mechanistic insight into binding interaction between ......mechanistic insight into binding...

International Journal of Biological Macromolecules 141 (2019) xxx

BIOMAC-13286; No of Pages 11

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules

j ourna l homepage: ht tp : / /www.e lsev ie r .com/ locate / i jb iomac

Mechanistic insight into binding interaction between chemosensoryprotein 4 and volatile larval pheromones in honeybees (Apis mellifera)

Fan Wu a, Yilu Feng b, Bin Han a, Han Hu a, Mao Feng a, Lifeng Meng a, Chuan Ma a, Linsheng Yu c,⁎, Jianke Li a,⁎a Institute of Apicultural Research/Key Laboratory of Pollinating Insect Biology, Ministry of Agriculture, Chinese Academy of Agricultural Science, Beijing 100081, PR Chinab State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, PR Chinac Anhui Agricultural University, Anhui 230036, PR China

⁎ Corresponding authors.E-mail addresses: [email protected] (L. Yu), ap

https://doi.org/10.1016/j.ijbiomac.2019.09.0410141-8130/© 2019 Published by Elsevier B.V.

Please cite this article as: F. Wu, Y. Feng, B. Hlarval pher..., , https://doi.org/10.1016/j.ijbio

a b s t r a c t
a r t i c l e i n f o
Article history:Received 19 June 2019Received in revised form 5 September 2019Accepted 5 September 2019Available online xxxx

Honeybees communicate with members of their intra-species via pheromones. The volatile pheromones, β-ocimene and allo-ocimene, are the primary signals of larvae to beg for the care from the nurses. Of the odorantbinding proteins (OBPs)/chemosensory proteins (CSPs), CSP4 has the best affinity with β-ocimene and allo-ocimene. To reveal the bindingmechanism of CPS4with them,fluorescent quenching, UV absorption spectra, cir-cular dichroism (CD) spectra, isothermal titration calorimetry (ITC),molecular docking,molecular dynamic (MD)simulation, and site-directed mutagenesis were applied. The quenching constant Ksv decreased with tempera-ture increase, and the interaction distance was 2.73 nm and 2.43 nm (b10 nm), indicating that β-ocimene andallo-ocimene could form stable complexes with CSP4. The observed△H b 0 and△S N 0 of thermodynamics sug-gest themain driving forces are electrostatic or hydrophobic force. All above thermodynamics findings are in linewith the results of ITC experiments. Furthermore, molecular docking,MD simulation and site-directedmutagen-esis indicate the binding cavities are located at cavity 1 in C-terminal of CSP4, where Tyr98 and Asp67 are vitalamino acids in maintaining the stable form of protein and larval pheromones, and electrostatic energies arethe main driving forces. Our findings gain novel insight into the binding mechanism of chemosensory proteinwith volatile larval pheromones and are important for understanding olfactory interaction of honeybees.

© 2019 Published by Elsevier B.V.

Keywords:Chemosensory proteinsVolatile larval pheromonesFluorescence spectroscopyQuenching mechanismMolecular dockingSite-directed mutation

1. Introduction

Sense of smell enables insects to locatemates, food sources, and ovi-position sites. For social insects, the olfactory system of honeybees (Apismellifera) is critical for detection and discrimination of olfactory cues,which is the predominant mode of coordination in the societies and isessential for colony communication [1,2]. The olfactory system is or-chestrated at various levels, starting with reception of odor at the pe-riphery, processing of signals at the antennal lobes and the highercenters of the brain, and ultimately translation of olfactory signals intobehavior and physiological changes [3]. Two families of olfaction-related small soluble proteins, odorant binding proteins (OBPs) andchemosensory proteins (CSPs) act as carriers for hydrophobic odors orpheromones through the aqueous sensillar lymph as thefirst step of sig-nal transduction [4]. In the genome of A. mellifera, 21 OBPs and 6 CSPsare identified [5,6]. All these olfactory proteins can transport a varietyof odor molecules and pheromones to odorant receptors in insects [4].Therefore, it is necessary to study the binding function of OBPs and CSPs.

The typical characteristics of OBPs and CSPs in insects are the inter-nal hydrophobic cavity that is favorable to bind suitable ligands [7]. To

[email protected] (J. Li).

an, et al., Mechanistic insightmac.2019.09.041

date, only 20 OBPs and 3 CSPs structures have been characterized in in-sects [8]. The methods for analyzing structure in common are X-raycrystallography and nuclear magnetic resonance (NMR) spectroscopy.The first reported structure of OBP is the pheromone binding protein(PBP) of Bombyx Mori [9], and the first CSP structure is CSPMbraA6 ofthe moth Mamestra brassicae [10]. In honeybees, the structures ofOBP1 andOBP14 are established byX-raydiffraction, ofwhich the struc-ture of OBP1 could be altered at pH 4.0, 5.5, and 7.0 [11]. For OBP14, thecavity is quite variable and can reshape to bind different odorant mole-cules [12]. These findings are suggestive of the fact that the pH of solu-tions and ligands could impact on the structure of binding proteins inhoneybees.

Comparing to structure analysis, fluorescence assay is an efficientplatform to study the binding activity of OBPs or CSPs,whichprovide es-sential information for understanding their physiological function [13].OBP1 (Antenna-specific protein 1, ASP1) is selectively expressed inworkers and drones with a good affinity for mandibular pheromonesof queen bees,which could have an impact on social behavior and phys-iology of bees [14,15]. OBP2 (Antenna-specific protein 2, ASP2) is able tobind 2-heptanone [16], an alarm pheromone that could mark bitten in-dividuals [17]. OBP3, highly expressed in mated queen bees, could bindwith benzoate [18,19]. The gene of Obp5 is highly expressed in 10- and15-day-old workers and has a good affinity with both benzyl alcohol

into binding interaction between chemosensory protein 4 and volatile

http://crossmark.crossref.org/dialog/?doi=10.1016/j.ijbiomac.2019.09.041&domain=pdf

https://doi.org/10.1016/j.ijbiomac.2019.09.041

mailto:[email protected]

mailto:[email protected]

Journal logo


http://www.sciencedirect.com/science/journal/

http://www.elsevier.com/locate/ijbiomac


2 F. Wu et al. / International Journal of Biological Macromolecules 141 (2019) xxx

and 2-phenylethanol, which are present in the volatile compounds ofchalkbrood disease-infected larvae [20]. OBP13 is mostly abundant inyoung worker larvae and virgin queens, and specifically binds witholeic acid and some structurally related compounds [21] which areemitted by the brood and cause long-term alteration to the receiver'sphysiological [22,23]. OBP14 is highly abundant in the mandibularglands of hive bees and better associated with monoterpenoid struc-tures [21], which improve the olfactory learning and memory [24].OBP16 and OBP18 have a strong binding force to β-ocimene and oleicacid, respectively, which are associated with hygienic behavior [25].OBP21 is abundant in old bees and binds farnesol [21], a trail phero-mone that attracts honeybee swarms [26]. However, olfactory functionsof CSPs in honeybees are poorly understood in the peripheralchemosensory system. CSP3 (Antenna-specific protein 3, ASP3) isshown to bind specifically to large fatty acids and ester derivatives[27] that is emitted by the brood, and thus affect the behavior of nursebees [23]. All these evidences are indicative of the fact that OBPs andCSPs are able to bind with a wide range of ligands, but are inclined totransport different odors or honeybee pheromones with a high bindingforce.

As a social insect, the cost of reproduction and brood care lead tocentral trade-offs in life-history. In honeybee colonies, all brood care isperformedby the nurse bees [28]. To prompt identify and accept the lar-vae in the comb cells, efficient interactions between larvae and workerbees are required. There are two classes of brood pheromones: non-volatile 10 fatty aliphatic esters and volatile β-ocimene [29,30]. The 10fatty aliphatic esters urge the adults to feed larvae and cap the broodcells [23,31]. Starving honeybee larvae evolve a skill to beg the needfor food from nurse bees by releasing β-ocimene, a pheromone signalto which worker bees react by attending brood [32]. Additional, our re-cent works have identified a new volatile larval pheromone allo-ocimene, which could also elicit antennal signaling and attract nursebees to care for the larvae (In press). However, there is nomore relevantresearch of combine mechanism or process between binding proteinsand volatile larval pheromones. To this end, we used a fluorescencecompetitive binding experiment to find the strongest binding force be-tween the olfactory proteins and volatile larval pheromones. Then, weapplied fluorescence quenching assays, circular dichroism (CD) spectra,isothermal titration calorimetry (ITC), and UV-absorption spectra to re-veal the physicochemicalmechanismof howvolatile larval pheromonesare carried by the transporter through the hydrophilic lymph of special-ized sensilla. Furthermore, homology modeling, molecular docking anddynamic simulation, and site-directed mutagenesis were employed toexplore the binding mode, and to confirm the key amino acids andtheir function during the binding processes of the protein with volatilelarval pheromones.

2. Materials and methods

The recombinant plasmid pET-30a (+)-OBPs/CSPs were con-structed and kept in our laboratory. The kits used for PCR and plas-mid extraction were bought from TaKaRa (Japan). Primers weresynthesized by Sangon biotech Co. Ltd. (Shanghai, China). ProteinNi-NTA Resin kit and the site directed mutagenesis systemwere pur-chased from Transgen Biotech Co. Ltd. (Beijing, China). The reagentsof protein electrophoresis were purchased from Beyotime Biotech-nology (Shanghai, China). The β-ocimene (purity N99%) and allo-ocimene (purity N80%) were purchased from Sigma-Aldrich(Taufkirchen, Germany). Other unspecified reagents were domesticchemicals of analytical grade.

The expression and purification of the wild OBPs/CSPs and mutatedCSP4 proteins were performed as described before [33] and visualizedby12%SDS–PAGE for confirmation. Theywere then prepared by dialysisagainst a 20mmol/L PBS buffer (pH 7.4) at 4 °C for 72 h, and the concen-trations were determined and stored at−80 °C until use.

Please cite this article as: F. Wu, Y. Feng, B. Han, et al., Mechanistic insightlarval pher..., , https://doi.org/10.1016/j.ijbiomac.2019.09.041

2.1. Fluorescence competitive binding experiment

To measure the binding force between olfactory proteins and broodchemicals, competitive bindingwasmeasured by titrating amixed solu-tion of protein and 1-NPN with 1 mM β-ocimene and allo-ocimene inmethanol. The competitive binding affinity between proteins and testedligands was measured on a RF-5301 PC spectrofluorimeter (Shimadzu,Japan) with a 1.0 cm quartz cell. The purified proteins were dissolvedin PBS (20mmol/L, pH 7.4) at a final concentration of 1 μmol/L. The fluo-rescent probe N-phenyl-1-naphthylamine (1-NPN) was excited at337 nm, and emission was recorded between 380 and 480 nm. Dissoci-ation constants for 1-NPNwere calculated using Graph Pad Prism. Com-parative dissociation constants between olfactory proteins and ligandswere calculated by the equation Kd = IC50/(1+ [1-NPN]/K1-NPN),where IC50 is the concentration of ligands halving the initial fluores-cence value of 1-NPN, [1-NPN] is the free concentration of 1-NPN, andK1-NPN is the dissociation constant of the protein/1-NPN complex. Ex-periments were performed in triplicates.

2.2. Fluorescence quenching assays

The binding characteristics of CSP4 and target ligandswere analyzedby fluorescence quenching assay. Fluorescence spectra data of CSP4with β-ocimene and allo-ocimene were recorded at two temperaturegradients (290 K and 300 K). The widths of excitation and emissionslit were set at 5.0 nm, excitation wavelength was 281 nm, and theemission spectra were recorded between 285 and 550 nm. The maxi-mumemission spectrawere observed at 340nm. For recording thefluo-rescence quenching spectra, the stock solution of CSP4 was diluted intoworking solution with concentration of 1 μmol/L, into which the work-ing β-ocimene and allo-ocimene (1 mmol/L, dissolved in methyl alco-hol) was titrated [33].

Fluorescence quenching modes are described by the Stern-Volmerequation: F0/F= 1+Kqτ0[Q]= 1+ Ksv[Q], where F0 and F are the fluo-rescence emission intensity in the absence and presence of a quencherat [Q] concentration, respectively. Ksv is the Stern-Volmer dynamicquenching constant, and it has a linear slope according to the Stern-Volmer equation, Kq is the quenching rate constant of the molecule,and τ0 is the average lifetime of the molecule without a quencher,which has a value of 10−8 s. As the temperature increases, Ksv increasesin dynamic quenching, while it decreases in static quenching [33].

2.3. Ultraviolet (UV) spectrum

To further confirm the quenchingmechanism, UV spectra were usedto analyze whether the complex of CSP4 and the two ligands wasformed or not. UV absorption measurements were performed onShimadzu UV-1800 spectrophotometer from 190 to 400 nm with a1.0 cm quartz cell at 290 K. The UV absorption spectra of the CSP4alone and ligands alone were recorded. Then, the UV absorption of themix was obtained where the molar ratio of ligands to CSP4 was 1:1.Themeasurementswere carried out in PBS buffer (pH7.4). All operatingparameters were the same as those in the fluorescence spectra assay.

2.4. Isothermal titration calorimetry (ITC)

Isothermal titration calorimetry experiments were carried out withtheMicroCal ITC-200 at 25 °C (298.15 K). Protein solutionwas preparedby dialysis against a 20 mmol/L PBS buffer pH 7.4 at 4 °C for 72 h, anddiluted to a final concentration of 20 μmol/L. The ligands were also dis-solved in the same PBS using sonication at concentration of 400 μmol/L.The ligands were added as 2-μL injection to the CSP4 contained in thecalorimeter cell. The raw data were processed with the Microcal originsoftware. Calculated injection enthalpies and dissociation constantswere fit to one single-site bindingmodel in theMicrocal data evaluationsoftware.



Table 1The mutant site and primer sequence of CSP4.

Bindingdomain

Mutationsites

Primername

Primer sequence (5′-3′) Tm

Cavity 1 Tyr98Gly m98-F GGGAGCTTATAAGCAGCATGCTCTTCAGAAT

61.8

m98-R GCATGCTGCTTATAAGCTCCCGTTGGATCA 64.3Cavity 1 Asp67Gly m67-F CAGAAAAAAATTGCGGCTAAAGTTGTGC 57.6

m67-R GCCGCAATTTTTTTCTGTTTCTCACTG 57.4Cavity 2 Tyr4Gly m4-F GGATCCGAAGACAAAGCCACGACGAAGT 64.7

m4-R GCTTTGTCTTCGGATCCGATATCAGCCA 62.5Cavity 2 Lys3Gly m3-F TCGGATCCGAAGACGCATACACGACGA 65.5

m3-R GCGTCTTCGGATCCGATATCAGCCAT 63.0

3F. Wu et al. / International Journal of Biological Macromolecules 141 (2019) xxx

2.5. Circular dichroism (CD)

To investigate the conformational change of CSP4 induced by β-ocimene and allo-ocimene, the CD spectra were recorded on CD spec-trometer (Jasco-815, Japan) with a 1 cm path length quartz cuvette.The CD spectra of CSP4 (0.1mg/mL) and the two ligands were recordedto investigate the conformational change at the wavelength of190–250 nm at room temperature, the baseline subtracted though PBSbuffer (pH 7.4). The gradients ofmolar ratio of ligands to CSP4were var-ied as 0:1, 1:1, 3:1 and 5:1, respectively. The secondary conformationforms of CSP4, including α-helix, β-sheet, β-turn, and random coil,were analyzed from the CD spectroscopic data using the onlineSELCON3 program.

2.6. Molecular docking and molecular dynamic (MD) simulation

To better understanding the dynamics of the CSP4-ligands inter-actions, protein structure modeling, molecular docking, and MDsimulation were performed. The 3D structures of CSP4 were pre-dicted depending on known crystal structures using SWISS-MODELonline (https://www.swissmodel.expasy.org/) [34]. According to se-quence similarity and secondary structure, the best protein was cho-sen as the template to build a 3D model of CSP4. Then, the MDsimulation was analyzed by Gromacs 4.0.7 with the parameters forliquid simulation (OPLS) force field [35,36]. The production runswere performed in 300 K under the NPT ensemble, for 10 ns, witha time step of 2 fs. The long-range electrostatics was treated withthe Particle Mesh Ewald (PME) approach with 1.1 nm cut-off. ForLennard-Jones interactions a 1.1 nm cut-off was employed. Thepair list was updated every 10 MD steps. In order to compute prefer-able the results, four independent 10 ns long MD simulation wereperformed. The 3D structures of β-ocimene (CID_5281553) andallo-ocimene (CID_5368821) were obtained from NCBI PubChemonline (https://pubchem.ncbi.nlm.nih.gov/). Afterwards, the stron-gest binding model of the predicted structures and ligands weredocked via the software Molegro Virtual Docker (MVD) 4.2 (freetrial). The PDB files of protein and ligands were added into theworkspace. Before the docking, the potential binding sites of the pro-tein were narrowed down by detect cavities using the grid-basedcavity prediction algorithm, and the max number of cavities was 5.Each cavity was then chosen to run the docking simulation indepen-dently. All optional parameters were default: scoring function,MolDock Score [GRID]; grid resolution (Å), 0.3; the radius of bindingsite, 15; the docking algorithm, MolDock SE; number of runs, 10;max iterations, 1500; max population size, 50; energy threshold,100; max steps for Simplex Evolution, 300; Neighbour distance fac-tor, 1; max number of returned poses, 5, and the RMSD thresholdof poses, 1. The MolDock Optimizer and MolDock Score were usedas the search criteria and grading standards, respectively [37]. Thebest docking model of CSP4 was chosen for the pose display of theprotein binding with candidate ligands. Docking models were visu-alized with the UCSF Chimera package. Based on the docking analy-sis, the detailed energy values involved in the binding of CSP4 withligands were calculated and key amino acid residues were identified.Furthermore, the binding free energies of wild-type and mutantCSP4 with β-ocimene or allo-ocimene were calculated by the basisof most physics-based scoring functions as well as themolecular me-chanics Poisson-Boltzmann surface area (MM/PBSA) method [38].Briefly, the binding free energy is defined as:

△Gbinding ¼ Gcomplex– Gprotein–Gligand� �

where △Gbinding is the total binding free energies of the protein-ligand complex, Gcomplex is the total free energy of the protein-ligand complex, Gprotein and Gligand are the total energy of separatedprotein and ligand in solvent, respectively. The free energy of each


individual is calculated as an average over the considered structures,and estimated by:

G½ � ¼ EMM½ � þ Gsolv½ � þ T SMM½ �

where EMM is the average molecular mechanics potential energy invacuum, Gsolv is free energy of solvation, SMM is the internal entropychange of the solutes upon binding. EMM is obtained from the molec-ular force field in vacuum as following [39].

EMM ¼ Eint þ Eelec þ ELJ

where Eint indicates bond, angle, and torsional angle energies, andEcelec and ELJ are the intramolecular electrostatic and Lennard-Jonesenergies, respectively. The solvation term is split into polar Gpolar

and nonpolar Gnonpolar contribution:

Gsolv ¼ Gpolar þ Gnonpolar

The polar contribution Gpolar refers to the energy required to transferthe solute from a continuum medium with a low dielectric constant (ε= 1) to a continuum medium with the dielectric constant of water (ε= 80). Gpolar is calculated using the non-linearized or linearizedPoisson-Boltzmann equation. The nonpolar contributionGnonpolar is con-sidered proportional to the solvent accessible surface area (SASA):

Gnonpolar ¼ γ SASAþ β

where γ is a coefficient related to surface tension of the solvent and b isfitting parameter, γ = 0.0227 KJ mol−1 Å−2 and β = 3.849 KJ mol−1

[40]. The dielectric boundary is defined using a probe of radius 1.4 Å.Binding free energy calculations based on the MM/PBSA approach

can be performed either according to the three trajectories method(TTM) or according to the single trajectorymethod (STM). And the stan-dard error (SE) was calculated by SE = δ / √N, where δ is the standarddeviation and N is the number of structure used in the calculation [41].

2.7. Site-directed mutagenesis

In order to verify which of the predicted interaction sites and aminoacids were critical for the binding of CSP4 with ligands, site-directedmutagenesis of the corresponding amino acid were carried out. All ofthe CSP4 mutants were generated using the Fast Mutagenesis Systemkit (TransGen, China), and the recombinant plasmid pET30-(a)-CSP4was used as the template. Themutant primers and sites were as follows(Table 1): Tyr98Gly, Asp67Gly, Tyr4Gly, and Lys3Gly.

The PCR conditions were (i) first step: an initial 3 min denaturationat 94 °C; (ii) 25 cycles: 94 °C for 30 s, X°C for 30 s, and 72 °C for 2 min;and (iii) final step: 72 °C for 10 min. The amplified products were ex-cised from the gel and extracted used gel extraction kit. After sequenc-ing, the correct plasmid was transformed into BL21 (DE3) E. colicompetent cells. Colonies containing the expected mutation were usedfor expression of recombinant proteins. After the mutant CSP4 proteins


https://www.swissmodel.expasy.org/

https://pubchem.ncbi.nlm.nih.gov/



obtained, the fluorescence quenching assay were performed as de-scribed before.

Fig. 2. The Stern-Volmer plots of CSP4 during static quenching at two different

3. Results

3.1. OBPs and CSPs exhibit varied binding affinities to volatile larvalpheromones

To test the most relevant of OBPs and CSPs interacted with larvalpheromones, the binding force between these proteins with β-ocimene and allo-ocimene were compared in a competitive fluores-cence binding assay. Firstly, all of the OBPs and CSPs tested had goodbinding affinities with fluorescence reporter 1-NPN. With increasingconcentrations of 1-NPN, the binding between 1-NPN and OBPs orCSPs were gradually saturated. Secondly, varied affinity OBPs/CSPsbound with β-ocimene and allo-ocimene was recorded (Fig. 1). OBP8was observed with the strongest binding affinity to β-ocimene (Kd =4.17 μmol/L), and CSP4 had the strongest binding affinity to allo-ocimene (Kd= 2.87 μmol/L). Of all OBPs and CSPs, CSP4was the carrierwith the strongest binding affinity to volatile larval pheromones.

temperatures. The higher temperature (300K) and lower temperature (290 K) for CSP4-β-ocimene are shown in red and black, and for CSP4-allo-ocimene are shown in pinkand blue, respectively. The widths of excitation and emission slit are set at 5.0 nm,excitation wavelength is 281 nm, and the emission spectra are recorded between 285and 550 nm. The concentration of CSP4 dissolved in 20 mmol/L PBS buffer is 1 μmol/L,and the concentration of ligands dissolved in methyl alcohol is 1 mmol/L.

3.2. Stable complexes form between CSP4 and larval pheromones

Fluorescence quenching experiment could explore the binding char-acteristics between protein and ligand, of which dynamic and staticquenching are the two common types. The dynamic type is from colli-sional encounters between the fluorescent sample and quencher, andthe static type is from stable binding between them. Both types are af-fected and can be distinguished by different temperatures: when thetemperature increases, there is a faster diffusion and dissociation ofweakly bound complexes, causing larger amounts of collision to occurin dynamic quenching. However, in static quenching, higher tempera-ture results in the more dissociation of stable complexes. The twomodes can be described by the Stern-Volmer equation: F0/F = 1+ Kqτ0[Q] = 1 + Ksv[Q]. Here, the fluorescence quenches of CSP4bound with β-ocimene and allo-ocimene were recorded at 290 K and300 K, and their Ksv decreased with temperatures increase (Fig. 2,Table 2). Then, the double logarithm equation, Log ((F0\\F)/F = LogKA+ n Log [Q]), was used to analyze the static quenching, where KA isthe apparent association constant, and n is the number of bindingsites between the protein and ligands (Table 2). The two values were

Fig. 1. Affinity of OBPs and CSPs to β-ocimene and allo-ocimene. Affinity was assessed bycompetitive binding experiments with 1-NPN as a fluorescent reporter. The dissociationconstants (Kd) values of OBPs and CSPs for β-ocimene (red) and allo-ocimene (black)revealed strong binding that was variable among proteins and ligands.


almost close to 1. These values led up to a binding ratio of 1:1 betweenthe β-ocimene or allo-ocimene and CSP4.

The binding interaction between macromolecules and micro-molecules includes hydrophobic interaction, electrostatic force, hy-drogen bonds, and Van der Waals interactions, etc. Therefore, ther-modynamic equations were used to calculate free energy change(△G), enthalpy change (△H), and entropy change (△S). △H and△S can reflect the main driving force. If △H is b0 or approximates0 and △S is greater 0, the main acting force is an electrostatic or hy-drophobic force; if△H is b0 and△S is b0, the main acting force is vander Waals or hydrogen bonding interactions; and if △H is greater 0and △S is N0, the main force is hydrophobic. △H is calculated fromthose thermal melting experiment using the slope of the van't Hoffrelationship:

△H ¼ R T1 T2 ln K2=K1ð Þ½ �= T2−T1ð Þ

where association constant K (K1 and K2) is same to the apparent as-sociation constant KA at the corresponding temperature T (T1 andT2). If the temperature changes slightly, the △H is always regardedas a constant. Then, ΔS can be determined from the van't Hoff equa-tion [42]:

Ln K ¼ − △H=R Tð Þ þ △S=Rð Þ

where R is the gas constant and T is the test temperature. Finally, the△G is estimated by the following relationship:

△G ¼ △H−T△S

The polarizability of a ligand in binding to a protein contributes tolarge negative values for the thermodynamic parameters △G, △Hand △S. All relevant data of the volatile β-ocimene and allo-ocimene interactions with CSP4 were calculated and shown inTable 2. In all, the main driving forces of β-ocimene and allo-ocimene interactions with CSP4 were electrostatic or hydrophobicforce on the basis of △H b 0 and △S N 0. △G b 0 suggested that thebinding interactions of CSP4 and the two pheromones occurredspontaneously.



Table 2Fluorescence quenching constants (Ksv), the quenching rate constant of the biomolecule (Kq) (in equation of Stern–Volmer), apparent association constant (KA) (in double logarithmequation), the number of binding sites (n) and the thermodynamic parameters at different temperature.

Ligands Temperature(K)

Ksv(L·mol−1)

Kq(L·mol−1 s−1)

KA

(L·mol−1)n △H

(KJ·mol−1)△S(J·mol−1·K−1)

△G(KJ·mol−1)

WTAllo-ocimene 290 8.41 × 104 8.41 × 1012 9.7 × 104 0.954 −10.06 60.76 −27.68

300 7.56 × 104 7.56 × 1012 8.44 × 104 0.9475 60.76 −28.29Ocimene 290 4.42 × 104 4.42 × 1012 4.63 × 104 0.9806 −4.51 73.75 −25.90

300 3.56 × 104 3.56 × 1012 4.35 × 104 0.9414 73.75 −26.64

Y98Allo-ocimene 290 2.1 × 104 2.1 × 1012 2.65 × 104 0.9327 −8.38 55.77 −24.56

300 1.63 × 104 1.63 × 1012 2.36 × 104 0.8827 55.77 −25.11Ocimene 290 1.64 × 104 1.64 × 1012 1.76 × 104 0.9808 −6.44 59.06 −23.57

300 1.08 × 104 1.08 × 1012 1.61 × 104 0.8762 59.06 −24.16

D67Allo-ocimene 290 5.38 × 104 5.38 × 1012 5.63 × 104 0.9881 −9.16 59.34 −26.37

300 4.13 × 104 4.13 × 1012 4.96 × 104 0.9407 59.34 −26.97Ocimene 290 2.66 × 104 2.66 × 1012 3.4 × 104 0.9237 −7.15 62.10 −25.16

300 1.97 × 104 1.97 × 1012 3.08 × 104 0.8584 62.10 −25.78

Y4Allo-ocimene 290 8.44 × 104 8.44 × 1012 7.77 × 104 1.0282 −10.07 58.89 −27.15

300 7.35 × 104 7.35 × 1012 6.67 × 104 1.0232 58.89 −27.74Ocimene 290 4.31 × 104 4.31 × 1012 3.82 × 104 1.0381 −10.80 50.46 −25.44

300 3.28 × 104 3.28 × 1012 3.29 × 104 1.005 50.46 −25.94

K3Allo-ocimene 290 8.34 × 104 8.34 × 1012 8.75 × 104 0.9843 −15.22 42.14 −27.44

300 7.55 × 104 7.55 × 1012 7.09 × 104 1.0234 42.14 −27.86Ocimene 290 4.17 × 104 4.17 × 1012 4.18 × 104 1.0034 −14.09 39.87 −25.66

300 3.69 × 104 3.69 × 1012 3.44 × 104 1.0241 39.87 −26.05


3.3. UV spectra justify short-binding distance of CSP4 and volatile larvalpheromones

According to Förster's Fluorescence Resonance Energy Transfer(FRET), the distance between fluorescence donor and acceptor canbe calculated by analyzing critical distance and efficiency of energytransfer using equations:

r0 ¼ R0 1=Eð Þ−1½ �1=6

Where r0 is the binding distance between donor and receptor, R0 isthe critical distance when the efficiency of transfer is 50%, E is energytransfer efficiency. E and R0 can be calculated by the following equa-tions:

E ¼ 1−FF0

R60 ¼ 8:8� 10−25K2N2∅X J:

where F and F0 are the correctedfluorescence emission intensities of thedonor in the presence and absence of the acceptor respectively, K2 is thespatial orientation factor of the donor and acceptor dipole, and assumedto be equal to 2/3, N is the refractive index of the medium, equal to1.336, Ф is the fluorescence quantum yield of the donor, equal to0.118 [43]. And J is the overlap integral of the fluorescence emissionspectrum of the donor with the absorption spectrum of the acceptorand was given by the expression:

J M−1cm3� �

¼X

F λð Þε λð Þλ−4ΔλPF λð ÞΔλ

where F(λ) is the fluorescence intensity of the fluorescent donor atwavelength λ; and ε(λ) is themolar absorption coefficient of the accep-tor at wavelength λ, △λ is the wavelength at a definite nanometer in-terval [44].


The overlap between the fluorescence emission spectrum of CSP4and the UV spectrum of the pheromones is shown in Fig. 3. Accordingto the equationsmentioned above, r0 of CSP4 and β-ocimenewas calcu-lated to be 2.73 nm, while r0 of CSP4 and allo-ocimene was 2.43 nm.Both of them are b10 nm, the academic maximum distance betweendonor and acceptor.

3.4. ITC reveals binding interaction of CSP4 with larval pheromones

The binding experiments of CSP4 with β-ocimene and allo-ocimenewere further conducted using ITC assay, a direct physical method forassessing ligand-protein interaction. Calorimetric binding isothermswere obtained at 25 °C. The values of parameters were depicted inFig. 4. The enthalpy △H of β-ocimene-CSP4 and allo-ocimene-CSP4were −4.795 ± 0.072 kcal/mol and −7.026 ± 0.107 kcal/mol, respec-tively. The entropy △S of β-ocimene-CSP4 and allo-ocimene-CSP4were 6.83 cal/mol/deg. and 8.59 cal/mol/deg., respectively. Both of themolar binding stoichiometry (n) were close to 1.

3.5. Helical structure of CSP4 is influenced by volatile larval pheromones

To investigate the conformational changes of the CSP4, CD experi-ments were executed in different ligand concentrations. The spectro-gram of CSP4 exhibited two negative dichroic minima at 208 and222 nm, which is the characteristic peak of a protein with high α-helix content. When β-ocimene or allo-ocimene was titrated intoCSP4 solution, the peak intensity of the protein decreased obviously,showing that the content of α-helix conformation of protein decreasedwith the increase of β-ocimene or allo-ocimene concentration (Fig. 5).

3.6. Molecular docking and molecular dynamic simulation identify the po-tential model of CSP4 binding with volatile larval pheromones

To reveal interaction pose of CSP4 with β-ocimene or allo-ocimene,the molecular modeling, molecular docking and molecular dynamic(MD) simulationwere used. The predicted three-dimensional structure



Fig. 3.Overlapping offluorescence emission spectrum of CSP4 (A) and UV absorption spectrum ofβ-ocimene (B) and allo-ocimene (C). The concentration of CSP4 (dissolved in 20mmol/LPBS buffer, pH 7.4) and ligands (dissolved in methyl alcohol) are the same, c (CSP4) = c (β-ocimene) = c (allo-ocimene) = 1 μmol/L and the emission wavelength λ = 281 nm.


of CSP4 was obtained on the basis of the structure of the desert locustschistocerca gregaria CSP-sg4 through homology modeling with a se-quence similarity of 56.73%. Five α-helices were the main structure ofCSP4 proteins. There were two potential external cavities (cavity 1and cavity 2) where ligands could be bound and transported and bothof them were not in the center formed by α-helices. To evaluate the

Fig. 4. Isothermal calorimetric titration curves of CSP4with β-ocimene (A) and allo-ocimene (Bconcentration in the calorimeter cell was 20 μmol/L, and ligands concentration in the syringe wenthalpies and dissociation constantswere fit to one single-site bindingmode. The binding enth


stability of predictive structure, CSP4 structure was analyzed by usingMD simulation. The Cα root-mean square (RMSD) deviations from theCSP4 structure were relatively stable with a RMSD profiles b2.5 Å(Fig. 6A), suggesting the suitability of MD simulation run. And thehigh content of α-helix reduced the Cα root-mean square fluctuations(RMSF) of CSP4 within the range of 2 Å (Fig. 6B). Furthermore, MVD

). The results were obtained at 20mmol/L PBS buffer pH 7.4. For the experiments, the CSP4as 400 μmol/L. The ligands were added as 2 μL injection to the CSP4. Calculated injectionalpy (DH), enthalpy (DS), and the number of binding sites (n) were depicted in the Figure.



Fig. 5. Circular dichroism (CD) spectra of CSP4 with β-ocimene (above) and allo-ocimene (below) in different concentrations. Black line, red line, blue line and pink line represented themolar ratios ofβ-ocimene and allo-ocimene to CSP4 for 0:1, 1:1, 3:1, and 5:1, respectively. The content ofα-helix conformation of protein decreasedwith the increase ofβ-ocimeneor allo-ocimene concentration.


showed that Tyr98 and Asp67 play important roles in binding cavity 1(Fig. 6C andD),while Tyr4 and Lys3 play important roles in binding cav-ity 2 (Fig. 6E and F). The energetic parameters driving the interactionbetween CSP4 and ligandswere investigated both in the native andmu-tant types using the MM/PBSA method (Table 3). The binding free en-ergy (△G) was b0, meaning the complex of CSP4 binding with thetwo ligands occurred spontaneously. And the electrostatic energy(△Gelec b 0) and van der Waal energy (△Gvdw b 0) contribute to com-plex formation. Compared to Tyr4 and Lys3, the difference in computa-tional binding free energies of Tyr98 and Asp67 with wild-type (△△G)was high,manifesting that theymightmore influence binding affinity ofCSP4 and larval pheromones. Collectively, above data indicate that thecomplexes of CSP4 and β-ocimene or allo-ocimene are stabilized byelectrostatic interaction. CSP4-Tyr98 and CSP4-Asp67 mutants de-creased the electrostatic force, resulting in antagonizing binding.

3.7. Site-specific mutagenesis confirms ligand binding sites

To further verify the cavity and key amino acids of CSP4 that bindwith β-ocimene or allo-ocimene, Tyr98, Asp67, Tyr4 and Lys3 were di-rectly mutated and sequence confirmed. Thereafter, the competitivebinding assays of the four mutants CSP4 with β-ocimene or allo-ocimene were performed. For β-ocimene or allo-ocimene, the bindingaffinity of CSP4-Tyr98 and CSP4-Asp67 was apparently declined,whereas the binding affinity of CSP4-Tyr4 and CSP4-Lys3was notmark-edly declined (Fig.7, Table 2). Hence, Tyr98 and Asp67 played more im-portant role suggested cavity 1 ismore likely to be the binding site of theinteraction for CSP4 and larval pheromones. Furthermore, β-ocimeneand allo-ocimenewere also involved in electrostatic force in the process

Table 3MM/PBSA binding free energies (KJ/mol) of wild-type and mutant CSP4 binding with β-ocimene and allo-ocimene.△G is the computational binding free energies,△△G is the dif-ferent between computational binding free energies of wild-type and mutant complex,△Gelec is the intramolecular electrostatic energies, and△Gvdw is van der Waals energies.

Protein Ligand △G(mean ± SE)

△△G △Gelec

(mean ± SE)△Gvdw

(mean ± SE)

CSP4 β-Ocimene −139.7 ± 2.8 0 −3246.4 ± 14.5 −61.1 ± 5.2Allo-ocimene −156.5 ± 3.3 0 −3585.3 ± 9.4 −58.6 ± 2.4

Tyr98Gly β-Ocimene −112.1 ± 3.1 27.6 −2459.5 ± 16.8 −84.5 ± 3.3Allo-ocimene −113.4 ± 2.9 43.1 −2578.2 ± 11.5 −64.2 ± 3.5

Asp67Gly β-Ocimene −107.7 ± 3.4 32 −2638.2 ± 17.1 −77.4 ± 2.9Allo-ocimene −119.0 ± 3.3 37.5 −2512.6 ± 15.0 −72.0 ± 3.6

Tyr4Gly β-Ocimene −132.8 ± 4.2 6.9 −2918.7 ± 15.4 −85.7 ± 4.2Allo-ocimene −151.8 ± 2.7 4.7 3126.6 ± 13.7 −43.5 ± 2.1

Lys3Gly β-Ocimene −134.5 ± 4.1 5.2 −2883.0 ± 16.2 −66.5 ± 3.4Allo-ocimene −150.4 ± 3.6 6.9 2955.4 ± 16.5 −55.3 ± 2.4


of interactions with mutant proteins by fluorescence quench. None ofthe four mutation sites was changed the main driving force.

4. Discussion

The complex chemicals produced by the honeybee larvae are neces-sary to induce the behavior and thephysiology ofworkers to care for theneeds of the brood. OBPs and CSPs are the odor molecular carriers thattransport larval pheromones through the sensillar lymph to ORs. Of alltested OBPs and CSPs, CSP4 is the olfactory protein with the strongestbinding affinity to allo-ocimene. To explore the interaction mechanismof CSP4 with volatile larval pheromones, β-ocimene and allo-ocimene,a wide range of biochemical and physical assays were used. Moreover,homology modeling, molecular docking, and site-specific mutagenesiswere applied to dissect the binding cavities and key active-site aminoacid residues of protein interaction with β-ocimene and allo-ocimene.The larval pheromones exhibit static quenchingwith high binding affin-ities with CSP4. The main driving forces of the two volatile larval pher-omones interacted with CSP4 are electrostatic force. The bindingcavities of β-ocimene and allo-ocimene are located at the C-terminalin CSP4, where Tyr98 and Asp67 are the key amino acids to maintain astable form of the two ligands with CSP4.

CSP4 is paramount important during the process of transporting vol-atile larval pheromones, β-ocimene and allo-ocimene. E-β-ocimene,identified in mated queens, could promote worker bees to accept thenewly introduced queens into the colonies [45,46]. It is also detectedin different ages of brood and could accelerate the development ofhypopharyngeal glands of workers [29], and provoke workers to feedlarvae [32]. Allo-ocimene has been reported as a new honey bee larvalpheromone identified in one-day-old larvae (between 24 and 36 hold), and could elicit antennal signaling and attract nurse bees, whichsuggests that it may complement the function of β-ocimene (Inpress). As main larval pheromones, the more OBPs and CSPs bind withthem, the more favorable and efficient for transporting to the odor re-ceptor. The observed β-ocimene and allo-ocimene could both bebound by all tested OBPs and CSPs, suggesting that volatile pheromonesare vital for larva function. This is similar to the case of methyl p-hydroxybenzoate (HOB), an important ingredient of queen pheromone,with which many OBPs and CSPs can bind to enhance social behavior[43,47]. However, OBPs and CSPs could partially transport differentplant odors or honeybee pheromone with a high binding force [48].Here, the varied binding affinities of OBPs and CSPs to β-ocimene andallo-ocimene, with CSP4 having the strongest binding affinity to allo-ocimene, suggests that CSP4 is one of the most important proteinsassisting workers to recognize larval pheromones.

The stable complexes of β-ocimene and allo-ocimene with CSP4 arecritical for transporting them through the sensillar lymph. This is



Fig. 6. Conformational analysis of predictive CSP4 and molecular docking simulation with β-ocimene and allo-ocimene. The homology modeling references the structure of schistocercagregaria CSP-sg4 with a sequence similarity of 56.73%. A. Cα root-mean square (RMSD) from free CSP4 structure as a function of time, four independent 10 ns long MD simulation. B.Cα atoms root mean square fluctuations (RMSF) from their time averaged positions for CSP4. C. Molecular docking of CSP4 with β-ocimene in cavity 1. D. Molecular docking of CSP4with β-ocimene in cavity 2. E. Molecular docking of CSP4 with allo-ocimene in cavity 1. F. Molecular docking of CSP4 with allo-ocimene in cavity 2.


Please cite this article as: F. Wu, Y. Feng, B. Han, et al., Mechanistic insight into binding interaction between chemosensory protein 4 and volatilelarval pher..., , https://doi.org/10.1016/j.ijbiomac.2019.09.041


Fig. 7. The Stern-Volmer plots ofmutant CSP4 during static quenching at two temperatures. The higher temperature and lower temperature for CSP4-β-ocimene are shown in red (300 K)and black (290 K), and for CSP4-allo-ocimene are shown inpink (300K) and blue (290 K), respectively. Thewidths of excitation and emission slit are set at 5.0 nm, excitationwavelength is281 nm, and the emission spectra are recorded between 285 and 550nm. The concentration ofmutant CSP4 dissolved in 20mmol/L PBS buffer is 1 μmol/L, and the concentration of ligandsdissolved in methyl alcohol is 1 mmol/L.


reflected by a strong ability to quench the intrinsic fluorescence of CSP4with β-ocimene and allo-ocimene, suggesting complexes are formedbetween CSP4 and larval pheromones, and the quenching mechanismof the two ligands are static quenching. Compared to dynamicquenching, a stable complex is more beneficial for transportation ofOBPs and CSPs [49]. For example, the stable complex of OBP1 and HOBis functionally important for the worker bees to receive the pheromonesignal [43]. E-β-ocimene and allo-ocimene are important larval phero-mones. Therefore, stable combinations and efficient transport of CSP4and brood pheromones are necessary for workers to identify larvae.The observed b0 of free energy change is suggestive of the fact thatthe complexes of CSP4 and the two volatile larval compounds areformed spontaneously, and the force of steady-state modemay be elec-trostatic force. This is supported by both the ITC experiment and MDstimulation even if the thermodynamic values of them are quite differ-ent. This is similar to the fact that the energy terms in a physics-basedscoring function (like MD simulation) has to be scaled down roughly10-fold to bring the results into range with experiment (like ITC exper-iment) [41,50]. According to Förster's theory, FRET depends mainly onthe following three factors: a. spectrum between the donor emissionand the acceptor absorption overlap, b. the distance r between the ac-ceptor and the donor is within 7 nm and c. a donor has high fluores-cence quantum yield [51,52]. Here, the observed distance between r0of β-ocimene and allo-ocimene with CSP4 was less than the academicmaximum, which is suggestive of the fact that non-radioactive energytransfer between the two ligands and CSP4 occurs. Taken together, fluo-rescence quenching analyses and multiple spectra of technology pro-vide more comprehensive understanding of CSP4 with the two larvalpheromones. However, none of the fluorescence experiments reflecttheir inner binding mode.


The structure of CSP4 plays crucial roles in recognition and bindingof larval pheromones. In general, the typical characteristic of OBPs andCSPs is a central hydrophobic cavity that can bind suitable ligands [7].However, it is possible that fluorescence quenching not only occurs inthe pocket, but also in any other part of a protein. It is reported thatLymantria dispar PBP2 binds +(−) disparlure at an external cavity[53], and the external site has a greater affinity for fatty acids than theother site [54]. Here, we found twomajor external binding cavities (cav-ity 1 and cavity 2) in homology modeling of CSP4, and both of themcould capture β-ocimene and allo-ocimene. This is further biologicallyconfirmed by molecular docking analysis. However, the greater influ-ence of Tyr98 and Asp67 mutants to the binding of β-ocimene andallo-ocimene with wild-type is indicative of the fact that cavity 1 islikely the binding site of volatile larval pheromones. Again, no formationof hydrogen bonds in β-ocimene and allo-ocimene, non-polar ligands,was found, further confirming that their specific binding to CSP4 reliesmainly on shape recognition and hydrophobic interactions. In addition,the external binding sites serve rapid release of odorant that could alsobe essential to adjust to the highly dynamic olfactory system.

5. Conclusion

Our datamanifest themechanism by characterization of the interac-tion between CSP4 and volatile larval pheromones, β-ocimene and allo-ocimene. Both of the two ligands could form stable complexes withCSP4, which are crucial for delivering the both pheromones throughthe sensillar lymph. Moreover, the binding sites located at the externalcavity of CSP4 that could rapid transmit of the pheromones. The efficienttransport and immediate release the pheromones are beneficial forworker bees to receive the larval signal.




Declaration of competing interest

The authors declare that they have no conflicts of interest with thecontents of this article.

Acknowledgments

This work was supported by the Agricultural Science and Technol-ogy Innovation Program (CAAS-ASTIP-2015-IAR), the Earmarked Fundfor Modern Agro-Industry Technology Research System (CARS-45), Na-tional Natural Science Foundation of China (No. 31601169) and Na-tional project for upgrading beekeeping industry of China. The fundershad no role in study design, data collection and analysis, decision topublish, or preparation of the manuscript.

Author contributions

FW, L-S Y and J-K L: conceived anddesigned the experiments; FW, Y-L F and BH: performed the experiments; HH, L-F M, MF and CM: ana-lyzed the data; FW and J-K L: drafted and revised the manuscript.

References

[1] F.J. Richard, J.H. Hunt, Intracolony chemical communication in social insects, Insect.Soc. 60 (2013) 275–291.

[2] M. Schott, C. Wehrenfennig, T. Gasch, A. Vilcinskas, Insect antenna-based biosensorsfor in situ detection of volatiles, Adv. Biochem. Eng. Biotechnol. 136 (2013)101–122.

[3] W.S. Leal, Odorant reception in insects: roles of receptors, binding proteins, anddegrading enzymes, Annu. Rev. Entomol. 58 (2013) 373–391.

[4] P. Pelosi, J.J. Zhou, L.P. Ban, M. Calvello, Soluble proteins in insect chemical commu-nication, Cell. Mol. Life Sci. 63 (2006) 1658–1676.

[5] S. Foret, R. Maleszka, Function and evolution of a gene family encoding odorantbinding-like proteins in a social insect, the honey bee (Apis mellifera), GenomeRes. 16 (2006) 1404–1413.

[6] S. Foret, K.W. Wanner, R. Maleszka, Chemosensory proteins in the honey bee: in-sights from the annotated genome, comparative analyses and expressional profiling,Insect Biochem. Mol. Biol. 37 (2007) 19–28.

[7] S.-Y. Yi, D.-Z. Li, C.-X. Zhou, Y.-L. Tang, H.E. Abdelnabby, M.-Q. Wang, Screening be-haviorally active compounds based on fluorescence quenching in combination withbinding mechanism analyses of SspOBP7, an odorant binding protein fromSclerodermus sp, Int. J. Biol. Macromol. 107 (2018) 2667–2678.

[8] N.F. Brito, M.F. Moreira, A.C.A. Melo, A look inside odorant-binding proteins in insectchemoreception, J. Insect Physiol. 95 (2016) 51–65.

[9] B.H. Sandler, L. Nikonova, W.S. Leal, J. Clardy, Sexual attraction in the silkwormmoth: structure of the pheromone-binding-protein-bombykol complex, Chem.Biol. 7 (2000) 143–151.

[10] V. Campanacci, A. Lartigue, B.M. Hallberg, T.A. Jones, M.T. Giudici-Orticoni, M.Tegoni, C. Cambillau, Moth chernosensory protein exhibits drastic conformationalchanges and cooperativity on ligand binding, Proc. Natl. Acad. Sci. U. S. A. 100(2003) 5069–5074.

[11] M.E. Pesenti, S. Spinelli, V. Bezirard, L. Briand, J.-C. Pernollet, V. Campanacci, M.Tegoni, C. Cambillau, Queen bee pheromone binding protein pH-induced domainswapping favors pheromone release, J. Mol. Biol. 390 (2009) 981–990.

[12] S. Spinelli, A. Lagarde, I. Iovinella, P. Legrand, M. Tegoni, P. Pelosi, C. Cambillau, Crys-tal structure of Apis mellifera OBP14, a C-minus odorant-binding protein, and itscomplexes with odorant molecules, Insect Biochem. Mol. Biol. 42 (2012) 41–50.

[13] Y. Wei, A. Brandazza, P. Pelosi, Binding of polycyclic aromatic hydrocarbons tomutants of odorant-binding protein: a first step towards biosensors for environ-mental monitoring, Biochim. Biophys. Acta Proteins Proteomics 1784 (2008)666–671.

[14] E. Danty, L. Briand, C.Michard-Vanhee, V. Perez, G. Arnold, O. Gaudemer, D. Huet, J.C.Huet, C. Ouali, C. Masson, J.C. Pernollet, Cloning and expression of a queenpheromone-binding protein in the honeybee: an olfactory-specific, developmen-tally regulated protein, J. Neurosci. 19 (1999) 7468–7475.

[15] L. Briand, C. Nespoulous, J.C. Huet, J.C. Pernollet, Disulfide pairing and secondarystructure of ASP(1), an olfactory-binding protein from honeybee (Apis mellifera L),J. Pept. Res. 58 (2001) 540–545.

[16] L. Briand, C. Nespoulous, J.C. Huet, M. Takahashi, J.C. Pernollet, Ligand binding andphysico-chemical properties of ASP2, a recombinant odorant-binding protein fromhoneybee (Apis mellifera L.), Eur. J. Biochem. 268 (2001) 752–760.

[17] R. Boch, D.A. Shearer, Chemical releasers of alarm behaviour in the honey-bee, Apismellifera, J. Insect Physiol. 17 (1971) 2277–2285.

[18] F.R. Dani, I. Iovinella, A. Felicioli, A. Niccolini, M.A. Calvello, M.G. Carucci, H.L. Qiao, G.Pieraccini, S. Turillazzi, G. Moneti, P. Pelosi, Mapping the expression of soluble olfac-tory proteins in the honeybee, J. Proteome Res. 9 (2010) 1822–1833.

[19] I. Iovinella, F. Cappa, A. Cini, I. Petrocelli, R. Cervo, S. Turillazzi, F.R. Dani, Antennalprotein profile in honeybees: caste and task matter more than age, Front. Physiol.9 (2018) 748.


[20] H.X. Zhao, X.N. Zeng, Q. Liang, X.F. Zhang, W.Z. Huang, H.S. Chen, Y.X. Luo, Study ofthe obp5 gene in Apis mellifera ligustica and Apis cerana cerana, Genet. Mol. Res. 14(2015) 6482–6494.

[21] I. Iovinella, F.R. Dani, A. Niccolini, S. Sagona, E. Michelucci, A. Gazzano, S. Turillazzi, A.Felicioli, P. Pelosi, Differential expression of odorant-binding proteins in the man-dibular glands of the honey bee according to caste and age, J. Proteome Res. 10(2011) 3439–3449.

[22] C. Castillo, H. Chen, C. Graves, A.Maisonnasse, Y. Le Conte, E. Plettner, Biosynthesis ofethyl oleate, a primer pheromone, in the honey bee (Apis mellifera L.), InsectBiochem. Mol. Biol. 42 (2012) 404–416.

[23] K.N. Slessor, M.L. Winston, Y. Le Conte, Pheromone communication in the honeybee(Apis mellifera L.), J. Chem. Ecol. 31 (2005) 2731–2745.

[24] E. Bonnafe, J. Alayrangues, L. Hotier, I. Massou, A. Renom, G. Souesme, P. Marty, M.Allaoua, M. Treilhou, C. Armengaud, Monoterpenoid-based preparations in beehivesaffect learning, memory, and gene expression in the bee brain, Environ. Toxicol.Chem. 36 (2017) 337–345.

[25] A. McAfee, A. Chapman, I. Iovinella, Y. Gallagher-Kurtzke, T.F. Collins, H. Higo, L.L.Madilao, P. Pelosi, L.J. Foster, A death pheromone, oleic acid, triggers hygienic behav-ior in honey bees (Apis mellifera L.), Sci. Rep. 8 (2018) 5719.

[26] J.B. Free, A.W. Ferguson, J.A. Pickett, I.H. Williams, Use of unpurified Nasonov pher-omone components to attract clustering honeybees, J. Apic. Res. 21 (1982) 26–29.

[27] L. Briand, N. Swasdipan, C. Nespoulous, V. Bezirard, F. Blon, J.C. Huet, P. Ebert, J.C.Pernollet, Characterization of a chemosensory protein (ASP3c) from honeybee(Apis mellifera L.) as a brood pheromone carrier, Eur. J. Biochem. 269 (2002)4586–4596.

[28] D.R. Tarpy, D.C. Gilley, T.D. Seeley, Levels of selection in a social insect: a review ofconflict and cooperation during honey bee (Apis mellifera) queen replacement,Behav. Ecol. Sociobiol. 55 (2004) 513–523.

[29] A. Maisonnasse, J.C. Lenoir, D. Beslay, D. Crauser, Y. Le Conte, E-beta-ocimene, a vol-atile brood pheromone involved in social regulation in the honey bee colony (Apismellifera), PLoS One 5 (2010) e13531.

[30] Y. Le Conte, G. Arnold, J. Trouiller, C. Masson, B. Chappe, G. Ourisson, Attraction ofthe parasitic mite Varroa to the drone larvae of honey bees by simple aliphatic es-ters, Science 245 (1989) 638–639.

[31] Y.A.G. Le Conte, J. Trouiller, C. Masson, Identification of a brood pheromone in hon-eybees, Naturwissenschaften 77 (1990) 334–336.

[32] X.J. He, X.C. Zhang, W.J. Jiang, A.B. Barron, J.H. Zhang, Z.J. Zeng, Starving honey bee(Apis mellifera) larvae signal pheromonally to worker bees, Sci. Rep. 6 (2016) 22359.

[33] H.L. Li, F. Wu, L. Zhao, J. Tan, H.T. Jiang, F.L. Hu, Neonicotinoid insecticide interactwith honeybee odorant-binding protein: implication for olfactory dysfunction, Int.J. Biol. Macromol. 81 (2015) 624–630.

[34] A. Waterhouse, M. Bertoni, S. Bienert, G. Studer, G. Tauriello, R. Gumienny, F.T. Heer,T.A.P. de Beer, C. Rempfer, L. Bordoli, R. Lepore, T. Schwede, SWISS-MODEL: homol-ogy modelling of protein structures and complexes, Nucleic Acids Res. 46 (2018)296–303.

[35] B. Hess, C. Kutzner, D. van der Spoel, E. Lindahl, GROMACS 4: algorithms for highlyefficient, load-balanced, and scalable molecular simulation, J. Chem. Theory Comput.4 (2008) 435–447.

[36] W. Jorgensen, J. Chandrasekhar, J. Madura, R. Impey, M. Klein, Comparison of simplepotential functions for simulating liquid water, J. Chem. Phys. 79 (1983) 926–935.

[37] M. Vaque, A. Ardrevol, C. Blade, M.J. Salvado, M. Blay, J. Fernandez-Larrea, L. Arola, G.Pujadas, Protein-ligand docking: a review of recent advances and future perspec-tives, Curr. Pharm. Anal. 4 (2008) 1–19.

[38] I. Massova, P.A. Kollman, Computational alanine scanning to probe protein-proteininteractions: a novel approach to evaluate binding free energies, J. Am. Chem. Soc.121 (1999) 8133–8143.

[39] S.P. Brown, S.W. Muchmore, Large-scale application of high-throughput molecularmechanics with poisson-boltzmann surface area for routine physicsbased scoringof protein-ligand complexes, J. Med. Chem. 52 (2009) 3159–3165.

[40] V. Sharad, G. Sonam, T. Chetna, G. Sukriti, J. Salma, S. Aditi, G. Abhinav, Hydrophobicinteractions are a key to MDM2 inhibition by polyphenols as revealed by moleculardynamics simulations and MM/PBSA free energy calculations, PLoS One 11 (2016),e0149014.

[41] S. Dimitrios, S. Andrea, M. Giovanna, Exploring PHD fingers and H3K4me0 interac-tion with molecular dynamics simulations and bidning free energy calculations:AIRE-PHD1, a comparative study, PLoS One 7 (2012), e46902.

[42] Y.J. Hu, Y. Liu, L.X. Zhang, R.M. Zhao, S.S. Qu, Studies of interaction between colchi-cine and bovine serum albumin by fluorescence quenching method, J. Mol. Struct.750 (2005) 174–178.

[43] C. Weng, Y. Fu, H. Jiang, S. Zhuang, H. Li, Binding interaction between a queen pher-omone component HOB and pheromone binding protein ASP1 of Apis cerana, Int. J.Biol. Macromol. 72 (2015) 430–436.

[44] Y. Sun, H. Zhang, Y. Sun, Y. Zhang, H. Liu, J. Cheng, S. Bi, H. Zhang, Study of interactionbetween protein and main active components in Citrus aurantium L. by opticalspectroscopy, J. Lumin. 130 (2010) 270–279.

[45] D.C. Gilley, G. Degrandi-Hoffman, J.E. Hooper, Volatile compounds emitted by liveEuropean honey bee (Apis mellifera L.) queens, J. Insect Physiol. 52 (2006) 520–527.

[46] G. DeGrandi-Hoffman, D. Gilley, J. Hooper, The influence of season and volatile com-pounds on the acceptance of introduced European honey bee (Apis mellifera)Queens into European and Africanized colonies, Apidologie 38 (2007) 230–237.

[47] Song, X. M., Zhang, L. Y., Fu, X. B., Wu, F., Tan, J., and Li, H. L. (2018) Various bee pher-omones binding affinity, exclusive Chemosensillar localization, and key amino acidsites reveal the distinctive characteristics of odorant-binding protein 11 in the east-ern honey bee, Apis cerana. Front. Physiol. 9，422.

[48] P. Pelosi, I. Iovinella, J. Zhu, G.R. Wang, F.R. Dani, Beyond chemoreception: diversetasks of soluble olfactory proteins in insects, Biol. Rev. 93 (2018) 184–200.


http://refhub.elsevier.com/S0141-8130(19)34596-9/rf0005












































































































































[49] J.D. Laughlin, T.S. Ha, D.N.M. Jones, D.P. Smith, Activation of pheromone-sensitiveneurons is mediated by conformational activation of pheromone-binding protein,Cell 133 (2008) 1255–1265.

[50] G.M. Morris, D.S. Goodsell, R.S. Halliday, R. Huey, W.E. Hart, R.K. Belew, A.J. Olson,Automated docking using a Lamarckian genetic algorithm and an empirical bindingfree energy function, J. Comput. Chem. 19 (1998) 1639–1662.

[51] C.G. Dosremedios, P.D.J. Moens, Fluorescence resonance energy-transfer spectros-copy is a reliable ruler for measuring structural-changes in proteins-dispelling theproblem of the unknown orientation factor, J. Struct. Biol. 115 (1995) 175–185.


[52] A. Mallick, B. Haldar, N. Chattopadhyay, Spectroscopic investigation on the interac-tion of ICT probe 3-acetyl-4-oxo-6,7-dihydro-12H indolo-2,3-a quinolizine withserum albumins, J. Phys. Chem. B 109 (2005) 14683–14690.

[53] Y. Gong, H. Tang, C. Bohne, E. Plettner, Binding conformation and kinetics of twopheromone-binding proteins from the gypsy moth Lymantria dispar with biologicaland nonbiological ligands, Biochemistry 49 (2010) 793–801.

[54] J. Nardella, M. Terrado, N.S. Honson, E. Plettner, Endogenous fatty acids in olfactoryhairs influence pheromone binding protein structure and function in Lymantriadispar, Arch. Biochem. Biophys. 579 (2015) 73–84.





















mechanistic insight into binding interaction between ......mechanistic insight into binding...

Documents