press at SCIENCE LIBRARY on August 8, 2016 - Published by Cold Springhttp://perspectivesinmedicine.cshlp.org/Downloaded from

http://perspectivesinmedicine.cshlp.org/

of the skin microbiota is “colonization resis-tance,” in which commensal microbiota occupythese distinct niches to block colonization and/or invasion by opportunistic or pathogenic or-ganisms.

Community composition equilibriumacross the varied geography of the skin is main-tained by nutrient and space competitionamong microbes, production of antimicrobialpeptides (AMPs) by commensal microbes andhost cells, and modulation of the host im-mune response by commensal microbes (Naka-tsuji and Gallo 2012). For example, the skincommensal Staphylococcus epidermidis has beenreported to modulate the innate immune re-sponse by inhibiting skin inflammation throughpattern-recognition receptor-mediated crosstalk (Lai et al. 2009). Complement, an evolu-tionarily conserved arm of the innate immunesystem, was shown to maintain diversity of theskin microbiota in a mouse model, and, con-versely, the skin microbiota regulated comple-ment at the gene expression level (Chehoudet al. 2013). The microbiome is also fundamen-tal in adaptive immune system equilibrium atthe skin, and skin T-cell function and the localinflammatory milieu appear to be autono-mously controlled by the commensal skin mi-crobiota (Naik et al. 2012). These and otherfindings have contributed to the mounting ev-idence suggesting that the commensal skin mi-crobiota is intricately involved in both innateand adaptive skin immunity.

For these reasons, a thorough understand-ing of the commensal skin microbiota is re-quired to gain insight into microbial involve-ment in skin health and disease. The beneficialrole of skin commensals and the pathogenic roleof those microbes that cause disease have longbeen a focus of studies examining the microbialecology of the skin. Contemporary, culture-in-dependent methods for identifying and charac-terizing microbial communities have accelerat-ed and added precision to our understanding ofhost–microbe interactions at the skin surface. Inthis article, we provide a comprehensive discus-sion of the human skin microbiome in healthand disease states and how this understanding isinforming skin disease diagnosis and treatment.

DAWNING OF THE MOLECULARMICROBIOLOGY ERA

The study of the human cutaneous micro-biota has a rich history that spans more thanfive decades (Marples 1965). Early methods forstudying skin-associated bacteria, fungi, and vi-ruses were limited to culturing the microorgan-ism and defining its phylogeny and taxonomythrough phenotypic, microscopic, and bio-chemical relationships. Dependency on genera-tion of pure cultures introduces inherent biasesbecause the procedures select for the most abun-dant and rapidly growing microorganisms ofthe community. Culture-based studies of viruses(including bacteriophage) are further limitedbecause they require coculturing with their pro-karyotic or eukaryotic hosts, additionally pre-venting the identification of viruses associatedwith unknown hosts. Viruses are also not readilyvisible by basic microscopic methods and thusare very difficult to characterize by direct mor-phological observation. Although great insightinto microbial colonization of cutaneous surfac-es in health and disease was gained using cul-ture-dependent methods, there were significantlimitations to the conclusions that could bedrawn.

Advances in DNA sequencing technologyand culture-independent methods of micro-bial identification have greatly enabled high-throughput, detailed characterization of micro-bial communities. These methods are based onsurveys of marker genes, generally conserved,universal genes found in all organisms withinparticular taxonomic levels. Bacterial commu-nities are most commonly classified by the se-quence of their small subunit 16S ribosomalRNA (rRNA) gene (Fig. 1) (Lane et al. 1985).These genes contain both conserved regions,which allow for PCR primer binding and phy-logenetic analysis, as well as variable regions,whose sequences allow for taxonomic classifi-cation. Following amplification and sequencingof 16S rRNA genes, sequence data can be ana-lyzed in a variety of ways, including assignmentof taxonomy, phylogenetic analysis, and com-munity analyses (Fig. 1). Fungi are often classi-fied by sequencing of the internal transcribed

G.D. Hannigan and E.A. Grice

2 Cite this article as Cold Spring Harb Perspect Med 2013;3:a015362

ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



spacer (ITS) region that lies between the smalland large subunit rRNA genes in eukaryotes(Chase and Fay 2009). In addition to offeringclearer definitions for determining microbialtaxonomy, conserved gene sequence analysis

does not require the microorganism to be cul-tured, which therefore eliminates those biasesassociated with culturing procedures.

Unlike bacteria and fungi, viruses and bac-teriophage present a special difficulty because

Bacteria collection

Genomic DNA isolation

16S rRNA gene PCR amplification

Sequencing of PCR products

Bioinformatics analysis

• Phylogenetic analysis

• Taxonomic identification

• Estimation of community membership, structure, and diversity

AGTCGGACTGGTCATGAACATGACGGTATTCGCATAGTTACCATGTACACAAGTTCCCAGGATAGAAGGGCTAGCTAGGACTGAC

GGGGGGGAAAAAAAAAACCCCCAAAATTTTGGGAACCCGGTATTGGGGGTTTTTAAAACCCCCAAAACCCAAAAGGTTCCTTAAAAAAAGGGGGCCCCCTTTTATAAGGGGGGAAACCTGAC

Figure 1. The workflow of a bacterial 16S rRNA gene microbiome study. A heterogeneous mixture of genomicDNA is extracted from samples taken from the skin. Primers, containing barcodes that allow for multiplexing,are designed to the desired region of the 16S rRNA gene. 16S rRNA gene PCR products are amplified andsequenced. Low-quality sequences are removed, and various analyses are performed. These analyses can includeassignment to taxonomy, analysis of shared phylogeny, and analysis of microbial community membership,structure, and diversity.

Skin Microbiome

Cite this article as Cold Spring Harb Perspect Med 2013;3:a015362 3

ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



they do not contain a consensus gene that can beused for widespread taxonomic identification.Closely related groups may be phylogeneticallyanalyzed using specific conserved genes, suchas the human papillomavirus L1 gene, but thisis far less robust than the 16S rRNA and ITSsequencing and identification approaches usedto classify bacteria and fungi. Comparative ge-nome analysis is complicated by the high fre-quency of gene transfer among virus and hostgenomes and the lack of comprehensive, anno-tated reference databases and assigned taxon-omy. A solution to this problem is the use ofwhole-genome shotgun metagenomics, whichdoes not rely on amplification and sequencingof marker genes but, rather, allows for sequenc-ing and analysis of the sample’s full genetic po-tential (National Research Council Committeeon Metagenomics 2007). This type of strategynot only bypasses PCR, but also can provideinsight into what microbial communities aredoing on the skin surface. These types of ap-proaches are still under development in theskin, because high amounts of host DNA andlow amounts of microbial DNA present techni-cal limitations for metagenomic approaches.

THE SKIN MICROBIOME IN HEALTH

Bacteria

Before the advent of molecular techniques tocharacterize skin microbiota, the temporal andtopographical diversity of the skin microbiotawas still considered vast. Early studies producedvariable results in bacterial quantity and taxon-omy, hypothesized at the time to be a result ofinherent topographical and temporal diversityof skin bacterial communities (Evans et al.1950). In a comprehensive study, which culturedunder both aerobic and anaerobic conditions,skin bacterial colonization differed between an-atomical sites, and the highest bacterial load wasobserved in sebaceous sites (Evans et al. 1950).Furthermore, skin colonization was dominatedby a small group of taxa, including Propionibac-terium acnes and Staphylococcus epidermidis.Years later, these same features are apparent us-ing sophisticated sequencing-based techniquesto characterize skin microbiota.

Indeed, site-specific colonization is a keyfeature of the human skin microbiome. Usinga 16S rRNA sequencing approach in healthyadults, sebaceous regions were found to be pref-erentially colonized by Propionibacterium andStaphylococcus spp.; moist sites predominantlymaintained Corynebacterium and Staphylococ-cus spp.; and dry sites, which, despite generalvariability and greater diversity, displayed a sig-nificant presence of b-Proteobacteria and Fla-vobacteriales (Grice et al. 2009). In the samestudy, 19 bacterial phyla were identified, butskin was dominated by four phyla: the Actino-bacteria, Firmicutes, Proteobacteria, and Bac-teroidetes (Fig. 2). Another key finding wasthat longitudinal stability was dependent onthe skin site, with sebaceous sites being themost stable and dry sites being the most variableover time. Costello et al. (2009) similarly re-ported that topographical community variabil-ity was greater than temporal variability amongindividuals. Interestingly, greater microbial di-versity characterized skin microbiota, as com-pared with gut or oral microbiota of the sameindividuals. Key findings of these and otherstudies show that skin bacterial communitiesare generally diverse between individuals (Gaoet al. 2007; Grice et al. 2008) and may be influ-enced by ethnicity, lifestyle, and/or geography,as suggested by a study comparing cutaneousmicrobiota colonizing South American Amer-indians and U.S. residents (Blaser et al. 2013).Subject sex, handedness, and time since lasthand washing also appear to affect bacterialcommunity composition (Fierer et al. 2008). Asubsequent study confirmed the differences incommunity composition between sexes wheninvestigating the forearm, but found little influ-ence of sex on forehead community composi-tion, thereby supporting early observations ofvariability among anatomical regions (Stau-dinger et al. 2011).

The human skin microbiota is establishedimmediately after birth, and delivery modeseems to influence the neonate’s first skin mi-crobiota. Dominguez-Bello et al. (2010) showedthat vaginally delivered neonates were colonizedwith bacteria similar to those colonizing themother’s vagina (i.e., Lactobacillus, Prevotella,



ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



Sneathia spp.), and neonates delivered by Cesar-ean section were colonized with those bacteriafound on the mother’s skin (i.e., Propionibacte-rium, Staphylococcus, Corynebacterium spp.).Studies in infants over the first year of lifeshowed that diversity of skin microbiota in-creases with age, as does site specificity, andis overall characterized by predominance ofthe phylum Firmicutes (Capone et al. 2011).Upon sexual maturation, the skin becomes col-onized by increased amounts of Corynebacteri-um and Propionibacterium (Oh et al. 2012). Col-

onization by these lipophilic bacterial taxa islikely a result of hormone-stimulated sebaceousgland activity and increasing sebum productionduring puberty. Metabolism of the lipids in se-bum by these bacterial taxa also decreases thepH of the skin, thus discouraging colonizationby other taxa.

The skin was an organ included in the Na-tional Institutes of Health Roadmap HumanMicrobiome Project, in which a cohort of 242phenotyped healthy adults were subject to sam-pling of microbiota at various body sites. Their

Cyanobacteria/

ChloroplastT

ener

icut

es

GemmatimonadetesBRC1

Actinobacteria

Bactero

idetes

OP11

Acidobacteria

Chrysiogenetes

Plancto

myc

etes

TM

7

Lent

ispha

erae

Thermotogae

Nitr

ospi

ra

OD1

Verru

com

icro

bia

Chl

amyd

iae

Armatimonadetes

SR1

Deinococcusthermus

CaldisericaChloroflexi

Proteobacteria

Firmicutes

The

rmod

esul

foba

cter

ia

WS3

Aqu

ifica

e

Fibrobacteres

Elusimicrobia

Dictyoglom

i

Fusobacteria

Deferribacteres

Chlorobi

Synergistetes

Spirochaetes

Not presentCommon Rare

Figure 2. Bacterial diversity of the skin. Phylogenetic tree of the domain Bacteria with each branch representinga phylum. Black branches represent numerically abundant phyla on the skin, red branches represent rare phylaon the skin, and green branches represent phyla that are absent from the skin. (The data are derived from Griceet al. 2009.)

Skin Microbiome


ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



findings confirmed previous smaller-scale stud-ies, by suggesting that the skin microbiota isdiverse, but dominated by a small group ofgenera, in particular Staphylococcus, Propioni-bacterium, and Corynebacterium (Human Mi-crobiome Project Consortium 2012). Interest-ingly, the metabolic and functional pathwaysencoded by the skin microbiota colonizing theretroauricular crease were more constant anddiverse than the taxonomic composition, sug-gesting low metabolic diversity among a tax-onomically diverse population. Furthermore,age was associated with differentially encodedmetagenomic pathways on the skin, as well asa decrease in the phylum Firmicutes.

Fungi

Although bacteria represent a major focus ofpast and present microbiome studies, the fungalmicrobiota is also thought to play a significantrole in skin health and disease. Cultivation-based studies identified the major componentof the skin fungal community as Malassezia(formerly known as Pityrosporum) genus, con-sisting primarily of seven of the 14 known spe-cies (Gaitanis et al. 2012). These findings havebeen confirmed by molecular community anal-ysis. Using 18S rRNA gene and ITS region se-quencing, Paulino et al. (2006) reported that theskin forearm community is dominated by Ma-lassezia, and further analysis with multiplexreal-time PCR (to speciate Malassezia) suggest-ed that the predominant commensal specieswere Malassezia globosa and Malassezia restricta,with Malassezia furfur (the dominant speciesidentified by culturing methods) contributingrelatively little to the overall community abun-dance (Paulino et al. 2008). Conversely, anotherrecent study of three healthy scalps found thatMalassezia spp. only account for a small fractionof the commensal fungi on the scalp (Park et al.2012). A larger-scale, extensive topographicalmap of the fungal skin microbiota, based onsequencing of the fungal ITS region, confirmedthat Malassezia is dominant in most regions ofthe skin, but sites on the feet (plantar heel, toe-nail, and toe web) had the greatest fungal diver-sity of all body sites (Findley et al. 2013). Data-

bases and other resources for identifying andanalyzing fungal sequences, similar to thoseused for 16S rRNA gene studies, are still underdevelopment, and it is expected that our knowl-edge of the fungal microbiome will expand asthese tools become readily available.

Viruses

One of the most extensively studied human skinviruses is the human papillomavirus (HPV).Although it was originally thought that certainstrains were found only in skin cancer lesions,PCR quantification of HPV marker genes re-vealed that healthy skin is also a habitat for abroad spectrum of HPV strains (de Villiers et al.1997; Astori et al. 1998). Sequence analysis ofthe conserved L1 open reading frame (ORF)revealed a diverse community of HPV typeson healthy skin, while identifying HPVs thatwere previously unknown (Antonsson et al.2000). Follow-up studies have confirmed theubiquity and diversity of HPV types throughouthuman populations (Antonsson et al. 2003a,b;Forslund 2007).

The other major group of commensal hu-man skin viruses is the human polyomaviruses(HPyVs). Polyomaviruses were first describedin mice in 1953 but have since been described innumerous animals, including humans (Moenset al. 2011). Although originally studied in thecontext of cancer, they, like the papilloma virus-es, have been found on healthy human skin(Schowalter et al. 2010). There are many typesof HPyVs, with many only recently discoveredusing molecular techniques; the most commonto human skin are HPyV6, HPyV7, and Merkelcell polyomavirus (MCHPyV) (Schowalter et al.2010; Moens et al. 2011). A recent study using awhole metagenomic analysis of the human skinvirome of healthy and cancerous individualsconfirmed a cutaneous viral microbiota domi-nated by HPVs, HPyVs, and circoviruses (Fou-longne et al. 2012). These studies are still in theirearly stages, and as new virus species continueto be discovered and new analysis strategies de-veloped, future studies will likely continue tocharacterize the viral community diversitiesand pathogenic/oncogenic potential.



ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



The other viral component of the micro-biome is the bacteriophage, about which littleis known in the skin. Recent studies have usedculture-dependent techniques paired with ge-nomic analyses, as well as analysis of prophage(bacteriophage integrated into the bacterial hostgenome), to understand and characterize thegenomic diversity of subsets of the skin bacter-iophage communities, such as the limited diver-sity of Propionibacterium bacteriophage and thediversity of Staphylococcus bacteriophage (Kwanet al. 2005; Goerke et al. 2009; Marinelli et al.2012). Whole metagenomic shotgun sequenceanalysis of skin swabs from five healthy patientsand one patient with a previous Merkel cell car-cinoma lesion indicate that two families dom-inate cutaneous bacteriophage communities,the Microviridae and Siphoviridae (Foulongneet al. 2012). Further studies will be required toperform more in-depth and functionally infor-mative analysis of the bacteriophage inhabitingthe skin, such as characterization of bacterialantibiotic resistance genes maintained in bac-teriophage genomes that may be horizontallytransferred among bacteria.

Bacteriophages are also known to be impor-tant, yet complicated mediators of bacterial hor-izontal gene transfer through a process knownas transduction. Commensal bacteriophagemetagenomes have been shown to maintain an-tibiotic-resistance genes, as well as mediate theirtransfer between bacteria, in gut and sputumsamples from cystic fibrosis patients (Wanget al. 2010; Fancello et al. 2011; Minot et al.2011). In the skin, bacteriophage communitieshave been suggested as mediators of resistancegene transfer between bacteria (Nakaminamiet al. 2007; Varga et al. 2012). However, moreresearch is required to understand these com-plicated interactions between bacteria and skinbacteriophage communities.

SKIN MICROBIOME IN DISEASE

Atopic Dermatitis

Atopic dermatitis (AD) is a chronic, recurringinflammatory skin disease that occurs more fre-quently in children than in adults, and has been

associated with skin colonization by Staphylo-coccus aureus. Although no clear microbial causehas been established, antibiotics, corticoste-roids, and dilute bleach baths have been relative-ly effective in the treatment of AD (Huang et al.2009). Furthermore, the enormous increase inincidence over the past three decades with noclear cause raises the interesting possibility thatthe skin microbiota may modulate gene–envi-ronment interactions at the skin surface.

Bacterial virulence factors may in part ex-plain the long-recognized pathogenic associa-tion between AD flares and increased coloniza-tion by S. aureus. Severe AD development wasreported in a mouse model with reduced skinbarrier function upon exposure to Staphylococ-cal protein A (SpA) (Terada et al. 2006). Thedetection of SpA among 89 children with ADlesions was evaluated as occurring in 91.0% ofpatients upon presentation, decreasing to 55.6%of patients after antibiotic therapy (Yao et al.2010). Furthermore, there was a significant pos-itive correlation between the levels of SpA andthe clinical severity of the lesions. It has alsobeen reported that AD lesions contain increasedlevels of lipotechoic acid, a known immune-stimulating molecule derived from Gram-posi-tive bacterial cell walls, whose presence furthersuggests a role of bacterial components in dis-ease (Travers et al. 2010).

Although S. aureus likely in part contributesto disease pathogenesis, a role for the greatermicrobial community has recently been inves-tigated. In a 16S-rRNA-based study that ana-lyzed skin microbiota during the course of ADflares and improvement, a correlation betweenincreased disease severity and decreased bacte-rial diversity was observed, along with alteredmicrobial community structure in AD patientsas compared with healthy controls (Fig. 3A)(Kong et al. 2012). Bacterial community diver-sity was also shown to increase after standardAD treatment. Additionally, fungal communi-ties have been shown to change in compositionas disease severity progresses (Kaga et al. 2011;Zhang et al. 2011). Infants who develop ADmaintained early fecal microbiota with less di-versity than the early fecal microbiotas of pa-tients who did not develop the disease (Wang

Skin Microbiome


ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



Healthy control Diseased state

Atopic dermatitis

Psoriasis

Acne vulgaris

Dandruff

Acremonium

Ascomycota

ConiochaetaDidymellaPenicillium

BasidiomycotaCryptococcusFilobasidiumMalasseziaRhodotorula

Other

Staphylococcaceae

Firmicutes

StreptococcaceaeOther

ActinobacteriaPropionibacteriaceaeCorynebacteriaceaeOther

ProteobacteriaBacteroidetesOther

RT1RT2RT3RT4

RT5RT6RT7

RT8RT9RT10

P. acnes strains

A

B

C

D

Figure 3. Changes in skin microbiota are associated with disease. (A) Relative abundance of bacteria (16S rRNA)in 12 children with AD flares as compared with 11 healthy controls (Kong et al. 2012). (B) Relative abundance ofbacteria (16S rRNA) in six patients with psoriasis, in the lesional area as compared with unaffected skin as acontrol (Gao et al. 2008). (C) Relative abundance of P. acnes strains in 49 acne patients and 52 healthy individuals(Fitz-Gibbon et al. 2013). (D) Relative abundance of fungi (26S rRNA) in three healthy scalps and four dandruff-afflicted scalps (Park et al. 2012).



ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



et al. 2008). Other studies have also shown thataltered bacterial compositions of the infant gutmicrobiota precede the development of AD(Penders et al. 2006, 2007).

Mutations in the gene-encoding filaggrin,an epidermal structural and hydration protein,have been associated with atopic dermatitis andother ichthyotic disorders (Sandilands et al.2007). Analysis of skin microbiota of a mousemodel with a hypomorphic mutation in St14,encoding the serine protease matriptase thatregulates filaggrin processing, showed a selec-tive shift in bacterial populations, with in-creased Corynebacterium and Streptococcus anddecreased Pseudomonas species (Scharschmidt etal. 2009). These findings provide a link betweenfilaggrin deficiency, a common genetic featureof AD, and changes in the skin microbiota.

Psoriasis

Multiple clinical observations support a role fordysbiosis of the skin microbiota in the patho-genesis of psoriasis including the clinical efficacyof topical corticosteroids in the treatment ofpsoriasis (Gottlieb 2005) and the observationthat a variant of plaque psoriasis, guttate psori-asis, is triggered by Streptococcus infection. Xe-nograft models of psoriasis, in which unaffectedskin from psoriasis patients was grafted on im-munodeficient mice, showed that stimulationwith bacterial antigen could trigger the skin tobecome lesional (Boehncke et al. 1996). Earlyculture-based studies examining microorgan-isms associated with psoriasis identified Malas-sezia, group A and B b-hemolytic streptococci,S. aureus, and Enterococcus faecalis (Aly et al.1976; Rosenberg et al. 1994; Nickoloff et al.2000). Culture-independent analysis of fungalmicrobiota found no conclusive evidence tolink Malassezia with psoriasis (Paulino et al.2006, 2008). Analyses of the bacterial microbiotaby 16S rRNA gene-based approaches in cross-sectional studies suggest underrepresentation ofPropionibacterium and increased representationof the phylum Firmicutes in psoriatic plaques ascompared with healthy controls or uninvolvedlimb skin (Fig. 3B) (Gao et al. 2008; Fahlen et al.2012). Longitudinal studies of the skin micro-

biota in psoriasis plaques may provide insightinto the role of microbes in triggering, propaga-tion, and maintenance of plaques.

Acne Vulgaris

Acne vulgaris is a common skin disorder char-acterized by abnormalities of sebum productionby the pilosebaceous unit, bacterial prolifera-tion, and inflammation. The etiology and path-ogenesis of acne remain unclear, but there hasbeen significant evidence supporting microbialroles in the disease. The primary microbe asso-ciated with development of acne is Propionibac-terium acnes, also a prominent member of thecommensal skin microbiota. Topical and sys-temic antibacterial drugs have long been usedto treat acne, with the efficacy commonly attrib-uted to decreased P. acnes colonization and/oractivity (Tan 2003). Strain-level analysis of the16S rRNA gene showed that, although the rela-tive abundances of P. acnes did not significantlydiffer between healthy and acne patients, therelative abundances of different strains did dif-fer between skin states (Fig. 3C) (Fitz-Gibbonet al. 2013). Additionally, genomic comparisonof 71 different P. acnes strains shows that theacne-associated genomes maintained differentchromosomal genomic region loci and a linearplasmid, thereby suggesting that there may bespecific genes at these loci that contribute toacne pathology (Fitz-Gibbon et al. 2013). Thesefindings suggest that strain-level analysis of theskin microbiota may be instrumental in ex-plaining disease pathogenesis.

Dandruff

Dandruff is a mild inflammatory condition thatis characterized by scaling of skin on the scalp.Malassezia fungi were proposed as the primarycause of dandruff in 1874, and this idea is stillprevalent today. In fact, dandruff therapeuticshampoos are made with strong antifungalcompounds in an attempt to target fungal caus-es of the disease (Bulmer and Bulmer 1999).Although Malassezia is the dominant fungal ge-nus cultured from the skin and has been shownto increase in abundance on dandruff-afflicted

Skin Microbiome


ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



skin (McGinley et al. 1975), recent work hassuggested that the dandruff microbial commu-nities are more complex. A molecular analysis ofthe 26S rRNA gene of the fungal communitiesassociated with healthy and dandruff-afflictedscalps showed that, similar to what was shownin previous studies, the relative abundance ofMalassezia was increased in the dandruff-af-flicted scalp skin (Fig. 3D) (Park et al. 2012).The study also reported that dandruff-afflictedskin harbored increased relative abundances ofPenicillium and Filoblasidium floriforme thatcorrelated with increased severity of dandruff.Furthermore, because Malassezia is found in thecommensal fungal microbiota, it is not a likelycause of disease on its own, and thus there maybe other interactive mechanisms involved inetiology.

Merkel Cell Carcinoma

Merkel cell carcinoma (MCC) is a rare but ag-gressive malignant, neuroendocrine tumor thathas been increasing in incidence in past decades(Hodgson 2005). In 2008, Feng et al. (2008)showed that there was a novel virus (Merkelcell polyomavirus [MCPyV]) associated withMCC tissue, but not healthy tissue. Numerousadditional studies, across diverse populations,also found strong associations between thepresence of MCPyV and MCC (Foulongneet al. 2008, 2010; Kassem et al. 2008; Becker etal. 2009; Duncavage et al. 2009; Katano et al.2009; Touze et al. 2009; Mangana et al. 2010;Jung et al. 2011; Paolini et al. 2011; Haitz et al.2012). Investigation into the virus’s role inhealth and disease have shown that MCPyVsare members of the commensal skin viral com-munities, are often asymptomatically carried,and can be shed from the skin as assembledvirus particles (Foulongne et al. 2008, 2010;Kassem et al. 2008; Becker et al. 2009; Duncav-age et al. 2009; Katano et al. 2009; Touze et al.2009; Mangana et al. 2010; Jung et al. 2011;Paolini et al. 2011; Haitz et al. 2012). Becausethis virus is a commensal microbe on healthyskin that does not develop MCC, there are likelyother factors that interact with MCPyV to causedisease, including host immune function.

DIAGNOSTIC AND THERAPEUTICPOTENTIAL OF THE MICROBIOMEIN SKIN DISEASE

It is clear that the microbiome plays a broad,intricate, and complicated role in both humanskin health and disease. In light of the manytranslational opportunities to use these findingsin the clinic, a great amount of research has beendevoted to clinical applications of microbiomeresearch (Table 1). Probiotics, live microorgan-isms or microorganism components that conferhealth benefits, have long been administeredtherapeutically and prophylactically to the gas-trointestinal tract, even before their mechanismwas known. Effective and safe probiotics foruse on the skin is an area of active investigationwith great promise (Muizzuddin et al. 2012;Lew and Liong 2013; Shu et al. 2013). For thoseskin diseases that may be influenced by the gutmicrobiota, there is evidence that probioticintervention may provide benefit. The efficacyof probiotics in treating AD remains somewhatcontroversial, but evidence suggests that ad-ministration of some Lactobacillus rhamnosusstrains to mothers before and after birth reducesthe occurrence and frequency of infantile AD(Kalliomaki et al. 2001; Wickens et al. 2008,2012; Dotterud et al. 2010).

Another microbiome-related approach totreating disease may be the use of prebiotics,which consist of substrates that promote thegrowth and/or metabolic activity of beneficialindigenous microbiota. Current prebiotics areprimarily associated with ingestion and conse-quent manipulation of the gut microbiome.Different types of gut prebiotics such as galacto-and long-chain fructo-oligosaccharides showpromise in treating infants with AD (Moroet al. 2006; Arslanoglu et al. 2008). But imagin-able prebiotic approaches such as treating theskin with substrates to alter the environmentalconditions and thus promote or discourage thegrowth of certain microbiota may offer promisefor the treatment of skin disorders whose path-ogenesis is clearly linked to a microbial cause.

Genetic engineering of microorganisms asvectors for delivery of therapeutic genes is an-other area of active investigation. The potential



ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



utility of such approaches was shown by a studyin which E. coli was engineered to express aquorum-sensing peptide that is naturally ex-pressed by Vibrio cholera and inhibits V. choleravirulence (Duan and March 2010). Administra-tion of the genetically engineered microbe tothe gut of infant mice before challenge withV. cholera significantly increased survival whiledecreasing cholera toxin binding to the intes-tines. Bacteriophage can also be engineered andadministered for therapeutic benefit. For exam-ple, bacteriophage have been used to delivergene constructs to reverse antibiotic resistancein bacteria populations (Edgar et al. 2012). Thisapproach provides the first steps toward apply-ing evolutionary pressure against antibiotic re-sistance, while reversing the pressure toward an-tibiotic resistance from decades of antibioticuse. Of particular concern to the skin is multi-drug resistance in skin-associated opportunisticpathogens, such as S. epidermidis, S. aureus, andPseudomonas aeruginosa (Branski et al. 2009;Otto 2009). Bacteriophages have also been en-gineered to degrade bacterial biofilms (Lu andCollins 2007), a significant therapeutic chal-lenge because antibiotics are often not able tophysically access the bacteria comprising the

biofilm, and are therefore not effective in treat-ing them.

An in-depth understanding of the humanskin microbiota may also have important im-plications in informing synthetic biology ther-apeutics. For example, comparative genomicanalysis of P. acnes bacteriophage genomes ledto the discovery of a highly conserved gene-en-coding endolysin, an enzyme with broad lyticpotential for P. acnes hosts (Marinelli et al.2012). The utilityof endolysin as an antibacterialhas been shown in other phage–host systems,and bacterial resistance to the recombinant pro-tein was not observed even after repeated expo-sure (Fischetti 2008).

CONCLUDING REMARKS

The skin acts as both a protective physical barrierbetween the body and the external environment,as well as an environmental substrate that har-bors rich and diverse communities of micro-organisms that contribute to skin health anddisease. The recent advent of molecular andmetagenomic techniques for microbial commu-nity analysis has addressed many culture-basedlimitations. As a result, a greater appreciation of

Table 1. Therapeutic approaches based on the microbiome

Therapeutic Disease target example Summary

Probiotics Atopic dermatitis(Batchelor et al. 2010)

Administration of microorganisms, or theircomponents, to confer health benefits

Prebiotics Atopic dermatitis (Fooladet al. 2008)

Administration of a substance to promote growthand/or action of therapeutically beneficialindigenous microbes

Bacteria-mediated genedelivery

Vibrio cholera infection(Duan and March 2010)

Inhibition of pathogen virulence by administratingbacteria engineered to express genes absent from thecommensal community

Bacteriophage-mediatedantibiotic susceptibility

Antibiotic-resistantbacteria (Edgar et al.2012)

Reduction in antibiotic-resistant bacteria populationsby using bacteriophage to deliver gene constructsthat promote evolution toward antibioticsusceptibility

Bacteriophageantimicrobial peptides

P. acnes infection(Marinelli et al. 2012)

Use of bacteriophage peptides, such as endolysin,which promotes bacteria lysis during the lyticbacteriophage life cycle, against bacterial infections

Direct bacteriophagetherapy

Escherichia coli biofilminfections (Lu andCollins 2007)

Administration of bacteriophages, which can beengineered to express enzymes for biofilmdestruction, to combat biofilm-forming bacteriainfections

Skin Microbiome


ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



the microbial diversity across different skin sitesas well as the diversity between people, overtime, has emerged. It is becoming increasinglyapparent that certain microbes promote healthyskin equilibrium, and contemporary molecu-lar approaches have also provided greater in-formation about the role of microbial commu-nity disturbances in disease pathogenesis.

The commensal fungal and viral communi-ties in either health or disease remain largelyuncharacterized, and future investigations arelikely to focus on these knowledge gaps. Mostmolecular studies up to this point have focusedon taxonomic characterization of microbial skincommunities. Although this approach is valu-able because taxonomy provides a functionalproxy for patterns of the genomes present, newtechniques will allow for more in-depth investi-gations, beyond taxonomic identification. Inlight of increasingly feasible whole metageno-mic shotgun sequencing approaches, investiga-tions will be able to focus directly on the geneticfunctional potential and assess the communitycompositions of relevant genes. We also expectthat, with the ever-advancing technologies andbioinformatics associated with mRNA sequenc-ing (the metatranscriptome) and protein com-munityanalysis (the metaproteome), significanteffort will be directed toward the functionalaspects of microbiomes associated with skinhealth and disease.

Finally, a looming challenge is applyingthis knowledge to develop therapeutic and di-agnostic tools for the clinic. Enhanced under-standing of the skin microbiome will continueto inform research toward probiotic and pre-biotic development, prevention of antibiotic re-sistance gene transfer, bacteriophage-mediatedtreatments, and gene delivery using bacterialvectors. New therapeutic developments will al-low for a type of “microbiome engineering” inwhich the community composition will bestimulated and/or manipulated to include ben-eficial components. Additionally, in light of in-creasing antibiotic resistance across medicallyrelevant bacterial populations, there will likelybe an increased interest in alternative approach-es to treating infections, as well as slowing thespread of resistance.

ACKNOWLEDGMENTS

We thank members of the Grice laboratory fortheir underlying contributions. G.D.H. is sup-ported by the Department of Defense throughthe National Defense Science and EngineeringGraduate Fellowship Program. E.A.G. gratefullyacknowledges the support of the National Insti-tutes of Health (AR060873) and the Universityof Pennsylvania Skin Disease Research Center(supported by AR057217).

REFERENCES

Aly R, Maibach HE, Mandel A. 1976. Bacterial flora in pso-riasis. Br J Dermatol 95: 603–606.

Antonsson A, Forslund O, Ekberg H, Sterner G, HanssonBG. 2000. The ubiquity and impressive genomic diversityof human skin papillomaviruses suggest a commensalicnature of these viruses. J Virol 74: 11636–11641.

Antonsson A, Erfurt C, Hazard K, Holmgren V, Simon M,Kataoka A, Hossain S, Hakangard C, Hansson BG. 2003a.Prevalence and type spectrum of human papillomavirus-es in healthy skin samples collected in three continents.J Gen Virol 84: 1881–1886.

Antonsson A, Karanfilovska S, Lindqvist PG, Hansson BG.2003b. General acquisition of human papillomavirus in-fections of skin occurs in early infancy. J Clin Microbiol41: 2509–2514.

Arslanoglu S, Moro GE, Schmitt J, Tandoi L, Rizzardi S,Boehm G. 2008. Early dietary intervention with a mixtureof prebiotic oligosaccharides reduces the incidence ofallergic manifestations and infections during the firsttwo years of life. J Nutr 138: 1091–1095.

Astori G, Lavergne D, Benton C, Hockmayr B, Egawa K,Garbe C, de Villiers EM. 1998. Human papillomavirusesare commonly found in normal skin of immunocompe-tent hosts. J Invest Dermatol 110: 752–755.

Batchelor JM, Grindlay DJ, Williams HC. 2010. What’s newin atopic dermatitis? An analysis of systematic reviewspublished in 2008 and 2009. Clin Exp Dermatol 35:823–827.

Becker JC, Houben R, Ugurel S, Trefzer U, Pfohler C,Schrama D. 2009. MC polyomavirus is frequently presentin Merkel cell carcinoma of European patients. J InvestDermatol 129: 248–250.

Blaser MJ, Dominguez-Bello MG, Contreras M, Magris M,Hidalgo G, Estrada I, Gao Z, Clemente JC, Costello EK,Knight R. 2013. Distinct cutaneous bacterial assemblagesin a sampling of South American Amerindians and USresidents. ISME J 7: 85–95.

Boehncke WH, Dressel D, Zollner TM, Kaufmann R. 1996.Pulling the trigger on psoriasis. Nature 379: 777.

Branski LK, Al-Mousawi A, Rivero H, Jeschke MG, SanfordAP, Herndon DN. 2009. Emerging infections in burns.Surg Infect (Larchmt) 10: 389–397.

Bulmer AC, Bulmer GS. 1999. The antifungal action of dan-druff shampoos. Mycopathologia 147: 63–65.



ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



Capone KA, Dowd SE, Stamatas GN, Nikolovski J. 2011.Diversity of the human skin microbiome early in life. JInvest Dermatol 131: 2026–2032.

Chase MW, Fay MF. 2009. Ecology. Barcoding of plants andfungi. Science 325: 682–683.

Chehoud C, Rafail S, Tyldsley AS, Seykora JT, Lambris JD,Grice EA. 2013. Complement modulates the cutaneousmicrobiome and inflammatory milieu. Proc Natl Acad Sci110: 15061–15066.

Costello EK, Lauber CL, Hamady M, Fierer N, Gordon JI,Knight R. 2009. Bacterial community variation in humanbody habitats across space and time. Science 326: 1694–1697.

de Villiers EM, Lavergne D, McLaren K, Benton EC. 1997.Prevailing papillomavirus types in non-melanoma carci-nomas of the skin in renal allograft recipients. Int J Cancer73: 356–361.

Dominguez-Bello MG, Costello EK, Contreras M, MagrisM, Hidalgo G, Fierer N, Knight R. 2010. Delivery modeshapes the acquisition and structure of the initial micro-biota across multiple body habitats in newborns. ProcNatl Acad Sci 107: 11971–11975.

Dotterud CK, Storro O, Johnsen R, Oien T. 2010. Probioticsin pregnant women to prevent allergic disease: A ran-domized, double-blind trial. Br J Dermatol 163: 616–623.

Duan F, March JC. 2010. Engineered bacterial communica-tion prevents Vibrio cholerae virulence in an infant mousemodel. Proc Natl Acad Sci 107: 11260–11264.

Duncavage EJ, Zehnbauer BA, Pfeifer JD. 2009. Prevalenceof Merkel cell polyomavirus in Merkel cell carcinoma.Mod Pathol 22: 516–521.

Edgar R, Friedman N, Molshanski-Mor S, Qimron U. 2012.Reversing bacterial resistance to antibiotics by phage-me-diated delivery of dominant sensitive genes. Appl EnvironMicrobiol 78: 744–751.

Evans CA, Smith WM, Johnston EA, Giblett ER. 1950. Bac-terial flora of the normal human skin. J Invest Dermatol15: 305–324.

Fahlen A, Engstrand L, Baker BS, Powles A, Fry L. 2012.Comparison of bacterial microbiota in skin biopsiesfrom normal and psoriatic skin. Arch Dermatol Res 304:15–22.

Fancello L, Desnues C, Raoult D, Rolain JM. 2011. Bacteri-ophages and diffusion of genes encoding antimicrobialresistance in cystic fibrosis sputum microbiota. J Antimi-crob Chemother 66: 2448–2454.

Feng H, Shuda M, Chang Y, Moore PS. 2008. Clonal inte-gration of a polyomavirus in human Merkel cell carcino-ma. Science 319: 1096–1100.

Fierer N, Hamady M, Lauber CL, Knight R. 2008. The in-fluence of sex, handedness, and washing on the diversityof hand surface bacteria. Proc Natl Acad Sci 105: 17994–17999.

Findley K, Oh J, Yang J, Conlan S, Deming C, Meyer JA,Schoenfeld D, Nomicos E, Park M, Becker J, et al. 2013.Topographic diversity of fungal and bacterial communi-ties in human skin. Nature 498: 367–370.

Fischetti VA. 2008. Bacteriophage lysins as effective antibac-terials. Curr Opin Microbiol 11: 393–400.

Fitz-Gibbon S, Tomida S, Chiu BH, Nguyen L, Du C, Liu M,Elashoff D, Erfe MC, Loncaric A, Kim J, et al. 2013. Pro-pionibacterium acnes strain populations in the humanskin microbiome associated with acne. J Invest Dermatol133: 2152–2160.

Foolad N, Brezinski EA, Chase EP, Armstrong AW. 2013.Effect of nutrient supplementation on atopic dermatitisin children: A systematic review of probiotics, prebiotics,formula, and fatty acids. JAMA Dermatol 149: 350–355.

Forslund O. 2007. Genetic diversity of cutaneous humanpapillomaviruses. J Gen Virol 88: 2662–2669.

Foulongne V, Kluger N, Dereure O, Brieu N, Guillot B,Segondy M. 2008. Merkel cell polyomavirus and Merkelcell carcinoma, France. Emerg Infect Dis 14: 1491–1493.

Foulongne V, Dereure O, Kluger N, Moles JP, Guillot B,Segondy M. 2010. Merkel cell polyomavirus DNA detec-tion in lesional and nonlesional skin from patients withMerkel cell carcinoma or other skin diseases. Br J Derma-tol 162: 59–63.

Foulongne V, Sauvage V, Hebert C, Dereure O, Cheval J,Gouilh MA, Pariente K, Segondy M, Burguiere A, Man-uguerra JC, et al. 2012. Human skin microbiota: Highdiversity of DNAviruses identified on the human skin byhigh throughput sequencing. PLoS ONE 7: e38499.

Fuchs E, Raghavan S. 2002. Getting under the skin of epi-dermal morphogenesis. Nat Rev Genet 3: 199–209.

Gaitanis G, Magiatis P, Hantschke M, Bassukas ID, VelegrakiA. 2012. The Malassezia genus in skin and systemic dis-eases. Clin Microbiol Rev 25: 106–141.

Gao Z, Tseng CH, Pei Z, Blaser MJ. 2007. Molecular analysisof human forearm superficial skin bacterial biota. ProcNatl Acad Sci 104: 2927–2932.

Gao Z, Tseng CH, Strober BE, Pei Z, Blaser MJ. 2008. Sub-stantial alterations of the cutaneous bacterial biota inpsoriatic lesions. PLoS ONE 3: e2719.

Goerke C, Pantucek R, Holtfreter S, Schulte B, Zink M,Grumann D, Broker BM, Doskar J, Wolz C. 2009. Diver-sity of prophages in dominant Staphylococcus aureusclonal lineages. J Bacteriol 191: 3462–3468.

Gottlieb AB. 2005. Therapeutic options in the treatment ofpsoriasis and atopic dermatitis. J Am Acad Dermatol 53:S3–S16.

Grice EA, Segre JA. 2012. The human microbiome: Oursecond genome. Annu Rev Genomics Hum Genet 13:151–170.

Grice EA, Kong HH, Renaud G, Young AC, Bouffard GG,Blakesley RW, Wolfsberg TG, Turner ML, Segre JA. 2008.A diversity profile of the human skin microbiota. GenomeRes 18: 1043–1050.

Grice EA, Kong HK, Conlan S, Deming CB, Davis J, YoungAC, Program NCS, Bouffard GG, Blakesley RW, MurrayPR, et al. 2009. Topographical and temporal diversity ofthe human skin microbiome. Science 324: 1190–1192.

Haitz KA, Rady PL, Nguyen HP, He Q, Prieto VG, Tyring SK,Ciurea AM. 2012. Merkel cell polyomavirus DNA detec-tion in a patient with Merkel cell carcinoma and multipleother skin cancers. Int J Dermatol 51: 442–444.

Hodgson NC. 2005. Merkel cell carcinoma: Changing inci-dence trends. J Surg Oncol 89: 1–4.

Huang JT, Abrams M, Tlougan B, Rademaker A, Paller AS.2009. Treatment of Staphylococcus aureus colonization in

Skin Microbiome


ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



atopic dermatitis decreases disease severity. Pediatrics123: e808–e814.

Human Microbiome Project Consortium. 2012. Structure,function and diversity of the healthy human micro-biome. Nature 486: 207–214.

Jung HS, Choi YL, Choi JS, Roh JH, Pyon JK, Woo KJ, LeeEH, Jang KT, Han J, Park CS, et al. 2011. Detection ofMerkel cell polyomavirus in Merkel cell carcinomas andsmall cell carcinomas by PCR and immunohistochemis-try. Histol Histopathol 26: 1231–1241.

Kaga M, Sugita T, Nishikawa A, Wada Y, Hiruma M, Ikeda S.2011. Molecular analysis of the cutaneous Malasseziamicrobiota from the skin of patients with atopic derma-titis of different severities. Mycoses 54: e24–e28.

Kalliomaki M, Salminen S, Arvilommi H, Kero P, KoskinenP, Isolauri E. 2001. Probiotics in primary prevention ofatopic disease: A randomised placebo-controlled trial.Lancet 357: 1076–1079.

Kassem A, Schopflin A, Diaz C, Weyers W, Stickeler E, Wer-ner M, Zur Hausen A. 2008. Frequent detection of Merkelcell polyomavirus in human Merkel cell carcinomas andidentification of a unique deletion in the VP1 gene. Can-cer Res 68: 5009–5013.

Katano H, Ito H, Suzuki Y, Nakamura T, Sato Y, Tsuji T,Matsuo K, Nakagawa H, Sata T. 2009. Detection of Merkelcell polyomavirus in Merkel cell carcinoma and Kaposi’ssarcoma. J Med Virol 81: 1951–1958.

Kong HH, Oh J, Deming C, Conlan S, Grice EA, BeatsonMA, Nomicos E, Polley EC, Komarow HD, Murray PR,et al. 2012. Temporal shifts in the skin microbiome asso-ciated with disease flares and treatment in children withatopic dermatitis. Genome Res 22: 850–859.

Kwan T, Liu J, DuBow M, Gros P, Pelletier J. 2005. Thecomplete genomes and proteomes of 27 Staphylococcusaureus bacteriophages. Proc Natl Acad Sci 102: 5174–5179.

Lai Y, Di Nardo A, Nakatsuji T, Leichtle A, Yang Y, Cogen AL,Wu ZR, Hooper LV, Schmidt RR, von Aulock S, et al.2009. Commensal bacteria regulate Toll-like receptor 3-dependent inflammation after skin injury. Nat Med 15:1377–1382.

Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, Pace NR.1985. Rapid determination of 16S ribosomal RNA se-quences for phylogenetic analyses. Proc Natl Acad Sci82: 6955–6959.

Lew LC, Liong MT. 2013. Bioactives from probiotics fordermal health: Functions and benefits. J Appl Microbiol114: 1241–1253.

Lu TK, Collins JJ. 2007. Dispersing biofilms with engineeredenzymatic bacteriophage. Proc Natl Acad Sci 104: 11197–11202.

Mangana J, Dziunycz P, Kerl K, Dummer R, Cozzio A. 2010.Prevalence of Merkel cell polyomavirus among SwissMerkel cell carcinoma patients. Dermatology 221: 184–188.

Marinelli LJ, Fitz-Gibbon S, Hayes C, Bowman C, Inkeles M,Loncaric A, Russell DA, Jacobs-Sera D, Cokus S, Pelle-grini M, et al. 2012. Propionibacterium acnes bacterio-phages display limited genetic diversity and broadkilling activity against bacterial skin isolates. mBio 3:e00279–12.

Marples MJ. 1965. The ecology of the human skin. Thomas,Springfield, IL.

McGinley KJ, Leyden JJ, Marples RR, Kligman AM. 1975.Quantitative microbiology of the scalp in non-dandruff,dandruff, and seborrheic dermatitis. J Invest Dermatol 64:401–405.

Minot S, Sinha R, Chen J, Li H, Keilbaugh SA, Wu GD, LewisJD, Bushman FD. 2011. The human gut virome: Inter-individual variation and dynamic response to diet. Ge-nome Res 21: 1616–1625.

Moens U, Ludvigsen M, Van Ghelue M. 2011. Human poly-omaviruses in skin diseases. Patholog Res Int 2011:123491.

Moro G, Arslanoglu S, Stahl B, Jelinek J, Wahn U, Boehm G.2006. A mixture of prebiotic oligosaccharides reduces theincidence of atopic dermatitis during the first six monthsof age. Arch Dis Child 91: 814–819.

Muizzuddin N, Maher W, Sullivan M, Schnittger S, Mam-mone T. 2012. Physiological effect of a probiotic on skin.J Cosmet Sci 63: 385–395.

Naik S, Bouladoux N, Wilhelm C, Molloy MJ, Salcedo R,Kastenmuller W, Deming C, Quinones M, Koo L, ConlanS, et al. 2012. Compartmentalized control of skin immu-nity by resident commensals. Science 337: 1115–1119.

Nakaminami H, Noguchi N, Nishijima S, Kurokawa I, So H,Sasatsu M. 2007. Transduction of the plasmid encodingantiseptic resistance gene qacB in Staphylococcus aureus.Biol Pharm Bull 30: 1412–1415.

Nakatsuji T, Gallo RL. 2012. Antimicrobial peptides: Oldmolecules with new ideas. J Invest Dermatol 132: 887–895.

National Research Council Committee on Metagenomics.2007. The new science of metagenomics: Revealing the se-crets of our microbial planet. The National AcademiesPress, Washington, DC.

Nickoloff BJ, Schroder JM, von den Driesch P, RaychaudhuriSP, Farber EM, Boehncke WH, Morhenn VB, RosenbergEW, Schon MP, Holick MF. 2000. Is psoriasis a T-celldisease? Exp Dermatol 9: 359–375.

Oh J, Conlan S, Polley EC, Segre JA, Kong HH. 2012. Shiftsin human skin and nares microbiota of healthy childrenand adults. Genome Med 4: 77.

Otto M. 2009. Staphylococcus epidermidis—The “acciden-tal” pathogen. Nat Rev Microbiol 7: 555–567.

Paolini F, Donati P, Amantea A, Bucher S, Migliano E, VenutiA. 2011. Merkel cell polyomavirus in Merkel cell carcino-ma of Italian patients. Virol J 8: 103.

Park HK, Ha MH, Park SG, Kim MN, Kim BJ, Kim W. 2012.Characterization of the fungal microbiota (mycobiome)in healthy and dandruff-afflicted human scalps. PLoSONE 7: e32847.

Paulino LC, Tseng CH, Strober BE, Blaser MJ. 2006. Molec-ular analysis of fungal microbiota in samples fromhealthy human skin and psoriatic lesions. J Clin Microbiol44: 2933–2941.

Paulino LC, Tseng CH, Blaser MJ. 2008. Analysis of Malas-sezia microbiota in healthy superficial human skin and inpsoriatic lesions by multiplex real-time PCR. FEMS YeastRes 8: 460–471.

Penders J, Stobberingh EE, Thijs C, Adams H, Vink C, vanRee R, van den Brandt PA. 2006. Molecular fingerprint-



ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



ing of the intestinal microbiota of infants in whom atopiceczema was or was not developing. Clin Exp Allergy 36:1602–1608.

Penders J, Thijs C, van den Brandt PA, Kummeling I,Snijders B, Stelma F, Adams H, van Ree R, StobberinghEE. 2007. Gut microbiota composition and developmentof atopic manifestations in infancy: The KOALA BirthCohort Study. Gut 56: 661–667.

Rosenberg EW, Noah PW, Skinner RB Jr. 1994. Microorgan-isms and psoriasis. J Natl Med Assoc 86: 305–310.

Sandilands A, Terron-Kwiatkowski A, Hull PR, O’ReganGM, Clayton TH, Watson RM, Carrick T, Evans AT,Liao H, Zhao Y, et al. 2007. Comprehensive analysis ofthe gene encoding filaggrin uncovers prevalent and raremutations in ichthyosis vulgaris and atopic eczema. NatGenet 39: 650–654.

Scharschmidt TC, List K, Grice EA, Szabo R, Renaud G, LeeCC, Wolfsberg TG, Bugge TH, Segre JA. 2009. Matrip-tase-deficient mice exhibit ichthyotic skin with a selectiveshift in skin microbiota. J Invest Dermatol 129: 2435–2442.

Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL,Buck CB. 2010. Merkel cell polyomavirus and two previ-ously unknown polyomaviruses are chronically shedfrom human skin. Cell Host Microbe 7: 509–515.

Shu M, Wang Y, Yu J, Kuo S, Coda A, Jiang Y, Gallo RL,Huang CM. 2013. Fermentation of Propionibacteriumacnes, a commensal bacterium in the human skin micro-biome, as skin probiotics against methicillin-resistantStaphylococcus aureus. PLoS ONE 8: e55380.

Staudinger T, Pipal A, Redl B. 2011. Molecular analysis of theprevalent microbiota of human male and female fore-head skin compared to forearm skin and the influenceof make-up. J Appl Microbiol 110: 1381–1389.

Tan HH. 2003. Antibacterial therapy for acne: A guide toselection and use of systemic agents. Am J Clin Dermatol4: 307–314.

Terada M, Tsutsui H, Imai Y, Yasuda K, Mizutani H, Yama-nishi K, Kubo M, Matsui K, Sano H, Nakanishi K. 2006.Contribution of IL-18 to atopic-dermatitis-like skin in-flammation induced by Staphylococcus aureus product inmice. Proc Natl Acad Sci 103: 8816–8821.

Touze A, Gaitan J, Maruani A, Le Bidre E, DoussinaudA, Clavel C, Durlach A, Aubin F, Guyetant S, Lorette G,et al. 2009. Merkel cell polyomavirus strains in patientswith Merkel cell carcinoma. Emerg Infect Dis 15: 960–962.

Travers JB, Kozman A, Mousdicas N, Saha C, Landis M, Al-Hassani M, Yao W, Yao Y, Hyatt AM, Sheehan MP, et al.2010. Infected atopic dermatitis lesions contain pharma-cologic amounts of lipoteichoic acid. J Allergy ClinImmunol 125: 146–152.

Varga M, Kuntova L, Pantucek R, Maslanova I, Ruzickova V,Doskar J. 2012. Efficient transfer of antibiotic resistanceplasmids by transduction within methicillin-resistantStaphylococcus aureus USA300 clone. FEMS MicrobiolLett 332: 146–152.

Wang M, Karlsson C, Olsson C, Adlerberth I, Wold AE,Strachan DP, Martricardi PM, Aberg N, Perkin MR, Tri-podi S, et al. 2008. Reduced diversity in the early fecalmicrobiota of infants with atopic eczema. J Allergy ClinImmunol 121: 129–134.

Wang X, Kim Y, Ma Q, Hong SH, Pokusaeva K, Sturino JM,Wood TK. 2010. Cryptic prophages help bacteria copewith adverse environments. Nat Commun 1: 147.

Wickens K, Black PN, Stanley TV, Mitchell E, Fitzharris P,Tannock GW, Purdie G, Crane J. 2008. A differentialeffect of 2 probiotics in the prevention of eczema andatopy: A double-blind, randomized, placebo-controlledtrial. J Allergy Clin Immunol 122: 788–794.

Wickens K, Black P, Stanley TV, Mitchell E, Barthow C,Fitzharris P, Purdie G, Crane J. 2012. A protective effectof Lactobacillus rhamnosus HN001 against eczema in thefirst 2 years of life persists to age 4 years. Clin Exp Allergy42: 1071–1079.

Yao Y, Kozman A, Al-Hassani M, Saha CK, Yi Q, Yao W,Mousdicas N, Kaplan MH, Travers JB. 2010. Identifica-tion of staphylococcal protein A in infected atopic der-matitis lesions. J Invest Dermatol 130: 2502–2504.

Zhang E, Tanaka T, Tajima M, Tsuboi R, Nishikawa A, SugitaT. 2011. Characterization of the skin fungal microbiota inpatients with atopic dermatitis and in healthy subjects.Microbiol Immunol 55: 625–632.

Skin Microbiome


ww

w.p

ersp

ecti

vesi

nm

edic

ine.

org



2013; doi: 10.1101/cshperspect.a015362Cold Spring Harb Perspect Med Geoffrey D. Hannigan and Elizabeth A. Grice Molecular MicrobiologyMicrobial Ecology of the Skin in the Era of Metagenomics and

Subject Collection The Skin and Its Diseases

InsightsMelanoma: Clinical Features and Genomic

Elena B. Hawryluk and Hensin TsaoDevelopment in the MouseModeling Cutaneous Squamous Carcinoma

Phillips Y. Huang and Allan BalmainWound Healing and Skin Regeneration

Makoto Takeo, Wendy Lee and Mayumi ItoNatural and Sun-Induced Aging of Human Skin

Laure Rittié and Gary J. Fisher

Development and Regeneration of the Hair FollicleEpithelial Stem and Progenitor Cells in The Dermal Papilla: An Instructive Niche for

Bruce A. Morgan

Advanced Treatment for Basal Cell Carcinomas

OroScott X. Atwood, Ramon J. Whitson and Anthony E.

Immunology and Skin in Health and DiseaseJillian M. Richmond and John E. Harris

Epidermal Polarity Genes in Health and Disease

M. NiessenFrederik Tellkamp, Susanne Vorhagen and Carien

and Adhesion in Epidermal Health and DiseaseDesmosomes: Regulators of Cellular Signaling

GreenJodi L. Johnson, Nicole A. Najor and Kathleen J.

Potentials, Advances, and LimitationsInduced Pluripotent Stem Cells in Dermatology:

Ganna Bilousova and Dennis R. Roop

in Adult Mammalian SkinMarkers of Epidermal Stem Cell Subpopulations

Kai Kretzschmar and Fiona M. Watt

The Genetics of Human Skin DiseaseGina M. DeStefano and Angela M. Christiano

Psoriasis

NestlePaola Di Meglio, Federica Villanova and Frank O. Disease

p53/p63/p73 in the Epidermis in Health and

Vladimir A. Botchkarev and Elsa R. FloresCell Therapy in Dermatology

McGrathGabriela Petrof, Alya Abdul-Wahab and John A. Receptors in Skin

Diversification and Specialization of Touch

David M. Owens and Ellen A. Lumpkin

http://perspectivesinmedicine.cshlp.org/cgi/collection/ For additional articles in this collection, see

Copyright © 2013 Cold Spring Harbor Laboratory Press; all rights reserved


http://perspectivesinmedicine.cshlp.org/cgi/collection/

http://perspectivesinmedicine.cshlp.org/cgi/collection/


microbial ecology of the skin in the era of metagenomics and … · microbial ecology of the skin...

Documents