Developmental Biology 364 (2012) 236–248

Contents lists available at SciVerse ScienceDirect

Developmental Biology

j ourna l homepage: www.e lsev ie r .com/deve lopmenta lb io logy

Maternally localized germ plasm mRNAs and germ cell/stem cell formation in thecnidarian Clytia

Lucas Leclère a,⁎,1, Muriel Jager a,1, Carine Barreau b, Patrick Chang b, Hervé Le Guyader a,Michaël Manuel a, Evelyn Houliston b

a Université Pierre et Marie Curie, Univ Paris 06 UMR 7138 CNRS MNHN IRD, Case 05, 7 quai St Bernard, 75005 Paris, Franceb Université Pierre et Marie Curie, Univ Paris 06 UMR 7009 CNRS, Observatoire Océanologique, 06230 Villefranche-sur-Mer, France

⁎ Corresponding author at: Sars International CentreUniversity of Bergen, Thormøhlensgate 55, N-5008, Ber

E-mail address: lucas.leclere@sars.uib.no (L. Leclère)1 These authors contributed equally.

0012-1606/$ – see front matter © 2012 Elsevier Inc. Alldoi:10.1016/j.ydbio.2012.01.018

a b s t r a c t

a r t i c l e i n f o

Article history:Received for publication 23 September 2011Revised 11 January 2012Accepted 20 January 2012Available online 28 January 2012

Keywords:Germ lineMultipotent stem cellGerm plasmPreformationHydrozoaCnidariaEvolution

The separation of the germ line from the soma is a classic concept in animal biology, and depending on spe-cies is thought to involve fate determination either by maternally localized germ plasm (“preformation” or“maternal inheritance”) or by inductive signaling (classically termed “epigenesis” or “zygotic induction”).The latter mechanism is generally considered to operate in non-bilaterian organisms such as cnidariansand sponges, in which germ cell fate is determined at adult stages from multipotent stem cells. We havefound in the hydrozoan cnidarian Clytia hemisphaerica that the multipotent “interstitial” cells (i-cells) inlarvae and adult medusae, from which germ cells derive, express a set of conserved germ cell markers:Vasa, Nanos1, Piwi and PL10. In situ hybridization analyses unexpectedly revealed maternal mRNAs forall these genes highly concentrated in a germ plasm-like region at the egg animal pole and inherited bythe i-cell lineage, strongly suggesting i-cell fate determination by inheritance of animal-localized factors.On the other hand, experimental tests showed that i-cells can form by epigenetic mechanisms in Clytia,since larvae derived from both animal and vegetal blastomeres separated during cleavage stages developedequivalent i-cell populations. Thus Clytia embryos appear to have maternal germ plasm inherited by i-cellsbut also the potential to form these cells by zygotic induction. Reassessment of available data indicates thatmaternally localized germ plasm molecular components were plausibly present in the common cnidarian/bilaterian ancestor, but that their role may not have been strictly deterministic.

© 2012 Elsevier Inc. All rights reserved.

Introduction

In a wide variety of metazoan species, a distinctive maternal cyto-plasmic region of the egg called pole plasm (in Drosophila) or germplasm (Saffman and Lasko, 1999), is selectively inherited by the pri-mordial germ cells (PGC), founders of the germ line. In some cases,notably in Drosophila and in anuran amphibians such as Xenopus,germ plasm components have been shown experimentally to act inthe determination of the germ line. This mechanism of germ lineformation by inheritance of a maternal germ plasm is called “prefor-mation” or “maternal inheritance”.

Germ plasm can be recognized by various distinctive features (Eddy,1975), including electron-dense granules composed of ribonucleo-protein complexes, variable association with dense concentrationsof mitochondria and nuclear pores and all or part of a conserved set

for Marine Molecular Biology,gen, Norway..

rights reserved.

of mRNAs and proteins (notably Piwi, Nanos, Vasa, PL10, Pumilio,Boule/Dazl and Bruno) involved in transposon silencing and mRNAregulation (Ewen-Campen et al., 2010; Juliano et al., 2010a; Voroninaet al., 2011). Germ plasm is detectable during oogenesis as an amor-phous substance termed nuage near the large oocyte nucleus (germinalvesicle), and relocates to a restricted area of the cortex during oogenesisor early development. It is then inherited by a subpopulation of blasto-meres that give rise to the PGCs.

Some animal species lack any distinguishable germ plasm duringearly embryonic stages, and their PGCs are specified by inductivesignals (Extavour and Akam, 2003). This type of germ line formationis termed “epigenesis” or “zygotic induction” and is well documentedin mammals and in urodele amphibians. In both cases, experimentalmanipulations can induce re-specification of cells from various embry-onic regions to PGC fates, and there is no detectablemRNAor protein lo-calization for the germ plasm “markers”, or localization of electron-dense granules during early development (see Extavour and Akam,2003). Bone morphogenetic proteins (BMPs) have been identified asprimordial germ cell inducers in mouse embryos (Lawson et al., 1999;Ohinata et al., 2009; Ying et al., 2003), but there is no indication thatthey are involved in germ line specification in other species (reviewed

237L. Leclère et al. / Developmental Biology 364 (2012) 236–248

in Ewen-Campen et al., 2010). Another “epigenetic” route to PGC forma-tion is seen in sponges, hydrozoans and planarians, and involves theirsegregation from multipotent stem cell populations maintained in theadult (Müller, 2006; Watanabe et al., 2009).

Irrespective of the mode and timing of PGC specification, genes ofthe Piwi, Vasa, nanos set have been consistently found expressed ei-ther in the germ line or in multipotent PGC precursors. Furthermore,genes of this set have been shown to be essential for the maintenanceand differentiation of both PGC and multipotent stem cells (Ewen-Campen et al., 2010; Juliano et al., 2010a). Their expression, however,is not exclusive to cells with germinal potential. For instance, Piwi,Vasa and PL10 are expressed in some somatic stem cell types inmammals and Drosophila (see Juliano et al., 2010a). In the cteno-phore Pleurobrachia, expression of Piwi, Vasa and PL10 genes occursin both the germ line and in a variety of non-germ line stem cells(Alié et al., 2011).

Expression of the germ plasm/germ line/stem cell genes describedabove has been used to trace the embryological origin of the germline, and to infer its mechanism of specification. The curious scattereddistribution of species thus inferred to use “preformation” versus“epigenesis” across the animal phylogeny has stimulated much de-bate as to which mechanism is evolutionarily the oldest. A surveybased heavily on such gene expression data suggested that “epigene-sis” was more widespread and probably ancestral (Extavour, 2007;Extavour and Akam, 2003).

Among the non-bilaterianmetazoan lineages, hydrozoan cnidariansare the group for which the origin of germ cells is best understood.Cnidarian are divided in two clades, anthozoans and medusozoanswhich include hydrozoans (Collins et al., 2006). Medusozoans arecharacterized by the presence of a medusa, in addition to the polypstage. In anthozoans such as Nematostella, the embryonic origin ofthe germ cells and stem cells is unclear. No germ cell-generatingpluripotent stem cells equivalent to hydrozoan interstitial cells (i-cells)have been detected (Technau and Steele, 2011), while reports ofthe localization of maternal Nanos mRNAs are contradictory (Extavouret al., 2005; Torras and Gonzalez-Crespo, 2005). In hydrozoans, thelife cycle typically comprises three phases: the planula larva, thebenthic, vegetatively-propagating polyp and the pelagic, sexual me-dusa. The i-cell population, present throughout the adult life, gener-ates both gamete precursors and various somatic cell types, namelyneuro-sensory cells (including nematocytes) and secretory glandcells (Watanabe et al., 2009). The i-cells originate during gastrula-tion and are first detectable in the central, endodermal region. Theyare later found predominantly in the ectoderm, or between the ecto-dermal and endodermal epithelia in the polyp and medusa. Studiesin various hydrozoan species (Podocoryne, Hydractinia and Hydra)have shown that i-cells in the planula larva, polyp and medusa ex-press genes considered to be germ line markers in bilaterian species(Piwi, Nanos, Vasa, PL10: Mochizuki et al., 2000, 2001; Rebscher et al.,2008; Seipel et al., 2004) and contain dense cytoplasmic granulessimilar to those considered characteristic of germ plasm (Noda andKanai, 1977 in Hydra). The impressive capacity of hydrozoan isolat-ed fragments from both early and late stage embryos to regulatenormal development (e.g., Freeman, 1981), has encouraged the as-sumption that i-cells have an epigenetic origin. Recent reports ofmaternally-localized Vasa protein in the hydrozoan Hydractinia(Rebscher et al., 2008), however, has raised doubts about this issue.

We have addressed the origin of i-cells in the experimental modelClytia hemisphaerica (Houliston et al., 2010). In situ hybridization an-alyses of five germ line marker genes (Piwi, Nanos1, Nanos2, PL10 andVasa) along with embryo bisection and q-PCR analyses provided evi-dence that maternally localized germ plasm co-exists with an epige-netic type mechanism of i-cell specification during Clytia embryonicdevelopment. Our findings have prompted us to reconsider the rela-tionship between germ plasm and germ line in metazoans, as wellas between preformation and epigenesis.

Material and methods

Gene identification

cDNA sequences corresponding to the CheNanos1 and 2, ChePiwi,ChePL10 and CheVasa genes were retrieved by BLAST searches onthe Clytia hemisphaerica EST collection (publicly available on Gen-Bank) sequenced by Genoscope (Evry, France) from C. hemisphaericamixed stage normalized cDNA libraries (see Houliston et al., 2010).The PL10 sequence was incomplete and subsequently extended usingdegenerate forward primers corresponding to amino-acid sequencesMACAQT (PL10-1: 5′ ATGGCNTGYGCNCARAC 3′) and GSGKTAA (PL10-2: 5′ GGNWSNGGNAARACNGCNGC 3′) and specific reverse primers(PL10-1rev: 5′ ATCCAACGCGACCAACAGCC 3′ and PL10-2rev: 5′ GCTAA-CATCTGAATTTCC 3′). Two rounds of nested PCR were performed using,as template, 1 μl of diluted cDNA extracted from a Clytia cDNA library.GenBank accession numbers: EU199802 (ChePiwi), JQ397273 (CheVasa),JQ397274 (CheNanos1), JQ397275 (CheNanos2) and JQ397276 (ChePL10).

Phylogenetic analyses

Cnidarian and bilaterian sequences were retrieved from GenBankor at www.compagen.org (Hemmrich and Bosch, 2008). Sequenceswere aligned using CLUSTALW in the BioEdit package (Hall, 1999) andthe alignment corrected manually. Conserved blocks were extractedto perform phylogenetic analyses, carried out using the Maximum-Likelihood (ML) method using the PhyML program (Guindon andGascuel, 2003) with the JTT model of amino-acid substitutions (Joneset al., 1994). A BioNJ tree was used as the input tree to generate theML tree. Among-site variation was estimated using a discrete approxi-mation to the gamma distribution with 8 rate categories. The gammashape parameter and the proportion of invariant sites were optimizedduring the ML search. Branch support was tested with bootstrapping(100 replicates).

Animals and embryo manipulation

We used Clytia hemisphaerica medusae cultured in Villefranche-sur-Mer from established laboratory colonies as described previously(Chevalier et al., 2006). 8-cell stage or blastula stage embryos werecut using fine tungsten needles on 2% agarose-coated Petri dishes.Embryo fragments were cultured in Millipore filtered natural or arti-ficial seawater containing antibiotics on agarose coated Petri dishes.Although C. hemisphaerica embryos exhibit variable morphologiesduring early development, we were able to use the “peanut” shapemost common among C. hemisphaerica blastulae as an indicator ofthe animal–vegetal axis (see Video S1).

In situ hybridization

Single and double in situ hybridizations were performed using DIG-or fluorescein-labeled antisense RNA probes as described in (Denkeret al., 2008) but with two modifications. (i) Color was developed withNBT/BCIP (Roche, Indianapolis, USA) for simple in situ hybridization,or NBT/BCIP and Fast RedTR-naphthol reagent (Sigma) for double insitu hybridizations. (ii) The concentration of each probe in the hy-bridization buffer was adapted to obtain the best results (low back-ground and intense signal): Piwi (80 ng/μl), Nanos1 (20 ng/μl), Nanos2(20 ng/μl), PL10 (2 ng/μl), Vasa (8 ng/μl) with 1 μl used for hybridiza-tion in a final volume of 1 ml.

Transmission electron microscopy

Embryos and gonads were pre-fixed at room temperature (RT) for10 min in solution A (3% glutaraldehyde, 0.3 M NaCl, 0.05% OsO4,0.1 M sodium cacodylate pH 7.3), then rinsed for 5 min in solution R

238 L. Leclère et al. / Developmental Biology 364 (2012) 236–248

(0.3 M NaCl, 0.2 M sodium cacodylate pH 7.3). They were fixed for 2 hat RT in solution A without OsO4, rinsed in solution R for 5 min andpost-fixed for 1 h on ice in 1% OsO4, 1.5% K-ferricyanide, 0.3 M NaCl,2.5% NaHCO3, pH 7.2 (protocol modified after Eisenman and Alfert,1982 and Sun et al., 2007). Samples were rinsed in H2O and dehy-drated for 15 min each, with an ethanol series (50, 70, 90, 95%) fol-lowed by 4 incubations in 100% ethanol. They were then embeddedin Spurr resin (Agar). Semi-thin sections were stained with 0.5%Methylene blue in 1% Borax. Thin sections were counter-stainedwith saturated aqueous uranyl acetate (15 min) and Reynolds leadcitrate (15 min).

Quantitative RT-PCR

Total RNA from individual cells or embryos was extracted usingRNAqueous-Micro kit according to the manufacturer's instructions(Ambion, Warrington, UK). First-strand cDNA was synthesized using

Fig. 1. Expression of stem cell marker genes in Clytiamedusae. A: In situ hybridization stainintentacle bulbs, asterisk: the manubrium). Insert in A4: staining in a statocyst (delineated bisolated gonads (or non-isolated in C4). In CI, C2 and C5 the gonad structure had been opeperipheral ring. D, E: Tentacle bulbs oriented with the proximal side at the top and the tewith stem cell marker genes (blue: B) and Minicollagen 3-4a (red: R) probes. Co-staining mco-expressing cells. Scale bars: A1–A5: 100 μm; B1–E5: 25 μm; insert in A4 and E4: 10 μm.

Random Hexamer Primer and Transcriptor Reverse Transcriptase(Roche Applied Science, Indianapolis, USA). q-PCRs were run in trip-licate or quadruplicate and EF-1alpha used as the reference controlgene. Each PCR contained 0.8 μl cDNA, 10 μl SYBR Green I MasterMix (Roche Applied Science), and 200 nM of each gene-specific prim-er, in a 20 μl final volume. q-PCR reactions were run in 96-well plates,in a LightCycler 480 Instrument (Roche Applied Science). Negativecontrols (RNA without reverse transcriptase) were performed forevery primer pair in each PCR plate, to ensure the absence of genomicDNA amplification. Sequences of forward and reverse primers designedfor each gene: EF-1alpha-F 5′ TGCTGTTGTCCCAATCTCTG 3′; EF-1alpha-R 5′ AAGACGGAGTGGTTTGGATG 3′; piwi-F 5′ GGTCACGACCCAGA-CAGAAT 3′; piwi-R 5′ GGAATGAGCGAAAAGACGAG 3′; wnt3-F 5′ATCATGGCAGGTGGAAACTC 3′; wnt3-R 5′ CCCCATTTCCAACCTTCTTC3′; vasa-F 5′ GCTCGTGCACTTGTCAAAAC 3′; vasa-R 5′ ACCCCAGC-CATCATTGTTAC 3′; PL10-F 5′ ACTGGTTTGTCCACCTCGTT 3′; PL10-R5′ CACCGCCATATCTGCTCTTT 3′; nanos1-F 5′ AATGAACCCTGGACCTTTCC

g of whole medusae (in A1—arrow: one of the four gonads, arrowhead: one of the eighty a dotted line). B, C: Expression in differentiating spermatozoids and oocytes withinned out and flattened so that the early oogenesis stages positioned proximally form antacle on the bottom. The row E shows double in situ hybridizations in tentacle bulbsakes a purple color (P). Insert in E4: higher magnification of CheNanos2–Minicollagen

239L. Leclère et al. / Developmental Biology 364 (2012) 236–248

3′; nanos1-R 5′ TCACTGTCTTTGAGCGTGTG 3′; nanos2-F 5′ GCCATCT-CAACCACAAAACC 3′; nanos2-R 5′ AATCGGGCAAGTGTAAGCAC 3′.

Imaging

All images of in situ-stained specimenswere acquired on an OlympusBX61 microscope using a Q-imaging Camera with Image Pro plus soft-ware (Mediacybernetics, Bethesda, MD). TEM images were acquired ona Hitachi H-600 at 100 kV. Timelapse recordings were made on a ZeissAxiovert microscope with a motorized stage and camera driven byMetamorph software.

Results

“Germ line” gene expression in jellyfish germ cells and somatic stem cells

We identified orthologues of five potential germ line/stem cellgenes from our C. hemisphaerica EST collection (Nanos (CheNanos1,CheNanos2), PL10 (ChePL10), Vasa (CheVasa), Piwi (ChePiwi)—seeFigs. S1 and S2 for gene orthology analyses).

In situ hybridization of Clytia medusae using antisense probes forall five genes investigated in this study showed expression in thezone of proliferating germ cell progenitors in the gonad (Amiel andHouliston, 2009). In addition, except for CheNanos2, they all showedexpression in “somatic” stem cells at the base of the tentacle bulbs(Fig. 1), specialized swellings that continuously supply nematocytes(among other cell types) to the tentacles (Denker et al., 2008). Inthis study we will consider both of these two spatially-separatestem cell populations as i-cells since they show equivalent gene ex-pression, but whether they are functionally interchangeable remainsto be verified experimentally. As in Podocoryne (Seipel et al., 2004;Torras et al., 2004), Hydractinia (Rebscher et al., 2008) and Hydra(Mochizuki et al., 2000, 2001), expression of all these genes wasmore easily detectable in the gonad than at other sites. In both male(Figs. 1B1–B5) and female (Figs. 1C1–C5) gonads, the in situ signal forall these genes was most intense in a proximal strip and distal rim, cor-responding to the sites of presumptive stem cells and early oocyte dif-ferentiation stages in females. Within tentacle bulbs, ChePiwi,CheNanos1, CheVasa and ChePL10 expression was detected both inthe stem cell zone of the proximal bulb area (see Denker et al.,2008, Figs. 1D1–D3, D5) and during the earliest step of nematogenesis,as indicated by limited overlap with expression of minicollagen

Fig. 2. Perinuclear concentration of “germ plasm” in growing oocytes. A–E: Characteristic penucleus). F, G: TEM sections of Clytia hemisphaerica growing oocytes. Red arrowheads indicbilaterian animals. er: endoplasmic reticulum, nm: nuclear membrane, pm: cell membrane

(Figs. 1E1–E3, E5), consistent with data from Hydra (Mochizuki et al.,2000, 2001) and Podocoryne (Seipel et al., 2004).

CheNanos2 was expressed in germ cells like the other genes, butotherwise differed in expression. In the tentacle bulb, CheNanos2mRNA was detected in a central band showing complete overlapwith expression of minicollagen (Fig. 1E4), indicating that this geneis expressed in differentiating nematoblasts but not in i-cells. It wasalso detected in the statocyst basal epithelium, near the bell margin(insert in Fig. 1A4). In young but not in mature medusae, CheNanos2expressionwas also detected in the endoderm of the radial and circulargastrovascular canals and of the manubrium (Figs. 1A4, S3).

Localized maternal mRNAs in a germ plasm-like domain, inherited byi-cells

The maternal mRNAs for all five genes studied were found to beconcentrated around the nucleus in small and large growing oocytes(Figs. 2A–E). In this region, transmission electron microscope (TEM)sections revealed amorphous “nuage” associated with mitochondriaand nuclear pores (Figs. 2F, G), highly reminiscent of germ plasmdescribed in other species (Eddy, 1975). The maternal mRNAs forall five genes investigated also showed a marked asymmetric distri-bution in spawned eggs, being highly concentrated in a restrictedregion immediately adjacent to the female pronucleus at the animalpole (Figs. 3A1–A5). In Hydractinia, perinuclear localization of Vasaprotein has been described in the corresponding region (Rebscheret al., 2008).

During cleavage stages, transcripts of all the 5 studied genes exceptCheVasa remained strongly detectable in the cortical region of blasto-meres inherited from the animal pole of the egg (Figs. 3B–D). In mostcases, the mRNAs were distributed in two patches on either side ofthe animal pole of cleavage and blastula stage embryos (see Fig. 3,lines C and D, but note the single patch in Figs. 3D1, D4). The split ofthe maternal mRNA into two patches reflects the division by thefirst unipolar cleavage furrow cutting through the animal pole, andfrequent subsequent physical separation of the animal sides of thetwo first blastomeres as development proceeds (see Video S1).

In early gastrula-stage embryos, ChePiwi, CheNanos1, CheNanos2 andChePL10mRNAwere detected in a cluster of small cells at the oral pole,the site of cell ingression (Fig. 3E1–E4). We hypothesize that zygotictranscription of these genes starts at the late blastula–early gastrulastage, as has been suggested for other embryonically expressed genes(e.g., Momose et al., 2008). At the end of gastrulation (approximately

rinuclear distribution of the five mRNAs in very early oocyte stages (cyt: cytoplasm; nu:ate perinuclear “nuage” material, similar to that described in the germ plasm of many, n: nucleus, nu: nucleolus, mit: mitochondria. Scale bars A–E, G: 5 μm, F: 1 μm.

Fig. 3. Distribution of stem cell marker mRNAs during embryonic development. Continuity of ChePiwi, ChePL10, CheNanos1 and CheNanos2mRNAs from animal cortex of the egg to i-cells. CheVasa is more broadly expressed during cleaving stages and becomes restricted to i-cell during gastrulation and early planula formation. In all panels the position of theanimal/oral pole is marked by an asterisk and corresponds to the gastrulation initiation site (asterisk in gastrulae E1–E5). Insert in B5: higher magnification of perinuclear CheVasamRNA detection in an 8-cell stage embryo. Scale bars for all panels: 50 μm.

240 L. Leclère et al. / Developmental Biology 364 (2012) 236–248

20–24 h post-fertilization) they were predominantly found in theoral half of the endodermal region of the newly-formed planulalarva (see Fig. 3F1–F4 and Fig. 4). Over the following 24 h the

distribution of these cells changed progressively, such that after2 days of development ChePiwi, CheNanos1, CheNanos2 and ChePL10positive cells were found dispersed throughout the endoderm of

Fig. 4. ChePiwi in situ hybridization during post-blastula embryonic development. A–C: 3 successive stages of gastrulation. D, E: 1 day planulae, F: 2 day planula, G: 3 day planula. H:Schematic representation of embryos shown in panels A to G (dark gray: ectoderm, light gray: endoderm, white: blastocoel, blue: ChePiwi positive cells). Embryos get longer andthinner during gastrulation and planula formation. Flattening of the planula during micro-slide preparation explains why they look bigger than early gastrula in the panels D–G; thesize of the planula has been corrected in the drawings shown in H. I: High magnification of Piwi-positive putative i-cells in the endodermal region of a 3 day old planula (ec: ec-toderm, en: endoderm, n: nucleus). Scale bars: A–G: 50 μm; I: 10 μm.

Fig. 5. Piwi expression in embryos derived from blastula halves. In situ hybridization staining for ChePiwi on uncut control embryos (A) fixed in parallel with embryos derived fromlateral (B), animal or vegetal (C) halves of mid-blastula stage embryos and fixed 5–30 min, 6 h or 20 h after cutting. Panels C4 and C5 show two different in situ hybridization pat-terns obtained with embryo deriving from the vegetal half at t=0–30 min. In all pictures the animal/oral pole is positioned on top. Proportions of embryos with or without clearPiwi-positive cells following fixation at successive times after cutting (n=number of embryos scored) are indicated on top left in each panel. Scale bars for all panels: 50 μm.

241L. Leclère et al. / Developmental Biology 364 (2012) 236–248

242 L. Leclère et al. / Developmental Biology 364 (2012) 236–248

the planula larva. In 2 and 3 day planulaeNanos2 expression was alsodetected in the aboral pole ectoderm (Fig. 3F4).

In 3 day planulae, ChePiwi, CheNanos1, CheNanos2 and ChePL10positive cells in the now-differentiated endoderm layer were identifi-able as i-cells by their round shape, characteristic disposition, andhigh nuclear–cytoplasmic ratio (Figs. 3 F1–F4, 4I). Interstitial cells havebeen described in the endodermal region of mature C. hemisphaericaplanulae in histological studies (Bodo and Bouillon, 1968). In Hydra,i-cell derivatives have been shown to include nematocytes, nervecells, gland cells, germ cells and differentiating stages of these four celltypes (Watanabe et al., 2009). No trace of capsule, dense granules orneurite-like structures was associated with the cells expressing thefour genes in the Clytia larvae. We thus conclude that these four genesare expressed inmultipotent i-cells and possibly also early stages of dif-ferentiation of derivative cell types, but not in mature nematoblasts,gland or nerve cells.

The expression pattern for CheVasa during embryonic develop-ment was slightly different from the other genes studied. In the egg,CheVasa mRNA was detected, albeit weakly, in the same cortical re-gion at the animal pole as the other mRNAs (Fig. 3A5). In embryosand larvae, however, cytoplasmic transcripts appeared distributed ina broad animal–vegetal gradient, with diffuse accumulations aroundnuclei in early cleavage stages (Fig. 3B5). In gastrulae and planulae,a population of cells strongly expressing CheVasa was detected withthe same general distribution as the putative i-cells expressing theother four genes (Figs. 3E5, F5).

Experimental demonstration of i-cell formation by epigenesis

To test whether i-cells can form in the absence of the Piwi/Nanos1/Nanos2/PL10/VasamRNA-rich “germ plasm”, embryo bisection exper-iments were performed at the 8-cell and blastula stages. Develop-ment of the i-cell population in the resultant half embryos wasmonitored by in situ hybridization, using ChePiwi as a marker.

We first attempted to separate the animal and vegetal halves atthe blastula stage by taking advantage of the characteristic peanutshape adopted by many cleaving embryos. At the blastula stage

Fig. 6. Piwi expression in embryos derived from isolated 8-cell stage blastomeres. A, B: In sitmini-embryos (B) derived from isolated blastomeres of 8 cell stage embryos at different timanimal/oral pole is on top. Proportion of embryos with or without clear Piwi-positive cellare indicated on top left in each panel. ChePiwi in situ hybridization of 2 day old planula (A

(5–6 h post fertilization), the animal pole of such embryos is markedby a deep cleft between two major lobes (e.g., see Fig. 3D2), whichfrom time-lapse movies of development can be deduced to derivefrom the animal side of the first unipolar cleavage furrow (VideoS1). In peanut-shaped embryos, in which two patches of ChePiwi,CheNanos1, CheNanos2 and ChePL10 mRNA-rich cells are situatedtowards the tips of the major two lobes, we attempted bisectionperpendicular to the cleft to separate animal and vegetal fragmentsor, for comparison, along the cleft to generate lateral halves eachcontaining one lobe and therefore one patch of Piwi/Nanos1/Nanos2/PL10-RNA positive cells (see diagrams in Figs. 5B and C). Our attemptsat producing animal–vegetal separation were partially successful,with 10/17 (58.8%) embryos deriving from blastula “vegetal” halvesfixed immediately after cutting (within 30 min) lacking Piwi-mRNAaggregates, while 100% of embryos derived from “animal” (n=17)and “lateral” (n=50) halves showed Piwi staining. The 7/17 Piwi-positive “vegetal” halves obtained in our experiments most probablyresulted from inaccurate cutting, but could theoretically also reflectrapid re-expression of Piwi in some vegetal fragments. Despite thesuccessful elimination of Piwi-mRNA aggregates in nearly 60% ofcases, nearly all gastrula (6 h after cutting; 20/22; 91%) and planula(20 h after cutting; 5/5; 100%) stage embryos derived from the “veg-etal” halves, showed clear populations of Piwi positive cells(Figs. 5C6 and C7), in a very similar pattern as uncut controls orlateral halves (Figs. 5A2, A3, B2 and B3). Furthermore, followingculture until the mature planula stage, all larvae derived from bothanimal and vegetal halves contained morphologically distinguish-able nematocytes and gland cells.

These blastula bisection experiments indicate that a functionali-cell lineage can develop in the absence of maternally-derived“germ plasm”, but are open to the criticism that there was signifi-cant contamination of the “vegetal” fragments by germ plasm. Toensure that none of the animal germ plasm material contaminatedthe vegetal fragments, we thus separated 8-cell stage embryos intosingle blastomeres. At this stage the germ plasm mRNA patches arerestricted to the 4 animal blastomeres, and so if germ plasm determinescell fate no i-cells should develop from the vegetal blastomeres (Fig. 6).

u hybridization staining for ChePiwi on uncut control embryos (A) fixed in parallel withes of development: 5–20 min, 1 h, 6.5 h, 20 h and 50 h after cutting. In all panels the

s following fixation at successive times after cutting (n=number of embryos scored)5) comes from an independent experiment. Scale bars for all panels: 50 μm.

Fig. 7.Widespread distribution of “germ plasm”mRNAs in early embryos. Quantitative RT-PCR detection of CheWnt3, CheNanos1, CheNanos2, ChePL10, ChePiwi and CheVasamRNAsin (A) animal and vegetal halves from three individual mid-blastula stage embryos (numbered 1 to 3 on the X axis) and (B) 4 isolated blastomeres from animal or vegetal halves offour 8 cell stage embryos (numbered 1 to 4), processed immediately after cutting. mRNA levels in each half are expressed as a percentage of the total quantity in the embryo. Theanimal cortical localized mRNA Wnt3 was quantified in parallel for comparison. q-PCR was performed in triplicate or quadruplicate and results normalized with respect to the levelof EF-1alpha mRNA.

243L. Leclère et al. / Developmental Biology 364 (2012) 236–248

As expected, Piwi mRNA aggregates were detectable in 35/66 (53%) ofblastomeres fixed within 20 min of isolation (Fig. 6B1). Note that theisolates were mixed, because in the absence of clear morphologicalpolarity markers it is hard to generate large populations of uniquelyanimal or vegetal blastomeres. Correspondingly, at the blastula stage,6 h 30 min after blastomere isolation, strongly Piwi positive cells weredetected in only 28/60 (47%) of the resultant mini-embryos (Fig. 6B3)indicating that there had been no reformation of germ plasm duringpre-blastula development. In planula larvae, however, fixed 20 h (1-day planula) or 50 h (2-day planula) after fertilization, 100% of theembryos had correctly formed epithelial endoderm and ectodermlayers and nearly all displayed Piwi-positive cells (73/78 and 65/68respectively—Figs. 6B4 and B5). Furthermore, mature nematocyteswere visible at the aboral pole in 66% (43/65) of the 2-day planulaewith Piwi-positive cells in the endodermal region. These resultsdemonstrate that embryo fragments lacking detectable mRNA-rich“germ plasm” are able to re-generate Piwi-expressing i-cells by thetime of gastrulation, and thereby to develop a functional interstitialcell lineage in the endoderm.

A pool of non-localized maternal germ cell/stem cell mRNAs

The observed development of Piwi-positive i-cells in vegetal em-bryo fragments could theoretically involve either the mobilization ofnon-localized maternal mRNAs or new transcription of germ cell/stem cell genes. As a first step to distinguishing these possibilitieswe quantified mRNA levels by reverse transcription PCR (Q-RT-PCR). Mid-blastula stage embryos were bisected into animal and veg-etal halves and subject directly to PCR to quantify levels of ChePiwi,CheVasa, ChePL10, CheNanos1 and CheNanos2mRNAs. The experimentshown in Fig. 7A involved independent measurement of threematched pairs of animal and vegetal halves. CheNanos1 and CheNa-nos2 mRNAs showed a clear animal bias in their distribution, equiva-lent to that of CheWnt3, whose maternal mRNAs has been shown tobe highly localized at the animal cortex of eggs and early embryos(Momose et al., 2008), while others showed levels in the vegetalhalf that were only modestly lower than in animal halves (ChePL10,ChePiwi) or indistinguishable (CheVasa). Equivalent results wereobtained following bisection of four 8-cell stage embryos along thethird cleavage plane. The average proportion of mRNA in the vegetalhalf (4 blastomeres) was approximately 30% for CheNanos1, 40% forCheNanos2, ChePL10 and ChePiwi and 50% for CheVasa (Fig. 7B).Prior to the blastula stage, Clytia embryos thus contain significantvegetal pools of many “germ plasm” mRNAs, despite the locallyhigh concentration around the animal pole revealed by in situhybridization.

Discussion

In this study we have provided evidence that maternally localized“germ plasm” mRNAs and a regulative “zygotic induction” (“epige-netic”) mechanism of interstitial stem cell lineage specification mayco-exist during embryogenesis in the hydrozoan Clytia hemisphaerica.The maternally localized mRNAs are not inherited by a dedicatedgerm line, but appear to segregate into precursors of multipotentstem cells (i-cells). We suggest that Clytia germ plasm does nothave a strictly deterministic function, but may favor the generationof i-cell precursors from the animal region of the egg during embry-onic development, thus coordinating their formation with that ofthe endoderm. Regulative mechanisms can promote i-cell formationwhen germ plasm is missing and could also account for position-dependent i-cell formation during normal embryogenesis. Distinctmechanisms based on signaling from surrounding tissues at a muchlater life cycle stage segregate definitive PGCs from the i-cell popula-tion. Our findings have prompted us to reconsider the relationship be-tween germ plasm and germ line, as well as between preformation/maternal inheritancemechanisms and two types of epigenetic/zygoticinduction mechanisms, one operating during embryogenesis and theother in adult life.

Maternal germ plasm in Clytia?

We have uncovered a distinct region in the animal cytoplasm ofClytia eggs characterized by marked local concentrations of Vasa,Piwi, Nanos and PL10 mRNAs. This region of the cytoplasm overlapswith a domain of corticalWnt3mRNA localization, which extends fur-ther away from the animal pole (Amiel and Houliston, 2009; Momoseet al., 2008), and also with the localization of CheSox1 and CheSox13mRNAs (Jager et al., 2011). The maternal perinuclear Piwi, Nanosand PL10 mRNA aggregates are inherited by a distinct cell populationlocated at the animal pole through cleavage stages. During gastrula-tion, expression of Piwi, Nanos1 and PL10, along with Vasa, continueszygotically in a sub-population of cells corresponding to i-cells (andpossibly some of their undifferentiated derivatives) in the planulalarvae. This maternal mRNA localization and inheritance profile ishighly suggestive of a “maternal inheritance” mechanism generatingi-cells. Although the i-cells do not constitute a dedicated germ line,we propose to retain the term “germ plasm”, to define a characteristiccytoplasmic domain inherited by a “germ track”, which includesboth multipotent somatic/germinal stem cells and dedicated germcell precursors. The concept of the germ track was originally elabo-rated by August Weismann (1893) in relation to his theory of thecontinuity of the “germ plasm”, originally developed from

244 L. Leclère et al. / Developmental Biology 364 (2012) 236–248

245L. Leclère et al. / Developmental Biology 364 (2012) 236–248

observations of germ cell segregation in hydrozoans (Berrill and Liu,1948;Weismann, 1883). It referred to the genealogy of cells contain-ing the germ plasm from the egg to the germ cells, with or withoutearly segregation of a proper germ line, i.e. of a cell lineage thatdoes not produce any somatic cell. It is important to realize thatmodern use of the term germ plasm, as referring to a cytoplasmicstructure, is completely different to Weismann's germ plasm,which in fact equates with nuclear genetic material (reviewed inLankenau, 2008). However, since the continuity of the (cytoplasmic)germ plasm appears to occur in species with or without early segre-gation of the germ line, the concept of “germ track” could find a newrelevance.

It is important to emphasize that the proposition that the Vasa/Nanos/Piwi/PL10mRNA-rich “germ plasm” in Clytia acts as a maternaldeterminant, and so directs the fate of the cells that inherit it, iscurrently based only on circumstantial evidence, and has two im-portant caveats. Firstly, current evidence does not show definitive-ly that the i-cell precursors actually inherit the maternally localizedgerm plasm mRNA, although they do form in the appropriate posi-tion in the embryo. Confirmation of direct inheritance during theblastula–gastrula transition would require the maternal mRNAs orthe cells that inherit them at the blastula stage to be tracked in vivo,possibilities that are not at themoment technically feasible. The succes-sive segregation of these localized mRNA during cleavage divisions,means that lineage tracing by dye injection at an earlier stage wouldbe uninformative.

Secondly, it should be stressed that localization does not implyfunction. Even if they are inherited by the i-cells, it is possible thatthe localized “germ plasm” mRNAs have no role in determiningtheir fate, or indeed no significant function in development, asseems to be the case for a set of mRNAs similarly closely associatedwith female pronucleus in the beetle Tribolium (Peel and Averof,2010). It is also possible that they could participate in otherdevelopmental processes, for example, in embryonic axis formation asseen with Drosophila Nanos. Testing the function of maternallylocalized mRNAs in Clytia is currently problematic because theirproximity to the nucleus precludes transplantation and irradiationapproaches. Testing the roles of individual genes by usingmorpholino antisense oligonucleotides to block translation couldbe undertaken (e.g. Momose et al., 2008), but would affect bothmaternally and zygotically transcribed mRNAs and so would notdistinguish between roles in maternal inheritance and regulativemechanisms. Specific experimental approaches to disrupt germplasm formation during oogenesis, and/or transgenesis approachesto specifically track germ plasm molecular components need to bedeveloped.

Fig. 8. Phylogenetic distribution of maternal localized germ plasm molecular components inand/or proteins (in red) is represented at 1-cell stage, cleavage and gastrula embryonic stgroups containing both species with maternal localized germ plasmmolecular components astage, the presence and distribution of the germ line (in yellow) and/or multipotent stem cimal/anterior pole for bilaterians and the animal/oral pole for cnidarians and ctenophores. Ming, only groups for which molecular data are available were considered: Porifera (Funayam(Alié et al., 2011—sp.: Pleurobrachia pileus), Anthozoa (Extavour et al., 2005; Torras and Gostage: Vasa, PL10, Nanos2), Hydrozoa (this study; Rebscher et al., 2008; Torras et al., 2004PL10, Nanos), Annelida (Agee et al., 2006; Dill and Seaver, 2008; Giani et al., 2011; Kang etet al., 2006—sp.: Platynereis dumerilii/st.: Vasa), Mollusca (Fabioux et al., 2004; Rabinowitz efera (Smith et al., 2010—sp.: Brachionus plicatilis/st.: Vasa), Nematoda (Subramaniam and Seypoda (Hay et al., 1990; Chang et al., 2002; 2009; Dearden et al., 2003; Extavour, 2005; Sagawet al., 2008; Özhan-Kizil et al., 2009—sp.: Drosophila melanogaster/st.: Vasa, Nanos), Chaetog2008; Juliano et al., 2006; Juliano et al., 2010b; Yajima and Wessel, 2011—sp.: Strongylocentidae/st.: Vasa, Nanos), Urochordata (Takamura et al., 2002; Shirae-Kurabayashi et al., 2006; Sal., 2011—sp.: Ciona intestinalis/st.: Vasa), Teleostei (Knaut et al., 2002; Raz, 2003; Saito et al.(Machado et al., 2005; Sekizaki et al., 2004—sp.: Xenopus laevis/st: Vasa), Amphibia CaudaMammalia (review for mice in Hayashi et al., 2007; Lee et al., 2005—sp.: Mus musculus/st.: Nmolecular studies in Acoelomorpha (De Mulder et al., 2009), Platyhelminthes (Handberg-T2009), Dipnoi (Johnson et al., 2003) and Chondrostei (Johnson et al., 2011) since these publicNote that while the Rotifera are considered in this figure to lack localized maternal germ pclusion is provisional since pre-molecular studies suggest that localized maternal germ pl

“Zygotic induction” mechanisms for i-cell formation

Our q-PCR measurements indicate that in Clytia, the region of i-cellformation is not restricted spatially by the distribution of “germ plasm”

mRNAs. Although they are highly concentrated in the animal pole regionthese mRNAs are also present across all regions of the early embryoto a greater or lesser extent. The pools of non-localized maternal RNAsclearly cannot play a classical determinant role otherwise all cells wouldbecome i-cells. A very similar situation exists for Drosophila germ plasmcomponents, with the majority of nanos and oskar mRNAs dispersedthroughout the embryo cytoplasm (96% and 82% respectively) despitestrikingmRNA localization to posterior pole plasm revealed by in situ hy-bridization (Bergsten and Gavis, 1999).

Given the presence of a distinct domain with germ plasm charac-teristics at the egg animal pole, our experimental demonstration thata regulative mechanism can generate i-cells from vegetal regions ofcleavage or blastula stage embryos was unexpected. Although initial-ly uncomfortable at a conceptual level, co-existence of germ plasm-based and “zygotic induction” mechanisms for interstitial stem celllineage specification during embryogenesis can be easily reconciledat a mechanistic level (as already suggested by Extavour, 2007). Start-ing from a situation where a conserved set of stem cell genes such asPiwi, Nanos and Vasa is expressed in the oocyte, it is easy to imaginethat the aggregation and association of their maternal mRNAs inone part of the egg could favor rapid interstitial stem cell determina-tion in the cells that inherit them, while signalingmechanisms actingafter the onset of zygotic gene transcription could contribute to reg-ulating the size of the cell population and/or to regionally restrictingtheir formation and/or proliferation, or to facilitate their restorationfollowing stress or injury. A similar situation has been described inthe ascidian Ciona intestinalis where a maternal germ plasm seemsto contain determinants of the germ line but removal of the PGCsat larval stage can be compensated by formation of new onesfrom multipotent stem cells (Takamura et al., 2002).

The term “zygotic induction” comprises very diverse modes of germline formation and is defined in opposition to the “maternal inheri-tance” mechanism. This later mode can clearly be defined based onclassical observations and more recent molecular analyses: (i) pres-ence of a distinct, restricted cytoplasmic region generated duringoogenesis, or at least before the first division; (ii) this specializedcytoplasm is restricted to a distinct subset of cells during early devel-opment, and (iii) the cells that take up this cytoplasm differentiateinto the primordial germ cells, while those that are not associatedwith the germ plasm, at least initially, take on a somatic fate. Thoseorganisms where all three criteria are met can be said to use mater-nal inheritance, while those that do not, including Clytia, require

the egg and type of PGC segregation in Metazoa. The distribution of germ plasm RNAsages for one species per taxonomic group for which molecular data are available. Fornd species without, a species with maternal localization is presented. At larval/juvenileell line giving rise to the germ line (in blue) are represented. Asterisks indicate the an-etazoan phylogeny presented is derived from Philippe et al. (2011). For character cod-a et al., 2010; Müller, 2006—species represented: Suberites domuncula), Ctenophoresnzalez-Crespo, 2005—sp.: Nemastostella vectensis/staining shown for early embryonic; Seipel et al., 2004; Mochizuki et al., 2000, 2001—sp.: Clytia hemisphaerica/st.: Piwi,al., 2002; Pilon and Weisblat, 1997; Rebscher et al., 2007; Sugio et al., 2008; Tadokorot al., 2008; Swartz et al., 2008; Kranz et al., 2010—sp.: Crassostrea gigas/st.: Vasa), Roti-doux, 1999; Salinas et al., 2007—sp.: Caenorhabditis elegans/st.: VBH-1=PL10), Arthro-a et al., 2005; Dearden, 2006; Schröder, 2006; Nakkrasae and Damrongphol, 2007; Mitonatha (Carré et al., 2002—sp.: Sagitta setosa/st.: Vasa), Echinodermata (Voronina et al.,rotus purpuratus/st.: Vasa), Cephalochordata (Wu et al., 2011—sp.: Branchiostoma flor-unanaga et al., 2006; Sunanaga et al., 2008; Brown et al., 2009, Review in Kawamura et, 2004; Herpin et al., 2007; Aoki et al., 2008—sp.: Danio rerio/st.: Vasa), Amphibia Anurata (Tamori et al., 2004; Bachvarova et al., 2004—sp.: Ambystoma mexicanum/st.: dazl),anos3), Aves (Tsunekawa et al., 2000—sp.: Gallus gallus/st.: Vasa). We did not considerhorsager and Saló, 2007; Pfister et al., 2008; Sato et al., 2006), turtles (Bachvarova et al.,ations do not provide expression patterns in mature eggs and cleavage stage embryos.lasm on the basis of the only molecular study available (Smith et al., 2010), this con-asm is present at least in some species of this group (see Extavour and Akam, 2003).

246 L. Leclère et al. / Developmental Biology 364 (2012) 236–248

additional input for the induction of the germ cells, and thus use the“zygotic induction” mode.

The “zygotic induction” modes of germ line formation can be di-vided into different types. One type, classically observed in mammalsand in urodele amphibians, involves determination of PGC fate duringembryogenesis, with no role for maternal germ plasm. A second typeis found in species like Clytia. A maternal germ plasm has a facultativeor essential role in multipotent stem-cell lineage determination, butdistinct intercellular signaling based mechanisms act at a much laterlife cycle stage to segregate definitive PGCs from the multipotentstem cell population. A similar two-step model of PGC determinationwas proposed by Rebscher et al. (2007) based on observations in thepolychaete Platynereis in which multipotent stem cells seem to orig-inate by inheritance of maternal determinants, and definitive germcell fate determination occurs secondarily, through an epigeneticsignal, from the multipotent stem cells.

The evolutionary origin of maternal germ plasm

As demonstrated in the survey presented in Fig. 8, maternallylocalized germ plasm as assessed mainly from molecular data, isvery widespread in the Metazoa. Germ plasm ultrastructure andits position in the egg at the future site of gastrulation arevery similar between distant animal groups. Germ plasm con-tains variable combinations of conserved gene products presentas mRNAs or proteins or both depending on the species, suchthat no single molecular component is a universal feature. Evenin species lacking maternal localization, germ plasm componentscan localize very early during embryogenesis, for instance in mi-cromeres at the 16-cell stage in echinoderms (Voronina et al.,2008; Yajima and Wessel, 2011) or in the 4d cell lineage for mostspecies of annelids and molluscs (e.g. Dill and Seaver, 2008; Kranzet al., 2010; Swartz et al., 2008). Overall, rare are the groups withoutlocalization of germ plasm components in a germ track prior to gastru-lation. Previous phylogenetic surveys, in which detection of maternalgerm plasm was equated with preformation, and evidence for latePGC formation equated with epigenesis, concluded that maternal germplasm/preformation probably derived from epigenesis multiple timesin evolution (Extavour, 2007; Extavour and Akam, 2003).

Given the close relationship of the Bilateria and Cnidaria(Philippe et al., 2009; Philippe et al., 2011), and the presence of lo-calized germ plasm in both Clytia and in nearly all the major bila-terian clades (Fig. 8), the hypothesis that maternally localizedgerm plasm was present in the last common cnidarian–bilaterian(=eumetazoan) ancestor remains quite plausible. This “ancestralgerm plasm” scenario implies that maternal germ plasm was lostin the urodele amphibians and mammalian lineages as well as inthe anthozoans. In support of this scenario, “basally branching”chordates such as urochordates or cephalochordates and proto-stomes such as chaetognaths seem to have a maternal germ plasmand “maternal inheritance” mode of germ line specification (Carré etal., 2002; Shirae-Kurabayashi et al., 2006; Wu et al., 2011).

On the other hand, in insects, maternal germplasm and early settingaside of germ cells are restricted to the monophyletic Holometabola,and are associated with the presence and function of the novel geneoskar, which is an Holometabola specific gene (Lynch et al., 2011).Species that have lost oskar also have lost maternal inheritance. Thismolecular and phylogenetic evidence indicates that maternal germplasm seen in insects such as Drosophila is a derived state within theinsects. In the chordate lineage, maternal inheritance is associated withanother novel gene, bucky-ball, which is similarly restricted to thevertebrate lineage (Bontems et al., 2009). This might also indicatethat maternal germ plasm in this clade is an evolutionary noveltyassociated with the invention of a new gene. However this gene isalso present in mammalian genomes that have a clear epigeneticmode of PGC segregation (Extavour and Akam, 2003) and is not

present in non-vertebrate chordate genomes such as Ciona and Bran-chiostoma that display “maternal inheritance” (Shirae-Kurabayashiet al., 2006; Wu et al., 2011).

Given the various arguments in both directions and the lack offunctional testing of the role of maternal germ plasm mRNAs inmost metazoan phyla, it is not possible for the moment to deducewhether the ancestral function of maternal germ plasm was to pro-vide determinants of the germ track. We suggest that both localizedmaternal germ plasm and “zygotic induction” of the germ track dur-ing embryonic development might have co-existed in the ancestorof the Eumetazoa and that some animal lineages have subsequentlyfavored or lost one or the other during evolution. This would offeran explanation of their presence in a diverse and phylogeneticallydispersed set of animals.

Maternal germ plasm RNAs in Clytia, as well as early zygotic ex-pression in Nematostella (Extavour et al., 2005), are localized on thesame side as mRNAs that direct gastrulation and endoderm formation(Martindale, 2005; Momose et al., 2008). The relationship betweengerm plasm and gastrulation is thus the same in cnidarians and inbilaterians, although the fate map is reversed with respect to egganimal–vegetal polarity (Martindale, 2005). A common associationbetween the germ plasm and the gastrulation site might representan ancient feature of animal development, facilitating association ofgerm cell precursors with developing endodermal or mesodermalderivatives, and/or reflecting ancestral participation of germ plasmcomponents in embryo patterning. The case of Nanos is interestingin this context as this mRNA has an additional function in patterningthe posterior pole in various protostomes (e.g. Drosophila—Lehmannand Nusslein-Volhard, 1991, grasshopper—Lall et al., 2003, mollusk—Rabinowitz et al., 2008, and leech—Agee et al., 2006). The role ofNanos in axial patterning may have evolved in the protostome line-age since no such function has been described in a deuterostome,and remains to be tested in non-bilaterians.

Considering the phylogenetic distribution of species harboringearly germ line segregation versus post-embryonic PGC formationfrom a multipotent stem cell lineage such as hydrozoan i-cells(Fig. 8), it is not clear which type of germ track is ancestral (i.e.one-step or two-step PGC segregation). Several recent reviews andarticles (e.g. Juliano and Wessel, 2010; Rebscher et al., 2007) favoran ancestral multipotent stem cell system capable of giving rise toboth germ line and somatic cells and still present in hydrozoansand planarians. Caution is required, however, since this scenario re-lies heavily on the absence of early embryonic PGC segregation inmany animal groups for which data on early embryonic stages arevery scattered and contradictory, like Platyhelminthes, Acoelomor-pha or Anthozoa (De Mulder et al., 2009; Extavour et al., 2005;Pfister et al., 2008). To solve this question, it would be particularlyinformative to know the timing of germ line segregation in earlybranching metazoans such as anthozoans, acoels and ctenophores.

Acknowledgments

We thank our research colleagues, Elsa Denker, Lisbeth C. Olsenand Fabian Rentzsch for useful suggestions, and two anonymous re-viewers for comments that improved the quality of the manuscript.This work was supported by a grant from the GIS “Institut de laGénomique Marine”–ANR “programme blanc” NT_NV_52 Genocni-daire and by the “Agence Nationale de la Recherche” grant ANR-09-BLAN-0236-01 DiploDevo. EST sequencing was performed by theConsortium National de Recherche en Génomique at the Genoscope(Evry, France).

Appendix A. Supplementary data

Supplementary data to this article can be found online at doi:10.1016/j.ydbio.2012.01.018.

247L. Leclère et al. / Developmental Biology 364 (2012) 236–248

References

Agee, S.J., Lyons, D.C., Weisblat, D.A., 2006. Maternal expression of a NANOS homolog isrequired for early development of the leech Helobdella robusta. Dev. Biol. 298,1–11.

Alié, A., Leclère, L., Jager, M., Dayraud, C., Chang, P., Le Guyader, H., Quéinnec, E.,Manuel, M., 2011. Somatic stem cells express Piwi and Vasa genes in an adultctenophore: ancient association of “germline genes” with stemness. Dev. Biol.350, 183–197.

Amiel, A., Houliston, E., 2009. Three distinct RNA localization mechanisms contribute tooocyte polarity establishment in the cnidarian Clytia hemisphaerica. Dev. Biol. 327,191–203.

Aoki, Y., Nagao, I., Saito, D., Ebe, Y., Kinjo, M., Tanaka, M., 2008. Temporal and spatial lo-calization of three germline-specific proteins in medaka. Dev. Dyn. 237, 800–807.

Bachvarova, R.F., Masi, T., Drum, M., Parker, N., Mason, K., Patient, R., Johnson, A.D.,2004. Gene expression in the axolotl germ line: Axdazl, Axvh, Axoct-4, and Axkit.Dev. Dyn. 231, 871–880.

Bachvarova, R.F., Crother, B.I., Manova, K., Chatfield, J., Shoemaker, C.M., Crews, D.P.,Johnson, A.D., 2009. Expression of Dazl and Vasa in turtle embryos and ovaries:evidence for inductive specification of germ cells. Evol. Dev. 11, 525–534.

Bergsten, S.E., Gavis, E.R., 1999. Role for mRNA localization in translational activationbut not spatial restriction of nanos RNA. Development 126, 659–669.

Berrill, N.J., Liu, C.K., 1948. Germplasm, Weismann, and hydrozoa. Q. Rev. Biol. 23,124–132.

Bodo, F., Bouillon, J., 1968. Étude histologique du développement embryonnaire dequelques hydroméduses de Roscoff: Phialidium hemisphaericum (L.), Obelia sp.Péron et Lesueur, Sarsia eximia (Allman), Podocoryne carnea (Sars), Gonionemusvertens Agassiz. Cah. Biol. Mar. 9, 69–104.

Bontems, F., Stein, A., Marlow, F., Lyautey, J., Gupta, T., Mullins, M.C., Dosch, R., 2009.Bucky ball organizes germ plasm assembly in zebrafish. Curr. Biol. 19, 414–422.

Brown, F.D., Tiozzo, S., Roux, M.M., Ishizuka, K., Swalla, B.J., De Tomaso, A.W., 2009. Earlylineage specification of long-lived germline precursors in the colonial ascidianBotryllus schlosseri. Development 136, 3485–3494.

Carré, D., Djediat, C., Sardet, C., 2002. Formation of a large Vasa-positive germ granule and itsinheritance by germ cells in the enigmatic Chaetognaths. Development 129, 661–670.

Chang, C.C., Dearden, P., Akam, M., 2002. Germ line development in the grasshopperSchistocerca gregaria: vasa as a marker. Dev. Biol. 252, 100–118.

Chang, C.C., Huang, T.Y., Cook, C.E., Lin, G.W., Shih, C.L., Chen, R.P., 2009. Developmentalexpression of Apnanos during oogenesis and embryogenesis in the parthenogeneticpea aphid Acyrthosiphon pisum. Int. J. Dev. Biol. 53, 169–176.

Chevalier, S., Martin, A., Leclère, L., Amiel, A., Houliston, E., 2006. Polarised expressionof FoxB and FoxQ2 genes during development of the hydrozoan Clytia hemisphaerica.Dev. Genes Evol. 216, 709–720.

Collins, A.G., Schuchert, P., Marques, A.C., Jankowski, T., Medina, M., Schierwater, B.,2006. Medusozoan phylogeny and character evolution clarified by new large andsmall subunit rDNA data and an assessment of the utility of phylogenetic mixturemodels. Syst. Biol. 55, 97–115.

Dearden, P.K., 2006. Germ cell development in the honeybee (Apis mellifera); vasa andnanos expression. BMC Dev. Biol. 6, 6.

Dearden, P., Grbic, M., Donly, C., 2003. Vasa expression and germ-cell specification inthe spider mite Tetranychus urticae. Dev. Genes Evol. 212, 599–603.

De Mulder, K., Kuales, G., Pfister, D., Willems, M., Egger, B., Salvenmoser, W., Thaler, M.,Gorny, A.K., Hrouda, M., Borgonie, G., Ladurner, P., 2009. Characterization of thestem cell system of the acoel Isodiametra pulchra. BMC Dev. Biol. 9, 69.

Denker, E., Manuel, M., Leclère, L., Le Guyader, H., Rabet, N., 2008. Ordered progressionof nematogenesis from stem cells through differentiation stages in the tentaclebulb of Clytia hemisphaerica (Hydrozoa, Cnidaria). Dev. Biol. 315, 99–113.

Dill, K.K., Seaver, E.C., 2008. Vasa and nanos are coexpressed in somatic and germ linetissue from early embryonic cleavage stages through adulthood in the polychaeteCapitella sp. I. Dev. Genes Evol. 218, 453–463.

Eddy, E.M., 1975. Germ plasm and the differentiation of the germ cell line. Int. Rev.Cytol. 43, 229–280.

Eisenman, E.A., Alfert, M., 1982. A new fixation procedure for preserving the ultra-structure of marine invertebrate tissues. J. Microsc. 125, 117–120.

Ewen-Campen, B., Schwager, E.E., Extavour, C.G.M., 2010. The molecular machinery ofgerm line specification. Mol. Reprod. Dev. 77, 3–18.

Extavour, C.G.M., 2005. The fate of isolated blastomeres with respect to germ cell for-mation in the amphipod crustacean Parhyale hawaiensis. Dev. Biol. 277, 387–402.

Extavour, C.G., 2007. Evolution of the bilaterian germ line: lineage origin and modula-tion of specification mechanisms. Integr. Comp. Biol. 47, 770–785.

Extavour, C.G., Akam, M., 2003. Mechanisms of germ cell specification across the meta-zoans: epigenesis and preformation. Development 130, 5869–5884.

Extavour, C.G., Pang, K., Matus, D.Q., Martindale, M.Q., 2005. vasa and nanos expressionpatterns in a sea anemone and the evolution of bilaterian germ cell specificationmechanisms. Evol. Dev. 7, 201–215.

Fabioux, C., Huvet, A., Lelong, C., Robert, R., Pouvreau, S., Daniel, J.Y., Minguant, C., LePennec, M., 2004. Oyster vasa-like gene as a marker of the germline cell develop-ment in Crassostrea gigas. Biochem. Biophys. Res. Commun. 320, 592–598.

Freeman, G., 1981. The role of polarity in the development of the hydrozoan planulalarva. Dev. Genes Evol. 190, 168–184.

Funayama, N., Nakatsukasa, M., Mohri, K., Masuda, Y., Agataa, K., 2010. Piwi expressionin archeocytes and choanocytes in demosponges: insights into the stem cell systemin demosponges. Evol. Dev. 12, 275–287.

Giani Jr., V.C., Emi, Y., Michael, B.J., Seaver, E.C., 2011. Somatic and germline expressionof piwi during development and regeneration in the marine polychaete annelidCapitella teleta. Evodevo 2, 10.

Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate largephylogenies by maximum likelihood. Syst. Biol. 52, 696–704.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysisprogram for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95–98.

Handberg-Thorsager, M., Saló, E., 2007. The planarian nanos-like gene Smednos isexpressed in germline and eye precursor cells during development and regener-ation. Dev. Genes Evol. 217, 403–411.

Hay, B., Jan, L.Y., Jan, Y.N., 1990. Localization of vasa, a component of Drosophila polargranules, in maternal-effect mutants that alter embryonic anteroposterior polarity.Development 109, 425–433.

Hayashi, K., de Sousa, Chuva, Lopes, S.M., Surani, M.A., 2007. Germ cell specification inmice. Science 316, 394–396.

Hemmrich, G., Bosch, T.C., 2008. Compagen, a comparative genomics platform for earlybranching metazoan animals, reveals early origins of genes regulating stem-celldifferentiation. Bioessays 30, 1010–1018.

Houliston, E., Momose, T., Manuel, M., 2010. Clytia hemisphaerica: a jellyfish cousinjoins the laboratory. Trends Genet. 26, 159–167.

Jager, M., Quéinnec, E., Le Guyader, H., Manuel, M., 2011. Multiple Sox genes areexpressed in stem cells or in differentiating neurosensory cells in the hydrozoanClytia hemisphaerica. Evodevo 2, 12.

Johnson, A.D., Drum, M., Bachvarova, R.F., Masi, T., White, M.E., Crother, B.I., 2003. Evo-lution of predetermined germ cells in vertebrate embryos: implications for macro-evolution. Evol. Dev. 5, 414–431.

Johnson, A.D., Richardson, E., Bachvarova, R.F., Crother, B.I., 2011. Evolution of the germline–soma relationship in vertebrate embryos. Reproduction 141, 291–300.

Jones, D.T., Taylor,W.R., Thornton, J.M., 1994. Amodel recognition approach to the predictionof all-helical membrane protein structure and topology. Biochemistry 33, 3038–3049.

Juliano, C., Wessel, G., 2010. Developmental biology. Versatile germline genes. Science329 (5992), 640–641.

Juliano, C.E., Voronina, E., Stack, C., Aldrich, M., Cameron, A.R., Wessel, G.M., 2006. Germline determinants are not localized early in sea urchin development, but do accu-mulate in the small micromere lineage. Dev. Biol. 300, 406–415.

Juliano, C.E., Swartz, S.Z., Wessel, G.M., 2010a. A conserved germline multipotencyprogram. Development 137, 4113–4126.

Juliano, C.E., Yajima, M., Wessel, G.M., 2010b. Nanos functions to maintain the fate ofthe small micromere lineage in the sea urchin embryo. Dev. Biol. 337, 220–232.

Kang, D., Pilon, M., Weisblat, D.A., 2002. Maternal and zygotic expression of a nanos-class gene in the leech Helobdella robusta: primordial germ cells arise from seg-mental mesoderm. Dev. Biol. 245, 28–41.

Kawamura, K., Tiozzo, S., Manni, L., Sunanaga, T., Burighel, P., De Tomaso, A.W., 2011.Germline cell formation and gonad regeneration in solitary and colonial ascidians.Dev. Dyn. 240, 299–308.

Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C., 2002. An evolutionaryconserved region in the vasa 3′UTR targets RNA translation to the germ cells inthe zebrafish. Curr. Biol. 12, 454–466.

Kranz, A.M., Tollenaere, A., Norris, B.J., Degnan, B.M., Degnan, S.M., 2010. Identifying thegermline in an equally cleaving mollusc: Vasa and Nanos expression during embry-onic and larval development of the vetigastropod Haliotis asinina. J. Exp. Zool. BMol. Dev. Evol. 314, 267–279.

Lall, S., Ludwig, M.Z., Patel, N.H., 2003. Nanos plays a conserved role in axial patterningoutside of the Diptera. Curr. Biol. 13, 224–229.

Lankenau, D.H., 2008. The legacy of the germ line—maintaining sex and life inmetazoans:cognitive roots of the concept of hierarchical selection. In: Egel, R., Lankenau, D.-H.(Eds.), Genomic Dynamics and Stability. : Recombination and Meiosis, 3. Springer,Berlin, Heidelberg, pp. 289–339.

Lawson, K.A., Dunn, N., Roelen, B.A., Zeinstra, L.M., Davis, A.M., Wright, C.V.E., Korving,J.P.W.F.M., Hogan, B.L.M., 1999. Bmp4 is required for the generation of primordialgerm cells in the mouse embryo. Genes Dev. 13, 424.

Lee, G.S., Kim, H.S., Lee, S.H., Kang, M.S., Kim, D.Y., Lee, C.K., Kang, S.K., Lee, B.C., Hwang,W.S., 2005. Characterization of pig vasa homolog gene and specific expression ingerm cell lineage. Mol. Reprod. Dev. 72, 320–328.

Lehmann, R., Nusslein-Volhard, C., 1991. The maternal gene nanos has a central role inposterior pattern formation of the Drosophila embryo. Development 112, 679–691.

Lynch, J.A., Ozüak, O., Khila, A., Abouheif, E., Desplan, C., Roth, S., 2011. The phylogeneticorigin of oskar coincided with the origin of maternally provisioned germ plasm andpole cells at the base of the Holometabola. PLoS Genet. 7, e1002029.

Machado, R.J., Moore, W., Hames, R., Houliston, E., Chang, P., King, M.L., Woodland, H.R.,2005. Xenopus Xpat protein is a major component of germ plasm and may func-tion in its organisation and positioning. Dev. Biol. 287, 289–300.

Martindale, M.Q., 2005. The evolution of metazoan axial properties. Nat. Rev. Genet. 6,917–927.

Mito, T., Nakamura, T., Sarashina, I., Chang, C.C., Ogawa, S., Ohuchi, H., Noji, S., 2008. Dy-namic expression patterns of vasa during embryogenesis in the cricket Gryllusbimaculatus. Dev. Genes Evol. 218, 381–387.

Mochizuki, K., Sano, H., Kobayashi, S., Nishimiya-Fujisawa, C., Fujisawa, T., 2000. Ex-pression and evolutionary conservation of nanos-related genes in Hydra. Dev.Genes Evol. 210, 591–602.

Mochizuki, K., Nishimiya-Fujisawa, C., Fujisawa, T., 2001. Universal occurrence of thevasa-related genes among metazoans and their germline expression in Hydra.Dev. Genes Evol. 211, 299–308.

Momose, T., Derelle, R., Houliston, E., 2008. Amaternally localisedWnt ligand required foraxial patterning in the cnidarian Clytia hemisphaerica. Development 135, 2105–2113.

Müller, W.E., 2006. The stem cell concept in sponges (Porifera): metazoan traits. Semin.Cell Dev. Biol. 17, 481–491.

Nakkrasae, L.I., Damrongphol, P., 2007. A vasa-like gene in the giant freshwater prawn,Macrobrachium rosenbergii. Mol. Reprod. Dev. 74, 835–842.

248 L. Leclère et al. / Developmental Biology 364 (2012) 236–248

Noda, K., Kanai, C., 1977. An ultrastructural observation on Pelmatohydra robusta atsexual and asexual stages, with a special reference to “Germinal plasm”. J. Ultra-struct. Res. 61, 284–294.

Ohinata, Y., Ohta, H., Shigeta, M., Yamanaka, K., Wakayama, T., Saitou, M., 2009. A sig-naling principle for the specification of the germ cell lineage in mice. Cell 137,571–584.

Özhan-Kizil, G., Havemann, J., Gerberding, M., 2009. Germ cells in the crustacean Par-hyale hawaiensis depend on Vasa protein for their maintenance but not for theirformation. Dev. Biol. 327, 230–239.

Peel, A.D., Averof, M., 2010. Early asymmetries in maternal transcript distribution asso-ciated with a cortical microtubule network and a polar body in the beetle Triboliumcastaneum. Dev. Dyn. 239, 2875–2887.

Pfister, D., De Mulder, K., Hartenstein, V., Kuales, G., Borgonie, G., Marx, F., Morris, J.,Ladurner, P., 2008. Flatworm stem cells and the germ line: developmental and evo-lutionary implications of macvasa expression in Macrostomum lignano. Dev. Biol.319, 146–159.

Philippe, H., Derelle, R., Lopez, P., Pick, K., Borchiellini, C., Boury-Esnault, N., Vacelet, J.,Renard, E., Houliston, E., Quéinnec, E., Da Silva, C., Wincker, P., Le Guyader, H., Leys,S., Jackson, D.J., Schreiber, F., Erpenbeck, D., Morgenstern, B., Wörheide, G., Manuel,M., 2009. Phylogenomics revives traditional views on deep animal relationships.Curr. Biol. 19, 706–712.

Philippe, H., Brinkmann, H., Lavrov, D.V., Littlewood, D.T., Manuel, M., Wörheide, G.,Baurain, D., 2011. Resolving difficult phylogenetic questions: why more sequencesare not enough. PLoS Biol. 9, e1000602.

Pilon, M., Weisblat, D.A., 1997. A nanos homolog in leech. Development 124, 1771–1780.Rabinowitz, J.S., Chan, X.Y., Kingsley, E.P., Duan, Y., Lambert, J.D., 2008. Nanos is re-

quired in somatic blast cell lineages in the posterior of a mollusk embryo. Curr.Biol. 18, 331–336.

Raz, E., 2003. Primordial germ-cell development: the zebrafish perspective. Nat. Rev.Genet. 4, 690–700.

Rebscher, N., Zelada-González, F., Banisch, T.U., Raible, F., Arendt, D., 2007. Vasa unveilsa common origin of germ cells and of somatic stem cells from the posterior growthzone in the polychaete Platynereis dumerilii. Dev. Biol. 306, 599–611.

Rebscher, N., Volk, C., Teo, R., Plickert, G., 2008. The germ plasm component vasa allowstracing of the interstitial stem cells in the cnidarian Hydractinia echinata. Dev. Dyn.237, 1736–1745.

Saffman, E.E., Lasko, P., 1999. Germline development in vertebrates and invertebrates.Cell. Mol. Life Sci. 55, 1141–1163.

Sagawa, K., Yamagata, H., Shiga, Y., 2005. Exploring embryonic germ line developmentin the water flea, Daphnia magna, by zinc-finger-containing VASA as a marker.Gene Expr. Patterns 5, 669–678.

Saito, T., Otani, S., Fujimoto, T., Suzuki, T., Nakatsuji, T., Arai, K., Yamaha, E., 2004. Thegerm line lineage in ukigori, Gymnogobius species (Teleostei: Gobiidae) during em-bryonic development. Int. J. Dev. Biol. 48, 1079–1085.

Salinas, L.S., Maldonado, E., Macías-Silva, M., Blackwell, T.K., Navarro, R.E., 2007. TheDEAD box RNA helicase VBH-1 is required for germ cell function in C. elegans.Genesis 45, 533–546.

Sato, K., Shibata, N., Orii, H., Amikura, R., Sakurai, T., Agata, K., Kobayashi, S., Watanabe,K., 2006. Identification and origin of the germline stem cells as revealed by theexpression of nanos-related gene in planarians. Dev. Growth Differ. 48, 615–628.

Schröder, R., 2006. vasa mRNA accumulates at the posterior pole during blastoderm for-mation in the flour beetle Tribolium castaneum. Dev. Genes Evol. 216, 277–283.

Seipel, K., Yanze, N., Schmid, V., 2004. The germ line and somatic stem cell gene Cniwiin the jellyfish Podocoryne carnea. Int. J. Dev. Biol. 48, 1–8.

Sekizaki, H., Takahashi, S., Tanegashima, K., Onuma, Y., Haramoto, Y., Asashima, M.,2004. Tracing of Xenopus tropicalis germ plasm and presumptive primordial germcells with the Xenopus tropicalis DAZ-like gene. Dev. Dyn. 229, 367–372.

Shirae-Kurabayashi, M., Nishikata, T., Takamura, K., Tanaka, K.J., Nakamoto, C.,Nakamura, A., 2006. Dynamic redistribution of vasa homolog and exclusion ofsomatic cell determinants during germ cell specification in Ciona intestinalis.Development 133, 2683–2693.

Smith, J.M., Cridge, A.G., Dearden, P.K., 2010. Germ cell specification and ovary struc-ture in the rotifer Brachionus plicatilis. Evodevo 1, 5.

Subramaniam, K., Seydoux, G., 1999. nos-1 and nos-2, two genes related to Drosophilananos, regulate primordial germ cell development and survival in Caenorhabditiselegans. Development 126, 4861–4871.

Sugio, M., Takeuchi, K., Kutsuna, J., Tadokoro, R., Takahashi, Y., Yoshida-Noro, C.,Tochinai, S., 2008. Exploration of embryonic origins of germline stem cells andneoblasts in Enchytraeus japonensis (Oligochaeta, Annelida). Gene Expr. Patterns8, 227–236.

Sun, M.G., Williams, J., Munoz-Pinedo, C., Perkins, G.A., Brown, J.M., Ellisman, M.H.,Douglas, R., Green, D.R., Frey, G.T., 2007. Correlated three-dimensional light andelectron microscopy reveals transformation of mitochondria during apoptosis.Nat. Cell Biol. 9, 1057–1065.

Sunanaga, T., Saito, Y., Kawamura, K., 2006. Postembryonic epigenesis of Vasa-positivegerm cells from aggregated hemoblasts in the colonial ascidian, Botryllus primi-genus. Dev. Growth Differ. 48, 87–100.

Sunanaga, T., Satoh, M., Kawamura, K., 2008. The role of Nanos homologue in gameto-genesis and blastogenesis with special reference to male germ cell formation in thecolonial ascidian, Botryllus primigenus. Dev. Biol. 324, 31–40.

Swartz, S.Z., Chan, X.Y., Lambert, J.D., 2008. Localization of Vasa mRNA during earlycleavage of the snail Ilyanassa. Dev. Genes Evol. 218, 107–113.

Tadokoro, R., Sugio, M., Kutsuna, J., Tochinai, S., Takahashi, Y., 2006. Early segregation ofgerm and somatic lineages during gonadal regeneration in the annelid Enchytraeusjaponensis. Curr. Biol. 16, 1012–1017.

Takamura, K., Fujimura, M., Yamaguchi, Y., 2002. Primordial germ cells originate from theendodermal strand cells in the ascidian Ciona intestinalis. Dev. Genes Evol. 212, 11–18.

Tamori, Y., Iwai, T., Mita, K., Wakahara, M., 2004. Spatio-temporal expression of a DAZ-like gene in the Japanese newt Cynops pyrrhogaster that has no germ plasm. Dev.Genes Evol. 214, 615–627.

Technau, U., Steele, R.E., 2011. Evolutionary crossroads in developmental biology:Cnidaria. Development 138, 447–458.

Torras, R., Gonzalez-Crespo, S., 2005. Posterior expression of nanos orthologs duringembryonic and larval development of the anthozoan Nematostella vectensis. Int.J. Dev. Biol. 49, 895–899.

Torras, R., Yanze, N., Schmid, V., González-Crespo, S., 2004. nanos expression at the em-bryonic posterior pole and the medusa phase in the hydrozoan Podocoryne carnea.Evol. Dev. 6, 362–371.

Tsunekawa, N., Naito, M., Sakai, Y., Nishida, T., Noce, T., 2000. Isolation of chicken vasahomolog gene and tracing the origin of primordial germ cells. Development 127,2741–2750.

Voronina, E., Lopez, M., Juliano, C.E., Gustafson, E., Song, J.L., Extavour, C., George, S.,Oliveri, P., McClay, D., Wessel, G., 2008. Vasa protein expression is restricted tothe small micromeres of the sea urchin, but is inducible in other lineages early indevelopment. Dev. Biol. 314, 276–286.

Voronina, E., Seydoux, G., Sassone-Corsi, P., Nagamori, I., 2011. RNA granules in germcells. Cold Spring Harb. Perspect. Biol. 3. doi:10.1101/cshperspect.a002774.

Watanabe, H., Hoang, V.T., Mättner, R., Holstein, T.W., 2009. Immortality and the baseof multicellular life: lessons from cnidarian stem cells. Semin. Cell Dev. Biol. 20,1114–1125.

Weismann, A., 1883. Die Entstehung der Sexualzellen bei den Hydromedusen. GustavFischer, Jena.

Weismann, A., 1893. Germ-Plasm, a Theory of Heredity. Scribners, New York. Englishtranslation by W. N. Parker and H. Ronnfeldt.

Wu, H.R., Chen, Y.T., Su, Y.H., Luo, Y.J., Holland, L.Z., Yu, J.K., 2011. Asymmetric localiza-tion of germline markers Vasa and Nanos during early development in the amphi-oxus Branchiostoma floridae. Dev. Biol. 353, 147–159.

Yajima, M., Wessel, G.M., 2011. Small micromeres contribute to the germline in the seaurchin. Development 138, 237–243.

Ying, Q.L., Nichols, J., Chambers, I., Smith, A., 2003. BMP induction of Id proteins sup-presses differentiation and sustains embryonic stem cell self-renewal in collabora-tion with STAT3. Cell 115, 281–292.