mechanisms involved in the ucb neurotoxicity on … · new therapeutic compounds for...
TRANSCRIPT
U N I V E R S I T À D E G L I S T U D I D I T R I E S T E
DIPARTIMENTO DI BIOCHIMICA, BIOFISICA E CHIMICA DELLE MACROMOLECOLE
DOTTORATO DI RICERCA IN SCIENZE BIOMOLECOLARI XXI CICLO
Settore scientifico-disciplinare: Biochimica (Bio/10)
MECHANISMS INVOLVED IN THE UCB
NEUROTOXICITY ON CELLULAR MODELS
Dottorando: Coordinatore del Collegio Docenti: Pablo José Giraudi Prof. Franco Vittur Università degli Studi di Trieste
Relatore: Prof. Claudio Tiribelli
Università degli Studi di Trieste
Correlatore:
Dott. ssa Cristina Bellarosa
Centro Studi Fegato
ANNO ACCADEMICO 2007-2008
A Silvia, Daniela, María y Francisco que me ayudan a crecer día a día
This study was supported by a fellowship from the Italian Ministry of Foreign
Affairs (MAE) in Rome, Italy. In particular, I wish to thank Dr. Paola
Ranocchia.
Contents
Abbreviations I
Summary III
Riassunto V
Chapter 1: General Introduction 1
1. Bilirubin Neurological Diseases 2
1.1. Bilirubin Encephalopathy 2
1.2. Kernicterus 2
1.3. Bilirubin-Induced Neurological Dysfunction 3
2. Chemical-physical characteristics of bilirubin 3
2.1. Structure 3
2.2. Bilirubin ionization and aqueous solubility 4
3. Bilirubin metabolism 5
4. Disorders of bilirubin metabolism 7
4.1. Disorders of bilirubin metabolism characterized by predominantly unconjugated
hyperbilirubinemia 7
4.2. Disorders of bilirubin metabolism characterized by predominantly conjugated
hyperbilirubinemia 9
5. Bilirubin neurotoxicity 10
5.1. The blood - brain barrier 10
5.2. Entry of UCB into brain and protective mechanisms against its neurotoxicity 11
5.3. Molecular basis of UCB neurotoxicity 12
6. Global aims of the thesis 14
7. References 14
Chapter 2: Cellular models for the study of bilirubin toxicity 21
Abstract 22
1. Introduction 23
2. Materials and Methods 24
2.1. Chemicals 24
2.2. Cell culture 24
2.3. UCB solutions and Bf measurements 25
2.4. [3H]- Bilirubin uptake in culture cells 26
2.5. Cell viability studies after UCB treatments 26
2.6. Immunocytochemistry labelling for Mrp1 27
2.7. RNA isolation, reverse transcription and quantitative PCR 28
2.8. Statistical analysis 29
3. Results 30
3.1. [3H]- Bilirubin uptake by HeLa, 2a1 and SH-SY5Y cells 30
3.2. Bilirubin effect on cell viability in HeLa, 2a1 and SH-SY5Y cells 30
3.3. Localization of Mrp1 in 2a1 and SH-SY5Y cells 31
3.4. Mrp1 and Mdr1 mRNA levels in HeLa and SH-SY5Y cells 32
4. Discussion 33
5 References 34
Chapter 3: Cytotoxicity is predicted by unbound and not total bilirubin concentration 40
Abstract 41
1. Introduction 42
2. Materials and Methods 43
2.1. Chemicals 43
2.2. Cell cultures 43
2.3. Preparations of bilirubin/albumin systems 43
2.4. Bf measurements 44
2.5. Cell viability by MTT reduction 44
2.6. Effect of different albumin preparations on Bf levels and time course of toxicity 44
2.7. Effect of sulfadimethoxine on Bf and cell viability 45
2.8. Effect of light on Bf and cell viability 45
2.9. Statistical analysis 45
3. Results 46
3.1. Effect of different binders on Bf levels 46
3.2. Effect of Bf on cell viability in different cell lines 46
3.3 Effect of sulfadimethoxine on Bf and on viability of SH-SY5Y cells 47
3.4 Effect of Bf on cell viability without albumin 48
3.5 Effect of light on Bf and cell viability 49
4 Discussion 50
5 References 52
Chapter 4: Characterization of the SH-SY5Y cells as a model to bilirubin toxicity 56
Abstract 57
1. Introduction 58
2. Materials and Methods 60
2.1. Chemicals 60
2.2. Cell culture 60
2.3. Treatment of SH-SY5Y cells with Bf (A time course study) 60
2.4. Priming with UCB of SH-SY5Y cells 62
2.5. Determination of intracellular ROS levels and cell proliferation by FACS analysis 62
2.6. Glutathione determinations 63
2.7. Monitoring of cell growth after priming 64
2.8. Response of SH-SY5Y primed cells to a second stress (Bf or H2O2) 64
2.9. Gene expression profile experiments (Microarray analysis) 64
2.10. Real time RT-PCR and Western Blot studies 65
2.11. Statistical analysis 68
3. Results 69
3.1. Sensitivity of SH-SY5Y cells to free bilirubin (Bf) 69
3.2. ROS production in SH-SY5Y primed cells 70
3.3. Intracellular total GSH level in SH-SY5Y primed cells 72
3.4. Growth curve analysis in SH-SY5Y primed cells 74
3.5. Response of SH-SY5Y primed cells to a second stress (Bf or H2O2) 75
3.6. Gene expression profiling induced by UCB 78
3.7. Validation of microarray results by Real time RT-PCR for SLC7A11 gene
and Western Blot for its expression product (xCT) 81
4. Discussion 84
5. References 87
Conclusions and perspectives 93
Acknownledgements 95
List of Publications 96
I
Abbreviations
ABE Acute bilirubin encephalopathy
ABR Auditory brainstem response
APE1/Ref1 Apurinic/apyrimidinic endonuclease 1/redox effector factor
ATP Adenosine triphosphate
BBB Blood Brain Barrier
Bf Free unconjugated bilirubin
BIND Bilirubin induced neurological dysfunction
BSA Bovine serum albumin
BSO Buthionine sulfoximine
BT Total unconjugated bilirubin
CNS Central nervous system
CP Choroid plexus
CSF Cerebrospinal fluid
DEM Diethyl maleate
DMSO Dimethyl sulfoxide
DTNB 5’,5’- dithiolbis-2-nitrobenzoic acid
ER Endoplasmic reticulum
Erg-1 Early growth response 1
FACS Fluorescence activated cell sorting
FCS Fetal calf serum
4F2hc 4F2 cell-surface antigen heavy chain
GSH Reduced glutathione
GSSG Oxidized glutathione
H2DCFDA 2’,7’- dichlorodihydrofluorescein diacetate
HSA Human serum albumin
MDR1 Multidrug resistance protein 1
MEF Mouse embryo fibroblast
MRI Magnetic resonance imaging
MRP1 Multidrug resistance - associated protein 1
MTT Methylthiazoletetrazolium
NADPH Nicotinamide – adenine dinucleotide phosphate
II
NMDA N- methyl – D – aspartate receptor
PBS Phosphate-buffered saline
PMSF Phenylmethylsulphonylfluoride
PTEN Phosphatase and tensin homolog
SLC7A11 Solute carrier family 7, (cationic amino acid transporter, y+ system)
member 11
SLC3A2 Solute carrier family 3 (activators of dibasic and neutral amino acid
transport
UCB Unconjugated bilirubin
xCT Cystine/glutamate transporter
III
SummarySummarySummarySummary
This doctoral thesis covers three years period (2006-2008) during which I have
investigated the bilirubin neurotoxicity in the neuroblastoma SH-SY5Y cell line, a
neuronal cell model widely used in the study of the pathogenesis and in the development of
new therapeutic compounds for neurodegenerative diseases.
In the first chapter is summarized the current knowledge about bilirubin chemistry
and metabolism including disorders of bilirubin metabolism and the neuronal disturbances
associated. In addition, the main discoveries in bilirubin toxicity mechanisms are
described.
Chapter two describes how we have chosen the cellular model to study the
unconjugated bilirubin (UCB) damage. We first compared the bilirubin accumulation and
cell viability in two neuronal cell lines (2a1 mouse neuronal progenitor cell line and SH-
SY5Y cell line) and one non neuronal cell line (HeLa cells). In addition, we performed
studies on cellular localization of Mrp1 (involved in UCB extrusion) and mRNA
expression. We observed that SH-SY5Y cells show higher accumulation of bilirubin and
lower survival than 2a1 and HeLa cells. SH-SY5Y cells shows a clear localization of Mrp1
at membrane level. Based on these observations we selected the SH-SY5Y cell line as our
experimental model, and we characterized this cell line for molecular events linked with
bilirubin neurotoxicity.
Chapter three revises original data published by mainly our group, about “the free
bilirubin hypothesis”. It has been suggested that cell injury correlates better with free
unconjugated bilirubin (Bf) than total unconjugated bilirubin (BT). To directly test this
hypothesis we evaluated cell viability in four cell lines (SH-SY5Y, MEF, HeLa and 2a1
cell lines) after incubation with different Bf/BT ratios, obtained by mixing varied UCB
concentrations and albumins with different binding affinities (bovine, fetal calf and
human); Bf was measured in each solution by the peroxidase method. Our data show that
the loss of viability is dependent on the Bf but not on BT although bilirubin sensitivity
varied with the different cell line tested. This in vitro study reinforces the proposal that Bf
or Bf combined with total serum bilirubin should improve risk assessment for
neurotoxicity in both term and premature infants.
Chapter four describes our studies about the biochemical and molecular changes in
SH-SY5Y cells exposed to a rather high Bf (140 nM) for 24 hours. Biochemical changes
Summary
IV
(cell viability, proliferation, cellular redox environment -ROS and GSH content) and gene
expression profile were evaluated in the cells which survived after the treatment. Results
suggest that the surviving cells become more resistant to a second oxidative exposition (Bf
or H2O2) and this was associated with an increases expression of various genes involved
both in ER stress response and in the transport system Xc- (cystine-glutamate exchanger).
This transport system is of great relevance in maintaining the redox homeostasis within the
cell, and together with the ER stress genes may contribute to the activation of an adaptative
response to bilirubin damage.
Further studies will be necessary to elucidate the molecular mechanisms that confer
resistance to bilirubin toxicity; these mechanisms could help understanding the different
sensitivity of the cells to bilirubin damage, and why some neuronal cells die (as the
Purkinje cells) while others don’t. Furthermore, these studies may achieve to the
identification of target proteins useful to develop new drugs: this may be the case of the
system Xc-.
V
RiassuntoRiassuntoRiassuntoRiassunto
Questo lavoro di tesi è il frutto delle ricerche svolte nei tre anni del mio dottorato
(2006-2008), durante i quali mi sono occupato dello studio della neurotossicità da
bilirubina nella linea cellulare di neuroblastoma umano SH-SY5Y; si tratta di un modello
cellulare neuronale ampiamente utilizzato nello studio della patogenesi di malattie
neurodegenerative, nonché nello sviluppo di composti neuroprotettivi.
Nel primo capitolo si trovano riassunte le conoscenze attuali riguardanti la chimica
della bilirubina, il suo metabolismo ed eventuali disordini ed i disturbi neuronali associati
ad essa; inoltre, sono descritte le principali scoperte sui suoi meccanismi di tossicità.
Nel secondo capitolo viene descritta come è stata effettuata la scelta di un modello
cellulare adeguato allo studio del danno da bilirubina non coniugata (UCB). A questo
scopo sono stati confrontati l’accumulo in bilirubina triziata e la vitalità cellulare dopo un
trattamento con bilirubina libera, in due linee cellulari neuronali (progenitori neuronali di
striato di topo -cellule 2a1- , neuroblastoma umano -cellule SH-SY5Y-) ed in una linea
cellulare non neuronale (cellule HeLa). Oltre a ciò, sono stati eseguiti alcuni studi sulla
localizzazione del trasportatore Mrp1 (coinvolto nell’estrusione di UCB), e
sull’espressione dei geni Mrp1 ed Mdr1 (il cui prodotto proteico è un possibile
trasportatore di bilirubina). Abbiamo osservato che le cellule SH-SY5Y presentano un
accumulo di bilirubina più elevato ed una più bassa sopravvivenza rispetto alle cellule 2a1
ed HeLa, sebbene nelle cellule SH-SY5Y la localizzazione di Mrp1 risulti essere a livello
di membrana plasmatica. Basandoci su queste osservazioni abbiamo scelto di lavorare con
il modello cellulare già noto SH-SY5Y, e ci siamo occupati di caratterizzarlo per la
neurotossicità da bilirubina.
Nel terzo capitolo vengono presentati dati sperimentali pubblicati dal nostro gruppo a
supporto dell’ “ipotesi della bilirubina libera”, la quale postula che il danno cellulare da
bilirubina correli in modo migliore con la concentrazione di bilirubina libera (Bf) piuttosto
che con quella di bilirubina totale (BT). Al fine di testare quest’ipotesi abbiamo valutato la
vitalità in quattro diverse linee cellulari (SH-SY5Y, MEF, HeLa e 2a1) dopo aver incubato
le cellule in soluzioni con un diverso rapporto Bf/BT. Tali soluzioni sono state ottenute
sciogliendo diverse quantità di UCB in terreno con diversi tipi di albumina (bovina, umana
e di siero fetale bovino); questi binders possiedono differenti affinità per la bilirubina. La
Bf è stata determinata in ciascuna soluzione utilizzando il metodo della perossidasi. I dati
VI
ottenuti suggeriscono che, sebbene la sensibilità alla bilirubina vari nelle diverse linee
cellulari, la riduzione in vitalità dipenda dalla Bf e non dalla BT. Quindi, questi studi in
vitro costituiscono un’evidenza in più a favore della teoria della bilirubina libera, e
sostengono la necessità di valutare il rischio di Kernittero mediante la misura della Bf
serica e non solo della bilirubina totale.
Nel quarto capitolo si descrivono le modificazioni a livello biochimico e molecolare
nella linea cellulare SH-SY5Y dovute ad un trattamento di 24 ore in presenza di un’elevata
concentrazione di bilirubina libera. Nelle cellule sopravvissute al trattamento abbiamo
valutato diversi parametri biochimici tra cui vitalità e proliferazione cellulare ed ambiente
redox cellulare (contenuto di ROS e GSH), nonché il pattern di espressione genica indotto
dalla bilirubina. I risultati ottenuti suggeriscono che le cellule SH-SY5Y sopravvissute
siano più resistenti all’esposizione ad un secondo stress ossidativo (Bf o H2O2), inoltre
queste cellule mostrano un’aumentata espressione di diversi geni coinvolti nella risposta
allo stress di reticolo endoplasmatico e dei geni i cui prodotti proteici fanno parte del
sistema di trasporto Xc- (antiporto cistina-glutammato). Questo sistema di trasporto è
estremamente importante nel mantenimento dell’omeostasi redox cellulare, ed insieme ai
geni dello stress di ER potrebbe contribuire all’attivazione di una risposta adattativa al
danno da bilirubina.
Ulteriori studi che ci consentano di comprendere i meccanismi molecolari che
conferiscono resistenza alla neurotossicità da bilirubina potrebbero aiutarci a capire la
differenza di sensibilità dei diversi tipi di cellule alla bilirubina stessa, ed il motivo per cui
alcune cellule neuronali muoiano (come ad esempio le cellule di Purkinje) mentre altre no.
Inoltre questi studi possono portarci all’identificazione di target proteici utili allo sviluppo
di nuovi farmaci, quale può essere ad esempio il caso del trasportatore Xc-.
1
Chapter 1
General Introduction
Chapter 1
2
1. Bilirubin Neurological Disease Although originally a pathologic diagnosis characterized by bilirubin staining of the
brainstem nuclei and cerebellum, the term “kernicterus” has come to be used
interchangeably with both the acute and chronic findings of bilirubin encephalopathy.
Bilirubin encephalopathy describes the clinical central nervous system findings
caused by bilirubin toxicity to the basal ganglia and various brainstem nuclei. To avoid
confusion and encourage greater consistency in the literature, the Committee for Quality
Improvemment and Subcommittee on Hyperbilirubinemia of the American Academy of
Pediatrics (AAP) recommends that in infants the term “acute bilirubin encephalopathy” be
used to describe the acute manifestations of bilirubin toxicity seen in the first weeks after
birth and that the term “kernicterus” be reserved for the chronic and permanent clinical
sequelae of bilirubin toxicity (1).
1.1 Bilirubin Encephalopathy The classical clinical expression of acute bilirubin encephalopathy (ABE) consists of
decreased feeding, lethargy, variable abnormal tone (hypotonia or hypertonia), highpitched
cry, retrocollis and opisthotonus, setting sun sign, fever, seizures, and death. Laboratory
evidence ranges from increased abnormal auditory brainstem respons (ABR) interwave
intervals I–III and I–V and decreased amplitude waves III and V to absent ABRs, and
magnetic resonance imaging (MRI) shows acute abnormalities in the globus pallidus and
subthalamic nucleus. Abnormal ABRs may improve or normalize with exchange
transfusion (2) (3).
1.2 Kernicterus Kernicterus is a severe and life-threatening condition with an incidence of less than 1
of 30,000 jaundiced neonates, described for the first time by Jaques F. É. Hervieux in 1847 (4). Kernicterus causes selective yellow staining in the basal ganglia, especially the globus
pallidus and subthalamic nucleus. Brainstem nuclei, especially the auditory (cochlear
nucleus, inferior colliculus, superior olivary complex), oculomotor and vestibular nuclei
are especially vulnerable. Other susceptible areas are the cerebellum, especially Purkinje
cells, and the hippocampus especially the CA2 sector. The basal ganglia lesions are
clinically correlated with the movement disorders of dystonia and athetosis. Abnormalities
of the auditory brainstem nuclei are associated with deafness, hearing loss, and a recently
Chapter 1
3
described entity known as auditory neuropathy (AN), also known as auditory dys-
synchrony (AD). Abnormalities of the brainstem oculomotor nuclei are associated with
strabismus and gaze palsies, especially paresis of upgaze (5).
The basal ganglia can be imaged with MRI, the signature of which is bilateral
damage of the globus pallidus. The subthalamic nucleus can sometimes be seen and is
characteristically affected.
In conclusion, kernicterus is a complex clinical and neuropathological syndrome
where 70% of children with kernicterus die within seven days, while the 30% survivors
usually suffer the irreversible described neurological sequelae. The clinical expression of
bilirubin neurotoxicity varies with location, severity, and time of assessment, and is
influenced by factors including the amount, duration and developmental age of exposure to
excessive free bilirubin. Although total serum bilirubin is an important risk factor,
kernicterus cannot be defined based on total serum bilirubin alone. Wennberg suggested
that measurement of free bilirubin in newborns with hyperbilirubinemia will improve risk
assessment for nurotoxicity (6). Finally, Shapiro suggest that kernicterus may be defined for
study purposes in term and near-term infants with total bilirubin 20 mg/dl using abnormal
muscle tone on neurological examination, auditory neurophysiological testing ABR and
MRI (5).
1.3 Bilirubin-Induced Neurological Dysfunction The term Bilirubin-Induced Neurological Dysfunction (BIND) is described by AAP
as a scoring scale to evaluate the severity of acute bilirubin encephalopathy in regards to
the need of treatment of infants. The BIND score has not yet been validated but it will
comprise a spectrum of permanent sequelae seen (often in the subtle, non-classical
sequelae) due to less severe hyperbilirubinemia (7).
2. Chemical – physical characteristics of bilirubin 2.1 Structure Unconjugated bilirubin (UCB) is a nearly symmetrical tetrapyrrole, consisting of two
rigid, planar dipyrrole units, joined by a methylene bridge at carbon 10. The structure thus
resembles a two bladed propeller, in which the blades could theoretically be joined at
different angles and each blade could rotate about its bond to the methylene bridge (8). In
Chapter 1
4
the preferred “ridge-tile” conformation, the two dipirrinones are synperiplanar, as in a
partially opened book, and the angle (θ) between the two planes is about 95°.
The rigid biplanar structure of bilirubin IXα the most naturally occurring isomer (9)(Figure 1.1), with its internal hydrogen bonds, was first demonstrated in the crystalline
state by X-ray diffraction (10), but is also the preferred conformation in solutions of UCB in
water, alcohols, and chloroform (11).
2.2 Bilirubin ionization and aqueous solubility At physiological pH values in plasma (7.4), tissues (7.6) and bile (6.0 to 8.0) there is
significant ionization of the –COOH groups of the natural IXα isomer of UCB (12), so that,
in addition to the diacid (H2B), a proportion of UCB is present as monoanion (HB-) and
dianion (B2-). The pK’a values of the –COOH groups on the two carboxymethyl
(propionyl) sidecahins determine the proportions of the free UCB species at any given pH.
The calculated proportions of the individual UCB species in aqueous solution at pH values
from 6.0 to 8.0, using the partition-derived experimental pK’a values (12), show that H2B is
the dominant species and HB- the dominant anion over this physiological pH range. The
bilirubin dianion B2- is a significant fraction only at pH 7.2 (Figure 1.2).
Figure 1.1. The structure of bilirubin IXα-Z,Z, diacid (H2B), which consist of two slightly asymmetrical, rigid, planar dipyrrinone chromophores, connected by a central –CH2- bridge. (Adapted from Pu et al. Tetrahedron 47: 6163-6170)
Chapter 1
5
The low aqueous solubility of UCB diacid is probably due to its many hydrophobic
groups and the internal hydrogen bonding of all its polar groups precluding their
interaction with water (13;14). Experimental solubility near to neutral pH, determined by
chloroform-to-water partition (12), indicate that the maximum aqueous solubility of H2B at
25°C and ionic strength 0.15, is about 70 nM. Bilirubin solubility increases with increasing
pH due to successive ionization of H2B to HB- and B2-.
3. Bilirubin Metabolism Bilirubin is the oxidative product of the protoporphyrin portion of the heme group
present in haemoglobin, myoglobin, and some enzymes. An adult healthy person produces
250-400 mg of bilirubin per day (15). More than 80% of the bilirubin produced in the
human body derives from heme catabolism liberated from senescent red cells, 15-20%
derives from the turnover of myoglobin, cytochromes and other hemoproteins, and less
than 3% derives from destruction of immature red blood cells in the bone marrow (15;16).
Heme degradation is performed by the reticuloendothelial enzyme heme oxigenase,
which is particularly abundant in spleen and liver Kupffer cells, the principal sites of red
cell breakdown. This enzyme directs stereospecific cleavage of the heme ring, freeing the
iron ion and forming a tetrapyrrolic chain with the final formation of biliverdin and carbon
monoxide (17). This reaction requires a reducing agent, such as, nicotinamide-adenine
dinucleotide phosphate (NADPH) and three molecules of oxygen. Following its synthesis
biliverdin is converted to bilirubin by the cytosolic enzyme biliverdin reductase, in the
presence of NADPH (Figure 1.3).
Figure 1.2. Proportions of unbound species of unconjugated bilirubin at pH 6.0 to 8.0, derived from partitions of UCB from chloroform into buffered NaCI at ionic strengh 0.15. Adapted from Hahm et ak, J. Lipid Rrs. 33: 1123-1137
Chapter 1
6
Once released in the blood and due to its poor aqueous solubility, bilirubin is tightly
but reversibly binds to serum albumin. Albumin binding keeps bilirubin in solution and
transports the pigment to different organs and to the liver in particular. Albumin binds
almost the total bilirubin and less than 0.1% of the pigment is unbound to albumin. This
small unbound fraction of bilirubin (Bf) is thought to be responsible for its biological
effects (18-20).
Despite high-affinity binding to albumin, bilirubin is rapidly transferred from plasma
into the liver. At the sinusoidal surface of the hepatocytes, bilirubin dissociates from
albumin and is internalized, though mechanism not yet fully clarified. Although it is
known that bilirubin uptake is saturable, indicating a carrier-mediated process, the
molecules responsible for this transport are still underdetermined (21;22). Once within the
aqueous environment of the hepatocyte, bilirubin is again bound to a group of proteins,
mainly to glutathione-S-transferases (23;24). These cytosolic proteins are of importance in
diminishing reflux of unconjugated and conjugated bilirubin back into the plasma.
Figure 1.3. Bilirubin metabolism. Bilirubin derives from heme metabolism by heme-oxigenase and biliverdin reductase.
Chapter 1
7
Inside of the endoplasmic reticulum, bilirubin is conjugated with either one or two
molecules of glucuronic acid by the enzime UDP-glucuronosyltransferase 1A1 (UGT).
These mono- and di- glucuronides display high polarity, which renders then water soluble
and unable to diffuse across membranes, and allows their secretion into the bile canaliculus
by the membrane transporter multidrug resistance protein 2 (MRP2 or ABCC2).
Conjugated bilirubin excreted in bile passes through the small intestine without
significant absorption. In the colon, it is both deconjugated, presumably by the bacterial β-
glucuronidase, and degraded by other bacterial enzymes to a large family of reduction-
oxidation products, collectively known as urobilinoids, which are mostly excreted by feces.
4 Disorders of bilirubin metabolism Hepatic transport of bilirubin involves four distinct but probably interrelated stages:
a) uptake from the circulation; b) intracellular binding or storage: c) conjugation, largely
with glucuronic acid; and d) biliary excretion. Abnormalities in any of these processes may
result in hyperbilirubinemia. In several inheritable disorders, the transfer of bilirubin from
blood to bile is disrupted at a specific step. Study of these disorders has permitted better
understanding of bilirubin metabolism in health and disease. Each disorder is characterized
by varied degrees of hyperbilirubinemia of the unconjugated or conjugated type (25).
4.1 Disorders of bilirubin metabolism characterized by predominantly
unconjugated hiperbilirubinemia Neonatal hyperbilirubinemia
In general, neonates are not jaundiced at the moment of birth because of the ability of
the placenta to clear bilirubin from the fetal circulation. At birth, this placental protection is
suddenly lost, just when an acute increase in production of unconjugated bilirubin occurs,
due to the shorter red blood cells life span of newborns (70-90 vs. 120 days in adults),
especially in prematures. In addition, the newborn has to use its own immature
mechanisms for hepatic uptake, conjugation and biliary secretion of bilirubin. All these
reasons together explain the significant retention of UCB occurring in almost all healthy
term neonates (9;26;27). Such retention is further enhanced by the absence of intestinal
bacterial flora in the newborn infant, leading to more unmetabolized UCB available for
intestinal absorption, thus increasing the enterohepatic circulation of UCB (28). As a result,
about half of all neonates become clinically jaundiced during the first days of life, with
Chapter 1
8
moderate to elevated serum UCB levels that returned to normal within 7 to 10 days with
not treatment requirement (27;29). This condition is known as “physiologic jaundice”. This
neonatal jaundice reflects the transition from intrauterine to extrauterine bilirubin
metabolism; it is considered benign and is linked to normal development.
However, in some newborns plasma UCB levels can increase dramatically and
expose the baby to the risk of kernicterus. Although plasma bilirubin levels of 20
mg/dL or higher are considered dangerous, bilirubin encephalopathy may occur at lower
concentrations. Phototherapy and exchange transfusions are two therapeutic options in the
neonate, which have significantly reduced the prevalence of bilirubin encephalopathy (30).
Crigler-Najjar Syndrome, Type I and II
Crigler-Najjar syndrome tipe I is a rare genetic disorder (one in 1.106 newborns)
described by Crigler and Najjar in 1952 (31) and is characterized by sever unconjugated
hyperbilirubinemia due to the absence of the UGT enzyme. Serum bilirubin is virtually all
unconjugated and the levels typically range from 15 to 45 mg/dL and, if untreated by
phototherapy, may result in kernicterus with permanent neurological damage, or death. At
present, the only cure is orthotropic liver transplantation (OLT), which permanently
corrects the metabolic defect (32).
Crigler-Najjar syndrome, type II is differentiated from type I by reduction of serum
bilirubin levels on treatment with phenobarbital or other agents which induce hepatic
microsomal enzymes (33;34). Phenobarbital functions via a phenobarbital-responsive
enhancer module which stimulates the UGT 1A1 gene to induce production of the bilirubin
conjugating enzyme (35).
Many different mutations in the UGT gene have been identified, which may cause
both types I and II Crigler Najjar syndrome. Most of these occur in the coding region of
the gene. Mutations leading to type I syndrome are mainly missense mutations, nonsense
mutations, mutations leading to a premature stop codon, mutations leading to frame shifts
and splice site mutations, all leading to no enzyme-proteins, truncated enzymes or inactive
full-length enzyme proteins. Missense mutations found in association with type II Crigler-
Najjar syndrome result in partial enzyme activity (36).
Chapter 1
9
An animal model of Crigler-Najjar Type I
Mutant Wistar rats with non-hemolytic unconjugated hyperbilirubinemia were
described by Gunn in 1938. Homozygous Gunn rats lack UGT activity and are prototypes
of Crigler-Najjar syndrome, type I. The molecular basis of UGT1A1 deficiency in this
strain is the deletion of a guanosine base in the common region exon 4. Gunn rats have 3 to
20 mg/dL of serum bilirubin, all of which is unconjugated. Heterozygous Gunn rats are
anicteric. Homozygous Gunn rats develop cytoplasmic neuronal changes on the third day
of life; and degeneration of Purkinje cells and other neuronal cells is evident by 2 weeks.
The brain of a healthy Gunn rat does not have yellow staining.
Gilbert Syndrome
It is a common, benign condition frequently encountered (3-5%) in healthy adults.
Gilbert syndrome is suspected when routine tests show an increased total serum bilirubin
(1-5 mg/dL), almost completely in the unconjugated moiety, without signs of increased
hemolysis and with normal routine liver function test and hepatic histology (25). The most
common genetic polymorphism encountered in association with Gilbert’s syndrome is that
of an additional TA insertion in the TATAA box of the UGT 1A1 promoter, identified as
UGT1A1*28, although not all individuals homozygous for the promoter mutation manifest
clinical signs of this condition (36).
4.2 Disorders of bilirubin metabolism characterized by predominantly conjugated hyperbilirubinemia
Dubin-Johnson Syndrome and Rotor’s syndrome
Dubin-Johnson syndrome is characterized by chronic intermittent conjugated
hyperbilirubinemia and black pigmentation of the liver without other abnormalities of
clinico-chemical test for liver dysfunction (37;38). The cause of Dubin-Johnson syndrome is
a nonsense mutation of the coding region of the gene for MRP2 (ABCC2), the canalicular
membrane transporter that normally extrudes a vast number of metabolites into bile,
including conjugated bilirubin. Bilirubin glucuronides reflux back into blood creating a
typical pattern of conjugated hyperbilirubinemia and are excrete by the kidneys causing
bilirubinuria.
Chapter 1
10
Rotor’s syndrome is characterized by accumulation of conjugated bilirubin also in
presence of normal liver function test. In contrast to Dubin-Johnson syndrome, there is no
increased pigmentation of the liver. Its molecular basis is unknown.
Onset is typically in adults although it may rarely become manifest in infancy as
severe cholestasis. Both syndromes have an excellent prognosis (39).
5. Bilirubin neurotoxicity Recent increases in the prevalence of bilirubin encephalopathy and its occasional
occurrence at plasma bilirubin levels below therapeutic guidelines (40) have revived interest
in understanding the mechanisms of UCB-induced neurotoxicity (41). Neurotoxicity is
determined primarily by the free bilirubin (Bf), the concentration of the unbound free
fraction of UCB in plasma. Below the aqueous solubility limit of 70 nM at pH 7·4,
unbound UCB is exclusively in the form of monomers and small oligomers (12). When Bf is
modestly above saturation, UCB diacid forms soluble oligomers and charge-stabilized,
metastable microaggregates (42). It is only at higher Bf values (roughly approximately 1
µM) that insoluble precipitates of UCB diacid form (12), which have long been believed to
cause frank kernicterus (43).
5.1 The blood-brain barrier
Except for the circumventricular region of the brain, penetration of drugs and other
compounds into the cerebrospinal fluid (CSF) and brain parenchyma is limited by two
barriers: the choroid plexus (CP, the blood–CSF barrier) and the brain capillary
endothelium (the blood–brain barrier, BBB). The endothelial cells of the BBB have tight
junctions and no fenestrae, so they severely restrict both paracellular and transcellular
diffusion of many toxic compounds to the adjacent neurons and astrocytes. In the CP, the
endothelial cells lack tight junctions and are fenestrated, allowing some access of plasma
proteins and their bound ligands to the CSF.
Chapter 1
11
5.2 Entry of UCB into brain and protective mechanisms against its neurotoxicity
In contrast to other reservoirs for bilirubin binding, the brain is unique by having a
BBB that reduced the velocity at which equilibrium between plasma and brain is achieved.
If the BBB is disrupted, the complex bilirubin-albumin rapidly moves into the extracellular
space of brain, and bilirubin will produce immediate global neurotoxicity (44;45). When the
BBB is intact, the rate of bilirubin uptake by brain is determined by: a) the Bf
concentration and Bf uptake presumably mediated by OAPTs/Oatps transporters (46); b) the
permeability and surface area of the capillary endothelium; c) the transit time through the
capillary bed; d) the dissociation rate of bilirubin/albumin, K-1; and e) the blood flow (47).
Bilirubin uptake may be increase by alterations in BBB permeability to Bf or albumin (e.g.
hyperosmolality, sever asphyxia), prolonged transit time (e.g. increased venous pressure),
an increase in blood flow (e.g. hypercarbia), or an increase in the dissociation rate (e.g.
altered albumin binding in sick infants).
Net transport of bilirubin across the BBB may also be influenced by the energy
dependent multidrug resistant transporters, MDR1 and MRP1. MRD1, or P-glycoprotein,
is one of several transporters involved in cellular efflux of xenobiotics, and is expressed in
capillary endothelial cells of the BBB, astrocytes, and the choroids plexus (46). In a study by
Watchko (48), brain uptake of bilirubin in Mdr1a-/- knockout mice infused with high
concentrations of bilirubin was twice that of controls ( Mdr1+/+). Inhibition of P-
glycoprotein augments bilirubin-induced apoptosis in a human neuroblastoma line (49) and
increases bilirubin content in brains of young adult rats (50).
Figure 1.4. Schematic representation of the organization of the brain and its barriers, including the distribution and, where known, polarity (arrows) of the MDR1/Mdr1 and MRP1/Mrp1 transporters in the various cell types. (Adapted from Ostrow J.D. et al. European Journal of Clinical Investigation 33: 988-997).
Chapter 1
12
The multidrug-resistance–associated protein, MRP1, performs similar functions.
MRP1 is highly expressed in choroid plexus epithelium, astrocytes, (rat) neurons, and
placenta trophoblast but has minimal expression in capillary endothelium in whole brain (51). It is upregulated in cultured cells that are exposed to unconjugated bilirubin and
mediates ATP-dependent cellular export of bilirubin (52). Inhibition of cultured astrocytes
with a non-specific MRPs inhibitor increases apoptosis induced by low concentrations of
bilirubin (53). More relevant is the observation that MRP1 is able to bind UCB with the
highest affinity so far reported (10 nM) (54) and MEF (mouse embryonic fibroblast) cells
from Mrp1 KO rats show a higher UCB toxicity (55). Recently Corich demonstrate in
neuroblastoma SH-SY5Y cells, by small interfering RNA of MRP1 and MDR1 that, at
clinically-relevant Bf levels, protection from UCB cytotoxicity was correlated with the
level of expression of MRP1 but not MDR1 (56).
Other potential cellular defense mechanisms include: a) mitochondrial bilirubin
oxidation that has been demonstrated in guinea pig and rat brain (57;58), but its distribution
in the central nervous system (CNS) and role in jaundiced animals are unknown; b)
binding of bilirubin to cytosolic proteins (e.g. glutathione-S-transferases); and c) anti-
apoptosis factors as neuronal apoptosis inhibitors proteins (NAIPs) that inhibit, caspases 3,
7 and other proteins in the apoptotic pathways (59;60).
5.3 Molecular basis of UCB neurotoxicity
The toxic effect of bilirubin in the brain of neonates has been observed since ancient
times. The study of morphological changes associated with hyperbilirubinemia has been
ongoing for decades, and yet the most basic question of the cytotoxicity of bilirubin and
pathogenesis of observed associated lesions remains unresolved.
Bilirubin exhibits a wide range of toxic effects in cell culture systems and in cell
homogenates. Bilirubin inhibits DNA synthesis in a mouse neuroblastoma cell line (61), and
uncouples oxidative phosphorylation and inhibits adenosine triphosphatase (ATPase)
activity of brain mitochondria (62). In mutant Gunn rats with congenital nonhemolytic
hyperbilirubinemia, bilirubin inhibited RNA and protein synthesis, and the carbohydrate
metabolism in brain (63). In developing rat brain neurons, UCB permeabilizes
mitochondrial membranes (64), (65), leading to mitochondrial swelling and the release of
cytochrome c into the cytosol (66). This triggers activation of caspase-3 and translocation of
bax, resulting in cell death by apoptosis via the mitochondrial pathway (67;68). Interestingly,
Chapter 1
13
the level of cell death by apoptosis is similar to that of necrosis in cultured astrocytes
exposed to UCB, suggesting that UCB-induced cell death is not linked to a single pathway (69-71). In a recent study, decreased oligodendroglial cell viability and increased apoptosis
following exposure to UCB were also observed (72). In addition to the role of mitochondria
in mediating apoptotic cell death initiated by UCB, activation of caspase 8, an initiator of
apoptosis, suggests that the cell-surface death receptor pathway might be amplified by
UCB-induced enlargement of the rough endoplasmic reticulum, which has direct effects on
intracellular Ca2+ (73;74). Indeed, in a cell-free system, bilirubin inhibited Ca2+-activated,
phospholipid-dependent, protein kinase (PKC) activity and 3’,5’-cyclic adenosine
monophosphate (cAMP)-dependent protein kinase activity (75) may be relevant in the
mechanisms of its toxicity. Recently, Cesaratto and Calligaris demonstrated using HeLa
and mouse embryonic fibroblasts that bilirubin modulates a signalling pathway involving
APE1/Ref-1 (a master redox regulator in eukaryotic cells), Egr-1 and PTEN (76).
Collectively, these observations point to the disruption of several vital functions by UCB,
rather than a single cell-death pathway.
On the other hand, the effects of UCB on neuronal excitability has been the subject
of several studies. UCB has significant inhibitory effects on the nervous system, end even
short-term exposure to UCB can inhibit long-term exposure potentiation of synaptic
transmission in the hippocampus (77), which is an important function affecting learning and
memory. This inhibition is in accordance with previous observations showing that UCB
inhibits protein kinase C activity in cultured neurons (78). This activity is essential to
maintain the synaptic activity that results from an influx of Ca2+ through a high
conductance cation channel in the plasma membrane of the post-synaptic neuron. The
opening of this channel is triggered by depolarization of the membrane, as well as the
binding of glutamate to N-methyl-D-aspartate (NMDA class 1) receptors in the membrane (79). The mechanism by which UCB disrupts cell homeostasis might also be related to the
direct interaction of UCB with nerve cell membranes, which increase oxidative damage
and membrane permeability and decreases lipid and protein order (80).
Chapter 1
14
6. Global aims of the thesis
The main goal of the present work is to further contribute to a better knowledge of
the molecular mechanisms underlying neonatal hyperbilirubinemia neurotoxicity
particularly in the early stage. This thesis has three specific aims:
1) To clarify, in vitro system if bilirubin cytotoxicity correlates with free bilirubin or
total bilirubin concentration,
2) To study biochemicals and genetic changes caused by bilirubin causes in the in vitro
system,
3) To identify potential drug targets to prevent bilirubin neurological damage.
7. Reference
1. (2004) Management of hyperbilirubinemia in the newborn infant 35 or more weeks of gestation, Pediatrics 114, 297-316.
2. Wennberg, R. P., Ahlfors, C. E., Bickers, R., McMurtry, C. A., and Shetter, J. L. (1982) Abnormal auditory brainstem response in a newborn infant with hyperbilirubinemia: improvement with exchange transfusion, J. Pediatr. 100, 624-626.
3. Nwaesei, C. G., Van, A. J., Boyden, M., and Perlman, M. (1984) Changes in auditory brainstem responses in hyperbilirubinemic infants before and after exchange transfusion, Pediatrics 74, 800-803.
4. Hansen, T. W. (2000) Pioneers in the scientific study of neonatal jaundice and kernicterus, Pediatrics 106, E15.
5. Shapiro, S. M. (2005) Definition of the clinical spectrum of kernicterus and bilirubin-induced neurologic dysfunction (BIND), J. Perinatol. 25, 54-59.
6. Wennberg, R. P., Ahlfors, C. E., Bhutani, V. K., Johnson, L. H., and Shapiro, S. M. (2006) Toward understanding kernicterus: a challenge to improve the management of jaundiced newborns, Pediatrics 117, 474-485.
Chapter 1
15
7. Shapiro, S. M. (2005) Definition of the clinical spectrum of kernicterus and bilirubin-induced neurologic dysfunction (BIND), J. Perinatol. 25, 54-59.
8. Tiribelli, C. and Ostrow, J. D. (1990) New concepts in bilirubin chemistry, transport and metabolism: report of the International Bilirubin Workshop, April 6-8, 1989, Trieste, Italy, Hepatology 11, 303-313.
9. Blanckaert, N., Heirwegh, K. P., and Compernolle, F. (1976) Synthesis and separation by thin-layer chromatography of bilirubin-IX isomers. Their identification as tetrapyrroles and dipyrrolic ethyl anthranilate azo derivatives, Biochem. J. 155, 405-417.
10. Bonnett, R., Davies, J. E., Hursthouse, M. B., and Sheldrick, G. M. (1978) The structure of bilirubin, Proc. R. Soc. Lond B Biol. Sci. 202, 249-268.
11. Ostrow, J. D., Mukerjee, P., and Tiribelli, C. (1994) Structure and binding of unconjugated bilirubin: relevance for physiological and pathophysiological function, J. Lipid Res. 35, 1715-1737.
12. Hahm, J. S., Ostrow, J. D., Mukerjee, P., and Celic, L. (1992) Ionization and self-association of unconjugated bilirubin, determined by rapid solvent partition from chloroform, with further studies of bilirubin solubility, J. Lipid Res. 33, 1123-1137.
13. Kaplan, D. and Navon, G. (1982) Studies of the conformation of bilirubin and its dimethyl ester in dimethyl sulphoxide solutions by nuclear magnetic resonance, Biochem. J. 201, 605-613.
14. Tiribelli, C. and Ostrow, J. D. (1993) New concepts in bilirubin chemistry, transport and metabolism: report of the Second International Bilirubin Workshop, April 9-11, 1992, Trieste, Italy, Hepatology 17, 715-736.
15. LONDON, I. M., WEST, R., SHEMIN, D., and RITTENBERG, D. (1950) On the origin of bile pigment in normal man, J. Biol. Chem. 184, 351-358.
16. Ostrow, J. D., JANDL, J. H., and SCHMID, R. (1962) The formation of bilirubin from hemoglobin in vivo, J. Clin. Invest 41, 1628-1637.
17. Tenhunen, R., Marver, H. S., and SCHMID, R. (1968) The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase, Proc. Natl. Acad. Sci. U. S. A 61, 748-755.
18. Ahlfors, C. E. (2001) Bilirubin-albumin binding and free bilirubin, J. Perinatol. 21 Suppl 1, S40-S42.
19. Weisiger, R. A., Ostrow, J. D., Koehler, R. K., Webster, C. C., Mukerjee, P., Pascolo, L., and Tiribelli, C. (2001) Affinity of human serum albumin for bilirubin varies with albumin concentration and buffer composition: results of a novel ultrafiltration method, J. Biol. Chem. 276, 29953-29960.
20. Wennberg, R. P., Ahlfors, C. E., and Rasmussen, L. F. (1979) The pathochemistry of kernicterus, Early Hum. Dev. 3, 353-372.
Chapter 1
16
21. Zucker, S. D., Goessling, W., and Hoppin, A. G. (1999) Unconjugated bilirubin exhibits spontaneous diffusion through model lipid bilayers and native hepatocyte membranes, J. Biol. Chem. 274, 10852-10862.
22. Cui, Y., Konig, J., Leier, I., Buchholz, U., and Keppler, D. (2001) Hepatic uptake of bilirubin and its conjugates by the human organic anion transporter SLC21A6, J. Biol. Chem. 276, 9626-9630.
23. Zucker, S. D., Goessling, W., Ransil, B. J., and Gollan, J. L. (1995) Influence of glutathione S-transferase B (ligandin) on the intermembrane transfer of bilirubin. Implications for the intracellular transport of nonsubstrate ligands in hepatocytes, J. Clin. Invest 96, 1927-1935.
24. Boyer, T. D. (1989) The glutathione S-transferases: an update, Hepatology 9, 486-496.
25. Chowdhury, N. R., Arias, I. M., and Wolkoff, A. W. C. J. R. (2001) Disorders of bilirubin metabolism. In: Arias IM, Boyer JL, Chisari FV, Fausto N, Schachter D, Shafritz DA, editors. The liver biology and pathobiology., pp 291-309.
26. Gourley, G. R. (1997) Bilirubin metabolism and kernicterus, Adv. Pediatr. 44, 173-229.
27. Reiser, D. J. (2004) Neonatal jaundice: physiologic variation or pathologic process, Crit Care Nurs. Clin. North Am. 16, 257-269.
28. Vitek, L., Kotal, P., Jirsa, M., Malina, J., Cerna, M., Chmelar, D., and Fevery, J. (2000) Intestinal colonization leading to fecal urobilinoid excretion may play a role in the pathogenesis of neonatal jaundice, J. Pediatr. Gastroenterol. Nutr. 30, 294-298.
29. Ostrow, J. D., Pascolo, L., Shapiro, S. M., and Tiribelli, C. (2003) New concepts in bilirubin encephalopathy, Eur. J. Clin. Invest 33, 988-997.
30. Turkel, S. B., Miller, C. A., Guttenberg, M. E., Moynes, D. R., and Godgman, J. E. (1982) A clinical pathologic reappraisal of kernicterus, Pediatrics 69, 267-272.
31. CRIGLER, J. F., Jr. and NAJJAR, V. A. (1952) Congenital familial nonhemolytic jaundice with kernicterus, Pediatrics 10, 169-180.
32. Gridelli, B., Lucianetti, A., Gatti, S., Colledan, M., Benti, R., Bruno, A., Rossi, L. N., and Fassati, L. R. (1997) Orthotopic liver transplantation for Crigler-Najjar type I syndrome, Transplant. Proc. 29, 440-441.
33. Arias, I. M., Gartner, L. M., Cohen, M., Ezzer, J. B., and Levi, A. J. (1969) Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronyl transferase deficiency. Clinical, biochemical, pharmacologic and genetic evidence for heterogeneity, Am. J. Med. 47, 395-409.
34. Black, M., Fevery, J., Parker, D., Jacobson, J., Billing, B. H., and Carson, E. R. (1974) Effect of phenobarbitone on plasma (14C)bilirubin clearance in patients with unconjugated hyperbilirubinaemia, Clin. Sci. Mol. Med. 46, 1-17.
Chapter 1
17
35. Sugatani, J., Kojima, H., Ueda, A., Kakizaki, S., Yoshinari, K., Gong, Q. H., Owens, I. S., Negishi, M., and Sueyoshi, T. (2001) The phenobarbital response enhancer module in the human bilirubin UDP-glucuronosyltransferase UGT1A1 gene and regulation by the nuclear receptor CAR, Hepatology 33, 1232-1238.
36. Kaplan M and Hammerman C (2005) Bilirubin and the genome: The hereditary basis of unconjugated neonatal hyperbilirubinemia, 3 ed., pp 21-42.
37. DUBIN, I. N. (1958) Chronic idiopathic jaundice; a review of fifty cases, Am. J. Med. 24, 268-292.
38. Shani, M., Seligsohn, U., Gilon, E., Sheba, C., and Adam, A. (1970) Dubin-Johnson syndrome in Israel. I. Clinical, laboratory, and genetic aspects of 101 cases, Q. J. Med. 39, 549-567.
39. Cekic D, Rigato I, and Tiribelli C (2005) Disturbances of bilirubin metabolism. In: Weinstein WM, Hawkey CJ, Bosch J, editors. Clinical Gastroenterology and Hepatology. London: Essevier Mosby, pp 693-698.
40. Maisels, M. J. and Newman, T. B. (1998) Jaundice in full-term and near-term babies who leave the hospital within 36 hours. The pediatrician's nemesis, Clin. Perinatol. 25, 295-302.
41. Saigal, S., Lunyk, O., Bennett, K. J., and Patterson, M. C. (1982) Serum bilirubin levels in breast- and formula-fed infants in the first 5 days of life, Can. Med. Assoc. J. 127, 985-989.
42. Mukerjee, P., Ostrow, J. D., and Tiribelli, C. (2002) Low solubility of unconjugated bilirubin in dimethylsulfoxide--water systems: implications for pKa determinations, BMC. Biochem. 3, 17.
43. Brodersen, R. (1980) Binding of bilirubin to albumin, CRC Crit Rev. Clin. Lab Sci. 11, 305-399.
44. Levine, R. L., Fredericks, W. R., and Rapoport, S. I. (1982) Entry of bilirubin into the brain due to opening of the blood-brain barrier, Pediatrics 69, 255-259.
45. Wennberg, R. P. and Hance, A. J. (1986) Experimental bilirubin encephalopathy: importance of total bilirubin, protein binding, and blood-brain barrier, Pediatr. Res. 20, 789-792.
46. Borst, P. and Elferink, R. O. (2002) Mammalian ABC transporters in health and disease, Annu. Rev. Biochem. 71, 537-592.
47. Wennberg, R. P. and Hance, A. J. (1986) Experimental bilirubin encephalopathy: importance of total bilirubin, protein binding, and blood-brain barrier, Pediatr. Res. 20, 789-792.
48. Watchko, J. F., Daood, M. J., and Hansen, T. W. (1998) Brain bilirubin content is increased in P-glycoprotein-deficient transgenic null mutant mice, Pediatr. Res. 44, 763-766.
Chapter 1
18
49. Watchko, J. F., Daood, M. J., Mahmood, B., Vats, K., Hart, C., and hdab-Barmada, M. (2001) P-glycoprotein and bilirubin disposition, J. Perinatol. 21 Suppl 1, S43-S47.
50. Hanko, E., Tommarello, S., Watchko, J. F., and Hansen, T. W. (2003) Administration of drugs known to inhibit P-glycoprotein increases brain bilirubin and alters the regional distribution of bilirubin in rat brain, Pediatr. Res. 54, 441-445.
51. Ostrow, J. D., Pascolo, L., Brites, D., and Tiribelli, C. (2004) Molecular basis of bilirubin-induced neurotoxicity, Trends Mol. Med. 10, 65-70.
52. Rigato, I., Pascolo, L., Fernetti, C., Ostrow, J. D., and Tiribelli, C. (2004) The human multidrug-resistance-associated protein MRP1 mediates ATP-dependent transport of unconjugated bilirubin, Biochem. J. 383, 335-341.
53. Gennuso, F., Fernetti, C., Tirolo, C., Testa, N., L'Episcopo, F., Caniglia, S., Morale, M. C., Ostrow, J. D., Pascolo, L., Tiribelli, C., and Marchetti, B. (2004) Bilirubin protects astrocytes from its own toxicity by inducing up-regulation and translocation of multidrug resistance-associated protein 1 (Mrp1), Proc. Natl. Acad. Sci. U. S. A 101, 2470-2475.
54. Rigato, I., Pascolo, L., Fernetti, C., Ostrow, J. D., and Tiribelli, C. (2004) The human multidrug-resistance-associated protein MRP1 mediates ATP-dependent transport of unconjugated bilirubin, Biochem. J. 383, 335-341.
55. Calligaris, S., Cekic, D., Roca-Burgos, L., Gerin, F., Mazzone, G., Ostrow, J. D., and Tiribelli, C. (2006) Multidrug resistance associated protein 1 protects against bilirubin-induced cytotoxicity, FEBS Lett. 580, 1355-1359.
56. Corich, L., Aranda, A., Carrassa, L., Bellarosa, C., Ostrow, J. D., and Tiribelli, C. (2009) The cytotoxic effect of unconjugated bilirubin in human neuroblastoma SH-SY5Y cells is modulated by the expression level of MRP1 but not MDR1, Biochem. J. 417, 305-312.
57. Brodersen, R. and Bartels, P. (1969) Enzymatic oxidation of bilirubin, Eur. J. Biochem. 10, 468-473.
58. Hansen, T. W. and Allen, J. W. (1996) Bilirubin-oxidizing activity in rat brain, Biol. Neonate 70, 289-295.
59. Ostrow, J. D., Pascolo, L., Shapiro, S. M., and Tiribelli, C. (2003) New concepts in bilirubin encephalopathy, Eur. J. Clin. Invest 33, 988-997.
60. Maier, J. K., Lahoua, Z., Gendron, N. H., Fetni, R., Johnston, A., Davoodi, J., Rasper, D., Roy, S., Slack, R. S., Nicholson, D. W., and MacKenzie, A. E. (2002) The neuronal apoptosis inhibitory protein is a direct inhibitor of caspases 3 and 7, J. Neurosci. 22, 2035-2043.
61. Schiff, D., Chan, G., and Poznansky, M. J. (1985) Bilirubin toxicity in neural cell lines N115 and NBR10A, Pediatr. Res. 19, 908-911.
Chapter 1
19
62. Mustafa, M. G., Cowger, M. L., and King, T. E. (1969) Effects of bilirubin on mitochondrial reactions, J. Biol. Chem. 244, 6403-6414.
63. Katoh-Semba, R. (1976) Studies on cellular toxicity of bilirubin: effect on brain glycolysis in the young rat, Brain Res. 113, 339-348.
64. Rodrigues, C. M., Sola, S., Castro, R. E., Laires, P. A., Brites, D., and Moura, J. J. (2002) Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis, J. Lipid Res. 43, 885-894.
65. Rodrigues, C. M., Sola, S., Brito, M. A., Brites, D., and Moura, J. J. (2002) Bilirubin directly disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat mitochondria, J. Hepatol. 36, 335-341.
66. Rodrigues, C. M., Sola, S., Silva, R., and Brites, D. (2000) Bilirubin and amyloid-beta peptide induce cytochrome c release through mitochondrial membrane permeabilization, Mol. Med. 6, 936-946.
67. Rodrigues, C. M., Sola, S., and Brites, D. (2002) Bilirubin induces apoptosis via the mitochondrial pathway in developing rat brain neurons, Hepatology 35, 1186-1195.
68. Han, Z., Hu, P., and Ni, D. (2002) [Bilirubin induced apoptosis of human neuroblastoma cell line SH-SY5Y and affected the mitochondrial membrane potential], Zhonghua Er. Bi Yan. Hou Ke. Za Zhi. 37, 243-246.
69. Silva, R. F., Rodrigues, C. M., and Brites, D. (2001) Bilirubin-induced apoptosis in cultured rat neural cells is aggravated by chenodeoxycholic acid but prevented by ursodeoxycholic acid, J. Hepatol. 34, 402-408.
70. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 926.
71. Hanko, E., Hansen, T. W., Almaas, R., Lindstad, J., and Rootwelt, T. (2005) Bilirubin induces apoptosis and necrosis in human NT2-N neurons, Pediatr. Res. 57, 179-184.
72. Genc, S., Genc, K., Kumral, A., Baskin, H., and Ozkan, H. (2003) Bilirubin is cytotoxic to rat oligodendrocytes in vitro, Brain Res. 985, 135-141.
73. Silva, R. F., Mata, L. M., Gulbenkian, S., and Brites, D. (2001) Endocytosis in rat cultured astrocytes is inhibited by unconjugated bilirubin, Neurochem. Res. 26, 793-800.
74. Ferrari, D., Pinton, P., Szabadkai, G., Chami, M., Campanella, M., Pozzan, T., and Rizzuto, R. (2002) Endoplasmic reticulum, Bcl-2 and Ca2+ handling in apoptosis, Cell Calcium 32, 413-420.
75. Sano, K., Nakamura, H., and Matsuo, T. (1985) Mode of inhibitory action of bilirubin on protein kinase C, Pediatr. Res. 19, 587-590.
Chapter 1
20
76. Cesaratto, L., Calligaris, S. D., Vascotto, C., Deganuto, M., Bellarosa, C., Quadrifoglio, F., Ostrow, J. D., Tiribelli, C., and Tell, G. (2007) Bilirubin-induced cell toxicity involves PTEN activation through an APE1/Ref-1-dependent pathway, J. Mol. Med. 85, 1099-1112.
77. Zhang, L., Liu, W., Tanswell, A. K., and Luo, X. (2003) The effects of bilirubin on evoked potentials and long-term potentiation in rat hippocampus in vivo, Pediatr. Res. 53, 939-944.
78. Grojean, S., Koziel, V., Vert, P., and Daval, J. L. (2000) Bilirubin induces apoptosis via activation of NMDA receptors in developing rat brain neurons, Exp. Neurol. 166, 334-341.
79. Silva, R., Mata, L. R., Gulbenkian, S., Brito, M. A., Tiribelli, C., and Brites, D. (1999) Inhibition of glutamate uptake by unconjugated bilirubin in cultured cortical rat astrocytes: role of concentration and pH, Biochem. Biophys. Res. Commun. 265, 67-72.
80. Rodrigues, C. M., Sola, S., and Brites, D. (2002) Bilirubin induces apoptosis via the mitochondrial pathway in developing rat brain neurons, Hepatology 35, 1186-1195.
21
Chapter 2
Cellular models for the study of bilirubin
toxicity
Cristina Bellarosa, Pablo GiraudiPablo GiraudiPablo GiraudiPablo Giraudi, Sebastian Calligaris, J. Donald
Ostrow and Claudio Tiribelli
Parts of this study was presented at the Annual Meeting of the
Pediatric Academic Societies in Toronto, 2007
Chapter 2
22
Abstract Unconjugated bilirubin (UCB) is neurotoxic and high UCB serum levels in newborns
can produce brain damage (kernicterus). Neurotoxicity correlates best with the plasma
concentration of the unbound (free) bilirubin (Bf) than total unconjugated bilirubin (UCB).
Previous data demonstrated that different cell lines sustain different extent of damage by
bilirubin under the same experimental conditions, but in these works the Bf was not
evaluated. In this study we selected an appropriate cellular model to study the bilirubin
damage. To this purpose, we compared the UCB cellular uptake and cell viability after 4h
of treatment with different Bf (10, 40 and 80 nM) on two neuronal (SH-SY5Y and 2a1
cells) and one non-neuronal (HeLa cells) cell lines. In addition, we studied: the localization
of Mrp1, involved in UCB extrusion, in SH-SY5Y and 2a1 cells and the mRNA expression
of Mrp 1 and Mdr1, a putative UCB transporter, in HeLa and SH-SY5Y cells. Results
show that SH-SY5Y cells are the most sensitive to Bf cytotoxicity and this correlate with a
higher capacity of UCB uptake. SH-SY5Y cells present Mrp1 mainly localized at
membrane level. These observations point to the well-known SH-SY5Y cell line as a good
model to study the intracellular mechanisms of UCB neurotoxicity.
Chapter 2
23
1. Introduction Unconjugated bilirubin (UCB) has been found to be toxic to many cell examined in
vitro, including fibroblasts (1), (2), hepatocytes, erytrocytes, leukcocytes (3), HeLa (4), (5),
primary cultures of astrocytes and neurons (6), mouse embryo fibroblast (7), NT2 cells (8),
8402 human cells (9) and neuronal cell lines (10), (11), (12).
Since UCB can diffuse into any cell (13), (14) and is a potent antioxidant at low
concentrations but toxic at high concentrations (15), all cells must maintain the intracellular
concentration of UCB below toxic concentrations. This is regulated by consumption
(conjugation and oxidation), and export of UCB (16). Since, unlike hepatocytes, most cells
possess low conjugation activity or do not possess it, they have to oxidize or export UCB
to prevent its intracellular accumulation.
Several studies in vitro have showed that MRP1/Mrp1 (multidrug resistance-
associated protein 1) transports the UCB (17), (18) with an affinity (Km = 10 nM) (19) that is 10
times more than other substrates and protects the cells against its accumulation and toxicity (20), (21), (22). UCB is considered a potential substrate also for Mdr1 or P-glycoprotain
(multidrug resistance protein 1), an ATP-dependent plasma membrane efflux pump
expressed in brain capillary endothelial cells and astrocytes (23), (24).
Serveral in vitro studies on bilirubin toxicity have demonstrated that the UCB
damage is different, depending on the cell type. We have recently demonstrated (25) (See
chapter 3) that is necessary to measure free bilirubin (“Bf the real damaging player”)
because it would facilitate interpretation and comparison of studies conducted in different
laboratories under different conditions. These shortcoming greatly contributed that the
molecular mechanisms of bilirubin toxicity are still not fully understood.
As regards of these molecular mechanisms, various observations (as already
described in “General Introduction”) suggests that the damage is initiated at the level of
membranes (plasmatic, mitochondrial, and ER) with resultant perturbations of membrane
permeability and function (26;27), (28). These perturbations will contribute to the genesis of
neuronal excitotoxicity (29), (30), mithocondrial energy failure (31), (32), (33), (34), (35) and
increased intracellular Ca2+ concentration (36). Collectively, these three phenomena and
downstream events trigger cell death by both apoptosis and necrosis (37), (38;39), (40).
In our laboratory three different cell lines were available: one was the HeLa cell line
(human epithelial cells from a fatal cervical carcinoma transformed by human
papillomavirus 18 (HPV18) and two neuronal cell lines: 2a1 (neuronal cell line from
Chapter 2
24
mouse striatum) and SH-SY5Y cell (a third generation neuroblastoma, cloned from SK-N-
SH isolated from a woman’s metastatic bone tumor). Since we were very interested in
selecting the more appropriate cellular model to study the bilirubin damage, we will
describe the characterization of the selected model.
To choose the model we first compared the cellular uptake and accumulation of
[3H]-bilirubin between the three cell lines. We then studied the correlation between the
cellular accumulation of UCB and changes in cell viability, and we finally investigated the
putative transporters involved in the extrusion of UCB out of the cell by analyzing: a)
localization of Mrp1 in 2a1 and SH-SY5Y cells, b) quantification of relative expression of
Mrp1 and Mdr1 in HeLa and SH-SY5Y cells.
2. Materials and Methods 2.1 Chemicals Unconjugated bilirubin (UCB)(Sigma Chemical Co, St. Louis MO), was purified as
described by Ostrow & Mukerjee (41). [3H]UCB (29.3 mCi/mmol) was biosynthetically
labeled in vivo and then highly purified from the bilirubin conjugates in bile as described (42). Dulbecco’s Phosphate Buffered saline (PBS), Dulbecco’s modified Eagle’s medium
high glucose (DMEM/high glucose), streptomycin and penicillin were purchased from
Euroclone, Milan (Italy). Ham’s Nutrient Mixture F12 (F12), Eagle’s Minimum Essential
Medium (EMEM), nonessential amino acid solution (MEM), fatty acid free bovine serum
albumin fraction V (BSA), 3(4,5-dimethiltiazolil-2)-2,5 diphenyl tetrazolium (MTT),
dimethy sulfoxide (DMSO), horseradish peroxidase (HRP type I) and Tri Reagent were
purchased from Sigma Chemical Co.-Aldrich, Milan (Italy). Fetal calf serum (FCS) and
GlutaMAXTM, obtained from Invitrogen (Carlsbad, CA) contained 24 g/L albumin.
Chloroform (HPLC grade) was obtained from Carlo Erba, Milan (Italy). iScriptTM cDNA
Synthesis kit, iQTM SYBR Green Supermix were purchased from Bio-Rad Laboratories
(Hercules, CA, USA). Polyclonal monospecific anti-Mrp1 A-23 antibody was developed in
our laboratory.
2.2 Cell culture Striatal precursor 2a1 cells were cultured under standard conditions in DMEMHG
supplemented with 10% (v/v) FCS, 2 mM L-glutamine, penicillin (100 U/mL) and
Chapter 2
25
streptomycin (100 µg/mL) at 33°C in 5% CO2 and 95% O2. HeLa cells were grown at the
same culture conditions than 2a1 cells but at 37 °C in 5% CO2.
Human neuroblastoma SH-SY5Y cells were cultured in a mixture of EMEM/F12 (1:1
v/v) containing 15% (v/v) FCS, 1% (v/v) nonessential amino acids, 1% (v/v) GlutaMAXTM,
penicillin (100 U/mL) and streptomycin (100 µg/mL) at 37°C under 5% CO2. 2a1 and SH-
SY5Y cells were kindly provided by Dr S. Gustincich (SISSA, Trieste, Italy).
2.3 UCB solutions and Bf measurements The free (unbound) plasma bilirubin concentration (Bf), a little fraction of total
bilirubin concentration, is the principal determinant of tissue uptake and toxicity. However,
methods to estimate the Bf from medium has rarely been performed (43),(44). Most reported
in vitro studies examining bilirubin effects or toxicity utilize HSA or BSA as a bilirubin
stabilizer or reservoir, but rarely measure Bf and often use initial bilirubin concentrations
that greatly exceed physiological or pathological significanse (45).
Recently, in our group the Bf levels in tissue culture media were evaluated by a
standardization of peroxidase method 46. The method involves minimal dilution of the
sample, minimizing the effect of dilution of the albumin concentration on the binding
affinity (47).
Using this method we determined the Bf in the different experimental cultures media
(Figure 1). With these data, we generated solutions with different molar ratios
(UCB/albumin) adding bilirubin directly to the medium (DMEM high glucose with 10%
FCS and DMEM/F12 with 15% FCS) in order to obtain solutions with variable doses of Bf
for treat the cells.
Figure 1. Relationship of Bf to UCB in two albumin-containing cultures medium.
(■) DMEMHG with 10% FCS (30 µM BSA) and (∆) EMEM/F12 with 15% FCS (54 µM BSA).
y = 1.40x1.71
R2 = 0.92
y = 1.35x1.33
R2 = 0.92
0
100
200
300
400
500
600
700
0 10 20 30 40 50
Unconjugated bilirubin (µµµµM)
Bf (nM)
Chapter 2
26
2.4 [3H]-Bilirubin uptake in culture cells 2a1, HeLa and SH-SY5Y cells were seeded in 6 multiwell plates (Corning
Incorporated Costar®) at a density of 60,000 cells/cm2, 50,000 cell/cm2 and 75,000 cell/cm2
respectively and left growing for 24 hours when they reached a 70% confluence. The
growth medium was removed and cells washed with PBS.
[3H]-UCB (29.30 mCi/mmol) was dissolved in DMSO and diluted with the
respective culture medium. The final solutions contained no more than 0.6% v/v DMSO,
and unbound UCB concentrations (Bf) of 10, 40 e 80 nM, measured as describe above (48).
The uptake of UCB at 37°C was measured 4 hours after the addition of 0.8 mL of the
medium containing [3H]-UCB to each well. Transport was stopped by removing the
incubation medium and washing twice with ice-cold PBS. The cells were lysed for 30 min
with 1 mL of NaOH 0.2 N containing SDS 2% and were removed from the well using a
cell scraper (Corning Incorporated Costar®). An aliquot (30 µL) of cell lysate was used for
measurement of protein concentration, while the remainder was diluted in 7 mL of liquid
scintillation cocktail for radioassay (Filter counter, Packarda Bioscience, Groningen, The
Netherlands). Radioactivity was measured in a liquid scintillation spectrometer (Beta V,
Kontron, Milan, Italy) with automatic quench corrections using external reference
standards and expressed in dpm. The quantity of [3H]-UCB retained by cells was
calculated using the following equation:
To correct for non-specific bilirubin binding to the cell membranes, radioactivity on
each type cells exposed to the same [3H]-UCB solution for one minute was subtracted from
the 4 hour values.
2.5 Cell viability studies after UCB treatments The day before the experiment 2a1, HeLa and SH-SY5Y cells were plated in 24
multiwell plates at a density of 60,000 cells/cm2, 50,000 cell/cm2 and 70,000 cells/cm2
respectively. The cell viability assay was performed with 70-80% confluence uniformly in
all wells. The growing medium was discarded. The cellular lines were washed with PBS at
37°C then treated for four hours in the following manner:
Dpm/[(Specific activity x MWUCB]/106) x (cell proteins (mg/mL) x µL utilized)/103]
= pmol UCB/mg prot
Chapter 2
27
Purified UCB was dissolved in chloroform at a concentration of 0.85 mM and
aliquots were dried under nitrogen. Immediately before each treatment, an aliquot was
dissolved in DMSO (0.3 µL of DMSO per µg of UCB, and diluted with each medium of
culture (30 µM of BSA or 54 µM of BSA). Experiments were performed with three final
UCB concentrations:
a) 1.35, 12.8 and 19.5 µM, yielding unbound UCB concentrations (Bf) to be respectively
10, 40 and 70 nM (Medium: DMEMHG with 10% FCS (30 µM BSA)) for HeLa and 2a1
cells;
b) 3.16, 7.10 and 9.85 µM, yielding unbound UCB concentrations (Bf) to be respectively
10, 40 and 70 nM (Medium: EMEM/F12 with 15% FCS (54 µM BSA)) for SH-SY5Y
cells.
In order to standardize DMSO-related effects, a further volume of DMSO was added
to the final solution to reach an equal total amount in all treatment groups. To minimize
photo-degradation, all the experiments with UCB were performed under light protection
(dim lighting and vials wrapped in tin foil). At the end of the incubation period, the
medium containing UCB was discarded and the cells tested for viability using the MTT
test.
The stock solution of 3(4,5-dimetyltiazolyl-2)-2,5 diphenyl tetrazolium (MTT) was
dissolved in PBS pH 7.4 at 5 mg/mL. Immediately before the experiment, the MTT
solution was diluted to 0.5 mg/mL in each medium (49). The cells were incubated with the
respective medium containing MTT for 2 hours at 37 °C. After incubation, MTT formazan
crystals were dissolved by adding 0.4 mL isopropanol/HCl 0.04 M and gentle shaking for 2
h at 37 °C. After centrifugation (10,000 RPM for 3 min), absorbance values at 570 nm
were determined in a LD 400C Luminescence Detector, Beckman Coulter, Milan Italy.
Results were expressed as percentage of MTT reduction by cells not exposed to UCB,
which was considered as 100% viability.
2.6 Immunocytochemistry labelling for MRP1 2a1 and SH-SY5Y cells were preincubated for 30 min in blocking buffer at room
temperature (0,3% Triton X-100, 5% BSA, 5% NGS in PBS) and then incubated overnight
at 4°C with primary antibody against Mrp1 (1:150, A23). Specific anti rabbit FITC Oregon
- secondary antibody was used at 1:250 dilution for 1 h at room temperature. Cells labelled
Chapter 2
28
by immunofluorescence were visualized and analyzed by using a Leica TCS NT (Ver. 1.0,
Leica Lasertechnik, Heidelberg) inverted confocal laser scanning microscope.
2.7 RNA isolation, reverse transcription and quantitative PCR HeLa and SH-SY5Y cells were cultured on T-75 flasks and the extraction was
performed when the 70% confluence was attained. Total RNA was isolated by Tri Reagent
solution according to the manufacture's suggestions (SIGMA, Missouri, USA. T9424). The
total RNA concentration and the purity were quanti_ed by spectrophotometric analysis in a
Beckman DU640. For each sample the A260/A280 ratio comprised between 1.8 and 2.0 was
considered as good RNA quality criteria. The integrity of RNA was assed on standard 1%
agarose/formaldehyde staining with ethidium bromide gel, indicating that the RNA
preparations were of high integrity. Isolated RNA was resuspended in RNAse free water
and stored at -80°C until analysis.
Single stranded cDNA was obtained from 1 µg of purified RNA using the
iScripTMcDNA Synthesis Kit, according to the manufacture’s suggestions. The reaction
was run in a Thermal Cycler (Gene Amp PCR System 2400, Perkin-Elmer, Boston, MA,
USA) in agreement with the reaction protocol proposed by the manufacturer. Real Time
quantitative PCR was performed with an iCycler IQ (Bio-Rad Laboratories, Hercules, CA,
USA), using β-actin, 18S and GAPDH as endogenous controls to normalize the expression
levels of MRP1 and MDR1. Primer sequences and references are reported in table 1. These
primers were designed using Beacon Designer 4.02 software (PREMIER Biosoft
International, Palo Alto, CA, USA). All primer pairs were synthesized by Sigma Genosys
(Cambridgeshire, UK).
Gene Accession
Number
Primer Forward Primer Reverse Product
(bp)
MRP1/ABCC1
MDR1/ABCB1
b-actin
18S
GPDH
NM_004996
NM_000927
NM_001101
X03205
NM_002046
GCCAAGAAGGAGGAGACC
TGCTCAGACAGGATGTGAGTTG
CCTGGCACCCAGCACAAT
CGTCTGCCCTATCAACTTTCG
CCCATGTTCGTCATGGGTGT
AGGAAGATGCTGAGGAAGG
AATTACAGCAAGCCTGGAACC
GCCGATCCACACGGAGTACT
GCCTGCTGCCTTCCTTGG
TGGTCATGAGTCCTTCCACGATA
128
122
120
150
145
Briefly, 25 ng of cDNA were amplified by PCR with 1x iQ SYBR Green Supermix
(100 mM KCl, 40 mM Tris-HCl, pH 8.40; 0.4 mM each dNTP; 50 U/mL iTaq DNA
Table 1: Primer sequence designed for the mRNA quantification
Chapter 2
29
polymerase; 6 mM MgCl2; SYBR Green I; 20 mM fluorescein; and stabilizers) (BIO-RAD
Laboratories) and 250 nM gene specific and anti-sense primers in a final volume of 25 µL
for each well. The PCR was performed in 96-well plates, each sample was performed in
triplicate, and a no-template control was included for each amplificate. Standard curves
using a “calibrator” cDNA (chosen among the cDNA samples) were prepared for each
target and reference gene. In order to verify the specificity of the amplification, a melt-
curve analysis was performed, immediately after the amplification protocol. Non-specific
products of PCR were not found in any case. The relative quantification was made using
the Pfaff1 modification of the ∆∆CT equation (CT, cycle number at which the fluorescence
passes the threshold level of detection), taking into account the efficiencies of individual
genes. The results were normalized to β-actin, 18S and GAPDH and the initial amount of
the template of each sample was determined as relative expression vs. one of the samples
chosen as reference (in this case, SH-SY5Y in normal growths conditions) which is
considered the 1 x sample. The relative expression of each sample was calculated by the
formula 2-∆∆CT. ∆CT is a value obtained, for each sample, by the difference between the
mean CT value of the target gene and the mean CT value of the housekeeping gene/s. ∆∆CT
of one sample is the difference between its ∆CT value and CT value of the sample chosen
as reference (User Bulletin 2 of the ABI Prism 7700 Sequence Detection System).
2.8 Statistical Analysis All experiments were run in triplicate and repeated three times. Results are expressed
as mean ± SD. Oneway ANOVA with Tukey-Kramer post test was performed using
GraphPad InStat version 3.00 (GraphPad Software, San Diego, CA, USA). Mean values
were considered statistically significant when P values where lower than 0.05.
Chapter 2
30
3. Results 3.1 [3H]-Bilirubin uptake by HeLa, 2a1 and SH-SY5Y cells Figure 2 shows that the cellular uptake of UCB increased linearly when cells were
exposed to increasing Bf. However, the intracellular accumulation of [3H]-bilirubin after
240 min, at all three UCB concentrations, was about four times greater in SH-SY5Y cells
than in 2a1 cells and more than seven times in SH-SY5Y that in HeLa cells.
3.2 Bilirubin effect on cell viability in HeLa, 2a1 and SH-SY5Y cells To verify the effect of UCB on the three cell lines, cells were treated with the same
doses of UCB used in the uptake experiments (Bf 10 nM, 40 nM and 80 nM) for 4 hours
and cell viability was assessed by the MTT test of mitochondrial function as described in
Materials and Methods.
Figure 3 shows the dose dependent effect on cell viability after the exposition. When
the cells were exposed to low Bf levels (10 and 40 nM, below the aqueous solubility of
UCB (70 nM)), a significant reduction of about 30% of cell viability was obtained in the
SH-SY5Y cells whereas HeLa and 2a1 remained unaffected. At higher Bf level of 80 nM,
cell viability decrease further (to 40% of control) in the SH-SY5Y cells, but showed little
decrease (to 10% of control) in HeLa cells and (to 20% of control) in 2a1 cells.
Figure 2. [3H] Bilirubin uptake. The cells were incubated with [3H] – UCB for 4 hours and the radioactivity was measured. Control cells were incubated for 1 min to measure the bilirubin unspecific cell membrane binding and the values obtained were subtracted from the four hours values. *: p< 0.001 vs HeLa and 2a1 cells at same experimental condition.
Bf (nM)
[3H]-UCB uptake in 4 hours (pmol/mg protein)
0
100
200
300
400
500
600
700
800
900
10 40 80
HeLa cells
2a1 cells
SH-SY5Y cells
*
*
*
Chapter 2
31
At each Bf, the greater sensitivity of SH-SY5Y cells was associated with a much
greater 4 hours intracellular accumulation of [3H]-bilirubin than HeLa and 2a1 cells.
3.3 Localization of Mrp1 in 2a1 and SH-SY5Y cells We monitored the protein expression of MRP1/Mrp1 in both SH-SY5Y and 2a1 cell
lines by immofluorescence under resting conditions, i.e. without exposure to UCB. In these
conditions, immunostainings appeared completely different. Mrp1 seems to be
membrane−localized in SH−SY5Y while it is segregated to perinuclear subcellular
structures in striatal 2a1 neurons. When immunolocalization experiments was repeated
after 4 hours of UCB treatments at two different concentrations of UCB (Bf 40 nM and 70
nM), no significant difference in the Mrp1 localization was observed at any concentration
both in SH-SY5Y and 2a1 cell lines (Figure 4).
0
20
40
60
80
100
120
0 10 40 80
Bf (nM)
HeLa cells
2a1 cells
SH-SY5Y cells
Cell Viability (%)
* * *
* # #
#
Figure 3. Effect of bilirubin on cell viability. The cells were exposed for 4 hours to three different concentrations of unbound UCB (Bf), and viability then assessed by MTT test. Results are expressed as mean percentage values (%) of three independent experiment performed in triplicate. *: p< 0.001 versus respective control. #: p< 0.001 vs Hela and 2a1 cells at same experimental condition.
Chapter 2
32
3.4 Mrp1 and Mdr1 mRNA levels in HeLa and SH-SY5Y cells We investigated by Real Time RT-PCR, the gene expression of Mrp1 and Mdr1 in
both HeLa and SH-SY5Y cell lines under normal growing conditions. As shown in Table
2, there is not difference in the mRNA expression level for Mrp1 between SH-SY5Y and
HeLa cells; gene expression of Mdr1 was undetectable in HeLa cells.
SH-SY5Y cells
8.35 8.6 18 S
16.45 17.15 ββββ-actin
17.45 17.60 GAPDH
N.D. N.D. 21.35 1 Mdr1
22.25 0.724 22.35 1 Mrp1
Threshold
cycle
Relative
expression
Threshold
cycle
Relative
expression
HeLa cells
Table 2. Real time RT-PCR of Mrp1 and Mdr1 in SH-SY5Y and in HeLa cells. Results were normalized to β-actin, GAPDH and 18S and the initial amount of the template of each sample was determined as relative expression vs the expression of Mrp1 in SH-SY5Y which is considered 1. In the table is indicated also the Threshold Cycle of each gene. N.D.: undetectable
2a1 (A)
2a1 (B)
2a1 (C)
SH-SY5Y (A)
SH-SY5Y (B)
SH-SY5Y (C)
Figure 4. Localization of MRP1/Mrp1 in 2a1 and SH-SY5Y cells. Cells were labeled with anti-Mrp1 antibody, revealed by FITC (green). 2a1 cells: (A) untreated, (B) treated with 40 nM Bf and (C) treated with 70 nM Bf. SH-SY5Y cells: (A) untreated, (B) treated with 40 nM Bf and (C) treated with 70 nM Bf. Treatment time: 4 hours.
Chapter 2
33
4. Discussion In the present work we investigated the susceptibility of a non neuronal cell line
(HeLa cells) and two neuronal cell lines (2a1 and SH-SY5Y cells) to unconjugated
bilirubin. The results obtained show that the human neuronal cell line SH-SY5Y presents a
vastly greater uptake of UCB than HeLa and 2a1 cells. This greater capacity of SH-SY5Y
cells to take up UCB nicely correlates with greater sensitivity to bilirubin toxicity than both
the human not-neuronal HeLa cell line and the mouse striatal cell line 2a1. Our results are
in line with those reported by Ngai et al (50) that confirm the clinical impression that
different cells sustain different degrees of cytotoxicities cause by bilirubin.
The reason for the predilection of bilirubin toxicity to neural cells and tissue is not
known. Several hypotheses have been proposed. Inherent cellular factors, such as their
ability to bind and to take up bilirubin may be important (9, 51), and ours results support this
hypothesis. The availability and affinity of binding sites at the cell surface would
determine the cellular content of bilirubin. Not all kinds of cells bind bilirubin with equal
affinity and not all cells of the same type would bind with equal avidity (52).
The binding of bilirubin to polar membranes may also play a role in the affinity of
bilirubin for the neural cells. Phospholipid has been shown to bind and interact with
bilirubin (53), (54), (55) and sphingomyelin (which is highly present in neural tissues), has also
been shown to have a high association constant for bilirubin (56). Bilirubin has also been
demonstrated to concentrate selectively in the synaptic and dendritic regions of the brain
where the concentration of gangliosides and sphingomyelin is high (57).
We also investigated whether the greater intracellular accumulation of UCB and
consequent higher toxicity on the SH-SY5Y cells may be related with a lower expression
or with the non-localization of the transporters Mrp1 and Mdr1 (candidates as protectors
against UCB toxicity (58), (59), (60) at the plasma membrane level.
The first results indicate that in SH-SY5Y cells Mrp1 is mainly localized at plasma
membrane level and in perinuclear subcellular structures in 2a1 cells. This suggested that
the SH-SY5Y should be more able to respond at xenotoxic agents (like UCB) than 2a1
cells. On the other hand, the UCB treatments did not generate a redistribution so much in
cells 2a1 as in cells SH-SY5Y as it was described by Gennuso et al. (61) in cultured mouse
astroglial cells.
We also found that Mrp1 is similarly expressed in the SH-SY5Y and HeLa cells, and
that Mdr1 is not expressed in HeLa cells. These results suggest that the higher UCB
Chapter 2
34
susceptibility observed in SH-SY5Y cells is linked to a higher uptake and/or to a different
metabolism of UCB in the cells.
Additional studies on the different patterns of gene and protein expression
(proteomics and gene array) would be necessary to elucidate the factors determininmg the
different susceptibility of the cells to the bilirubin damage. These data will contribute to
understand why the bilirubin damage in neonates shows predilection to neural tissues.
Based on the three major observations that we obtained: a) the higher (3H)-UCB
uptake; b) the greater membrane localization of Mrp1; and c) the high sensitivity to UCB
treatment, we selected the neuroblastoma SH-SY5Y cells as “the cellular model to be
characterized for bilirubin damage”.
5. References 1. Nelson, T., Jacobsen, J., and Wennberg, R. P. (1974) Effect of pH on the interaction
of bilirubin with albumin and tissue culture cells, Pediatr. Res. 8, 963-967.
2. Ngai, K. C., Yeung, C. Y., and Leung, C. S. (2000) Difference in susceptibilities of different cell lines to bilirubin damage, J. Paediatr. Child Health 36, 51-55.
3. Czernobilsky, B. and Dubin, I. N. (1965) Effect of fibroblasts, Chang and rat liver cells on bilirubin in tissue culture, Proc. Soc. Exp. Biol. Med. 119, 964-966.
4. Shimabuku, R. and Nakamura, H. (1983) Drug-mediated displacement of bilirubin from albumin in cultured cells, Jpn. J. Exp. Med. 53, 215-217.
5. Cesaratto, L., Calligaris, S. D., Vascotto, C., Deganuto, M., Bellarosa, C., Quadrifoglio, F., Ostrow, J. D., Tiribelli, C., and Tell, G. (2007) Bilirubin-induced cell toxicity involves PTEN activation through an APE1/Ref-1-dependent pathway, J. Mol. Med. 85, 1099-1112.
6. Brito, M. A., Rosa, A. I., Falcao, A. S., Fernandes, A., Silva, R. F., Butterfield, D. A., and Brites, D. (2008) Unconjugated bilirubin differentially affects the redox status of neuronal and astroglial cells, Neurobiol. Dis. 29, 30-40.
7. Calligaris, S., Cekic, D., Roca-Burgos, L., Gerin, F., Mazzone, G., Ostrow, J. D., and Tiribelli, C. (2006) Multidrug resistance associated protein 1 protects against bilirubin-induced cytotoxicity, FEBS Lett. 580, 1355-1359.
Chapter 2
35
8. Hanko, E., Hansen, T. W., Almaas, R., Lindstad, J., and Rootwelt, T. (2005) Bilirubin induces apoptosis and necrosis in human NT2-N neurons, Pediatr. Res. 57, 179-184.
9. Pramanik, A. K., Horn, N., and Schwemer, G. (1980) 8402 human cell culture--a model for evaluating bilirubin-albumin interactions with drug, Toxicology 17, 255-259.
10. Ngai, K. C., Yeung, C. Y., and Leung, C. S. (2000) Difference in susceptibilities of different cell lines to bilirubin damage, J. Paediatr. Child Health 36, 51-55.
11. Han, Z., Hu, P., and Ni, D. (2002) [Bilirubin induced apoptosis of human neuroblastoma cell line SH-SY5Y and affected the mitochondrial membrane potential], Zhonghua Er. Bi Yan. Hou Ke. Za Zhi. 37, 243-246.
12. Schiff, D., Chan, G., and Poznansky, M. J. (1985) Bilirubin toxicity in neural cell lines N115 and NBR10A, Pediatr. Res. 19, 908-911.
13. Zucker, S. D., Goessling, W., and Hoppin, A. G. (1999) Unconjugated bilirubin exhibits spontaneous diffusion through model lipid bilayers and native hepatocyte membranes, J. Biol. Chem. 274, 10852-10862.
14. Wang, P., Kim, R. B., Chowdhury, J. R., and Wolkoff, A. W. (2003) The human organic anion transport protein SLC21A6 is not sufficient for bilirubin transport, J. Biol. Chem. 278, 20695-20699.
15. Granato, A., Gores, G., Vilei, M. T., Tolando, R., Ferraresso, C., and Muraca, M. (2003) Bilirubin inhibits bile acid induced apoptosis in rat hepatocytes, Gut 52, 1774-1778.
16. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 926.
17. Petrovic, S., Pascolo, L., Gallo, R., Cupelli, F., Ostrow, J. D., Goffeau, A., Tiribelli, C., and Bruschi, C. V. (2000) The products of YCF1 and YLL015w (BPT1) cooperate for the ATP-dependent vacuolar transport of unconjugated bilirubin in Saccharomyces cerevisiae, Yeast 16, 561-571.
18. Pascolo, L., Fernetti, C., Garcia-Mediavilla, M. V., Ostrow, J. D., and Tiribelli, C. (2001) Mechanisms for the transport of unconjugated bilirubin in human trophoblastic BeWo cells, FEBS Lett. 495, 94-99.
19. Rigato, I., Pascolo, L., Fernetti, C., Ostrow, J. D., and Tiribelli, C. (2004) The human multidrug-resistance-associated protein MRP1 mediates ATP-dependent transport of unconjugated bilirubin, Biochem. J. 383, 335-341.
20. Gennuso, F., Fernetti, C., Tirolo, C., Testa, N., L'Episcopo, F., Caniglia, S., Morale, M. C., Ostrow, J. D., Pascolo, L., Tiribelli, C., and Marchetti, B. (2004) Bilirubin protects astrocytes from its own toxicity by inducing up-regulation and translocation of multidrug resistance-associated protein 1 (Mrp1), Proc. Natl. Acad. Sci. U. S. A 101, 2470-2475.
Chapter 2
36
21. Calligaris, S., Cekic, D., Roca-Burgos, L., Gerin, F., Mazzone, G., Ostrow, J. D., and Tiribelli, C. (2006) Multidrug resistance associated protein 1 protects against bilirubin-induced cytotoxicity, FEBS Lett. 580, 1355-1359.
22. Corich, L., Aranda, A., Carrassa, L., Bellarosa, C., Ostrow, J. D., and Tiribelli, C. (2009) The cytotoxic effect of unconjugated bilirubin in human neuroblastoma SH-SY5Y cells is modulated by the expression level of MRP1 but not MDR1, Biochem. J. 417, 305-312.
23. Watchko, J. F., Daood, M. J., and Hansen, T. W. (1998) Brain bilirubin content is increased in P-glycoprotein-deficient transgenic null mutant mice, Pediatr. Res. 44, 763-766.
24. Watchko, J. F., Daood, M. J., and Hansen, T. W. (1998) Brain bilirubin content is increased in P-glycoprotein-deficient transgenic null mutant mice, Pediatr. Res. 44, 763-766.
25. Calligaris, S. D., Bellarosa, C., Giraudi, P., Wennberg, R. P., Ostrow, J. D., and Tiribelli, C. (2007) Cytotoxicity is predicted by unbound and not total bilirubin concentration, Pediatr. Res. 62, 576-580.
26. Rodrigues, C. M., Sola, S., Castro, R. E., Laires, P. A., Brites, D., and Moura, J. J. (2002) Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis, J. Lipid Res. 43, 885-894.
27. Rodrigues, C. M., Sola, S., Brito, M. A., Brites, D., and Moura, J. J. (2002) Bilirubin directly disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat mitochondria, J. Hepatol. 36, 335-341.
28. Brito, M. A., Brites, D., and Butterfield, D. A. (2004) A link between hyperbilirubinemia, oxidative stress and injury to neocortical synaptosomes, Brain Res. 1026, 33-43.
29. Grojean, S., Lievre, V., Koziel, V., Vert, P., and Daval, J. L. (2001) Bilirubin exerts additional toxic effects in hypoxic cultured neurons from the developing rat brain by the recruitment of glutamate neurotoxicity, Pediatr. Res. 49, 507-513.
30. McDonald, J. W., Shapiro, S. M., Silverstein, F. S., and Johnston, M. V. (1998) Role of glutamate receptor-mediated excitotoxicity in bilirubin-induced brain injury in the Gunn rat model, Exp. Neurol. 150, 21-29.
31. Day, R. L. (1954) Inhibition of brain respiration in vitro by bilirubin; reversal of inhibition by various means, Proc. Soc. Exp. Biol. Med. 85, 261-264.
32. ERNSTER, L. and ZETTERSTROM, R. (1956) Bilirubin, an uncoupler of oxidative phosphorylation in isolated mitochondria, Nature 178, 1335-1337.
33. Vogt, M. T. and Basford, R. E. (1968) The effect of bilirubin on the energy metabolism of brain mitochondria, J. Neurochem. 15, 1313-1320.
Chapter 2
37
34. Rodrigues, C. M., Sola, S., Silva, R., and Brites, D. (2000) Bilirubin and amyloid-beta peptide induce cytochrome c release through mitochondrial membrane permeabilization, Mol. Med. 6, 936-946.
35. Oakes, G. H. and Bend, J. R. (2005) Early steps in bilirubin-mediated apoptosis in murine hepatoma (Hepa 1c1c7) cells are characterized by aryl hydrocarbon receptor-independent oxidative stress and activation of the mitochondrial pathway, J. Biochem. Mol. Toxicol. 19, 244-255.
36. Brito, M. A., Brites, D., and Butterfield, D. A. (2004) A link between hyperbilirubinemia, oxidative stress and injury to neocortical synaptosomes, Brain Res. 1026, 33-43.
37. Rodrigues, C. M., Sola, S., Castro, R. E., Laires, P. A., Brites, D., and Moura, J. J. (2002) Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis, J. Lipid Res. 43, 885-894.
38. Hanko, E., Hansen, T. W., Almaas, R., Lindstad, J., and Rootwelt, T. (2005) Bilirubin induces apoptosis and necrosis in human NT2-N neurons, Pediatr. Res. 57, 179-184.
39. Watchko, J. F. (2005) Bilirubin induced apoptosis in vitro: insights for kernicterus: commentary on the article by Hanko et al. on page 179, Pediatr. Res. 57, 177-178.
40. Hanko, E., Hansen, T. W., Almaas, R., Paulsen, R., and Rootwelt, T. (2006) Synergistic protection of a general caspase inhibitor and MK-801 in bilirubin-induced cell death in human NT2-N neurons, Pediatr. Res. 59, 72-77.
41. Ostrow, J. D. and Mukerjee, P. (2007) Solvent partition of 14C-unconjugated bilirubin to remove labeled polar contaminants, Transl. Res. 149, 37-45.
42. Bayon, J. E., Pascolo, L., Gonzalo-Orden, J. M., Altonaga, J. R., Gonzalez-Gallego, J., Webster, C., Haigh, W. G., Stelzner, M., Pekow, C., Tiribelli, C., and Ostrow, J. D. (2001) Pitfalls in preparation of (3)H-unconjugated bilirubin by biosynthetic labeling from precursor (3)H-5-aminolevulinic acid in the dog, J. Lab Clin. Med. 138, 313-321.
43. Nelson, T., Jacobsen, J., and Wennberg, R. P. (1974) Effect of pH on the interaction of bilirubin with albumin and tissue culture cells, Pediatr. Res. 8, 963-967.
44. Jacobsen, J. and Wennberg, R. P. (1974) Determination of unbound bilirubin in the serum of newborns, Clin. Chem. 20, 783.
45. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 926.
46. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr. Res. 60, 724-728.
Chapter 2
38
47. Ahlfors, C. E. (1981) Effect of serum dilution on apparent unbound bilirubin concentration as measured by the peroxidase method, Clin. Chem. 27, 692-696.
48. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr. Res. 60, 724-728.
49. Denizot, F. and Lang, R. (1986) Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability, J. Immunol. Methods 89, 271-277.
50. Ngai, K. C., Yeung, C. Y., and Leung, C. S. (2000) Difference in susceptibilities of different cell lines to bilirubin damage, J. Paediatr. Child Health 36, 51-55.
51. Schiff, D., Chan, G., and Poznansky, M. J. (1985) Bilirubin toxicity in neural cell lines N115 and NBR10A, Pediatr. Res. 19, 908-911.
52. Wennberg, R. P. and Rasmussen, L. F. (1978) Factors determining the cellular uptake of bilirubin, 12 ed., pp 536-542.
53. Talafant, E. (1971) Bile pigment-phospholipid interactions, Biochim. Biophys. Acta 231, 394-398.
54. Notter, R. H., Shapiro, D. L., Taubold, R., and Chen, J. (1982) Bilirubin interactions with phospholipid components of lung surfactant, Pediatr. Res. 16, 130-136.
55. Rodrigues, C. M., Sola, S., Brito, M. A., Brites, D., and Moura, J. J. (2002) Bilirubin directly disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat mitochondria, J. Hepatol. 36, 335-341.
56. Nagaoka, S. and Cowger, M. L. (1978) Interaction of bilirubin with lipids studied by fluorescence quenching method, J. Biol. Chem. 253, 2005-2011.
57. Vazquez, J., Garcia-Calvo, M., Valdivieso, F., Mayor, F., and Mayor, F., Jr. (1988) Interaction of bilirubin with the synaptosomal plasma membrane, J. Biol. Chem. 263, 1255-1265.
58. Gennuso, F., Fernetti, C., Tirolo, C., Testa, N., L'Episcopo, F., Caniglia, S., Morale, M. C., Ostrow, J. D., Pascolo, L., Tiribelli, C., and Marchetti, B. (2004) Bilirubin protects astrocytes from its own toxicity by inducing up-regulation and translocation of multidrug resistance-associated protein 1 (Mrp1), Proc. Natl. Acad. Sci. U. S. A 101, 2470-2475.
59. Calligaris, S., Cekic, D., Roca-Burgos, L., Gerin, F., Mazzone, G., Ostrow, J. D., and Tiribelli, C. (2006) Multidrug resistance associated protein 1 protects against bilirubin-induced cytotoxicity, FEBS Lett. 580, 1355-1359.
60. Corich, L., Aranda, A., Carrassa, L., Bellarosa, C., Ostrow, J. D., and Tiribelli, C. (2009) The cytotoxic effect of unconjugated bilirubin in human neuroblastoma SH-SY5Y cells is modulated by the expression level of MRP1 but not MDR1, Biochem. J. 417, 305-312.
Chapter 2
39
61. Gennuso, F., Fernetti, C., Tirolo, C., Testa, N., L'Episcopo, F., Caniglia, S., Morale, M. C., Ostrow, J. D., Pascolo, L., Tiribelli, C., and Marchetti, B. (2004) Bilirubin protects astrocytes from its own toxicity by inducing up-regulation and translocation of multidrug resistance-associated protein 1 (Mrp1), Proc. Natl. Acad. Sci. U. S. A 101, 2470-2475.
40
Chapter 3
Cytotoxicity is predicted by unbound and
not total bilirubin concentration
Sebastián D. Calligaris, Cristina Bellarosa, Pablo Pablo Pablo Pablo GiraudiGiraudiGiraudiGiraudi, Richard
P. Wennberg, J. Donald Ostrow, and Claudio Tiribelli
Pediatric Research 2007 Nov; 62, (5):576-80
This study was supported in part by a grant from Telethon (GGP05062)
Chapter 3
41
Abstract
Although it has been suggested that the unbound (free, Bf) rather than total (BT)
bilirubin level correlates with cell toxicity, experimental data to support this is limited. To
test “the free bilirubin hypothesis”, in vitro cytotoxicity was assessed in four cell lines
exposed to different Bf/BT ratios, obtained by mixing varied concentrations of
unconjugated bilirubin and serum albumins with different binding affinities (bovine, fetal
calf and human). Although bilirubin cytotoxicity varied with cell line it was invariably
related to Bf and not BT. Light exposure decreased toxicity by 15-20%, consistent with the
decrease in Bf. We conclude that bilirubin cytotoxicity is accurately predicted by Bf, not
BT, irrespective of the source or concentration of albumin.
Chapter 3
42
1. Introduction Plasma levels of unconjugated bilirubin (UCB) are elevated in almost all newborn
infants. In some infants with markedly elevated plasma UCB levels, bilirubin causes
neurotoxicity, sometimes resulting in permanent neurologic dysfunction (1). Management
guidelines for jaundiced term and near-term infants, published by the American Academy
of Pediatrics (AAP), are based on the premise that total serum bilirubin concentration (BT)
is the best available predictor of risk for bilirubin-induced neurologic damage (BIND) (2).
Clinical evidence has indicated, however, that BT, beyond a threshold value of 20 mg/dL,
is a poor discriminator of individual risk for BIND (3), (4). Since over 99.9% of total plasma
UCB (BT) is bound to albumin or apolipoprotein D (5) and only unbound bilirubin can
enter the brain across an intact blood-brain barrier, the level of unbound “free” bilirubin
(Bf) should theoretically provide a more accurate indication of the risk of kernicterus.
Published studies of UCB toxicity in cell cultures, conducted with different types of
albumin at varied molar ratios of bilirubin/albumin (6-9) reported an increase in cell damage
depending on BT. The hypothesis that cell injury is correlated better with Bf was first
suggested by Nelson et al.(10) in an in vitro study. Moreover, Ostrow et al.(11) reported a
meta analysis of in vitro studies that suggested cytotoxicity was better correlated with Bf (12). This conclusion was however based on Bf calculations using published binding
constants, rather than direct measurement in the culture medium, and was thus limited by
unknown variations in binding associated with differences in the composition of the
incubation media.
In jaundiced newborns, plasma Bf levels at any given BT or BT/albumin ratio can
vary widely due to varying concentrations of albumin and apolipoprotein D, differences in
the binding affinity, and/or the presence of inhibitors of binding (13). Bf, therefore, cannot
be accurately predicted from the concentrations of BT and albumin in plasma or culture
medium, and must be measured directly. A modified, enzymatic peroxidase method has
been developed to measure Bf in plasma (14) and tissue culture media (15), with minimal
dilution of the sample. This is important, since the binding affinity for UCB decreases
markedly with increasing albumin concentration (16-18). This assay is based on the
observation that, in the presence of peroxidase and peroxide, unbound bilirubin is oxidized
to colorless compounds, whereas proteinbound bilirubin is protected from oxidation (19).
The present study, for the first time, directly tests the hypothesis that Bf, measured
with the peroxidase method, rather than BT predicts the toxicity of UCB in several cell
Chapter 3
43
lines under a wide variety of incubation conditions, using 3(4,5-dimethiltiazolil-2)-2,5
diphenyl tetrazolium (MTT) reduction to assess cell viability.
2. Materials and Methods 2.1 Chemicals Dulbecco’s Phosphate Buffered saline (PBS), Dulbecco’s modified Eagle’s medium
high glucose (DMEM/high glucose), streptomycin and penicillin were purchased from
Euroclone, Milan (Italy). Ham’s Nutrient Mixture F12 (F12), Eagle’s Minimum Essential
Medium (EMEM), nonessential amino acid solution (MEM), fatty acid free human serum
albumin (HSA), fatty acid free bovine serum albumin fraction V (BSA), 3(4,5-
dimethiltiazolil-2)-2,5 diphenyl tetrazolium (MTT), unconjugate bilirubin (UCB), dimethy
sulfoxide (DMSO), horseradish peroxidase (HRP type I), hydrogen peroxide (H2O2, 30%
wt/vol) were purchased from Sigma Chemical Co.-Aldrich, Milan (Italy). Fetal calf serum
(FCS) and GlutaMAXTM, obtained from Invitrogen (Carlsbad, CA) contained 24 g/L
albumin. Chloroform was obtained from Carlo Erba, Milan (Italy).
2.2 Cell cultures SH-SY5Y cells were grown under 5% CO2 in F12/EMEM (1:1) supplemented with
penicillin, streptomycin, GlutaMAXTM, MEM and 15% FCS. HeLa, primary mouse
embryo fibroblast (MEF) and Striatal precursor 2a1 cell lines (20) were grown in
DMEM/high glucose with penicillin, streptomycin and 10% FCS at 37ºC, except for 2a1
cells that were incubated at 33ºC under 5% CO2. SHSY5Y and Striatal precursor 2a1 cell
lines were kindly provided by Dr S. Gustincich (SISSA, Trieste, Italy). MEF were
prepared as described by Hertzog (21). The animal protocol was approved by the Animal
Care and Use Committee of the University of Trieste.
2.3 Preparation of bilirubin/albumin systems UCB was purified by the method of Ostrow & Mukerjee (22), divided into 200 or 400
µg aliquots, and stored at -20ºC until used. Just before use, an aliquot was dissolved in 66
or 133 µL DMSO, yielding a stock solution containing 5 mM (3 µg/mL) UCB, which was
added to the albumin-containing culture medium to a final DMSO concentration that did
not exceed 1% (v/v).
Chapter 3
44
2.4 Bf measurements The unbound bilirubin (Bf) concentrations were determined using a modification of
the horseradish peroxidase assay (23) as described by Roca-Burgos, et al.(24). These methods
involve minimal dilution of the sample, minimizing the effect of dilution of the albumin
concentration on binding affinity (25).
2.5 Cell viability by MTT reduction Cells were plated in 24 multiwell plates, achieving 70-80% confluence by the
following day. The growing medium was then discarded, cells were washed with PBS at
37ºC and exposed to UCB dissolved in the respective culture medium containing either
fetal calf serum 15% (54 µM albumin), 30 µM or 60 µM HSA, or 30 µM BSA. Control
cells were incubated in the same medium to which had been added the same amount of
DMSO as the added stock UCB solution. After incubation with the UCB, the medium
containing UCB was removed and replaced with culture medium containing MTT 0.5
mg/mL (26). After incubating the cells with MTT for 2 hours at 37 °C, the medium was
discarded and MTT formazan crystals dissolved by adding 0.4 ml isopropanol/HCl 0.04 M
and gentle shaking for 2 hours at 37 °C. After centrifugation, absorbance values at 570 nm
were determined in a LD 400C Luminescence Detector, Beckman Coulter, Milan, Italy.
Results were expressed as percentage of MTT reduction by cells not exposed to UCB,
which was considered as 100% viability.
2.6 Effect of different albumin preparations on Bf levels and time course of toxicity
The relationship of Bf, BT, and different albumin preparations on binding and
toxicity were examined by incubating cells in media containint 30 or 60 µM HSA,
30 µM BSA or 10% FCS and varying bilirubin/albumin molar ratios to yield three
ranges of Bf concentrations (10-20, 40-50, and 80-90 nM). Cell viability was
ascertained following a 2 hours exposure to bilirubin.
We compared the susceptibility of four cell lines to bilirubin toxicity: HeLa
cells (27) and mouse embryo fibroblasts (28) and two neuronal cell lines SH-SY5Y
neuroblastoma cells and striatal precursor 2a1 cells.
Chapter 3
45
2.7 Effect of sulfadimethoxine on Bf and cell viability Bf was measured under the optimal growth conditions (15% FCS) for SH-SY5Y,
with or without 250 µM sulfadimethoxine, a strong binding competitor for UCB (29). BT
ranged from 3 to 32 µM with total BSA concentration of 54 µM. Similar Bf in the presence
and absence of sulfadimethoxine were established by using much lower BT concentrations
in the presence of sulfadimethoxine. Control systems contained 250 µM sulfadimethoxine
and the same volume of DMSO, but no UCB. Cells were incubated for 2 hours and MTT
assay then performed.
2.8 Effect of light on Bf and cell viability The effects of light (1000 lux) on Bf was evaluated using 15% FCS and 32 µM UCB
in F12/EMEM medium. The solution flask was placed 10 cm below a POLILUX 4000
58WT8 fluorescent lamp in a biological safety cabin (Model-VBH72 MP/99; Sterial,
Milan, Italy), and Bf was measured at 37ºC after 60 min light exposure. SHSY5Y cells
were incubated for 2 hours with culture medium exposure or not to light and cell toxicity
assessed by MTT assay.
2.9 Statistical analysis Results of at least three different experiments, performed in duplicate, are expressed
as mean ± SEM. Significant differences between two groups were determined by the two-
tailed t test performed on the basis of equal and unequal variance as appropriate.
Comparison of more than two groups was done by ANOVA using Instat 3.00 (GraphPad
Software, San Diego, CA, USA). Mean values were considered statistically significant
when P values where lower than 0.05.
Chapter 3
46
3. Results 3.1 Effect of different binders on Bf levels With all three albumin preparations, Bf increased with increasing BT. At a given BT,
30 µM BSA and 10% (v/v) FCS yielded comparable BT values (Figure 1). These were
roughly double the Bf obtained using the same concentration of HSA, consistent with the
weaker binding affinity of BSA (30).
3.2 Effect of Bf on cell viability in different cell lines Figure 2 shows the changes in cell viability when the 4 cell lines were exposed to a
Bf of 10-20, 40-50 and 80-90 nM for 2 hours. A constant Bf with varying BT was obtained
by using albumin preparations with different binding characteristics, as shown in Figure 1.
0
40
80
120
160
200
240
280
0 10 20 30 40 50 60
BT(µM)
Bf(nM)
FCS 10%BSA 30 µMHSA 30 µMHSA 60 µM
0
40
80
120
160
200
240
280
0
40
80
120
160
200
240
280
0 10 20 30 40 50 600 10 20 30 40 50 60
BT(µM) BT(µM)
Bf(nM)
Bf(nM)
FCS 10%BSA 30 µMHSA 30 µMHSA 60 µM
FCS 10%BSA 30 µMHSA 30 µMHSA 60 µM
Figure 1. Relationship of Bf to BT with four different albumin preparations. As follows: (▲) FCS 10%, (□) BSA 30 µM, ( ) HSA 30 µM, (■) HSA 60 µM. Data represent the mean ± SD of three independent experiments in triplicate.
70
80
90
100
110
120
0 10-20 40-50 80-90
Bf (nM)
Cell Viability (%)
FCS 10%
HSA 60 µM
A
*
70
80
90
100
110
120
0 10-20 40-50 80-90
Bf (nM)
FCS 10 %
HSA 60 µM
Cell Viability (%)
B
*
Chapter 3
47
Although the sensitivity to damage differed among the 4 cell lines, their viability
after two hours of incubation with UCB generally decreased as Bf increased. SHSY5Y
cells were most sensitive to UCB with about a 20% loss of viability at Bf = 40-50 and 30%
loss at Bf = 80-90 nM (p < 0.05 for each). HeLa cells were likewise significantly affected
at these concentrations, albeit less severely. In contrast, 2a1 cells showed a modest
decrease in viability only at a Bf = 80-90 nM (p < 0.05) while MEF cells showed a trend
toward decreased viability that did not achieve statistical significance. Similar results were
observed after 1 hour exposure to UCB: viability of SHSY5Y cells was already
significantly impaired at Bf = 40 nM, whereas HeLa, 2a1 and MEF cells showed
unimpaired survival even at Bf = 80-90 nM. Longer exposure (6 hr) to a Bf = 80-90 nM
resulted in a further increase in cytotoxicity in SHSY5Y cells (40 ± 3% decrease in
viability) and the appearance of a cytotoxic effect in the other cell lines (20 ± 5 for HeLa,
15 ±4% for 2a1 and 16 ± 3 for MEF). Again, similar toxicity was observed at similar Bf
obtained by varying UCB/albumin ratios.
3.3 Effect of sulfadimethoxine on Bf and on viability of SHSY5Y cells
Bf increased about 5 fold in the presence of sulfamethoxine, when the bilirubin/15%
v/v FCS molar ratios were 0.11 and 0.22 respectively, confirming the ability of the drug to
displace UCB from albumin. Sulfadimethoxine in the absence of UCB had no effect on
cell viability (100 ± 9.1 control vs 94.4 ± 12.4 treated cells). As shown in Figure 3, loss of
Figure 2. Effect of Bf on viability of four different cell lines, assessed by MTT test. 2a1 (A), HeLa (B), MEF(C) were incubated with DMEMHG but SHSY5Y cells (D) were incubated in F12/EMEM medium culture for 2 hours at various Bf as indicated. HSA 30 or 60 µM, BSA 30 µM and FCS 10% were the bilirubin binders. Data represent the mean ± SD of three experiments.
70
80
90
100
110
120
0 10-20 40-50 80-90
Bf (nM)
Cell Viability (%)
FCS 10%
HSA 60 µM
C
60
70
80
90
100
110
120
0 10-20 40-50 80-90
Bf (nM)
Cell Viability (%)
FCS 10% BSA 30 µM HSA 30 µM
D
*
*
Chapter 3
48
cell viability was comparable at any given Bf level, irrespective of BT (low in the presence
of sulfadimethoxine) or BT/albumin molar ratio.
3.4 Effect of Bf on cell viability without albumin
We exposed SHSY5Y cells for 2 h to BT ranging from 10 to 1000 nM, without
albumin - thus, all UCB in the medium is initially “free” (Bf = BT). Cell viability remained
unchanged up to Bf = 500 nM (Figure 4). In contrast, cells incubated in the presence of
15% v/v FCS and increasing concentrations of UCB to achieve Bf varying from 10-20 to
140-160 nM) viability was 40-50% lower (p<0.001).
Figure 3. Effect of sulfadimethoxine on Bf and cell viability. SHSY5Y cells were incubated in F12/EMEM with 15% vol/vol FCS (albumin concentration: 54 µM) with (black bars) or without (open bars) 250 µM sulfadimethoxine. BT was adjusted between 3 to 32 µM to yield similar Bf in the presence and absence of sulfadimethoxine, using much lower BT concentrations in the presence of sulfadimethoxine. Control systems contained 250 µM sulfadimethoxine but no UCB. Viability was assessed by the MTT assay after 2 h ofincubation with UCB. Data represent the mean ± SD of three independent experiments performed in triplicate.
0.6 0.22 0.22 0.11 0.11 0.05 0.05 0 0 Molar ratio
(BT/Albumin)
+
0
- + - + - + - - Sulfa 250 (µM)
32 12 12 6 6 3 3 0 BT (µM)
40
60
80
100
120
Cell Viability (%)
Bf (nM) 0 ≤ 10 40-50 150-160
Chapter 3
49
3.5 Effect of light on Bf and cell viability
Addition of 32 ± 1.5 µM UCB to 15% FCS (BSA 54 µM) resulted in a Bf of 164 ±
16 nM which decreased to 136 ± 13 nM following 60 min exposure to 1000 lux for 60 min
(p<0.01). BT decreased to 27.3 ± 0.9 µM (p<.0.01) and the calculated apparent binding
constant, Kf, (31) assuming one binding site on BSA (32), decreased from 8.98 ± 0.8 x 106 to
7.44 x 106 ± 0.7 M-1, (p<0.06). Viability of SHSY5Y cells incubated for 2 h with non-
irradiated media decreased to 34.6 ± 6.9%, but only to 45.9 ± 6.8% in irradiated media
(p<0.05). The improved viability after irradiation was appropriate for the lower Bf found.
In neither condition did Bf change significantly during incubation (Bf = 164 ± 16 vs. 155 ±
13 in non irradiated solution and 136 ± 14 vs. 130 ± 10 after irradiation). This was
anticipated, since uptake of unbound UCB by the cells during incubation was buffered by
release of Bf from the reservoir of albumin–bound UCB.
50
60
70
80
90
100
110
0 10 - 20 40 - 50 140 - 160 500 1000
B f (nM)
Cell Viability (%)
No FCS
15 % FCS
Figure 4. Effect of UCB without albumin on cell viability. SHSY5Y cells were incubated with UCB in F12/EMEM medium without (∆) or with 15% vol/vol FCS (▲), with BT adjusted to yield comparable Bf in both systems. Viability was assessed by the MTT assay after 2 h of incubation with UCB. Data represent the mean ± SD of three separate experiments performed in triplicate.
Chapter 3
50
4. Discussion In this study we demonstrated variable sensitivity of four different cell lines to
bilirubin toxicity. Loss of viability was dependent on the free bilirubin level (Bf) but not
the total bilirubin concentration (BT), whether or not the Bf is varied by using preparations
of albumin with different binding affinities, or by displacement of UCB from albumin by
sulfadimethoxine. The results obtained with sulfadimethoxine confirm the observation that
viability of cultured 8402 human cells correlated (r2 = 0.94) with the square root of Bf
level, with or without sulfisoxazole (33). SHSY5Y cells, a neuronal model for studies of
Alzheimer’s disease (34), are more sensitive to UCB cyotoxicity than the 3 nonneuronal cell
lines tested. The response of SHSY5Y cells to bilirubin is similar to other neuronal or
astrocytic cell lines reported in the literature (35). Interestingly, this greater susceptibility of
SHSY5Y cells to UCB toxicity is manifested both at lower Bf and at shorter incubation
times compared with the other three cell lines tested. Although the molecular pathogenesis
of bilirubin induced neuronal cell injury is not completely understood, cell damage at any
given Bf is affected by a variety of mechanisms (36) including export of UCB by ABC
transporters, binding of UCB by cytosolic proteins, cellular oxidation and conjugation of
UCB. We observed a marked difference in dose-response when SHSY5Y cells were
exposed to UCB in the absence of albumin. The Bf required for a comparable decrease in
viability was more than double that observed with albumin present. Nelson reported
similar findings with L929 cells (37). These results can be explained in part by self-
aggregation of unbound UCB and by the reservoir function of the albumin bound UCB.
The true determinant of UCB cytotoxicity is the intracellular content of UCB. In the
absence of the reservoir of albumin-bound UCB, the small amount of unbound UCB in the
extracellular fluid in our experimental system (150 pmol at a Bf (= BT) of 150 nM) is
quickly consumed, so that a sufficiently high toxic intracellular level of UCB is not
reached. Unfortunately, due to extremely low concentration, it was impossible to measure
the “equilibrium” extracellular BT in the absence of albumin, or to compare the
intracellular UCB concentrations with and without albumin. With albumin present, UCB
taken up from the extracellular pool of unbound UCB is instantaneously replaced by
dissociation of bound UCB from the albumin, thus maintaining a constant Bf. In the
presence of 15% FCS, a Bf of 150 nM requires a total bilirubin content of 20,000 pmol i.e.,
more than 130 times greater than that found at a comparable Bf in the absence of FCS.
Binding to albumin also prevents the pigment from aggregating and precipitating and
Chapter 3
51
stabilizes the pigment against oxidation (38). Collectively these data indicate that in addition
to the Bf, the total amount of UCB available for uptake is also important to predict cellular
damage. In vivo, the presence of a large reservoir of albumin-bound UCB renders this
consideration irrelevant. Application of phototherapy to jaundiced infants produces photo-
isomers and photo-oxidative derivatives of UCB. The water soluble photo-isomers are
thought to be nontoxic, although confirming experimental evidence is lacking, and they
cannot be discriminated from native UCB (bilirubin IX_z,z) by usual assays for BT. There
is evidence that these isomers bind less avidly to albumin (39), and concern has been raised
that they will be oxidized faster than bilirubin IX_z,z, and yield misleading values of Bf (40,
41). Our data support previous observations that photo-products do not significantly alter
the measurement of Bf (42, 43), either by displacing native UCB from the binding site and/or
by having a lower binding affinity to the albumin or the peroxidase enzyme. Regardless of
mechanism, the predictable relationship between measured Bf and toxicity in medium
exposed to intense light supports the validity of the peroxidase assay in evaluating risk for
bilirubin toxicity when photo-isomers are present. The presence of serum or albumin in
culture media is often necessary for optimal cell growth. The use of BSA or FCS rather
than HSA in studies of UCB cytotoxicity in vitro is supported by several reasons among
which the most relevant are: 1) BSA is much less expensive than HSA; and 2) BSA has a
lower affinity constant for UCB, requiring a much lower BT to achieve any given Bf level (44). Using the peroxidase method (45), Bf can be easily measured without dilution of culture
medium in any study where BSA or FCS is used as a UCB reservoir (46). Measurement of
Bf in all in vitro experiments would greatly facilitate interpretation and comparison of
dose-response studies conducted in different laboratories under different conditions.
This study supports the “free bilirubin theory” which hypothesizes that bilirubin
toxicity occurs when unbound bilirubin enters the brain and binds to intracellular structures (1). Recent clinical reviews, reports (47) and follow-up studies of infants with marked
hyperbilirubinemia (48) emphasizes the limitation of BT as a predictor of neurologic
outcome. Verification of Bf as the critical determinant of toxicity in vitro reinforces the
proposal to assess the risk for kernicterus by measuring Bf in hyperbilirubinemic newborn
plasma (49), rather than depending solely on BT, as currently recommended by the
American Academy of Pediatrics (50).
Chapter 3
52
5 References 1. Gourley, G. R. (1997) Bilirubin metabolism and kernicterus, 44 ed., pp 173-229.
2. (2004) Management of hyperbilirubinemia in the newborn infant 35 or more weeks of gestation, Pediatrics 114, 297-316.
3. Wennberg, R. P., Ahlfors, C. E., Bhutani, V. K., Johnson, L. H., and Shapiro, S. M. (2006) Toward understanding kernicterus: a challenge to improve the management of jaundiced newborns, Pediatrics 117, 474-485.
4. Newman, T. B., Liljestrand, P., Jeremy, R. J., Ferriero, D. M., Wu, Y. W., Hudes, E. S., and Escobar, G. J. (2006) Outcomes among newborns with total serum bilirubin levels of 25 mg per deciliter or more, N. Engl. J. Med. 354, 1889-1900.
5. Goessling, W. and Zucker, S. D. (2000) Role of apolipoprotein D in the transport of bilirubin in plasma, Am. J. Physiol Gastrointest. Liver Physiol 279, G356-G365.
6. Silva, R. F., Rodrigues, C. M., and Brites, D. (2002) Rat cultured neuronal and glial cells respond differently to toxicity of unconjugated bilirubin, Pediatr. Res. 51, 535-541.
7. Hanko, E., Hansen, T. W., Almaas, R., Paulsen, R., and Rootwelt, T. (2006) Synergistic protection of a general caspase inhibitor and MK-801 in bilirubin-induced cell death in human NT2-N neurons, Pediatr. Res. 59, 72-77.
8. Keshavan, P., Schwemberger, S. J., Smith, D. L., Babcock, G. F., and Zucker, S. D. (2004) Unconjugated bilirubin induces apoptosis in colon cancer cells by triggering mitochondrial depolarization, Int. J. Cancer 112, 433-445.
9. Ngai, K. C., Yeung, C. Y., and Leung, C. S. (2000) Difference in susceptibilities of different cell lines to bilirubin damage, J. Paediatr. Child Health 36, 51-55.
10. Nelson, T., Jacobsen, J., and Wennberg, R. P. (1974) Effect of pH on the interaction of bilirubin with albumin and tissue culture cells, Pediatr. Res. 8, 963-967.
11. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 98-104.
12. Ahlfors, C. E. (2000) Measurement of plasma unbound unconjugated bilirubin, Anal. Biochem 279, 130-135.
13. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
14. Ahlfors, C. E. (2000) Measurement of plasma unbound unconjugated bilirubin, Anal. Biochem 279, 130-135.
Chapter 3
53
15. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
16. Ahlfors, C. E. (2000) Measurement of plasma unbound unconjugated bilirubin, Anal. Biochem 279, 130-135.
17. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
18. Jacobsen, J. and Wennberg, R. P. (1974) Determination of unbound bilirubin in the serum of newborns, Clin. Chem. 20, 783.
19. Jacobsen, J. and Wennberg, R. P. (1974) Determination of unbound bilirubin in the serum of newborns, Clin. Chem. 20, 783.
20. Trettel, F., Rigamonti, D., Hilditch-Maguire, P., Wheeler, V. C., Sharp, A. H., Persichetti, F., Cattaneo, E., and MacDonald, M. E. (2000) Dominant phenotypes produced by the HD mutation in STHdh(Q111) striatal cells, Hum. Mol Genet. 9, 2799-2809.
21. Hertzog, P. J. (2001) Isolation of embryonic fibroblasts and their use in the in vitro characterization of gene function, Methods Mol Biol. 158, 205-215.
22. Ostrow, J. D. and Mukerjee, P. (2007) Solvent partition of 14C-unconjugated bilirubin to remove labeled polar contaminants, Transl. Res 149, 37-45.
23. Ahlfors, C. E. (2000) Measurement of plasma unbound unconjugated bilirubin, Anal. Biochem 279, 130-135.
24. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
25. Ahlfors, C. E. (1981) Effect of serum dilution on apparent unbound bilirubin concentration as measured by the peroxidase method, Clin. Chem. 27, 692-696.
26. Denizot, F. and Lang, R. (1986) Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability, J Immunol. Methods 89, 271-277.
27. Calligaris, S., Cekic, D., Roca-Burgos, L., Gerin, F., Mazzone, G., Ostrow, J. D., and Tiribelli, C. (2006) Multidrug resistance associated protein 1 protects against bilirubin-induced cytotoxicity, FEBS Lett. 580, 1355-1359.
28. Baranano, D. E., Rao, M., Ferris, C. D., and Snyder, S. H. (2002) Biliverdin reductase: a major physiologic cytoprotectant, Proc. Natl. Acad. Sci. U. S. A 99, 16093-16098.
Chapter 3
54
29. Wadsworth, S. J. and Suh, B. (1988) In vitro displacement of bilirubin by antibiotics and 2-hydroxybenzoylglycine in newborns, Antimicrob. Agents Chemother. 32, 1571-1575.
30. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
31. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
32. Weisiger, R. A., Ostrow, J. D., Koehler, R. K., Webster, C. C., Mukerjee, P., Pascolo, L., and Tiribelli, C. (2001) Affinity of human serum albumin for bilirubin varies with albumin concentration and buffer composition: results of a novel ultrafiltration method, J. Biol. Chem. 276, 29953-29960.
33. Pramanik, A. K., Horn, N., and Schwemer, G. (1980) 8402 human cell culture--a model for evaluating bilirubin-albumin interactions with drug, Toxicology 17, 255-259.
34. Martin, H., Lambert, M. P., Barber, K., Hinton, S., and Klein, W. L. (1995) Alzheimer's-associated phospho-tau epitope in human neuroblastoma cell cultures: up-regulation by fibronectin and laminin, Neuroscience 66, 769-779.
35. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 98-104.
36. Ostrow, J. D., Pascolo, L., Brites, D., and Tiribelli, C. (2004) Molecular basis of bilirubin-induced neurotoxicity, Trends Mol. Med. 10, 65-70.
37. Nelson, T., Jacobsen, J., and Wennberg, R. P. (1974) Effect of pH on the interaction of bilirubin with albumin and tissue culture cells, Pediatr. Res. 8, 963-967.
38. Ostrow, J. D., Mukerjee, P., and Tiribelli, C. (1994) Structure and binding of unconjugated bilirubin: relevance for physiological and pathophysiological function, J. Lipid Res. 35, 1715-1737.
39. Lamola, A. A., Flores, J., and Blumberg, W. E. (1983) Binding of photobilirubin to human serum albumin. Estimate of the affinity constant, Eur. J. Biochem. 132, 165-169.
40. McDonagh, A. F. and Maisels, M. J. (2006) Bilirubin unbound: deja vu all over again?, Pediatrics 117, 523-525.
41. McDonagh, A. F. (2006) Ex uno plures: the concealed complexity of bilirubin species in neonatal blood samples, Pediatrics 118, 1185-1187.
42. Ahlfors, C. E., Shwer, M. L., and Wennberg, R. P. (1982) Absence of bilirubin binding competitors during phototherapy for neonatal jaundice, Early Hum. Dev. 6, 125-130.
Chapter 3
55
43. Itoh, S., Yamakawa, T., Onishi, S., Isobe, K., Manabe, M., and Sasaki, K. (1986) The effect of bilirubin photoisomers on unbound-bilirubin concentrations estimated by the peroxidase method, Biochem. J. 239, 417-421.
44. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
45. Ahlfors, C. E. (2000) Measurement of plasma unbound unconjugated bilirubin, Anal. Biochem 279, 130-135.
46. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr Res 60, 724-728.
47. Wennberg, R. P., Ahlfors, C. E., Bhutani, V. K., Johnson, L. H., and Shapiro, S. M. (2006) Toward understanding kernicterus: a challenge to improve the management of jaundiced newborns, Pediatrics 117, 474-485.
48. Newman, T. B., Liljestrand, P., Jeremy, R. J., Ferriero, D. M., Wu, Y. W., Hudes, E. S., and Escobar, G. J. (2006) Outcomes among newborns with total serum bilirubin levels of 25 mg per deciliter or more, N. Engl. J. Med. 354, 1889-1900.
49. Wennberg, R. P., Ahlfors, C. E., Bhutani, V. K., Johnson, L. H., and Shapiro, S. M. (2006) Toward understanding kernicterus: a challenge to improve the management of jaundiced newborns, Pediatrics 117, 474-485.
50. Ahlfors, C. E., Shwer, M. L., and Wennberg, R. P. (1982) Absence of bilirubin binding competitors during phototherapy for neonatal jaundice, Early Hum. Dev. 6, 125-130.
56
Chapter 4
Characterization of the SH-SY5Y cells as
a model for bilirubin toxicity
Cristina Bellarosa, Pablo GiraudiPablo GiraudiPablo GiraudiPablo Giraudi, Raffaella Calligaris, Rossana
Foti, Stefano Gustincih and Claudio Tiribelli
Parts of this study have been submitted at the Annual Meeting of
the Pediatric Academic Societies in Baltimore, 2009
This study was supported in part by a grant from Thelethon (GGP05062)
Chapter 4
57
Abstract In spite of plenty of published articles about molecular mechanisms of bilirubin
neurotoxicity, at present the general picture is far to be completed. Our aim was to
characterize a neuronal cell model to determine the molecular events of UCB toxicity. We
decided to use SH-SY5Y neuronal cells as they shows: 1) high UCB uptake, 2) MRP1
(involved in UCB extrusion) localized at membrane level and 3) high sensitivity to UCB
treatment. On the other hand, this cell line is a commonly used catecholaminergic model in
studies relative to neurotoxicity of various substances, oxidative stress, and
neurodegenerative diseases. Methods: Cells were exposed for different time to a Bf level of
10, 40, 70 and 140 nM and cell viability evaluated by MTT test. Cells were also “primed”
by the exposure at a Bf of 140 nM for 24 hours and cell growth was monitored for 8 days
after priming. After 48 and 156 hours of priming, cells were re-exposed for 4 hours to Bf
ranging 40 to 140 nM. RNA and total protein were collected to perform gene array
experiments, RT-Real time PCR and Western Blot analysis. Results: The reduction in cell
viability caused by UCB never exceeded 40% of the cell population regardless of the time
and concentration of the UCB exposure. Next experiment are obtained on cells survived
after UCB priming ( Bf 140 nM, 24h). Primed cells show a ROS increase 4 h upon release.
ROS return to normal levels in 16 hours upon release. Primed cells growth stops for 4 days
upon release and SH-SY5Y primed cells became resistant to a second stress (Bf or H2O2).
Gene array experiments showed that several genes involved in ER stress response and the
SLC7A11 gene are strongly and consistently increased in SH-primed cells. On the contrary
the protein expression of the specific subunit of cystine-glutamate exchange systems xCT
product of SLC7A11 was unchanged. In conclusion, these data suggest that UCB elicits a
long lasting adaptive response to oxidative stress, where genes involved in ER stress and
SLC7A11 are implicated.
Chapter 4
58
1. Introduction
Some neonates with severe hyperbilirubinemia develop bilirubin encephalopathy, in
which multifocal deposition of UCB in selected regions of the brain results in temporary or
permanent impairment of auditory, motor or mental function (1). Recent increases in the
prevalence of bilirubin encephalopathy and its occasional occurrence at plasma bilirubin
levels below those indicated by therapeutic guidelines have revived the interest in
understanding the mechanisms of UCB induced neurotoxicity (2).
Bilirubin neurotoxicity is determined primarily by the concentration of the unbound
(free) fraction of UCB in plasma (Bf) (3). In vitro exposure of neurons and astrocytes to
UCB has revealed neuroprotection at Bf below aqueous saturation of UCB (70 nM), but
neurotoxicity at Bf modestly above aqueous saturation of UCB (4). The cell death cause by
bilirubin has features of apoptosis, including DNA fragmentation, release of cytochrome c,
activation of caspase-3 and cleavage of poly(ADP)ribose polymerase (5), (6), (7), (8). In
addition, recent evidences demonstrate that UCB-mediated apoptosis in Hepa 1c1c7 cells
is associated with oxidative stress (9) and in HeLa cells the increase in intracellular reactive
oxygen species due to UCB activate a signaling pathway involving APE1/Ref-1, Egr-1 and
PTEN in response to toxic effect of bilirubin (10).
The major cellular antioxidant glutathione (GSH) is an important line of defense
against oxidative stress, and its deficiency can sensitize the brain to injury (11), (12); (13). GSH
is a tripeptide containing the amino acids cysteine, glutamate and glycine. Its synthesis is
limited by availability of the sulfhydryl amino acid cysteine, which is readily oxidized to
cystine in the extracellular milieu. High-affinity cystine uptake by the Na+-independen
cystine-glutamate exchange transporter (system xc-) is a rate-limiting step for GSH
synthesis in various brain cell types (14). In particular, fetal brain cells (15) immature cortical
neurons (16), HT22 hippocampal cell line (17) and gliomas (18) are uniquely vulnerable to
cystine deprivation or competitive inhibition of system xc- by excessive extracellular
glutamate concentrations (oxidative glutamate toxicity).
Structurally, system xc- is a member of the disulfide-linked heterodimeric amino acid
transporter family and consists of a light-chain subunit (xCT, encoded by the SLC7A11
gene), which confers substrate specificity (19), and a glycosylated heavy-chain subunit
(4F2hc, encoded by the SLC3A2) common to the transporter family (20). It transports
cystine into cells in a 1:1 exchange with glutamate and is thus inhibited by high
concentrations of extracellular glutamate. The activity of system xc- is induced by various
Chapter 4
59
stimuli, including electrophilic agents like diethyl maleate (21), oxygen (22), bacterial
lipopolysaccharide (23), cysteine and others amino acids (24),(25).
Although upregulation of the xc- exchanger will provide more cysteine for GSH
synthesis, glutamate release will also increase, potentially causing the extracellular
concentration to rise (26). This could trigger glutamate-mediated toxicity in certain brain
diseases.
Excitotoxic mechanisms have previously been proposed to contribute to bilirubin-
induced CNS injury both in vitro (27) and in vivo (28). Potential contributors to the risk of
bilirubin-induced excitotoxicity include the following: evidence that UCB also impairs
glutamate uptake (29), enhanced expression of excitatory amino acid receptors in the
bilirubin susceptible regions of the developing CNS (30) and observations that the Purkinje
cell, one of the neuronal subtypes most susceptible to bilirubin toxicity, is characteristically
vulnerable to glutamate-mediated excitotoxicity across a variety of pathological conditions (31). Exactly how excitotoxicity is initiated by hyperbilirubinemia and the molecular
mechanisms that contribute to UCB neurotoxicity remain unclear, thus new studies
working with the free bilirubin (that now is appreciated) in well-known cellular models are
necessary
The SH-SY5Y cell line is a third successive sub-clone of the parent cell line SK-N-
SH, originally established from a bone marrow biopsy of a neuroblastoma patient (32). The
SK-N-SH parental line comprise at least two morphologically and biochemically distinct
phenotypes: neuroblastic (N-type, more-agressive) and substrate adherent (S-type, less
agressive). Although derived from a neuroblastic subclone SH-SY5Y cells retains a low
proportion of S-type cells (33), (34), (35). Ross et al. describe that S-type cells and N-type could
undergo transdifferentiation. More recently, Cohen N suggested that the simultaneous
coexistence of both cell types and the subsequent clonal expansion of one over the other is
a possible explanation for the phenomenon observed and not the accepted interconversion
model.
Based on the results described in Chapter 1 and that SH-SY5Y neuroblastoma cells is
a widely used model for studying neurotoxicity and neuroprotection, we decided
characterize this neuronal cell model to determine the molecular events of UCB-cell
damage.
Chapter 4
60
2 Materials and Methods
2.1 Chemicals Dulbecco’s Phosphate Buffered saline (PBS), streptomycin and penicillin were
purchased from Euroclone, Milan (Italy). Ham’s Nutrient Mixture F12 (F12), Fetal calf
serum (FCS), GlutaMAXTM and TRIZOL reagent, obtained from Invitrogen (Carlsbad,
CA) contained 24 g/L albumin. Ham’s Nutrient Mixture F12 (F12), Eagle’s Minimum
Essential Medium (EMEM), nonessential amino acid solution (MEM), dimethy sulfoxide
(DMSO), peroxide (H2O2, 30% wt/vol), 3(4,5-dimethiltiazolil-2)-2,5 diphenyl tetrazolium
(MTT), L-buthionine-[S,R]-sulfoximine, NADPH, DEM, glutathione reductase, 2,2’-
dinitro-5,5’-di-thiobenzoic acid (DTNB), Tri Reagent were purchased from Sigma
Chemical Co.-Aldrich, Milan (Italy). Chloroform was obtained from Carlo Erba, Milan
(Italy).
Unconjugated bilirubin (UCB)(Sigma Chemical Co, St. Louis MO), was purified as
described by Ostrow & Murkerjee (36). The 2,7-dichlorodihydrofluorescein diacetate
(H2DCFDA) was obtainded from Molecular Probes (Carlsbad, CA, USA) and iScriptTM
cDNA Synthesis kit, iQTM SYBR Green Supermix were purchased from Bio-Rad
Laboratories (Hercules, CA, USA).
2.2 Cell Culture Human neuroblastoma SH-SY5Y cells were cultured in a mixture of EMEM/F12 (1:1
v/v) containing 15% (v/v) FCS, 1% (v/v) nonessential amino acids, 1% (v/v) GlutaMAXTM,
penicillin (100 U/mL) and streptomycin (100 µg/mL) in 75 cm2 tissue culture flasks at
37°C in a humidified atmosphere of 5% CO2. The cells were fed every 2 days and
subcultured once they reached 80-90% confluence. Cultures were stopped at the 20th
passage, because it is recommended so since has been described that the SH-SY5Y cells
show loss of neuronal characteristics.
2.3 Treatments of SH-SY5Y cells with Bf (A time course study) The day before the experiment SH-SY5Y cells were plated in 24 multiwell plates at a
density of 70,000 cells/cm2. Cell viability assays were conducted when 70% confluence
was attained uniformly in all wells. The growing medium was discarded and the cells were
Chapter 4
61
washed with PBS at 37 °C. Then, cells were incubated with increasing doses of UCB
dissolved in EMEM/F12 with 15% FCS.
Immediately before each incubation an aliquot of purified UCB was dissolved in
DMSO (0.3 µL of DMSO per µg of UCB) obtaining a final concentration of 5 mM and
then added to the culture with fetal calf serum. In the different UCB solutions, the
concentration of free bilirubin (Bf) was measured with the peroxidase method (37).
In the time course studies, cells were exposed to increasing Bf (10, 40, 70 and 140
nM) for 1, 2, 4, 6 e 24 hours. At the end of the incubation period, the medium containing
UCB was discarded and the cells washed 3 times with PBS at 37°C, and tested for viability
by the MTT test.
In order to standardize DMSO-related effects, cells were incubated with medium
containing DMSO 0.6% (the quantity of DMSO to dissolve the UCB and obtain the more
concentrated solution Bf 140 nM) and the viability was checked at the end of each
incubation period.
MTT test
The stock solution of 3(4,5-dimethyltiazolyl-2)-2,5 diphenyl tetrazolium (MTT) was
dissolved in PBS pH 7.4 at 5 mg/mL. Immediately before the experiment, the MTT
solution was diluted to 0.5 mg/mL in EMEM/F12 with 15% FCS (38). The cells were
incubated with MTT solution 0.5 mg/mL for 2 hours at 37 °C. After incubation, to dissolve
MTT formazan crystals, the medium was replaced with 0.4 mL of DMSO and the sample
gentle shaking for 15 min. Absorbance values at 570 nm were determined in a LD 400C
Luminescence Detector, Beckman Coulter, Milan, Italy. Results were expressed as
percentage of control cells, not exposed to UCB, which was considered as 100% viability.
Chapter 4
62
Figure 1. Priming protocol
SH-SY5Y cells
80,000 cells/cm2
70-80% of confluence
SH -primedAspire medium
Wash PBS (1x)
Bf 140 nM
SH-non primedAspire medium
Wash PBS (1x)
DMSO 0.6%
Wash PBS (3x)
Fresh medium
Cell detachment (trypsinization)Cells plated for MTT test (70,000 cells/cm2)
24 h
75 cm2
Viability by MTT test
Bf 40, 70, 140 nM Time: 2, 4 6 hours
SH-SY5Y cells
80,000 cells/cm2
70-80% of confluence
SH -primedAspire medium
Wash PBS (1x)
Bf 140 nM
SH-non primedAspire medium
Wash PBS (1x)
DMSO 0.6%
Wash PBS (3x)
Fresh medium
Cell detachment (trypsinization)Cells plated for MTT test (70,000 cells/cm2)
24 h
75 cm2
Viability by MTT test
Bf 40, 70, 140 nM Time: 2, 4 6 hours
2.4 Priming with UCB of SH-SY5Y cells SH-SY5Y cells were seeded in
75 cm2 flasks at a density of 80,000
cells/cm2. Part of these flasks, were
treated for 24 hours with a solution of
UCB in EMEM/F12 with 15% FCS
(Bf = 140 nM). We labeled this
treatment “the priming” and the cells
that survived as “SH-primed cells”.
Control were cells SH-SY5Y grown
for 24 hours in EMEM/F12 (15%
FCS) containing 0.6% of DMSO (the
quantity of DMSO that is necessary
to dissolve the UCB and obtain a Bf
of 140 nM) but without UCB. These
cells were labeled as “SH- non-primed cells”.
After the incubation period in the two groups of cells the medium was discarded
and they were washed 3 times with PBS at 37°C to eliminate bilirubin or DMSO.
Then cells were released in optimal growth conditions (EMEM/F12, 15% FCS) until
they were used in the ulterior studies.
2.5 Determination of intracellular ROS levels and cell proliferation state by FACS analysis
Intracellular ROS levels were monitored by using the fluorescent dye 2’7’-
dichlorodihydrofluorescein diacetate (H2DCFDA), which is a non polar compound
converted into a non fluorescent polar derivative (H2DCF) by cellular esterases after
incorporation into cells. H2DCF is membrane-impermeable and is oxidized rapidly to the
highly fluorescent 2’,7’-dichlorofluorescein (DCF) in the presence of intracellular ROS (39).
SH-SY5Y cells were seeded in 6 multiwell plates at a density of 50,000 cell/cm2 and
24 hours later were subjected to the “priming protocol”. After this, cells were washed three
times in PBS at 37°C and released in complete medium (EMEM/F12, 15% FCS) for 4 and
16 hours. ROS concentration and cell morphology were evaluated at 0, 4 and 16 hours
Chapter 4
63
from the release. These experiments were performed with the collaboration of the group
coordinated by Prof. G. Tell (Molecular Biology Section, University of Udine).
At these times, SH-SY5Y cells were washed once with serum free media and
incubated for 30 min with serum free media supplemented with 10 µM H2DCFDA. Upon
incubation cells were washed twice with PBS, harvested with trypsin, centrifuged for 3
min at 280 x g and resuspended in 500 µL of PBS to evaluate ROS mediated cell
fluorescence and cell morphology using FACS analysis on a FACScan device (Becton
Dickinson, Franklin Lakes, NJ, USA).
2.6 Glutathione determinations The tripeptide glutathione is the most abundant thiol present in mammalian cells,
playing an important role in the cellular detoxification of ROS (40). Total glutathione (GSH)
was determined by an enzymatic recycling procedure: the sulphydryl group of the
molecule reacts with 5,5’-dithiobis-2-nitrobenzoic acid (DTNB, Ellman’s reagent)
producing a yellow colored 5-thio-2-nitrobenzoic acid (TNB), and the disulfide is reduced
by NADPH in the presence of glutathione reductase (41), (42).
SH-SY5Y cells were seeded in 60 mm cell culture dishes at a density of 70,000
cell/cm2, and when achieved a 70% confluence were subjected to a specific treatment
(buthionine sulfoximine or diethyl maleate) or at the priming protocol. Cells were then
washed three times with PBS at 37°C and 500 µL ice-cold 5% perchloric acid was added.
Cells were detached by scrapping, harvested, and the dishes rinsed twice with 500 µL ice-
cold 5% perchloric acid. The two fractions pooled together, homogenized and transferred
to eppendorf tubes. The samples were centrifugated at 13.000 g and the acid-soluble
fraction was separated from the pellet and both were stored at -70°C until analysis was
performed. The pellet was solubilized in 1 mol/L NaOH and quantified for protein
concentration according to bicinchoninic acid assay.
GSH was quantified in the acid supernatants after its neutralization with a 0.76 M
KHCO3, formed potassium perchlorate was removed by centrifugation and supernatants
were used for quantification of total glutathione. Briefly, supernatant aliquots (100 µL)
were assayed in 900 µL of the reaction mixture (0.1 M sodium phosphate buffer (pH 7.5)
containing 1 mM EDTA, 0.3 mM DTNB, 0.4 mM NADPH). The rate of TNB formation
was monitored following addition of 1 U/mL glutathione reductase in a termostated cuvette
(30 °C), at 415 nm, for 3 min, in a Bckman DU 640 spectrophotometer). Glutathione
concentrations were calculated using appropriate standards and were expressed in
Chapter 4
64
nmols/mg protein. Proteins were quantified using the bicinchoninic acid assay from acid-
precipitated pellet by treatment with 1 M NaOH.
2.7 Monitoring of cell growth after priming SH-SY5Y cells were subjected to the priming protocol, washed 3 times with PBS
and released 16 hours in EMEM/F12 with 15% FCS. Cells were then washed once, and the
same number of cells (controls, non-primed and primed) was seeded in complete medium.
Cells were grown for eight days and counted each day.
2.8 Response of SH-SY5Y primed cells to a second stress (Bf or H2O2) After priming, SH-SY5Y cells were washed 3 times with PBS and released in
complete medium for 16 hours. SH- non-primed and primed cells were then washed,
harvested with trypsin and plated at 70,000 cells/cm2 in 24 multiwell plates. Next day, cells
were treated with 40, 70 and 140 nM of Bf and cell viability was evaluated by MTT test 48
hours after priming was performed.
In a second set of experiments we evaluated the viability of SH- non-primed and
primed cells in response to 40, 70 and 140 nM of Bf 156 hours after priming.
To standardize DMSO effects, SH- non-primed and primed cells were incubated with
medium containing DMSO 0.6% , the quantity of DMSO to dissolve the UCB and obtain
the more concentrated solution Bf 140 nM.
In parallel the effect on cell viability with increasing doses of H2O2 (0-1 mM) for 1 or
3 h was investigated in non-primed and primed cells. Cell viability was assessed by the
MTT assay both 48 and 156 hours after priming.
2.9 Gene expression profile experiments (Microarray analysis) SH-SY5Y cells were seeded in T-75 flask at a density of 80,000 cells/cm2 ;until they
reached a 70% of confluence when the growth medium was eliminated and cells were
exposed to a Bf of 140 nM for 1, 4 and 24 hours. RNA was collected and extracted in
TRIZOL according to the manufacturer’s instructions. Control cells were grown in
EMEM/F12 with 0,6% DMSO and RNA was collected for each time point. Gene
expression experiments were performed at the Laboratory of Molecular Neurobiology
(SISSA) coordinated by Dr. S. Gustincich.
Chapter 4
65
RNAs were purified according to the manufacture’s suggestions, monitored on a
bioanalyzer (Agilent) and hybridized on a Affymetrix platform using an Ambion Illumina
probe synthesis protocol and a GeneChip®Human Genome U133 Plus 2.0 Affymetrix
array. The Ambion Illumina probe synthesis method allows very sensitive and reproducible
results with a single round of T7 polymerization starting from 500 ng of total RNA.
GeneChip®Human Genome permits analyse the expression level of over 47,000 transcripts
and variants, including 38,500 well-characterized human genes. Chips were scanned with a
GeneChip Scanner 3000 7G and data analyzed by dCHIP software. All the experiments
were performed in duplicates. All the hybridizations met Affymetrix quality control
standards.
2.10 Real-Time RT-PCR and Western Blot studies SH-SY5Y cells were plated on T-75 flasks at a density of 80,000 cells/cm2 and they
were treated with 140 nM Bf for 1, 4, 24 hours, when the 70% confluence was attained.
We perfomed two series of controls, SH-SY5Y cells grown in optimal medium conditions
and SH-SY5Y cells grown in EMEM/F12 with 0,6% DMSO for 1, 4 and 24 hours. Total
RNA and proteins were extracted after incubation times.
In a second set of experiments, SH-SY5Y cells at 70% of confluence were treated
with 140 nM Bf for 24 hours (priming). Then SH-SY5Y cells were washed 3 times with
PBS at 37°C and released in EMEM/F12 with 15% FCS. Total RNA and proteins were
extracted immediately, 8 or 24 hours after the exposition to the UCB.
RNA extraction and quantification by Real-Time RT-PCR
Total RNA was isolated by Tri Reagent solution according to the manufacture's
suggestions (SIGMA, Missouri, USA. T9424). The total RNA concentration and the purity
were quantified by spectrophotometric analysis in a Beckman DU640. For each sample the
A260/A280 ratio comprised between 1.8 and 2.0 was considered as good RNA quality
criteria. The integrity of RNA was assed on standard 1% agarose/formaldehyde staining
with ethidium bromide gel, indicating that the RNA preparations were of high integrity.
Isolated RNA was resuspended in RNAse free water and stored at -80°C until analysis.
Single stranded cDNA was obtained from 1 µg of purified RNA using the
iScripTMcDNA Synthesis Kit, according to the manufacture’s suggestions. The reaction
was run in a Thermal Cycler (Gene Amp PCR System 2400, Perkin-Elmer, Boston, MA,
Chapter 4
66
USA) in agreement with the reaction protocol proposed by the manufacturer. Real Time
quantitative PCR was performed with an iCycler IQ (Bio-Rad Laboratories, Hercules, CA,
USA), using β-actin, HPRT and GAPDH as endogenous controls to normalize the
expression level of SLC7A11 gene. Primer sequences and references are reported in table
1. These primers were designed using Beacon Designer 4.02 software (PREMIER Biosoft
International, Palo Alto, CA, USA). All primer pairs were synthesized by Sigma Genosys
(Cambridgeshire, UK).
Gene Accession
Number
Primer Forward Primer Reverse Produc
t (bp)
SLC7A11
b-actin
HPRT
GPDH
NM_014331.3
NM_001101
NM_000194
NM_002046
GGTGGTGTGTTTGCTGTC
CCTGGCACCCAGCACAAT
CTGGAAAGAATGTCTTGATTGTGG
CCCATGTTCGTCATGGGTGT
GCTGGTAGAGGAGTGTGC
GCCGATCCACACGGAGTACT
TTTGGATTATACTGCCTGACCAAG
TGGTCATGAGTCCTTCCACGATA
107
120
91
145
Briefly, 25 ng of cDNA were amplified by PCR with 1x iQ SYBR Green Supermix
(100 mM KCl, 40 mM Tris-HCl, pH 8.40; 0.4 mM each dNTP; 50 U/mL iTaq DNA
polymerase; 6 mM MgCl2; SYBR Green I; 20 mM fluorescein; and stabilizers) (BIO-RAD
Laboratories) and 250 nM gene specific and anti-sense primers in a final volume of 25 µL
for each well. The PCR was performed in 96-well plates, each sample was performed in
triplicate, and a no-template control was included for each amplificate. Standard curves
using a “calibrator” cDNA (chosen among the cDNA samples) were prepared for each
target and reference gene. In order to verify the specificity of the amplification, a melt-
curve analysis was performed, immediately after the amplification protocol. Non-specific
products of PCR were not found in any case. The relative quantification was made using
the Pfaff1 modification of the ∆∆CT equation (CT, cycle number at which the fluorescence
passes the threshold level of detection), taking into account the efficiencies of individual
genes. The results were normalized to β-actin, HPRT and GAPDH and the initial amount
of the template of each sample was determined as relative expression vs. one of the
samples chosen as reference (SH-SY5Y cells in optimal medium condition in Figure 15(a)
and SH-SY5Y cells in complete medium with 0.6% DMSO in Figure 16(b)) which is
considered the 1 x sample. The relative expression of each sample was calculated by the
formula 2-∆∆CT. ∆CT is a value obtained, for each sample, by the difference between the
Table 1: Primer sequence designed for the mRNA quantification
Chapter 4
67
mean CT value of the target gene and the mean CT value of the housekeeping gene/s. ∆∆CT
of one sample is the difference between its ∆CT value and CT value of the sample chosen
as reference (User Bulletin 2 of the ABI Prism 7700 Sequence Detection System).
Protein extraction and Western Blot anlaysis Total cells extracts were obtained by lysing cells in ice-cold RIPA lysis buffer (150
mM NaCl, 1% Nonidet P-40, 0,1% SDS, 50 mM Trizma Base and 100 µM PMSF) for 10
min, on ice, and using scrapper. The lysate was centrifuged at 13.000 g for 10 min, at 4°C,
and the supernatant was collected and stored at -80°C. Protein concentration in the lysate
was determined by the Bicinchoninic Acid Protein Assay (BCA) (43) following the
instructions reported by the supplier (B-9643, SIGMA).
Equal amounts of protein (35 µg) were subjected to sodium dodecyl sulphate-
poliacrilamide gel electrophoresis (SDS-PAGE). Molecular weight standards (10-250 kDa,
#SM1811 Fermentas) were used as marker proteins. 2.5% β-mercapoethanolo was added
to the samples then were immersed in a boiling water bath for 5 min and after this
immediately settled on ice. Proteins were loaded on 10% polyacrylamide gel by
electrophoresis in a Hoefer SE 250 System (Amersham Biosciences). After SDS-PAGE,
gels were electrotransferred with a semi-dry blotting system at 100 V for 60 min to a
immune-blot PVDF membranes (Bio-Rad).
Membranes were blocked for 1h at 4°C in 4% BSA (fatty acid free, fraction V) in
TTBS (0,2% Tween 20, 20 mM Tris-HCl (pH 7.5), 500 mM NaCl) and incubated
overnight at 4°C with a 1:3000 dilution of the commercial rabbit polyclonal antibody
(ab37185, abcam) against xCT. Then, membranes were washing three times with 5% BSA-
TTBS and were incubated for 60 min with a 1:2000 of anti rabbit IgG antibody conjugated
with peroxidase (P0448, Dako, Denmark). Normalization was performed by concomitant
determination of β-actin using the polyclonal anti-Actin antibody (A2066, Sigma
Chemical, St. Louis, MO). Protein bands were detected by peroxide reaction using ECL-
Plus Western Blot detection system solutions (ECL Plus Western Blot detection reagents,
GE-Healthcare BioSciences, Italy) and visualized by autoradiography with Hyperfilm
Sigma. The relative intensities of protein bands were analysed using the NIH Image
software (Scion Corporation Frederick, MD, USA).
Chapter 4
68
2.11 Statisticals analysis Results are expressed as mean ± SD of three assays per condition. Oneway ANOVA
with Tukey-Kramer post test was performed using GraphPad InStat version 3.00 (Graph-
Pad Software, San Diego, CA, USA). Probabilities, ≤ 0.05 were considered statistically
significant.
Chapter 4
69
3. Results 3.1 Sensitivity of SH-SY5Y cells to free bilirubin (Bf) To evaluate the sensitivity of SH-SY5Y to UCB (as we explained in Materials and
Methods); cells were exposed to a Bf of 10, 40, 70 and 140 nM for different times and cell
viability was assessed by MTT test (Figure 2).
The reduction of cell viability caused by UCB is concentration-dependent at short
time (1h) while the toxic effect reached a plateau after 4 hours. An interesting observation
was that the extent of reduction on cell viability never exceeded 40% of the cell population
even at high bilirubin concentration (Bf 140 nM) and after a long time of exposure (24
hours).
Based on this observation we decided to focus our attention on the surviving 60%
SH-SY5Y cells of the initial population. In the following studies we subjected the SH-
SY5Y to the “priming protocol” (140 nM Bf, 24 h - See Materials and Methods 2.4). and
several events were recorded.
0
20
40
60
80
100
120
0 1 2 4 6 24
Cellviability(%)
DMSO 0.6% Bf 10 nM Bf 40 nM Bf 70 nM Bf 140 nM
time of incubation (hours)
0
20
40
60
80
100
120
0 1 2 4 6 24
Cellviability(%)
DMSO 0.6% Bf 10 nM Bf 40 nM Bf 70 nM Bf 140 nM
time of incubation (hours)
§
* *
*
* * * *
* #
* * *
*
* *
*
*
#
§ §
Figure 2. Effect of UCB on cell viability: MTT test time course. SH-SY5Y cells were incubated with different concentrations of free UCB (Bf) for different times, and the viability was evaluated by MTT test. Time 0 correspond to 1 min of exposition with the respective UCB solutions, then cells were washed 3 times with PBS and tested for viability. Control cells were grown in EMEM/F12 with 0.6% DMSO for each time. * p<0.01 and # p<0.01 treated cells vs. control cells. § p<0.001 between treatments.
Chapter 4
70
3.2 ROS production in SH-SY5Y primed cells Figure 3 shows the ROS mediated fluorescence intensity into the cells, immediately
after priming (0 h) and when they were released in complete medium for 4 and 16 hours.
At time 0 h in SH-primed cells there was not significant change in ROS levels compared to
SH- non-primed cells. On the contrary ROS levels were significantly increased at 4 hours
upon the release, whereas the returned to basal levels 16 hours.
The intriguing results in ROS production shown in Figure 3 may be possible
explained by an alteration in cell proliferation/activity induced by UCB exposure followed
by release. To test this hypothesis we performed FACS analyses to evaluate ( through light
scatter parameters) the proliferation state of cell population in the culture. High forward
scatter is associated with large cell dimensions, linked to an active proliferation state. High
side scatter is instead associated to cell granulosity, possibly linked to apoptosis, whereas
low scatter parameters (side and forward) come obtained in presence of small, non
proliferating cells.
We confronted cell proliferation states of SH-SY5Y cells growing in EMEM/F12
(15% FCS, Figure 4a) with SH-SY5Y starved cells (Figure 4b, 4c) and SH-primed cells
(Figure 5).
time after priming (hours)
SH-primed SH-non primed
0 4 16
300
250
200
150
100
50
0 ROS mediated fluorescence (U.A.)
*
*
#
Figure 3. Dynamic of ROS levels after priming. SH-primed cells are SH-SY5Y cells subjected to the priming (Bf 140 nM, 24 h). SH-non primed cells are the control for priming (SH-SY5Y cells in optimal growth media with 0.6% DMSO, 24 h). ROS levels were measured (as DCF fluorescence) at the end of priming (0 h) and at 4 h and 16 h from release cells in complete media. Results were indicated as mean ± SD of three different experiments. *p<0.01 SH-primed cells vs. SH-non primed cells. # p<0.01 SH-primed cells 4 h vs. SH-primed cells 0 h and 16 h.
Chapter 4
71
Figure 4a shows the three populations with different morphology that we observed in
FACS analysis of SH-SY5Y cells in optimal growth conditions. As positive control SH-
SY5Y cells were deprived from serum. As you can see in fig. 4b, serum starvatiation
provokes an increase in the low forward parameter (low proliferation) as regards to middle
and high forward scatter parameters ( high proliferation) which was correlated to the
reduction in ROS levels (Figure 4c).
Figure 5 shows the cell morphology distribution at two different times after priming
in SH-SY5Y cells.
0
10
20
30
40
50
60
70
80
% of cellpopulation
High scatterMiddle scatterLow scatter
Cyclingtime of starvation (hours)
4 160
10
20
30
40
50
60
70
80
% of cellpopulation
High scatterMiddle scatterLow scatter
0
10
20
30
40
50
60
70
80
% of cellpopulation
High scatterHigh scatterMiddle scatterMiddle scatterLow scatterLow scatter
Cyclingtime of starvation (hours)
4 16
*
4 (b)
4 (a)
scatter scatter Middle scatter High
Low scatter
Middle scatter High
Low scatter
4 (c)
Figure 4. Cell morphology distribution and ROS mediated fluorescence were related to the proliferative state of SH-SY5Y cells. (a) FACS analysis of SH-SY5Y cells grown in EMEM/F12 with 15%FCS (Cycling = Control cells). Three populations with different light scatter parameters were detected and marked. (b) Cells were grown in serum free media for the indicated times and analyzed at FACS for cell morphology * p<0.001 Starved cells vs. control cells. (c) Cells were subjected to starvation and ROS levels were evaluated at the indicated times. Each bar represents the mean ± SD of three independent experiments. *p<0.01 Starved cells vs. Control cells.
Rosmediatedfluorescence(U.A.)
0
50
100
150
200
250
300
350
400
Cycling 4 16
time of starvation (hours)
Rosmediatedfluorescence(U.A.)
0
50
100
150
200
250
300
350
400
Cycling 4 16
time of starvation (hours)
*
*
Chapter 4
72
Upon release from UCB exposure there was a clear reduction in the low scattering
parameters at 4 hours indicating an increase in cell proliferation. However after 16 hours
both the middle and high scattering parameters were reduced and the low scattering
increased suggesting that the cell proliferation rate was reduced. These results are
consistent with the dynamic changes in ROS levels that we obtained (see Figure 3).
3.3 Intracellular total GSH level in SH-SY5Y primed cells To further assess the cellular redox state after priming, we decided to quantify the
content of glutathione: one of the most abundant intracellular thiols in the central nervous
system and therefore the major cellular antioxidant (11). We determined the total GSH
content (GSH + GSSG) using Griffith’s method (44), that is described in Materials and
Methods, after cells were subjected to the followings conditions:
a) SH-SY5Y cells grown in EMEM/F12 with 15%FCS for 24 h (Controls),
b) SH-SY5Y cells grown in EMEM/F12 (15% FCS) with 100 µM BSO (an inhibitor of
glutamylcysteine synthetase) for 24 h,
c) SH-SY5Y cells grown in EMEM/F12 (15% FCS) with 50 µM DEM for 24 h,
d) SH-SY5Y cells grown in EMEM/F12 (15% FCS) with 0.6% DMSO (Control of
priming),
e) SH-SY5Y cells grown in EMEM/F12 (15% FCS) with 140 nM Bf for 24 h (priming).
Figure 5. Morphological changes in SH-primed cells. Cells were subjected to priming and scatter parameters were evaluated by FACS immediately after priming and at 4 and 16 hours from release the cells in EMEM/F12 (15% FCS). High and middle scatter parameters are associated with active proliferation and low scatter parameter with non proliferating cells. Results were expressed as the mean ± SD of three different experiments. # p< 0.05 and * p< 0.001 Scatter parameter at each time of release vs. respective scatter parameter at 0 h.
0
20
40
60
80
100 High scatter Middle scatter Low scatter
Cycling 0
20
40
60
80
100
% of cell population
High scatter High scatter Middle scatter Middle scatter Low scatter Low scatter
0
time after priming (hours) 16 4
*
*
#
#
Chapter 4
73
At the end of each treatment, the cells were washed and released in complete media,
and the samples were collected 4 and 16 hours from the release. The glutathione extracted
from the cells was mostly GSH, and the content of GSSG was negligibly low in these
studies. As shown in Figure 6, control levels of total intracellular GSH in SH-SY5Y cells
decreased from 2.6 nmol/mg protein to 0.29 nmol/mg protein (p< 0.01) after 24 h of 100
µM BSO treatment and increased at 10 nmol/mg after 24 h of 50 µM DEM. Upon 16 h of
removal of BSO, GSH levels returned to the basal levels whereas both 4 and 16 h after
removal of DEM the cellular GSH levels higher than in controls. No changes in cell
viability in response to BSO or DEM treatment were detected. The changes induced by
BSO and DEM were in line with that described previously (45;46), (47) and served as internal
control.
As for the UCB SH-primed cells, the GSH cellular content increased by about 4
times at the three times in study (Figure 7). SH- non-primed cells showed GSH levels
similar to the control cells indicating that the exposured of SH cells to 140 nM Bf for 24 h
produced GSH changes similar to that observed after a treatment with DEM.
0
5
10
15
20
25
0 4 16
time after treatment (hours)
IntracellularGSH content(nmol/mg protein) Control 100 µM BSO 50 µM DEM
0
5
10
15
20
25
0 4 16
time after treatment (hours)
IntracellularGSH content(nmol/mg protein) ControlControl 100 µM BSO100 µM BSO 50 µM DEM50 µM DEM
Figure 6. GSH levels in SH-SY5Y cells after treatment with BSO or DEM. Cells were exposed for 24 hours to 100 µM BSO or 50 µM DEM and intracellular content of GSH was determined after treatment at 0, 4 or 16 hours from release the cells in EMEM/F12. GSH levels were quantified using the method of Griffith. Control: GSH levels in SH-SY5Y cells grown in EMEM/F12 (15% FCS). *p<0.01 with respect to untreated cells.
*
*
*
Chapter 4
74
3.4 Growth curve analysis in SH-SY5Y primed cells Figure 8 shows the variations with time in cell number for SH-SY5Y, SH- non-
primed and SH-primed cells at 37°C under 5% CO2 in EMEM/F12 (15% FCS). Cell
growth of SH-primed cells was blocked for at least 4 days after priming, whereas in both
controls wasn’t. SH-primed cells restarted their growth after 96 hours from the priming,
with the same slope that SH- non-primed and SH-SY5Y cells.
350
250
200
300
150
100
50
0
Cellnumber(x103)
0 24 48 72 96 120 144 168 192 216
time after priming (hours)
SH- primed cells
SH- non primed cells
SH-SY5Y cells350
250
200
300
150
100
50
0
350
250
200
300
150
100
50
0
Cellnumber(x103)
0 24 48 72 96 120 144 168 192 216 0 24 48 72 96 120 144 168 192 216
time after priming (hours)
SH- primed cells
SH- non primed cells
SH-SY5Y cells
SH- primed cellsSH- primed cells
SH- non primed cellsSH- non primed cells
SH-SY5Y cellsSH-SY5Y cells
Figure 8. Growth curve of SH-primed cells. SH-SY5Y cells were grown in complete medium. SH-primed cells are SH-SY5Y exposed to 140 nM Bf for 24 h and SH- non-primed cells were grown in complete medium with 0.6% DMSO (and were controls of the Bf treatment). The cells were seeded at a density of 2 x104 cells/cm2 in six-well dish and the amount of cells was monitored at different time points for 8 day after priming (Bf 140 nM, 24 h) by counting the number of cells by Burker camera.
time after priming (hours)
0
5
10
15
20
0 4 16
IntracellularGSH content(nmol/mg prot)
Control SH-non primed SH- primed
time after priming (hours)
0
5
10
15
20
0 4 16
IntracellularGSH content(nmol/mg prot)
time after priming (hours)
0
5
10
15
20
0 4 16
IntracellularGSH content(nmol/mg prot)
Control SH-non primed SH- primedControlControl SH-non primedSH-non primed SH- primedSH- primed
Figure 7. GSH levels in SH-primed cells. Cells were subjected to priming and intracellular content of GSH was determined immediately after priming and at 4 and 16 hours from release the cells in EMEM/F12. SH- non-primed are SH-SY5Y cells grown in complete medium with 0.6% DMSO. Control: GSH levels in SH-SY5Y cells grown in EMEM/F12 (15% FCS). *p<0.01 SH-primed cells vs. SH-non-primed and control cells.
* * #
Chapter 4
75
3.5 Response of SH-SY5Y primed cells to a second stress (Bf or H2O2) Since the exposition to some stressing agents can select a subset of resistant cells we
decided to evaluate the cell viability of SH-primed cells after re-exposing them to different
concentrations of Bf or H2O2. We performed these studies at two different times, ie. 48 h
after priming when SH-primed cells were in cell growth arrest and 156 h after priming
during active cell growth state (See Figure 8).
Figure 9 shows the cell viability by MTT test of SH-primed cells re-exposed to 40,
70, and 140 nM of Bf for different times, and these experiments 48 hours after priming
(resting). Results at 2, 4 and 6 h of re-exposition to free bilirubin show that SH-primed
cells were more resistant with about 20% higher viability than their respective controls, the
SH- non-primed cells (p<0.05).
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0
20
40
60
80
100
120
140
0 40 70 140
0
20
40
60
80
100
120
140
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primedSH-non primed SH- primedSH- primed
Cellviability(%)
Bf (nM)
(a)
Figure 9. Viability of SH-primed and
non-primed cells re-exposed at
different concentrations of Bf, 48 h
after priming.
Cells were incubated with 40, 70, and 140 nM Bf for (a) 2 h, (b) 4 h, and (c) 6 h. SH- non-primed cells are SH-SY5Y cells in optimal growth medium with 0.6% DMSO and they were the control for priming. *p<0.05 SH-primed cells vs. SH- non-primed cells. #p<0.01 SH- non-primed or primed cells treated vs. untreated cells.
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primedSH-non primed SH- primedSH- primed
Cellviability(%)
Bf (nM)
(c)
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primedSH-non primed SH- primedSH- primed
Cellviability(%)
Bf (nM)
(b)
*
*
#
*
#
*
Chapter 4
76
As regards to the exposition of SH-primed cells to increasing H2O2 concentrations 48
hours after priming, both SH-primed and non-primed cells showed a time- and
concentration-.dependent reduction on cell viability with H2O2 treatment. Viability started
reducing at 500 µM H2O2 (1h of treatment) in both SH-primed and non-primed cells.
Beyond this concentration, SH-primed cells showed about 20% higher viability than SH-
non-primed cells (Figure 10(a)). At 3 h of treatment with H2O2, viability was decreased at
concentrations as low as 100 µM of H2O2 in SH- non-primed and primed cells, but again
the last ones were more resistant (Figure 10(b)).
As shown in Figure 11, the same pattern of resistance to re-exposition to UCB was
observed in SH-primed cells 156 h after the priming was performed. At this point, SH-
primed cells were again in active proliferation state and they showed a higher viability than
SH- non-primed cells at all the Bf concentrations and times that were evaluated.
Cell viability (%)
0
20
40
60
80
100
120
140
0
100
200
300
400
450
500
550
600
700
1000
SH-non primed SH- primed
H2O2 (µM)
0
20
40
60
80
100
120
140
0
100
200
300
400
450
500
550
600
700
1000
SH-non primed SH- primed
H2O2 (µM)
(a)
* *
# #
#
Figure 10. Viability of SH-primed and non-primed cells exposed at different concentrations of H2O2. 48 h after priming cells were incubated with H2O2 (range: 0 - 1 mM) for (a) 1 h, (b) 3 h. Viability was assayed by MTT test. * The lowest H2O2 concentration that produce a significant viability decrease in SH- primed and SH- non-primed cells (p<0.01). #1p<0.05 and #p<0.01 SH-primed cells vs. SH- non-primed cells.
H2O2 (µM)
0
20
40
60
80
100
120
140
0
100
150
200
300
400
450
500
600
700
1000
SH-non primed SH- primed
Cellviability(%)
H2O2 (µM)
0
20
40
60
80
100
120
140
0
100
150
200
300
400
450
500
600
700
1000
SH-non primed SH- primed
Cellviability(%)
0
20
40
60
80
100
120
140
0
100
150
200
300
400
450
500
600
700
1000
SH-non primed SH- primed
Cellviability(%)
*
* #1
# # #
(b)
Chapter 4
77
When SH-primed and non-primed cells were exposed to increasing H2O2
concentrations (range: 0-1 mM) for 1 or 3 hours we did not find any difference in the
response at the treatment between SH-primed and non-primed cells. SH-primed, now in
active growth, showed the same loss in viability as the SH- non-primed cells, at each time
and concentration of H2O2 (Figure 12 (a) and (b)).
Figure 11. Viability of SH-primed and
non-primed cells re-exposed at different
concentrations of Bf, 156 h after
priming.
Cells were incubated with 40, 70, and 140 nM Bf for (a) 2 h, (b) 4 h, and (c) 6 h. SH- non-primed cells are SH-SY5Y cells in optimal growth medium with 0.6% DMSO and they were the control for priming. *p<0.05 SH-primed cells vs. SH- non-primed cells. #p<0.01 SH- non-primed or primed cells treated vs. untreated cells.
0
20
40
60
80
100
120
140
160
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0
20
40
60
80
100
120
140
160
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0 40 70 1400 40 70 140
SH-non primedSH-non primed SH- primedSH- primed
Cellviability(%)
Bf (nM)
(c)
* *
*
#
#
#
#
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0
20
40
60
80
100
120
140
0 40 70 1400 40 70 140
SH-non primedSH-non primed SH- primedSH- primed
Cellviability(%)
Bf (nM)
(b)
#
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primed SH- primed
Cellviability(%)
Bf (nM)
0
20
40
60
80
100
120
140
0 40 70 140
SH-non primedSH-non primed SH- primedSH- primed
Cellviability(%)
Bf (nM)
(a)
*
*
# #
* #
Chapter 4
78
Collectively there data suggest that UCB exposure elicits a long lasting adaptive
response to bilirubin and other oxidative agents as hydrogen peroxide. To unravel the
molecular events that are elicited by UCB and generate an adaptive response, we
performed the gene array experiments.
3.6 Gene expression profiling induced by UCB SH-SY5Y cells were exposed to a toxic concentration of Bf (140 nM) and total RNA
was collected at 1, 4 and 24 hours after treatment, to make gene array studies, as we
previously described in Materials and Methods. No significant change of expression was
observed after one hour of treatment. After 4 hours the only gene significantly and
consistently regulated appeared to be: MARCH6: membrane associated ring finger
(C3HC4). After 24 hours of treatment, 22 genes appeared to be up-regulated and 3 down-
reguletad. Table 2 shows the list of genes that are consistently up-regulated in two
independent time courses including only genes with >2 fold change, with a median False
Discovery rate of 0.02 and with a difference of probe intensity > 100 in both experiments.
Their average differences of expression in the two biological replicates are shown on the
last column in the right.
0
20
40
60
80
100
120
0
100
150
200
250
300
400
500
600
700
1000
SH-non primed SH-primed
H2O2 (µM)
Cellviability(%)
0
20
40
60
80
100
120
0
100
150
200
250
300
400
500
600
700
1000
SH-non primed SH-primed
H2O2 (µM)
Cellviability(%) *
*
# #1
(b)
Figure 12. Viability of SH-primed and non-primed cells exposed at different concentrations of H2O2. 156 h after priming cells were incubated with H2O2 (range: 0 - 1 mM) for (a) 1 h, (b) 3 h. Viability was assayed by MTT test. * The lowest H2O2 concentration that produce a significant viability decrease in SH- primed and SH- non-primed cells (p<0.01). #1p<0.05 and #p<0.001 SH-primed cells vs. SH- non-primed cells.
0
20
40
60
80
100
120
0
100
200
300
400
450
500
550
600
700
1000
SH-non primed SH-primed
H2O2 (µM)
Cellviability(%)
0
20
40
60
80
100
120
0
100
200
300
400
450
500
550
600
700
1000
SH-non primed SH-primed
H2O2 (µM)
Cellviability(%) *
*
(a)
Chapter 4
79
Gene Accession Fold
DDIT3: DNA-damage inducible transcript 3 BC003637 24.6
SLC7A11: solute carrier family 7 (cationic amino acid transporter, y+ system) member 11 AB040875 18.3
FAM129A: family with sequence similarly 129, member A AF288391 16.6
PTGS1: prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase,
cyclooxygenase) S36219 11.9
GDF15: growth differentiation factor 15 BC000529 10.3
ATF3: activating transcription factor 3 NM_001674 8.5
SLC3A2: solute carrier family 3 (activators of dibasic and neutral amino acid transport),
member 2 NM_02394 7.1
TRIB3: tribbles homolog 3 NM_021158 7.2
DNAJB9: DnaJ (Hsp40) homolog, subfamily B, member 9 NM_012328 6.9
CHAC1: ChacC, cation transport regulator homolog 1(E. Coli) NM_0241111 6.9
CEBPB: CCAAT/enhancer binding protein (C/EBP), beta AL564683 6.6
PPP1R15A: protein phosphatase 1, regulatory (inhibitor) protein subunit 15A NM_014330 4.24
STC2: stanniocalcin 2 AI435828 4.85
JUN: jun oncogene BC002646 4.6
HERPUD1: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin like
domain member AF21790 4
DDIT4: DNA-damage inducible transcript 4 NM_019058 4.5
WIPI1: WD repeat domain, phosphoinositide interacting 1 NM_017983 3.7
IFRD1: interferon-related developmental regulator 1 AA747426 3.0
ITPKB: inositol 1,4,5-trisphosphate-3-kinase B NM_02221 3.4
FAT: FAT tumor suppressor homolog 1 (Drosophila) NM_05245 2.9
ABCG1: ATP binding cassette subfamily G (WHITE) member 1 NM_004915 2.4
SFRP1: secreted frizzled related-protein 1 AF017987 -2.8
LUM: lumican NM_002345 -2.8
ASCL1: achaete-scutex complex homolog 1 (Drosophila) BC001638 -14.4
Considering all the genes that were consistently modified by UCB treatment, we
decided to divide them in two major categories:
UCB strongly induces the genes that encoding for both subunits of the transport system
X(C)(−).
Table 2 Genes induced in SH-SY5Y cells upon 24 hours of 140 nM Bf treatment
Chapter 4
80
SLC7A11: solute carrier family 7, (cationic amino acid transporter, y+ system) member
11; SLC3A2: solute carrier family 3 (activators of dibasic and neutral amino acid
transport), member 2. SLC7A11 (xCT) together with SLC3A2 (4F2hc) encodes for the
heterodimeric amino acid transport system xc-, which mediates cystine-glutamate
exchange and thereby regulates intracellular glutathione levels.
UCB induces many genes involved in Endoplasmic Reticulum(ER)-stress response.
Many genes induced by UCB are active participants of the cellular ER stress
response. In Table 2 (shown in bold letters).
1. DDIT3: DNA-damage-inducible transcript 3 is the strongest UCB up-regulated gene,
also known as CHOP or growth arrest− and DNA damage inducible gene 153
(GAD153). It was first identified as a member of the CCAAT/enhancer binding
proteins (C/EBPs) that serves as dominant negative inhibitor of C/EBPs. It is
considered as a marker of ER stress and one of the major components of the ER stress-
mediated apoptosis.
2. FAM129A: family with sequence similarity 129, member A is also known as Niban.
This gene has been recently identified as a component of the ER stress response.
3. ATF3: activating transcription factor 3 is a member of the mammalian activation
transcription factor/cAMP responsive element-binding (CREB) protein family of
transcription factors. Its transcription is induced by eIF2 phosphorylation and ATF4
activation during ER stress. ATF3 is an important component in the regulation of
genes involved in metabolism, the redox status of the cells and apoptosis. Loss of
ATF3 function significantly lowers stress-induced expression of DDIT3/CHOP.
4. TRIB3: tribbles homolog 3 is strongly up-regulated by endoplasmic reticulum (ER)
stress-inducing agents. TRIB3 and ATF4 belong to the same protein complex bound to
the sequence involved in the ATF4-dependent regulation of gene expression by ER
stress.
5. DNAJB9: DnaJ (Hsp40) homolog, subfamily B, member 9 is also known as
endoplasmic reticulum DnaJ homolog 4 and Microvascular endothelial differentiation
gene 1 (MDG1). It has been shown to be induced by ER stress in a XBP−1−dependent
manner. It is an ER resident protein. Its over-expression inhibited cell death induced
by ER stress.
Chapter 4
81
6. PPP1R15A: protein phosphatase 1, regulatory (inhibitor) subunit 15A is also known
as GADD34, a crucial component of the ER stress response. It is a target of ATF4
activation while negatively regulates the eIF2alpha-mediated inhibition of translation.
7. JUN: jun oncogene plays a fondamental role in ER-stress response. Activation of the
JNK pathways is one of the major apoptotic mechanisms of ER stress-induced cell
death.
8. STC2: stanniocalcin 2 is rapidly up-regulated in cultured cells by ATF4 after
activation of the ER-resident kinase PERK after exposure to tunicamycin and
thapsigargin, ER stressors. siRNA-mediated inhibition of STC2 expression renders
N2a neuroblastoma cells and HeLa cells significantly more vulnerable to apoptotic cell
death induced by ER stress. Overexpression of STC2 attenuated cell death.
9. HERPUD1: homocysteine-inducible, endoplasmic reticulum stress-inducible,
ubiquitin-like domain member 1 may play a role in both UPR and ERAD. Its
expression is induced by ER stress and it encodes a protein with an N-terminal
ubiquitin-like domain which interact with the ERAD system.
Interestingly, MARCH6: membrane-associated ring finger (C3HC4) 6 is the only gene
induced upon 4 hours of UCB treatment and is an ER (endoplasmic reticulum)-resident
ubiquitin ligase. Information about these genes and their expression products is
available on the website: www.expasy.org/uniprot.
To verify the Affymetrix results, we validated by RT- real time PCR the change of
expression for SLC7A11 gene (one of the most up-regulated genes after the priming of
UCB).
3.7 Validation of microarray results by Real time RT-PCR for SLC7A11 gene and Western Blot for its expression product (xCT)
We performed two sets of experiments in order to confirm the up-regulation of the
expression for the gene SLC7A11. In the first experiment we exposed SH-SY5Y cells to a
140 nM Bf for 1, 4 and 24 h. Results of RT- real time PCR confirmed the up-regulation of
the expression for SLC7A11 at 24 h of treatment (Figure 13 (a)). We obtained an increase
of about 11 fold of SLC7A11 expression in comparison to the control (SH-SY5Y cells
grown in complete medium with 0.6% DMSO).
Chapter 4
82
However, is spite of the clear upregulation in the gene When we studied the changes
at protein level at each time of treatment, we did not obtain any significant difference
between controls and treated cells (Figure 13 (b)).
Given the results of the previousa experiments, we decided to subject SH-SY5Y cells
at 24 hours of Bf 140 nM (priming) and we assessed mRNA expression and protein
expression upon 8 and 24 h of release cells in complete medium. Figure 14(a) shows RT-
real time PCR results for SLC7A11 mRNA expression at 8 and 24 h upon release. In SH-
SH5Y exposed to bilirubin, the RNA expression level upon 8 h of release remained higher
than in control cells and they returned to basal levels at 24 h after priming.
Figure 14(b) shows protein expression results for xCT; again, we didn’t find any
significant difference of xCT expression between SH-primed cells and control cells, upon
8 or 24 h of release the cells in complete medium.
0
2
4
6
8
10
12
Control 1 4 24
time of treatment (hours)
SLC7A11 mRNA
Relative expression
Bf 140 nMDMSO 0.6%
0
2
4
6
8
10
12
Control 1 4 24
time of treatment (hours)
SLC7A11 mRNA
Relative expression
0
2
4
6
8
10
12
Control 1 4 24
time of treatment (hours)
SLC7A11 mRNA
Relative expression
Bf 140 nMBf 140 nMDMSO 0.6%DMSO 0.6%
(a)
xCTprotein
Relative expression
1 4 24
time of treatment (hours)
xCT
actin
1h 4h 24hC
1.5
1.3
1.0
0.8
0.5
0.3
0.0
xCTprotein
Relative expression
1 4 24
time of treatment (hours)
xCT
actin
1h 4h 24hC
1.5
1.3
1.0
0.8
0.5
0.3
0.0
1.5
1.3
1.0
0.8
0.5
0.3
0.0
(b)
Figure 13. Time course of the relative gene and protein expression for SLC7A11 in SH-SY5Y cells exposed to free bilirubin. (a) Relative SLC7A11 mRNA expression in SH-SY5Y cells after 1, 4 and 24 h of treatment with Bf 140 nM. SH-SY5Y cells treated with 0.6% DMSO were used as controls at each Bf treatement. Results were expressed taking as reference SH-SY5Y cells grown in complete medium for 1h (Control). RT-real time PCR was performed by normalizing SLC7A11 expression values to housekeeping genes HPRT, GAPDH and β-actin. (b) Western Blot analysis of xCT and actin proteins in the same treatments as in (a). Bands were visualized by Kodak 1D image software and quantified by Scion Image software. Each bar represents the means ± S.D. of three separate experiments.
Chapter 4
83
0
1
2
3
4
5
6
8 24
time after treatment (hours)
SLC7A11 mRNA
Relative expression
Bf 140 nMDMSO 0.6%
0
1
2
3
4
5
6
8 24
time after treatment (hours)
SLC7A11 mRNA
Relative expression
0
1
2
3
4
5
6
8 24
time after treatment (hours)
SLC7A11 mRNA
Relative expression
Bf 140 nMBf 140 nMDMSO 0.6%DMSO 0.6%
(a)
DMSO 0.6% Bf 140 nM
time after treatment (hours)
8 24
xCTprotein
Relative expression
xCT
actin
8h 24h
1.2
1.0
0.8
0.6
0.4
0.2
0.0
DMSO 0.6%DMSO 0.6% Bf 140 nMBf 140 nM
time after treatment (hours)
8 24
xCTprotein
Relative expression
xCT
actinactin
8h 24h
1.2
1.0
0.8
0.6
0.4
0.2
0.0
(b)
Figure 14. Time course of the relative gene and protein expression for SLC7A11 in SH-SY5Y cells exposed to priming. (a) SY5Y cells were subjected to priming (140 nM Bf, 24 h) and relative SLC7A11 mRNA expression upon 8 and 24 h of release in complete medium was quantified. SH-SY5Y cells treated 24 h with 0.6% DMSO and released at 8 and 24 h were considered as controls. RT-real time PCR was performed by normalizing SLC7A11 expression values to housekeeping genes HPRT, GAPDH and β-actin. (b) Western Blot analysis of xCT and actin proteins was performed at the same experimental conditions as in (a). Bands were visualized by Kodak 1D image software and quantified by Scion Image software. Each bar represents the means ± S.D. of three separate experiments.
Chapter 4
84
4. Discussion
The present study was undertaken to characterize the neuronal cell line SH-SY5Y for
the study of the molecular events associated to bilirubin neurotoxicity and understand the
changes at biochemical and molecular level that bilirubin induce to generate toxicity.
In the cell viability study, the Bf concentrations were chosen according with the
present accepted concept that establishes a threshold for bilirubin toxicity at 70 nM
approximately (48). We observed a rather high susceptibility of this cell line to bilirubin
toxicity (73±8 % at a Bf of 40 nM after 1h). Ours results agree with the studies of Silva et.
al. (49) that demonstrate deleterious effects on mitochondrial function at 85 nM (50).
However in this study direct Bf measurement was not performed and comparative results
becomes very difficult.
Of great interest is the fact that SH-SY5Y cells after 24 hours of 140 nM Bf showed a
reduction of 40% in viability, and this effect was already obtained with only 2 h of
exposition. One possible explanation of these results includes the possibility that one of the
two cell populations that are present could be more susceptible to UCB damage and/or to
the activation of an adaptive mechanism of the cell to damage which will render the
surviving cells insensitive the UCB toxicity.
Considering the hypothesis that Bf somehow “primes” a cell population, either
modifying the entire SH-SY5Y pool, or selecting, among the different cell pools, a
resistant subset, we concentrated our attention to the 60% of cells that remain alive after 24
h of treatment with 140 nM Bf, the SH- primed cells. SH- primed cells showed an
increased ROS levels 4 hours upon the removal of UCB followed by a decrease at 16
hours. This behavior could be associated to an increase of non proliferating cells at 16
hours. This is in live with the observation that non proliferating cells have a lower
metabolic activity and therefore a reduced production of ROS that are generated mainly by
the mitochondrial electron transport chain (51). On the contrary, SH-primed cells 4 h after
release in complete medium showed an increase in both proliferating cells and ROS level.
Possibly the gap between ROS increase and Bf treatment could be due to process than
internalization and trafficking of bilirubin or to a response when the insult come removed.
When we studied the total intracellular glutathione content in SH-primed cells, we
observed an increase of cellular GSH concomitant with and increased ROS level: The
increased GSH levels remained high event 16 hours upon release when the ROS level
decreased suggesting that the two events were not fully linked. We have no explanation to
Chapter 4
85
this conflicting results and additional work is needed to understand the mechanism(s)
behind what we observed.
The involvement of oxidative stress in bilirubin cytotoxicity is far from being clear.
Despite the protective antioxidant role proposed for bilirubin (52); (53); (54), (55), (56), studies
performed by Grojean et al. (57) failed to confirm that role, while others point to an
oxidative effect of the pigment. Actually, disruption of the redox status, with increased lipid
peroxidation and intracellular ROS production, was reported in different models (58), (59), (60),
(61), (62). These apparently contradictory effects were reconciled by the study of Doré et al. (63) which demonstrated that bilirubin at concentrations as low as 10 nM protects neurons
from H2O2-induced toxicity, whereas above that threshold neuroprotection decreases. Thus,
the underlying reason for the imbalance between the antioxidant mechanisms and the
prooxidant damaging effect of bilirubin, although deserving further exploration.
Our results of growth curve together with the increase of non proliferating cells
(FACS analysis) in SH- primed cells demonstrated that Bf cause a long term reduction in
the proliferation rate of the cells, and are in line with the previous studies of Notter et al. (64)
that observed over 3 days of growth inhibition in a neuroblastoma cell line. More recently,
bilirubin was demonstrated to inhibit the proliferation of vascular smooth muscle cells,
arresting cell cycle progression at the G1 phase (65).
The experiments of re-exposition to bilirubin at two different times after the priming,
(48 hours after priming when cells were in growth arrest and 156 hours after priming when
the cells restart the proliferation) show that cells previously exposed to the Bf (priming) are
less sensitive to the damage in comparison with SH-non primed cells. These results agree
with the hypothesis that a pool of cell to the SH-SY5Y population seems to be resistant to
bilirubin damage and will be favored to proliferate. In fact, we observed the same resistant
effect after 156 hours from the removal of the stimulus.
If the correct explanation was that the priming triggers an adaptive response,
therefore it would be expected that 156 hours after the removal of the stimulus the cells
returned to be sensitive to bilirubin damage. This was not the case in the experiments with
H2O2. Cells growth arrest (48 hours after the priming) were less sensitive to oxidative
damage than the respective controls. At the contrary, cells in active proliferation (156
hours after the priming) were sensitive to H2O2 stress at same extent than controls.
It seems therefore that besides the selection of a resistant cellular pool, the priming
also induces molecular mechanism to respond to oxidative stress, but these will be lost
when cells come back to an active proliferation state.
Chapter 4
86
Regarding the molecular mechanisms that play role in bilirubin response, we have
observed that many genes involved in response to ER stress and two genes implicated in
the regulation of intracellular glutathione levels are strongly induced after UCB treatment.
As explained in the Introduction of this chapter, the cystine/glutamate antiporter system Xc¯
is composed of two subunits: xCT (substrate specificity) encoding by SLC7A11gene and
4F2hc encoding by SLC3A2, two genes that we demonstrated strongly up-regulated by
UCB. Interesting and in line with this reasoning is the observation that the exposure for 24
h to bilirubin or DEM treatment induce the increase of total gluthathione content and both
of them are related with the up-regulation of xCT. In a study of Sasaki et al (66) it was
demonstrated that cells treated with stress agents such as sodium arsenite, CdCl2,
hydroquinone and DEM increased cysteine uptake and concomitant intracellular GSH
content. DEM effects were caused by the induction of the activity of system Xc¯ and the
induction of γ-GCS. Also they showed that the induction of xCT mRNA by DEM is
mediated by electrophile response element located in the 5’-flanking region of SLC7A11
gene and than the transcription factor Nrf2 binds to this element activating SLC7A11 gene
transcription.
Recently Sato et al. showed that ATF4 is involved in the basal and inducible
expression of xCT in response to cystine starvation with an amino acid-response element
within the proximal SLC7A11 gene promoter region (67). On the other hand, ATF4 is a
mediator for modulating the transcription of the other AARE-mediated genes like CHOP,
asparagines synthethase and cationic amino acid transporter-1(68), (69), (70). Recently
Lewerenz. demonstrated that PC12 selected for resistance against amyloid β1-42 peptide
(Aβ), a key factor in the pathogenesis of Alzheimer’s disease increased activity of the
phospho-eIF2α/ATF4/xCT module contributes to the resistant phenotype. There is good
evidence that eIF2α phosphorylation can modulate the resistance of nerve cells to oxidative
stress with an ability to maintain a high glutathione (GSH) concentration in the presence
oxidative stress (71).
In this study, we observed by gene arrays experiments that in SH-SY5Y cells
subjected to priming (140 nM Bf, 24 h), CHOP (DDIT3), ATF4, ATF3, FAM129A and
others markers of ER stress were induced for the treatment. Thus, in line with the
previously mentioned data it could be possible that the up-regulation of the genes involved
in ER stress and SLC7A11 gene contributes to the resistance of SH- primed cells at a
second UCB exposition and to overcomes the growth inhibition. Further studies are
necessary to confirm and understand how bilirubin stress produces changes to the cell
Chapter 4
87
proteome and how this can originate an adaptation to stress or initiation of programmed cell
death.
The elucidation of these mechanisms will provide a basis for the increased
susceptibility of neuronal cells and specially the Purkinje cells and a further insight into the
pathogenesis of UCB-induced neurotoxicity, offering a starting point for the development
of new therapeutic interventions.
5. References 1. Gourley, G. R. (1997) Bilirubin metabolism and kernicterus, Adv. Pediatr. 44, 173-
229.
2. Ostrow, J. D., Pascolo, L., Shapiro, S. M., and Tiribelli, C. (2003) New concepts in bilirubin encephalopathy, Eur. J. Clin. Invest 33, 988-997.
3. Ahlfors, C. E. (2001) Bilirubin-albumin binding and free bilirubin, J. Perinatol. 21 Suppl 1, S40-S42.
4. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 98-104.
5. Hanko, E., Hansen, T. W., Almaas, R., Lindstad, J., and Rootwelt, T. (2005) Bilirubin induces apoptosis and necrosis in human NT2-N neurons, Pediatr. Res. 57, 179-184.
6. Rodrigues, C. M., Sola, S., Castro, R. E., Laires, P. A., Brites, D., and Moura, J. J. (2002) Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis, J. Lipid Res. 43, 885-894.
7. Hanko, E., Hansen, T. W., Almaas, R., Paulsen, R., and Rootwelt, T. (2006) Synergistic protection of a general caspase inhibitor and MK-801 in bilirubin-induced cell death in human NT2-N neurons, Pediatr. Res. 59, 72-77.
8. Rodrigues, C. M., Sola, S., Brito, M. A., Brites, D., and Moura, J. J. (2002) Bilirubin directly disrupts membrane lipid polarity and fluidity, protein order, and redox status in rat mitochondria, J. Hepatol. 36, 335-341.
9. Oakes, G. H. and Bend, J. R. (2005) Early steps in bilirubin-mediated apoptosis in murine hepatoma (Hepa 1c1c7) cells are characterized by aryl hydrocarbon receptor-independent oxidative stress and activation of the mitochondrial pathway, J. Biochem. Mol. Toxicol. 19, 244-255.
Chapter 4
88
10. Cesaratto, L., Calligaris, S. D., Vascotto, C., Deganuto, M., Bellarosa, C., Quadrifoglio, F., Ostrow, J. D., Tiribelli, C., and Tell, G. (2007) Bilirubin-induced cell toxicity involves PTEN activation through an APE1/Ref-1-dependent pathway, J. Mol. Med. 85, 1099-1112.
11. Meister, A. and Anderson, M. E. (1983) Glutathione, Annu. Rev. Biochem. 52, 711-760.
12. Mizui, T., Kinouchi, H., and Chan, P. H. (1992) Depletion of brain glutathione by buthionine sulfoximine enhances cerebral ischemic injury in rats, Am. J. Physiol 262, H313-H317.
13. Bobyn, P. J., Franklin, J. L., Wall, C. M., Thornhill, J. A., Juurlink, B. H., and Paterson, P. G. (2002) The effects of dietary sulfur amino acid deficiency on rat brain glutathione concentration and neural damage in global hemispheric hypoxia-ischemia, Nutr. Neurosci. 5, 407-416.
14. Miura, K., Ishii, T., Sugita, Y., and Bannai, S. (1992) Cystine uptake and glutathione level in endothelial cells exposed to oxidative stress, Am. J. Physiol 262, C50-C58.
15. Sagara, J., Miura, K., and Bannai, S. (1993) Cystine uptake and glutathione level in fetal brain cells in primary culture and in suspension, J. Neurochem. 61, 1667-1671.
16. Murphy, T. H., Schnaar, R. L., and Coyle, J. T. (1990) Immature cortical neurons are uniquely sensitive to glutamate toxicity by inhibition of cystine uptake, FASEB J. 4, 1624-1633.
17. Li, Y., Maher, P., and Schubert, D. (1997) Requirement for cGMP in nerve cell death caused by glutathione depletion, J. Cell Biol. 139, 1317-1324.
18. Chung, W. J., Lyons, S. A., Nelson, G. M., Hamza, H., Gladson, C. L., Gillespie, G. Y., and Sontheimer, H. (2005) Inhibition of cystine uptake disrupts the growth of primary brain tumors, J. Neurosci. 25, 7101-7110.
19. Sato, H., Tamba, M., Ishii, T., and Bannai, S. (1999) Cloning and expression of a plasma membrane cystine/glutamate exchange transporter composed of two distinct proteins, J. Biol. Chem. 274, 11455-11458.
20. Mastroberardino, L., Spindler, B., Pfeiffer, R., Skelly, P. J., Loffing, J., Shoemaker, C. B., and Verrey, F. (1998) Amino-acid transport by heterodimers of 4F2hc/CD98 and members of a permease family, Nature 395, 288-291.
21. Bannai, S. (1984) Induction of cystine and glutamate transport activity in human fibroblasts by diethyl maleate and other electrophilic agents, J. Biol. Chem. 259, 2435-2440.
22. Bannai, S., Sato, H., Ishii, T., and Sugita, Y. (1989) Induction of cystine transport activity in human fibroblasts by oxygen, J. Biol. Chem. 264, 18480-18484.
23. Sato, H., Fujiwara, K., Sagara, J., and Bannai, S. (1995) Induction of cystine transport activity in mouse peritoneal macrophages by bacterial lipopolysaccharide, Biochem. J. 310 ( Pt 2), 547-551.
Chapter 4
89
24. Sato, H., Nomura, S., Maebara, K., Sato, K., Tamba, M., and Bannai, S. (2004) Transcriptional control of cystine/glutamate transporter gene by amino acid deprivation, Biochem. Biophys. Res. Commun. 325, 109-116.
25. Bannai, S. (1984) Induction of cystine and glutamate transport activity in human fibroblasts by diethyl maleate and other electrophilic agents, J. Biol. Chem. 259, 2435-2440.
26. Warr, O., Takahashi, M., and Attwell, D. (1999) Modulation of extracellular glutamate concentration in rat brain slices by cystine-glutamate exchange, J. Physiol 514 ( Pt 3), 783-793.
27. Grojean, S., Koziel, V., Vert, P., and Daval, J. L. (2000) Bilirubin induces apoptosis via activation of NMDA receptors in developing rat brain neurons, Exp. Neurol. 166, 334-341.
28. Hoffman, D. J., Zanelli, S. A., Kubin, J., Mishra, O. P., and ivoria-Papadopoulos, M. (1996) The in vivo effect of bilirubin on the N-methyl-D-aspartate receptor/ion channel complex in the brains of newborn piglets, Pediatr. Res. 40, 804-808.
29. Silva, R., Mata, L. R., Gulbenkian, S., Brito, M. A., Tiribelli, C., and Brites, D. (1999) Inhibition of glutamate uptake by unconjugated bilirubin in cultured cortical rat astrocytes: role of concentration and pH, Biochem. Biophys. Res. Commun. 265, 67-72.
30. McDonald, J. W. and Johnston, M. V. (1990) Physiological and pathophysiological roles of excitatory amino acids during central nervous system development, Brain Res. Brain Res. Rev. 15, 41-70.
31. Sarna, J. R. and Hawkes, R. (2003) Patterned Purkinje cell death in the cerebellum, Prog. Neurobiol. 70, 473-507.
32. Biedler, J. L., Helson, L., and Spengler, B. A. (1973) Morphology and growth, tumorigenicity, and cytogenetics of human neuroblastoma cells in continuous culture, Cancer Res. 33, 2643-2652.
33. Ross, R. A., Spengler, B. A., and Biedler, J. L. (1983) Coordinate morphological and biochemical interconversion of human neuroblastoma cells, J. Natl. Cancer Inst. 71, 741-747.
34. Ridge, J., Terle, D. A., Dragunsky, E., and Levenbook, I. (1996) Effects of gamma-IFN and NGF on subpopulations in a human neuroblastoma cell line: flow cytometric and morphological analysis, In Vitro Cell Dev. Biol. Anim 32, 238-248.
35. Encinas, M., Iglesias, M., Liu, Y., Wang, H., Muhaisen, A., Cena, V., Gallego, C., and Comella, J. X. (2000) Sequential treatment of SH-SY5Y cells with retinoic acid and brain-derived neurotrophic factor gives rise to fully differentiated, neurotrophic factor-dependent, human neuron-like cells, J. Neurochem. 75, 991-1003.
36. Ostrow, J. D. and Mukerjee, P. (2007) Solvent partition of 14C-unconjugated bilirubin to remove labeled polar contaminants, Transl. Res. 149, 37-45.
Chapter 4
90
37. Roca, L., Calligaris, S., Wennberg, R. P., Ahlfors, C. E., Malik, S. G., Ostrow, J. D., and Tiribelli, C. (2006) Factors affecting the binding of bilirubin to serum albumins: validation and application of the peroxidase method, Pediatr. Res. 60, 724-728.
38. Denizot, F. and Lang, R. (1986) Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability, J. Immunol. Methods 89, 271-277.
39. Frenkel, K. and Gleichauf, C. (1991) Hydrogen peroxide formation by cells treated with a tumor promoter, Free Radic. Res. Commun. 12-13 Pt 2, 783-794.
40. Dringen, R. (2000) Metabolism and functions of glutathione in brain, Prog. Neurobiol. 62, 649-671.
41. Griffith, O. W. (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine, Anal. Biochem. 106, 207-212.
42. Tietze, F. (1969) Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues, Anal. Biochem. 27, 502-522.
43. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Measurement of protein using bicinchoninic acid, Anal. Biochem. 150, 76-85.
44. Griffith, O. W. (1980) Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpyridine, Anal. Biochem. 106, 207-212.
45. Meister, A. (1983) Selective modification of glutathione metabolism, Science 220, 472-477.
46. Meister, A. (1992) Depletion of glutathione in normal and malignant human cells in vivo by L-buthionine sulfoximine: possible interaction with ascorbate, J. Natl. Cancer Inst. 84, 1601-1602.
47. Sasaki, H., Sato, H., Kuriyama-Matsumura, K., Sato, K., Maebara, K., Wang, H., Tamba, M., Itoh, K., Yamamoto, M., and Bannai, S. (2002) Electrophile response element-mediated induction of the cystine/glutamate exchange transporter gene expression, J. Biol. Chem. 277, 44765-44771.
48. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 98-104.
49. Silva, R. F., Rodrigues, C. M., and Brites, D. (2001) Bilirubin-induced apoptosis in cultured rat neural cells is aggravated by chenodeoxycholic acid but prevented by ursodeoxycholic acid, J. Hepatol. 34, 402-408.
50. Ostrow, J. D., Pascolo, L., and Tiribelli, C. (2003) Reassessment of the unbound concentrations of unconjugated bilirubin in relation to neurotoxicity in vitro, Pediatr. Res. 54, 98-104.
Chapter 4
91
51. Tan, S., Sagara, Y., Liu, Y., Maher, P., and Schubert, D. (1998) The regulation of reactive oxygen species production during programmed cell death, J. Cell Biol. 141, 1423-1432.
52. Clark, J. E., Foresti, R., Green, C. J., and Motterlini, R. (2000) Dynamics of haem oxygenase-1 expression and bilirubin production in cellular protection against oxidative stress, Biochem. J. 348 Pt 3, 615-619.
53. Liu, Y., Zhu, B., Wang, X., Luo, L., Li, P., Paty, D. W., and Cynader, M. S. (2003) Bilirubin as a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications for the role of oxidative stress in the development of multiple sclerosis, J. Neuroimmunol. 139, 27-35.
54. Stocker, R., Yamamoto, Y., McDonagh, A. F., Glazer, A. N., and Ames, B. N. (1987) Bilirubin is an antioxidant of possible physiological importance, Science 235, 1043-1046.
55. Wiedemann, M., Kontush, A., Finckh, B., Hellwege, H. H., and Kohlschutter, A. (2003) Neonatal blood plasma is less susceptible to oxidation than adult plasma owing to its higher content of bilirubin and lower content of oxidizable Fatty acids, Pediatr. Res. 53, 843-849.
56. Baranano, D. E., Rao, M., Ferris, C. D., and Snyder, S. H. (2002) Biliverdin reductase: a major physiologic cytoprotectant, Proc. Natl. Acad. Sci. U. S. A 99, 16093-16098.
57. Grojean, S., Koziel, V., Vert, P., and Daval, J. L. (2000) Bilirubin induces apoptosis via activation of NMDA receptors in developing rat brain neurons, Exp. Neurol. 166, 334-341.
58. Park, W. S., Chang, Y. S., Chung, S. H., Seo, D. W., Hong, S. H., and Lee, M. (2001) Effect of hypothermia on bilirubin-induced alterations in brain cell membrane function and energy metabolism in newborn piglets, Brain Res. 922, 276-281.
59. Rodrigues, C. M., Sola, S., Castro, R. E., Laires, P. A., Brites, D., and Moura, J. J. (2002) Perturbation of membrane dynamics in nerve cells as an early event during bilirubin-induced apoptosis, J. Lipid Res. 43, 885-894.
60. Seubert, J. M., Darmon, A. J., El-Kadi, A. O., D'Souza, S. J., and Bend, J. R. (2002) Apoptosis in murine hepatoma hepa 1c1c7 wild-type, C12, and C4 cells mediated by bilirubin, Mol. Pharmacol. 62, 257-264.
61. Brito, M. A., Lima, S., Fernandes, A., Falcao, A. S., Silva, R. F., Butterfield, D. A., and Brites, D. (2008) Bilirubin injury to neurons: contribution of oxidative stress and rescue by glycoursodeoxycholic acid, Neurotoxicology 29, 259-269.
62. Cesaratto, L., Calligaris, S. D., Vascotto, C., Deganuto, M., Bellarosa, C., Quadrifoglio, F., Ostrow, J. D., Tiribelli, C., and Tell, G. (2007) Bilirubin-induced cell toxicity involves PTEN activation through an APE1/Ref-1-dependent pathway, J. Mol. Med. 85, 1099-1112.
Chapter 4
92
63. Dore, S. and Snyder, S. H. (1999) Neuroprotective action of bilirubin against oxidative stress in primary hippocampal cultures, Ann. N. Y. Acad. Sci. 890, 167-172.
64. Notter, M. F. and Kendig, J. W. (1986) Differential sensitivity of neural cells to bilirubin toxicity, Exp. Neurol. 94, 670-682.
65. Ollinger, R., Bilban, M., Erat, A., Froio, A., McDaid, J., Tyagi, S., Csizmadia, E., Graca-Souza, A. V., Liloia, A., Soares, M. P., Otterbein, L. E., Usheva, A., Yamashita, K., and Bach, F. H. (2005) Bilirubin: a natural inhibitor of vascular smooth muscle cell proliferation, Circulation 112, 1030-1039.
66. Sasaki, H., Sato, H., Kuriyama-Matsumura, K., Sato, K., Maebara, K., Wang, H., Tamba, M., Itoh, K., Yamamoto, M., and Bannai, S. (2002) Electrophile response element-mediated induction of the cystine/glutamate exchange transporter gene expression, J. Biol. Chem. 277, 44765-44771.
67. Sato, H., Nomura, S., Maebara, K., Sato, K., Tamba, M., and Bannai, S. (2004) Transcriptional control of cystine/glutamate transporter gene by amino acid deprivation, Biochem. Biophys. Res. Commun. 325, 109-116.
68. Averous, J., Bruhat, A., Jousse, C., Carraro, V., Thiel, G., and Fafournoux, P. (2004) Induction of CHOP expression by amino acid limitation requires both ATF4 expression and ATF2 phosphorylation, J. Biol. Chem. 279, 5288-5297.
69. Fernandez, J., Lopez, A. B., Wang, C., Mishra, R., Zhou, L., Yaman, I., Snider, M. D., and Hatzoglou, M. (2003) Transcriptional control of the arginine/lysine transporter, cat-1, by physiological stress, J. Biol. Chem. 278, 50000-50009.
70. Siu, F., Bain, P. J., LeBlanc-Chaffin, R., Chen, H., and Kilberg, M. S. (2002) ATF4 is a mediator of the nutrient-sensing response pathway that activates the human asparagine synthetase gene, J. Biol. Chem. 277, 24120-24127.
71. Tan, S., Somia, N., Maher, P., and Schubert, D. (2001) Regulation of antioxidant metabolism by translation initiation factor 2alpha, J. Cell Biol. 152, 997-1006.
93
Conclusions and perspectivesConclusions and perspectivesConclusions and perspectivesConclusions and perspectives
In spite of the fact that bilirubin encephalopathy was described more that 200 years ago and is
still a major clinical concern for neonatologists, the molecular mechanisms of bilirubin
neurotoxicity are only now becoming understood.
Neural cells exposed to UCB suffer complex alterations in a variety of vital cell functions,
leading to cell death with a mixed feature of apoptosis and necrosis (1). Only few studies have been
performed with purified UCB at modestly elevated, clinical relevant unbound concentrations.
Therefore it is uncertain and unlikely whether the several studies performed previously with impure
UCB at vastly higher Bf levels may have pathophysiological relevance (2).
The present thesis contributes to the description of early molecular events involved in cellular
responses to UCB by studies performed in the neuroblatosma SH-SY5Y cell line, regularly used as
an in vitro model for neurotoxicity experiments. To obtain the most appropriates experimental
conditions, all UCB studies were performed with purified UCB, and the free bilirubin
concentrations (Bf) used were experimentally determined in culture medium by direct Bf
measurements with the modified peroxidase method developed by our group. Working with these
standardized conditions allowed us to obtain original in vitro data to support and further confirm the
“free bilirubin theory”, reinforcing the proposal that the best way to assess the risk of kernicterus is
to measure Bf in hyperbilirubinemic newborn plasma. Unfortunately, we still lack reliable, fast and
accurate methods for Bf determinations in human plasma unless greatly diluted, and new efforts are
necessary to realize an early diagnosis of reversible bilirubin encephalopathy.
This work adds new relevant information about the neuronal response to UCB neurotoxicity,
obtained by gene expression profile studies. Changes in cellular redox status are associated with an
increase of the expression of the genes that encode for the transport system Xc- (SLC7A11 and
SLC3A2 genes) and involved in ER stress response. We have already validated by real time RT-
PCR, the high expression of SLC7A11 gene, and we are now interested in the study of its product
expression xCT, the specific subunit of the transport system Xc-; possibly with a neuroprotective
function by maintaining stable intracellular concentrations of glutathione. We will study if UCB
neurotoxicity can be modified by the overexpression of the transport system Xc-, indicating this
transport system as a candidate drug target for therapeutic treatment. Thus, bilirubin induction of
these cell responses provides new starting-points for future research in the bilirubin mediate cell
injury field.
94
As usual in science each answer raise at least 2 questions and this is also certainly
true in the “yellow world of bilirubin”. Though I have come a long way during the 3 years
of PhD thesis the remaining path is certainly longer.
References
1. Dore S, Takahashi M, Ferris D.C, Hester D.L, Guastella D, and Snyder H.S (1999) Bilirubin, formed by activation of heme oxygenase-2, protects neurons against oxidative stress injury, Proc. Natl. Acad. Sci. U. S. A 96, 2445-2450.
2. Ostrow, J. D., Pascolo, L., Shapiro, S. M., and Tiribelli, C. (2003) New concepts in bilirubin encephalopathy, Eur. J. Clin. Invest 33, 988-997.
95
Acknowledgements:
Università di Udine - Sezione Biologia Molecolare
Prof. Gianluca Tell Marta Deganuto Laura Cesaratto
Prof. Stefano Gustincich Raffaela Calligaris
Rossana Foti
SISSA - Sezione Neurobiologia
Centro Italoargentino de Criobiología
Prof. Joaquín Rodríguez All members of the center
Centro Studi Fegato
Prof. Claudio Tiribelli
Sandra Leal Safarina Malik Graciela Mazzone María Gabriela Mediavilla Devis Pascut Mohammed Qaisiya Celeste Robert Natalia Rosso Haninder Paul Sang Caecilia Sukowati Francesca Tricarico
Alejandro Aranda Andrea Berengeno Giulia Bortolussi Elena Boscolo Sebastián Calligaris Norberto Chavez Tapia Carlos Coda Zabetta Lucia Corich Sabrina Corsucci Vittorio Di Maso Silvia Gazzin
Cristina Bellarosa
University of Washington
R. P. Wennberg D. J. Ostrow
96
List of publications Sebastián D. Calligaris, Cristina Bellarosa, Pablo Giraudi, Richard P. Wennberg, J.
Donald Ostrow, and Claudio Tiribelli. Cytotoxicity is predicted by unbound and not total
bilirubin concentration. Pediatric Research 2007 Nov; 62, (5):576-80.
Congress presentations C Bellarosa, P Giraudi, SD Calligaris, JD Ostrow and C Tiribelli. A human neuronal cell
line shows greater bilirubin cytotoxicity and uptake than a non-neuronal cell line. In
abstract of poster symposium for Paediatric Academic Societies annual meeting, Toronto,
May 5-8, 2007.
SD Calligaris, C Bellarosa, P Giraudi, RP Wennberg, JD Ostrow and C Tiribelli.
Unbound, not total bilirubin concentration predicts citotoxicity in vitro. In abstract of
poster symposium for Paediatric Academic Societies annual meeting, Toronto, May 5-8,
2007.
Pablo J. Giraudi, Cristina Bellarosa, Sebastián Calligaris, Marta Deganuto, Gianluca Tell
and Claudio Tiribelli. Caratterizzazione del modello cellulare neuronale SH-SY5Y per il
danno da bilirubina. In abstract of poster symposium for 20a Riunione Nazionale “A.
Castellani” dei dottorandi di ricerca in discipline biochimiche, Brallo di Pregola, Pavia,
Italy, Jun 12-15, 2007.
Cristina Bellarosa, Raffaella Calligaris, Sebastian Calligaris, Laura Cesaratto, Marta
Deganuto, Rossana Foti, Pablo Giraudi, Stefano Gustincich, Gainluca Tell, Carlo
Vascotto and Claudio Tiribelli. Genetic determinants of bilirubin encephalopathy. In
abstract of poster symposium for Telethon Scientific Convention annual meeting,
Salsomaggiore Terme, Italy, March 12-14, 2007.
Cristina Bellarosa, Pablo Giraudi, Raffaela Calligaris, Rossana Foti, Stefano Gustincich
and Claudio Tiribelli. A target of UCB damage in SH-SY5Y neuroblastoma cell line. In
abstract submitted at the annual meeting of the Paediatric Academic Societies, Baltimore,
Maryland, Maggio 2-5, 2009.