methods to study litter decomposition || manipulation of stream retentiveness

169M.A.S. Graça, F. Bärlocher & M.O. Gessner (eds.), Methods to Study Litter Decomposition:A Practical Guide, 169 – 176.© 2005 Springer. Printed in The Netherlands.

CHAPTER 22

MOLECULAR APPROACHES TO ESTIMATE

FUNGAL DIVERSITY. I. TERMINAL

RESTRICTION FRAGMENT LENGTH

POLYMORPHISM (T-RFLP)

LILIYA G. NIKOLCHEVA & FELIX BÄRLOCHER

63B York Street, Dept. of Biology, Mt. Allison University, Sackville, NB, Canada E4L 1G7.

1. INTRODUCTION

The major ecological function of aquatic hyphomycetes centres around the breakdown of leaves and other plant detritus in streams and rivers (Bärlocher 1992,Gessner et al. 2003). To fully characterize the fungal contribution to leaf decay and invertebrate nutrition, it is essential to subdivide the community into its constituentspecies and to determine the contribution of each species to the total fungal biomassfproduction and leaf breakdown.

The most commonly used approach to describe community structure of aquatichyphomycetes is based on inducing sporulation in mycelia present in the substrate(Gessner et al. 2003, Chapter 24). Released conidia are captured on a membranefilter, stained, counted and identified. This method will miss mycelia that do not sporulate, either because they are too small (recently established), too old (e.g.because they are dormant), or too slow to form conidia during standard incubationperiods (commonly 48 h). Among aquatic hyphomycetes, the number of releasedspores is not necessarily correlated with mycelial biomass on the substrate (Bermingham et al. 1997), and in some cases reliable identification may be hampered by broadly overlapping spore morphologies (Chapter 21). The conventional approach will also miss the presence of fungal taxa other than aquatichyphomycetes (e.g., some Ascomycota and Basidiomycota. Chytridiomycota,Zygomycota, and Oomycota).

Molecular approaches, based on characterizing the sequence and diversity of nucleic acids (most notably DNA), potentially circumvent these problems. For example, a recently developed system for field use can detect and identify a bacterialspecies in less than 10 min (Belgrader et al. 1999). The advantage of molecular

170 L.G. NIKOLCHEVANN & F.BÄRLOCHERBB

techniques in general is their extreme sensitivity (very low microbial biomass can be detected), and their applicability to all stages of the microbial life cycle.

When applied to microbial community diversity, molecular techniques most often rely on the amplification of DNA with taxon-specific primers (Borneman & Hatrin 2000) and subsequent characterization of the diversity of amplified DNA(Head et al. 1998). A high-throughput technique developed in bacterial ecology isterminal restriction fragment length polymorphism (T-RFLP). In T-RFLP, the extracted DNA is amplified with one or both of two primers fluorescently labelled atttthe 5’ end. The products of the polymerase chain reaction (PCR) are then digestedwith a restriction enzyme, and the labelled terminal fragments are separated anddetected on a DNA sequencer. The number of DNA fragments of different sizes gives an estimate of the minimum number of strains present in the analyzed community (Liu et al. 1997). Thus, the number of fragments detected is indicative of the number of phylogenetically different strains (phylotypes) present in a sample. The pattern of fragments obtained from T-RFLP is compared to the fragment lengthsgenerated from digestion of DNA from pure cultures of aquatic hyphomycetes(Nikolcheva et al. 2003). Although this technique cannot be used to identify fungalspecies or strains, it provides a good estimate of the number of fungal phylotypeswhich is related to the fungal species richness on each substrate. This fast, high-throughput technique has been used to characterize fungi associated with Spartinaalterniflora decaying in salt marshes (Buchan et al. 2002), and with soil fungi(Klamer et al. 2002).

The method for T-RFLP presented here is modified from Nikolcheva et al. (2003) and describes DNA extraction, amplification and purification, followed byffendonuclease digestion and separation of the fragments. The technique has been adapted to the specific materials and equipment available at our laboratory but can easily be modified for other laboratory set-ups.

2. EQUIPMENT, CHEMICALS AND SOLUTIONS

2.1. Equipment and Material

Pure fungal cultures Autumn-shed leaves, air dried Litter bags (10 x 10 cm, 10, 1 or 0.5 mm mesh size) Filtering apparatus and 8 µm membrane filters (e.g. Millipore Corporation,Bedford, MA)Freeze-dryerMortar and pestle MoBio Ultra Clean Soil DNA extraction kit (MoBio, Solana Beach, CA, USA)or Nucleon PhytoPure Plant DNA Extraction Kit (Amersham Biosciences, Piscataway, NJ, USA) 3 pipettes: ranges of 0.5—10, 2—20 and 20—200 µl Pipette tips: 0.1—20 µl (white) and 2—200 µl (yellow)

FUNGAL DIVERSITY I: T-RFLP 171

Ready-to-go PCR Beads (Amersham Biosciences, Piscataway, New Jersey,USA). Any other available PCR mix should work as well. Chambers for running horizontal agarose gelsPCR thermocyclerParafilmDNA automated sequencer with fragment analysis software (e.g. Visible Genetics Long Read Tower by Visible Genetics, Suwanee, Georgia, USA)Water bath at 37 °C Ice bath

2.2. Chemicals

Agarose (molecular biology grade)Malt brothLiquid nitrogenTris(hydroxymethyl)aminomethane (TRIS, analytical grade) Ethylenediaminetetraaceticacid (EDTA, analytical grade)Sodium acetate Boric acidAcrylamide (6% for sequencing gels, Visible Genetics). The acrylamide must be compatible with the type of automated sequencer used.Bromophenol blueGlycerolAutoclaved deionized water (e.g. Milli-Q quality)Primers for the PCR reaction, specifically the fungal-specific primer F1300 (5’ GATAACGAACGAGACCTTAAC 3’; Nikolcheva et al. 2003) labelled at the5’ end with Cy5.5 and the primer D (5’ CYGCAGGTTCACCTAC 3’; Elwood et al. 1985) labelled at the 5’ end with Cy5. Primer NS8 (5’ TCCGCAGGTTCACCTACGGA 3’; White et al. 1990) can be used instead of primer D. Fluorescent DNA stain, preferably GelStar (BioWhittacker Molecular Applications, Rockland, Maine, USA), but ethidium bromide or other stains can also be used.DNA ladder with 100 or 250 base pairs (bp; Amersham Biosciences)Dimethyl sulfoxide (DMSO, analytical grade) Formamide loading dye, which is included with the sequencing kit; it keeps theDNA single-stranded before separation of the fragments by gel electrophoresis. GFX PCR and gel band purification kit (Amersham Biosciences)Restriction enzymes CfoI, RsaI, HinfI and DdeI (Roche Diagnostics, Indianapolis, IN, USA)Buffers for restriction enzymes: SuRE cut buffer L and buffer H (RocheDiagnostics); these buffers are supplied with the restriction enzymes.


ALF Express Sizer 50—500 bases (Amersham Biosciences). This DNAstandard works only if the automated sequencer can detect Cy5 and Cy5.5fluorescent dyes. If the sequencer has a different detection system, DNAfragments of standard sizes labelled with appropriate dyes must be used.

2.3.Solutions

5 TBE (450 mM Tris, 450 mM boric acid, 13 mM EDTA)1 TBE (100 ml 5 TBE and 400 ml deionized water)0.5 TBE (100 ml 5 TBE and 900 ml deionized water)Agarose gel loading buffer (5 ml glycerol, 5 ml water, 5 mg bromophenol blue)100 GelStar DNA stain (2 µl concentrated GelStar, 198 µl DMSO)

3. EXPERIMENTAL PROCEDURES

3.1. Sample Preparation

1. Grow pure fungal cultures in malt broth for 3 weeks. Filter through an 8-µmfilter and freeze-dry overnight. The collected mycelia can be stored indefinitelydat –80 °C.

2. Expose leaves in litter bags in the field and collected as described in Chapter 6. 3. Rinse leaves to remove any adhering particles, freeze-dry and store at –80 °C.

3.2. DNA Extraction

1. Use 30 mg of the dry pure fungal culture or up to 50 mg of dry plant tissue.Gently grind the samples with a mortar and pestle in liquid nitrogen for no more than 1 min.

2. Use the MoBio UltraClean Soil DNA extraction kit and follow themanufacturer’s instruction for DNA isolation. The Nucleon PhytoPure Kit mayalso be used. Elute or resuspend the extracted DNA in 50 µl autoclaved deionized water.

3. The extracted DNA can be stored for up to 2 months at 4 °C or indefinitely at r–20 °C.

3.3. DNA Amplification

1. To a Ready-to-go PCR bead add 19 µl of deionized autoclaved water, 2 µl of 10 µM forward primer (F1300; Nikolcheva et al. 2003), 2 µl of 10 µM reverseprimer (D; Elwood et al. 1985) and 2 µl of extracted DNA.

2. Place all amplification reactions in a thermocycler programmed for 2 min of 95 °C initial denaturation followed by 35 cycles of denaturation at 95 °C for30 s, primer annealing at 55 °C for 30 s and primer extension at 72 °C for 1 min.


End the program with 72 °C for 5 min of final extension. Store the PCR products at 4 °C.

3.4. Agarose Gel Electrophoresis

1. To check the concentration and quality of the PCR products, run an agarose gel.f2. Mix 30 ml 0.5 TBE buffer with 300 mg agarose. Microwave until the agarose

has melted, then cast the gel. Let it solidify for 20 min.3. Mix 1 µl loading dye, 0.7 µl 100 GelStar and 2 µl of PCR product (or 0.5 µg

DNA ladder) on a piece of Parafilm. 4. Load the entire reaction in a well of the gel. Run the gel in 0.5 TBE buffer at

160 V for 15 min. 5. View on a UV transilluminator (wear protective glasses!).

3.5. DNA Purification

1. Purify the PCR products from solution (there should be 23 µl left) with GFXDNA and the gel band purification kit. Use the manufacturer’s protocol forpurification of PCR products from solution.

2. If the calculated DNA concentration from the agarose gel is between 0.1 and 0.3 µg ml-1, elute the DNA with 50 µl deionized water. If the concentration islower, elute in 25 µl.

3.6. Restriction Digest

1. Each digestion reaction contains 4.5 µl purified PCR product, 0.5 µl 10enzyme buffer (buffer L is suitable for CfoI and RsaI, buffer H is suitable forDdeI and HinfI) and 5 U restriction enzyme.

2. If the restriction enzyme cleavage of DNA fragments is performed with a singleenzyme, use 5 U of that enzyme. If the restriction is performed with two enzymes acting simultaneously, use 2.5 U of each. The enzymes CfoI and RsaIare compatible with each other, because both require SuRe cut buffer L; DdeI and HinfI are also compatible with one another, as they require SuRe cut buffer H.

3. Incubate the digestion reactions in a water bath or in the thermocycler at 37 °C for 2 h. The digestion products should be used immediately or stored at –20 °C.

3.7. Separation of Terminal Rrestriction Fragments

1. Prepare digestion products for loading on sequencing gel or capillary.2. Combine 2 µl digestion product, 3 µl deionized water and 3 µl formamide

loading dye.3. For each set of 8 reaction mixtures, use 2 µl of the ALF express 50—500 bp

sizer and 3 µl loading dye to run an external control.


4. Incubate all mixtures in a preheated thermocycler at 90 °C for 3 min to denaturethe DNA and then place them immediately on ice to keep the DNA single-stranded.

5. Load 2 µl of each sample on a sequencing gel within 1 h after denaturation.6. Run the gel in 1 TBE buffer at 1500 V and 52 °C for 45 min. The conditions

for electrophoresis are specific to the automated sequencer used.

4. FINAL REMARKS

For calibration, the DNA from pure fungal cultures can be analyzed before the environmental samples. Each fungal species should theoretically yield one fragment, and ideally, the fragment length is species-specific. However, some primers will amplify conserved genes and some enzymes will cut at a conserved region in DNA; when this happens, fragments of different species or genera may be identical. The results of a T-RFLP analysis (i.e., number of fragments differing in length) thereforeprovide an estimate of how much variability can be detected with a givenprimer/enzyme combination, and true diversity will generally be underestimated. In our experience, the enzyme DdeI gives the highest variability among pure fungalcultures. This restriction enzyme was therefore used to analyze environmentalsamples (Fig. 22.1). The fragment lengths obtained from pure cultures can becompared to observed lengths in environmental samples; if the peaks on the chromatograms coincide, the environmental samples may contain the particularfungal species. However, the fragments in the environmental samples cannot beidentified with certainty.

Rather than using extraction kits, DNA can be extracted from samples with a standard SDS or CTAB-based phenol-chloroform procedure. The DNA yield fromthese types of extractions can be very high, but in our experience the DNA quality is often poor, making amplification by PCR impossible.

In our experience, the 18S rRNA restrictions enzymes CfoI and DdeI detect the highest community variability (Nikolcheva et al. 2003), and a combination of restriction enzymes may result in an even higher interspecific variability(Nikolcheva & Bärlocher 2004).r


Fig. 22.1. T-RFLP chromatograms from fungal communities associated with alder, beech,and oak leaves after 7 days of exposure in a stream. The 3’ end of the 18S rRNA gene was

amplified with a fungal-specific primer pair and digested with DdeI. The peak designated byithe arrow is unextended primer. The lane labeled “controls” contains fragments from the

digestion of A: Anguillospora furtiva, B:a Colispora elongata, C: a Articulospora tetracladia, D:aAnguillospora rubescens, E: Tetracladium marchalianum, and F:m Heliscus lugdunensis.


5. REFERENCES

Bärlocher, F. (1992). The Ecology of Aquatic Hyphomycetes. Springer-Verlag. Berlin.Belgrader, P., Benett, W., Hadley, D., Richards, J., Stratton, P., Mariella Jr., R. & Milanovich, F. (1999).

PCR detection of bacteria in seven minutes. Science, 284, 449-450. Bermingham, S., Maltby, L. & Dewey, F.M. (1997). Use of immunoassays for the study of natural

assemblages of aquatic hyphomycetes. Microbial Ecology, 33, 223-229. Borneman, J. & Hatrin, R.J. (2000). PCR primers that amplify fungal rRNA genes from environmental

samples. Applied and Environmental Microbiology, 66, 4356-4360.Buchan, A., Newell, S.Y., Moreta, J.I.L. & Moran, M.A. (2002). Analysis of internal transcribed spacer

(ITS) regions of rRNA genes in fungal communities in a southeastern U.S. salt marsh. MicrobialEcology, 43, 329-340.

Elwood, H.J., Olsen, G.J. & Sogin, M.L. (1985). The small-subunit ribosomal RNA gene sequences fromthe hypotrichous ciliates Oxytricha nova and Stylonychia pustulata. Molecular and BiologicalEvolution, 2, 399-410.

Gessner, M.O., Bärlocher, F. & Chauvet, E. (2003). Qualitative and quantitative analyses of aquatic hyphomycetes in streams. In: C.K.M. Tsui & K.D. Hyde (eds.). Freshwater Mycology (pp. 127-157).Fungal Diversity Press. Hong Kong.

Head, I.M., Sanders, J.R. & Pickup, R.W. (1998). Microbial evolution, diversity, and ecology: a decadeof ribosomal RNA analysis of uncultivated organisms. Microbial Ecology, 35, 1-21.

Klamer, M., Roberts, M.S., Levine, L.H., Drake, B.G. & Graland, J.L. (2002). Influence of elevated CO2

on the fungal community in a coastal scrub oak forest soil investigated with Terminal-RestrictionFragment Length Polymorphism analysis. Applied and Environmental Microbiology, 68, 4370-4376.

Liu, W.-T., Marsh, T.L., Cheng, H. & Forney, L.J. (1997). Characterization of microbial diversity bydetermining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Applied and Environmental Microbiology, 63, 4516-4522.

Nikolcheva, L.G. & Bärlocher,F. (2004). Seasonal and substrate preferences of fungi colonizing leaves in streams: traditional vs. molecular evidence. Environmental Microbiology, in press.

Nikolcheva, L.G., Cockshutt, A.M. & Bärlocher, F. (2003). Diversity of freshwater fungi on decaying leaves: comparing traditional and molecular approaches. Applied and Environmental Microbiology,69, 2548-2554.

White, T.J., Bruns, T., Lee, S. & Taylor, J.W. (1990). Amplification and direct sequencing of fungalribosomal RNA genes for phylogenetics. In: M. A. Innis, D. H. Gelfand, J. J. Sninsky & T.J. White (eds.). PCR protocols: A guide to Methods and Applications (pp. 315-322). Academic Press, Inc. New York.

methods to study litter decomposition || manipulation of stream retentiveness

Documents