loss of tankyrase-mediated destruction of 3bp2 is the underlying pathogenic mechanism of cherubism

Loss of Tankyrase-Mediated Destructionof 3BP2 Is the Underlying PathogenicMechanism of CherubismNoam Levaot,1,6 Oleksandr Voytyuk,1,6 Ioannis Dimitriou,1 Fabrice Sircoulomb,1 Arun Chandrakumar,1 Marcel Deckert,2

Paul M. Krzyzanowski,1 Andrew Scotter,1 Shengqing Gu,1 Salima Janmohamed,1 Feng Cong,3 Paul D. Simoncic,1

Yasuyoshi Ueki,4 Jose La Rose,1 and Robert Rottapel1,5,*1Ontario Cancer Institute and the Campbell Family Cancer Research Institute, 101 College Street, Rm 8-703, Toronto Medical Discovery

Tower, University of Toronto, Toronto, Ontario M5G 1L7, Canada2INSERM, UMR576, University of Nice, Sophia-Antipolis, Nice F-06202, France3Developmental and Molecular Pathways, Novartis Institute of Biomedical Research, Cambridge, MA 02139, USA4School of Dentistry, University of Missouri-Kansas City, 650 E 25th Street, Kansas City, MO 64108, USA5Division of Rheumatology, Department of Medicine, Saint Michael’s Hospital, 30 Bond Street, Toronto, Ontario M5B 1W8, Canada6These authors contributed equally to the work

*Correspondence: [email protected]

DOI 10.1016/j.cell.2011.10.045

SUMMARY

Cherubism is an autosomal-dominant syndromecharacterized by inflammatory destructive bonylesions resulting in symmetrical deformities of thefacial bones. Cherubism is caused by mutations inSh3bp2, the gene that encodes the adaptor protein3BP2. Most identified mutations in 3BP2 lie withinthe peptide sequence RSPPDG. A mouse model ofcherubism develops hyperactive bone-remodelingosteoclasts and systemic inflammation character-ized by expansion of the myelomonocytic lineage.The mechanism by which cherubism mutations alter3BP2 function has remained obscure. Here we showthat Tankyrase, a member of the poly(ADP-ribose)polymerase (PARP) family, regulates 3BP2 stabilitythrough ADP-ribosylation and subsequent ubiquity-lation by the E3-ubiquitin ligase RNF146 in osteo-clasts. Cherubism mutations uncouple 3BP2 fromTankyrase-mediated protein destruction, whichresults in its stabilization and subsequent hyperacti-vation of the SRC, SYK, and VAV signaling pathways.

INTRODUCTION

Cherubism is a dominantly inherited disorder characterized by

facial disfigurement, early tooth loss, failure of permanent tooth

eruption, and distortion of the orbital socket creating an upturned

eye appearance occasionally associated with blindness (Jones

et al., 1950). Interosseous fibrocystic lesions arise in cherubism

patients as a result of highly activated osteoclasts and infiltrating

inflammatory and mesenchymal cells. The cherubism locus was

mapped to chromosome 4p16 (Tiziani et al., 1999) with subse-

quent identification of single missense mutations in the gene en-

coding the adaptor protein 3BP2 within this locus (Ueki et al.,

1324 Cell 147, 1324–1339, December 9, 2011 ª2011 Elsevier Inc.

2001). 3BP2 contains an N-terminal pleckstrin homology (PH)

domain, a proline-rich stretch that binds to Src homology (SH) 3

domain-containing proteins, and a C-terminal SH2 domain that

binds to phosphotyrosine residues (Deckert, 2006) (Figure 1D).

Most 3BP2 mutations associated with cherubism cluster within

peptide sequence RSPPDG lying between the PH and SH2

domains. A mouse model of cherubism in which the most

common disease-associated allele, P416R, was knocked into

the Sh3bp2 locus develops severe osteoporosis associated

with highly activated osteoclasts and demonstrated thatmutation

within this peptide sequence results in a gain-of-function pheno-

type (Ueki et al., 2007). Analysis of mice harboring two copies of

the cherubismallele uncovered 3BP2 as amajor governor ofmye-

lomonocytic homeostatic cell numbers. Homozygous mice die of

a systemic inflammation disorder at 25weeks of age as a result of

myelomonocytic infiltrationof theskin, synovial lining, andvisceral

organs associated with elevated serum TNF-a levels, trabecular

bone loss, and cortical bone erosions (Ueki et al., 2007).

3BP2 was originally identified as a binding protein of the tyro-

sine kinase ABL SH3 domain through proline-rich sequences

lying between the PH and SH2 domains (Cicchetti et al., 1992).

3BP2 is part of a multiprotein signaling complex composed of

the SRC family kinases (SFKs), SYK, and the RHO family guanine

nucleotide exchange factor VAV (Deckert and Rottapel, 2006)

and is required for optimal B cell antigen receptor (Chen et al.,

2007; de la Fuente et al., 2006) and integrin activation (Levaot

et al., 2011). The biochemical basis by which cherubism muta-

tions alter the activity of the 3BP2 adaptor protein has remained

elusive. The tight cluster of mutations in the peptide sequence of

3BP2 observed in cherubism patients suggested to us that this

sequence might define a protein interaction motif.

Here we identify the poly(ADP-ribose)polymerase (PARP)

family member Tankyrase as the protein that binds to the

RSPPDG sequence and serves to repress 3BP2 protein levels

through ADP-ribosylation and subsequent ubiquitylation by the

E3-ubiquitin ligase RNF146. We demonstrate that cherubism

mutations disrupt 3BP2 binding to Tankyrase and stabilize the

mailto:[email protected]

http://dx.doi.org/10.1016/j.cell.2011.10.045

Figure 1. 3BP2 Cherubism Mutant Protein Is Stabilized

(A) 3BP2 protein expression in macrophages derived from WT, Sh3bp2KI/+, or Sh3bp2KI/KI mice was determined by western blot analysis.

(B) Quantitative PCR of sh3bp2 mRNA derived from WT, Sh3bp2KI/+, or Sh3bp2KI/KI macrophages. Error bars represent SEM.

(C) Cycloheximide chase to ascertain 3BP2 protein stability in WT or Sh3bp2KI/KI bone marrow-derivedmacrophages (BMMs). BMMs obtained from either WT or

Sh3bp2KI/KI mice were treated with cycloheximide for the indicated time intervals and lysed, and 3BP2 protein levels determined by western blot analysis. The

percentages of 3BP2 protein levels were plotted as a function of time.

(D) 3BP2 and TNKS2 domain organization. 3BP2 is a PH and SH2 domain-containing adaptor protein. The RSSPDG sequence mutated in cherubism patients is

shown. TNKS2 contains five repeat clusters (ARCs), a SAM domain, and the PARP domain.

(E) 3BP2 bind both TNKS and TNKS2. Myc-Tankyrase western blot of Flag-3BP2 immune complexes expressed in HEK293T cells.

(F) 3BP2 but not cherubism mutants bind to TNKS2. Tankyrase western blot of GST-3BP2 and GST-3BP2 cherubism mutant immune complexes.

(G) The 3BP2 targeting peptide (Hex) is sufficient to bind to TNKS2. Immobilized GST, GST-Hex(WT), or GST-Hex cherubismmutations R413Q, P416H, or G418R

were incubated with lysates from HEK293T cells overexpressing Myc-TNKS2 and probed for Myc-TNKS2 by western blot. The levels of the recombinant GST-

Hex peptide were evaluated by Coomassie staining.

See also Figure S1.

Cell 147, 1324–1339, December 9, 2011 ª2011 Elsevier Inc. 1325

Figure 2. 3BP2 Is ADP-Ribosylated by TNKS2 In Vitro and In Vivo

(A) Ribosylation of 3BP2 and TNKS2 in vitro require the SAM and PARP domains of TNKS2. Flag-3BP2 immune complexes were subjected to an in vitro PARP

reaction using [32P]NAD+. Proteins were separated by SDS-PAGE and visualized by autoradiography.

(B) The PARP inhibitor PJ-34 inhibits TNKS2-dependent ribosylation of 3BP2. Flag-3BP2 immune complexes were subjected to an in vitro PARP reaction in the

presence of increasing concentration of PJ-34. Lower panel, quantified inhibition of TNKS2 PARP activity by PJ-34, as evaluated by Myc-TNKS2 autor-

ibosylation.

(C) 3BP2 but not cherubismmutants of 3BP2 are ribosylated by TNKS2. Flag-3BP2 or Flag-3BP2 cherubismmutants were subjected to an in vitro PARP reaction.

Ribosylation was measured by autoradiography.


3BP2 protein. Our accompanying manuscript (Guettler et al.,

2011 [this issue of Cell]) provides the structural basis of 3BP2

peptide recognition by the ankyrin repeats of Tankyrase, amech-

anism shared by all known Tankyrase substrates. The structural

insights enable us to rationalize how cherubism mutations allow

3BP2 to escape recruitment by Tankyrase. Elevated steady-state

protein levels of 3BP2 observed in primary osteoclasts derived

from cherubism mutant mice are associated with high levels of

SRC, SYK, and VAV activity, whereas osteoclasts lacking 3BP2

are unable to normally activate SRC, SYK, and VAV. Lastly, we

show that inhibition of Tankyrase in osteoclasts in vitro or deple-

tion of Tankyrase in vivo recapitulates many of the phenotypic

features of cherubism. These genetic and pharmacologic exper-

iments provide direct evidence that Tankyrase is a negative regu-

lator of the SRC signaling pathway through its action on 3BP2.

Our study elucidates the biochemical basis underlying the path-

ogenesis of cherubism and uncovers Tankyrase as a previously

unknown component of a regulatory pathway controlling bone

homeostasis and inflammatory cytokine production.

RESULTS

Cherubism Mutations Increase 3BP2 Protein StabilityWe examined the levels of 3BP2 protein expressed in osteoclast

progenitors, primary bone marrow-derived macrophages from

wild-type (WT) mice (Figure 1A, lanes 1 and 2) or mice harboring

one (Sh3bp2KI/+) (Figure 1A, lanes 3 and 4) or two alleles

(Sh3bp2KI/KI) (Figure 1A, lanes 5 and 6) of the cherubismmutation

P416R. Strikingly, the steady-state level of 3BP2 was increased

in macrophages derived from both the hetero- and homozygote

cherubism mutant mice. Quantitative PCR indicated that the

levels of sh3bp2 mRNA in macrophages were similar between

the three different mice strains (Figure 1B). This observation

raised the possibility that cherubism arises as a result of a gain-

of-functionmutation leading to theaccumulationof 3BP2protein.

To determine whether the cherubism mutation altered the

stability of 3BP2, we performed a cycloheximide chase experi-

ment onWT- orSh3bp2KI/KI-derivedbonemarrowmacrophages.

As shown in Figure 1C, the half-life of the WT 3BP2 protein was

6.5 hr compared to 31.4 hr for the cherubism mutant form of

the protein. These data demonstrate that the P416R cherubism

mutation increases the protein stability of 3BP2.

3BP2 Binds to Tankyrase, an Interaction Disruptedby Cherubism MutationsWe conjectured that the 3BP2-RSPPDG sequence might define

a docking site for a negative regulatory protein responsible for

controlling 3BP2 protein levels and that docking is impaired by

the cherubism mutations. We used the yeast two-hybrid system

with full-length 3BP2 as bait to identify 3BP2-binding proteins

from a hematopoietic cell library. From this screen we identified

Tankyrase 2 (TNKS2) as a potential 3BP2-interacting protein.

TNKS2 is a member of the PARP family of proteins, which cata-

(D)RibosylatedTNKS2 ispresent in3BP2butnotcherubismmutantprotein comple

protein complexeswere dissociated in 1%SDSheated to 68�C then subjected to r

(E) Endogenous 3BP2 but not a cherubism mutant is ribosylated in primary o

Sh3bp2KI/KI bone marrow-derived osteoclasts were probed with anti-PAR-speci

lyze the addition of ADP-ribose from NAD+ to acceptor proteins.

TNKS2 is most closely related to Tankyrase 1 (TNKS), a protein

originally identified as a repressor of the telomerase inhibitor

TRF1/TERF1 (Smith et al., 1998). TNKS and TNKS2 contain five

ankyrin repeat clusters (ARCs, see accompanying manuscript

[Guettler et al., 2011]), a sterile-alpha motif (SAM) domain medi-

atingmultimerization, and thePARPcatalytic domain (Figure 1D).

We showed that epitope-tagged versions of both TNKS and

TNKS2 bind to 3BP2 in transfected HEK293T cells (Figure 1E).

We next tested the capacity of 3BP2 proteins harboring any

one of three independent cherubism mutations within the

RSPPDG motif, R413Q, P416H, or G418R, to bind to TNKS2

and showed that none of the cherubism mutants were able to

bind to TNKS2 (Figure 1F, lane 5–7). In contrast, a mutant form

of 3BP2 that contains a mutation in its SH2 domain (R486K),

rendering it unable to bind to phosphotyrosine-containing

proteins (Sada et al., 2002), bound to TNKS2 comparably to the

WT protein (Figure 1F, lane 4). These data demonstrate that the

cherubismmutations disrupt binding between 3BP2 and TNKS2.

A recombinant GST-fusion protein containing the 3BP2

RSPPDG six amino acid sequence (GST-Hex) immobilized on

glutathione Sepharose was sufficient to recruit TNKS2 from

HEK293T cell lysates (Figure 1G, lane 5) but not resin alone or

resin coupled to GST (Figure 1G, lanes 3 and 4). However,

GST-Hex peptides containing any of the three cherubism muta-

tions failed to interact with TNKS2 (Figure 1G, lanes 6–8). These

data and those presented in Figure 1F show that the RSPPDG

sequence in 3BP2 mutated in cherubism patients is both neces-

sary and sufficient to mediate binding with TNKS2.

Wemapped the interaction between 3BP2andTNKS2by dele-

tionmutagenesis. TNKS2 constructs lacking either the first or the

secondhalf of theankyrin regionbound to 3BP2,whereasbinding

was lost when the entire ankyrin region was deleted (Figure S1

available online). This suggests that 3BP2 likely binds to more

thanoneof theARCs inTNKS2asconfirmed inouraccompanying

manuscript (Guettler et al., 2011). The interaction between 3BP2

and TNKS2 was not dependent on the SAM domain (Figure S1).

Using fluorescence polarization, we quantified binding between

the recombinant N-terminal region of TNKS2 containing all five

ARCsand the 3BP2Tankyrase-targetingpeptide anddetermined

a dissociation constant of 0.5 ± 0.1 mM (see Guettler et al., 2011).

Wild-Type 3BP2 but Not 3BP2 Cherubism MutantsAre Ribosylated by TankyraseTo determine whether 3BP2 is a TNKS2 substrate, we performed

an in vitro ribosylation assay. Radioactive [32P]NAD+ was added

as a source of ADP-ribose to 3BP2 immune complexes precipi-

tated fromHEK293T cells overexpressing TNKS2 and 3BP2. The

reaction was resolved by SDS-PAGE and revealed by autoradi-

ography. We observed two bands corresponding to the size of

3BP2 (�80 kDa) and TNKS2 (�120 kDa), respectively, or a yet

to be identified copurifying protein (Figure 2A, lane 2).

Ribosylation wasmuch stronger for the higher-molecular-weight

xes. Flag-3BP2andMyc-TNKS2werecoexpressed inHEK293Tcells. Flag-3BP2

eprecipitationwith an anti-Myc antibody and probedwith an anti- PAR antibody.

steoclasts. Western blots of 3BP2 immune complexes derived from WT or

fic antibodies. See also Figure S2.


Figure 3. TNKS2 Controls 3BP2 Protein Levels through Ubiquitin-Mediated Proteolysis

(A) Proteasome inhibition by MG132 and LLnL reverses TNKS2-dependent suppression of 3BP2 protein levels.

(B) Ubiquitylation of 3BP2 is stimulated by TNKS2 and requires PARP activity. HEK293T cells were transfected with TNKS2 and HA-ubiquitin and incubated with

proteosome or PARP inhibitors as indicated. Endogenous 3BP2 was immunoprecipitated and probed for HA-ubiquitin.

(C) TNKS2 stimulates ubiquitin-K48 modification of 3BP2. GST-3BP2 or GST-3BP2R413Q was expressed in HEK293T in the absence or presence of TNKS2.

GST-3BP2 proteins were precipitated and probed with anti-UbK48-specific antibodies.

(D) The E3-ubiquitin ligase RNF146 binds to 3BP2 but not a cherubism mutant. Flag-3BP2 or Flag-3BP2R413Q immune complexes were probed for HA-RNF146

or Myc-TNKS2. The levels of protein expression for each condition are indicated in the panels below.


species compared to the lower-molecular-weight protein and

was dependent on an intact TNKS2 SAMand PARP domain (Fig-

ure 2A, lanes 3 and 4). Addition of the PARP inhibitor PJ-34

(10 mM) at a concentration above the half-maximal inhibitory

concentration (IC50) for Tankyrasewas sufficient to inhibit ribosy-

lation of both the lower- and higher-molecular-weight ribosy-

lated species (Figure 2B, lane 3).

To determine the effect of the cherubism mutation on 3BP2 ri-

bosylation, we subjected three mutant forms of 3BP2, R413Q,

P416H, or G418R, derived from cherubism patients to an

in vitro ribosylation assay. Whereas WT 3BP2 and TNKS2

formed a complex and were ribosylated (Figure 2C, lane 3),

none of the three cherubism mutants bound to TNKS2 nor

became ribosylated (Figure 2C, lanes 4–6), suggesting that the

biochemical defect observed in cherubism may result from the

failure of 3BP2 to bind to TNKS2 and be modified by ADP-ribose

conjugation.

To confirm the identity of the ribosylated 120 kDa species

present in 3BP2 immune complexes, we dissociated proteins

in 1%heated SDS, reprecipitated TNKS2, and probed the immu-

noprecipitates with either an antibody that recognizes ADP-

ribose (PAR) or an anti-TNKS2 antibody. We confirmed that

TNKS2 is autoribosylated in 3BP2 immune complexes (Fig-

ure 2D, lane 3) but not in cherubism mutant 3BP2 protein

complexes (Figure 2D, lanes 4–6).

We next sought to determine whether endogenous 3BP2 is

ribosylated in primary osteoclasts. 3BP2 immune complexes

derived from WT or Sh3bp2KI/KI osteoclasts were probed with

the anti-PAR antibody. We observed that endogenous 3BP2

was ribosylated and was associated with an abundantly ribosy-

lated protein with a molecular weight similar to TNKS2 and high-

molecular-weight ribosylated species of unknown identity. Ribo-

sylation was dramatically reduced in 3BP2 protein complexes

derived from osteoclasts obtained from cherubism mice (Fig-

ure 2E). Again we noticed that the level of 3BP2 protein present

in the Sh3bp2KI/KI-derived osteoclasts was significantly elevated

compared to theWT controls (Figure 2E, row 2). We showed that

an N-terminal fragment of 3BP2 containing the RSPPDG

sequence and a C-terminal fragment beginning with the

RSPPDG sequence were both ribosylated by Tankyrase,

showing that 3BP2 is either modified at multiple sites throughout

the protein, or a single ribosylation site lies in the 13 amino acid

stretch common to both constructs (Figure S2A).

Although we found that the Tankyrase-binding sequence in

3BP2 is sufficient for the recruitment of Tankyrase (see above),

it remained possible that its position in 3BP2 contributes to

Tankyrase recruitment and/or ribosylation. To determine the

positional effects of the Tankyrase-binding sequence on 3BP2

stability and ribosylation, we created a chimeric protein in which

(E) Binding of RNF146 to 3BP2 is ADP-ribosylation dependent. Flag-3BP2 or Flag

Tankyrase inhibitor XAV-939 were probed for HA-RNF146 or Myc-TNKS2.

(F) Ubiquitylation of 3BP2 requires the ring finger and the WWE domain of RNF14

3BP2 ubiquitylation. HA-RNF146, HA-RNF146DWWE, or HA-RNF146DRF were c

were probed with anti-UbK48-specific antibodies.

(G) Depletion of RNF146 stabilizes 3BP2 protein levels. HEK293T cells were transf

nonspecific shRNAs. Endogenous 3BP2 and actin proteins were probed by wes

See also Figure S3.

the nonmutated RSPPDG sequence was added to the C

terminus of the cherubism mutant 3BP2R413Q. Tankyrase was

able to bind to the chimeric protein but was unable to alter the

steady-state levels of the chimeric protein or induce ribosylation

(Figures S2B–S2D). These data suggest that 3BP2 ribosylation

and destabilization are sensitive to the position of the Tankyr-

ase-binding sequence in 3BP2.

Ribosylation of the Wild-Type but Not a CherubismMutant Form of 3BP2 by TNKS2 Induces 3BP2Ubiquitylation and Subsequent DegradationWe investigated whether TNKS2 could directly regulate 3BP2

protein levels. Wild-type 3BP2 or the cherubism mutant

3BP2R413Q was coexpressed with increasing amounts of the

TNKS2 expression vector. We observed that whereas the

steady-state level of 3BP2 was inversely related to TNKS2

protein level, the 3BP2R413Qmutant was resistant to the effects

of TNKS2 overexpression (Figure S3A). To determine whether

the PARP domain was required for TNKS2-induced 3BP2 desta-

bilization, we repeated the experiment with a PARP domain-

deleted mutant form of TNKS2. Although TNKS2DPARP and

3BP2 formed a complex (see Figure S3B, row 3), 3BP2 protein

levels were unaffected by increasing levels of TNKS2DPARP

(Figure S3B). These data show that the ability of TNKS2 to per-

turb 3BP2 protein levels is not a result of binding alone but

requires the intact TNKS2 catalytic domain.

We sought to elucidate the mechanism underlying the regula-

tion of 3BP2 protein stability by TNKS2. Conceivably, TNKS2-

mediated ribosylation could mark 3BP2 for ubiquitylation and

subsequent proteasome-mediated degradation. To test this

possibility, we coexpressed 3BP2 and TNKS2 in the absence

or presence of proteasome inhibitors. We observed that the

diminished steady-state levels of 3BP2 resulting from coexpres-

sion of TNKS2 were reversed in the presence of proteasome

inhibitors (Figure 3A). We noticed that TNKS2 levels were dimin-

ished when coexpressed with WT 3BP2 but not cherubism

mutants (Figures 1E, 1F, 2C, and 2D), suggesting that both

components of the complex are rendered unstable by the inter-

action and stabilized by proteasome inhibition. We sought to

determine whether endogenous 3BP2 was ubiquitylated in

response to TNKS2 expression. A tagged version of ubiquitin

was expressed in cells in the presence or absence of ectopically

expressed TNKS2. Endogenous 3BP2 was then immunoprecip-

itated and probed by western blotting for ubiquitin modification.

Whereas little ubiquitin was detected in 3BP2 immunoprecipi-

tates in the absence of TNKS2, intense ubiquitylation of proteins

present in the 3BP2 complex, seen as a diffuse smear, was

induced when TNKS2 was coexpressed (Figure 3B, lane 2

versus lane 4).

-3BP2R413Q immune complexes derived from cells cultured in the presence of

6. HA-RNF146 but not HA-RNF146DWWE or HA-RNF146DRF mutants induce

oexpressed with Flag-3BP2 and Myc-TNKS2. Flag-3BP2 immune complexes

ected with one of three individual shRNAs targeting RNF146 (shRNF1–3) or two

tern blot.


Figure 4. Elevated Levels of Wild-Type 3BP2 Protein Are Sufficient to Induce Enhanced Osteoclast Formation and TNF-a Secretion by

Macrophages

(A) Lysates from RAW264.7 cell infected with retroviruses expressing WT Flag-3BP2, Flag-3BP2P416R, or empty vector were probed with anti-Flag antibodies.

(B) TRAP-positive multinucleated osteoclast cells derived from RAW264.7 infected cells as in (A). Images obtained using a Leica inverted microscope with 53

objectives.

(C) TNF-a levels in supernatants from RAW264.7 infected cells as in (A) from four independent experiments are shown. Error bars represent SEM.


To determine whether TNKS2 PARP activity was required to

stimulate 3BP2 ubiquitylation, we repeated the experiment in

the presence of the nonselective PARP inhibitor PJ-34 and

observed that the TNKS2 induction of 3BP2 ubiquitylation was

blocked (Figure 3B, lanes 5 and 6). We confirmed that 3BP2 is

itself ubiquitylated, by a precipitation-reprecipitation experiment

under denaturing conditions (Figure S3C). These data show that

endogenous 3BP2 ubiquitylation is stimulated by TNKS2 and

requires PARP activity.

To ascertain the form of TNKS2-dependent ubiquitinmodifica-

tion of 3BP2, we used a monoclonal antibody, which recognizes

lysine 48 (Ub-K48), and observed that TNKS2 induced intense

stepwise K48 ubiquitin modification, likely of 3BP2 (Figure 3C,

lane 2). To determine the effect of the cherubism mutation on

3BP2 ubiquitylation, we expressed WT 3BP2 or the cherubism

mutant 3BP2R413Q in the absence or presence of TNKS2.

Whereas WT 3BP2 became polyubiquitylated in the presence

of TNKS2, the 3BP2 cherubism mutant poorly incorporated

ubiquitin (Figure 3C, lanes 3 and 4).

The E3-ubiquitin ligase RNF146 has recently been shown to

regulate the Tankyrase-dependent ubiquitylation of Axin2

(Zhang et al., 2011). RNF146 may be widely employed as an

ubiquitin ligase for additional Tankyrase substrates, and we

tested whether RNF146 also targets ribosylated 3BP2. We

showed that RNF146 binds to 3BP2 but not to a cherubism

mutant or to WT 3BP2 in cells in which Tankyrase PARP activity

has been inhibited by the Tankyrase-selective inhibitor XAV939

(Figures 3D and 3E). Importantly, coexpression of RNF146 abol-

ished the detection of the 3BP2:Tankyrase complex, suggesting

that RNF146 might be part of a destruction complex involving

3BP2 and Tankyrase (Figures 3D and 2E, 2nd row). Moreover,

WT RNF146, but not a mutant form of the ligase lacking its ring

finger or the WWE ADP-ribose-binding domain, potently stimu-

lated K48 ubiquitylation of 3BP2 (Figure 3F). Depletion of

RNF146 in HEK293T cells by three independent interfering

RNA hairpin lentiviruses, which efficiently knocked down

RNF146 transcript, resulted in increased steady-state levels of

3BP2 (Figures 3G and S3D), demonstrating that RNF146 is the

functional E3-ligase controlling 3BP2 protein levels.

Elevated Levels of Wild-Type 3BP2 ProteinAre Sufficient to Induce Enhanced OsteoclastFormation and TNF-a Secretion by MacrophagesOur data demonstrate that cherubism mutations result in the

stabilization of 3BP2 protein as a result of loss of repression by

Tankyrase. We next asked whether the cherubism-associated

characteristics of an in vitro culture of osteoclasts result from

elevated 3BP2 levels or from some other neomorphic changes

(D) SRC, SYK, and VAV are hyperphosphorylated in Sh3bp2KI/KI osteoclasts. Lys

phosphospecific antibodies against SRC, SYK, or VAV (left panel). The total prot

(E) SRC kinase activity is elevated in Sh3bp2KI/KI osteoclasts. Bone marrow-deri

subjected to a SRC-specific immune complex in vitro kinase reaction. The specific

the level of SRC expression.

(F) SYK immune complex in vitro kinase reaction performed as in (E).

(G) RAC-GTP levels are elevated inSh3bp2KI/KI osteoclasts. RAC-GTP levels in ost

pull-down assay. RAC-GTP levels in the WT osteoclasts were normalized to 1,

compared to WT values.

associated with these mutations. We overexpressed WT 3BP2

or the cherubism mutant allele P416R at similar levels using

retroviral transduction in the RAW264.7 monocytic cell line,

which have osteoclastogenic potential (Figure 4A). We observed

that overexpression of either WT 3BP2 or the 3BP2P416R cher-

ubism mutant induced the formation of multinucleated Tartrate-

resistant acid phosphatase (TRAP) positive cells in the absence

of RANKL while no multinucleated cells were observed in empty

vector-transduced control cells (Figure 4B). Moreover,

RAW264.7 cells ectopically expressing either WT or a cherubism

mutant variant of 3BP2 secreted high levels of TNF-a compared

to vector-infected controls (Figure 4C). These results demon-

strate that elevated levels of WT 3BP2 protein are sufficient to

induce enhanced osteoclast formation in the absence of RANKL

and increased TNF-a secretion by macrophages consistent with

the idea that the basis of cherubsim results from elevated levels

of 3BP2 and not due to a neomorphic protein property of the

protein.

Enhanced Activation of SRC, SYK, and VAVin Cherubism Osteoclasts3BP2 nucleates a signaling complex that contains SRC kinases,

SYK, and the guanine nucleotide exchange factor VAV (Deckert

and Rottapel, 2006). To understand the effect of 3BP2 stabiliza-

tion on the signaling pathways that 3BP2 connects to, we

examined the phosphorylation levels of SRC, SYK, and VAV as

a surrogate of their activation state. SRC, SYK, and VAV were

highly tyrosine phosphorylated in osteoclasts derived from

Sh3bp2KI/KI mice compared to osteoclasts from control mice,

whereas total SYK, SRC, and VAV protein levels were similar in

osteoclasts derived from both mouse strains (Figure 4D). To

verify that the activities of SRC and SYK were elevated, we per-

formed in vitro kinase assays on both proteins. Both SRC (Fig-

ure 4E) and SYK (Figure 4F) autophosphorylation levels were

elevated in cherubism osteoclasts compared to normal controls.

Similarly, the increased levels of VAV phosphorylation correlated

with elevated levels of RAC-GTP in the osteoclasts from cherub-

ism mice as measured by a PAK-CRIB RAC binding pull-down

assay (Figure 4G, lanes 3 and 6).

TNKS/TNKS2-Depleted Osteoclasts PhenocopyCherubism OsteoclastsTo test whether the failure of TNKS2-mediated negative regula-

tion of 3BP2 observed in cherubism osteoclasts accounted for

their activated phenotype, we examined whether TNKS2-defi-

cient osteoclasts phenocopied cherubism osteoclasts. Wild-

type macrophages normally complete osteoclastogenesis

in vitro within 5 to 6 days when cultured in RANKL and CSF-1.

ates from osteoclasts derived from WT or Sh3bp2KI/KI mice were probed with

ein levels are shown respectively on the right panel.

ved osteoclasts from either WT (lane 1) or Sh3bp2KI/KI (lane 2) were lysed and

kinase activity was calculated as the ratio of the autophosphorylation signal to

eoclast-derivedWT orSh3bp2KI/KImiceweremeasured using a PAKGST-PBD

and RAC-GTP levels in Sh3bp2KI/KI osteoclasts expressed as fold difference


Figure 5. Primary Bone Marrow-Derived Macrophages Depleted of TNKS/TNKS2 Undergo Accelerated Osteoclastogenesis

(A) TNKS/TNKS2-deficient osteoclasts phenocopy cherubism osteoclasts. BMMs fromWT, Sh3bp2KI/KI, or Tnks2�/� mice were infected with scrambled shRNA

retrovirus (first three rows). BMMs derived from Tnks2�/� mice were infected with tnks-specific shRNA retrovirus (fourth row). Cells were then grown in CSF-1

(30 ng/ml) and RANKL (5 ng/ml, 10 ng/ml, or 40 ng/ml) for 3 days to initiate osteoclastogenesis, then TRAP stained. Experiments were performed in triplicate.

Scale bar: 50 mm.

(B) Both tnks and tnks2mRNA are expressed in osteoclasts. TankyrasemRNA levels in BMMs cultured in RANKL and CSF-1 as determined by qPCR at day 0 and

day 5. *p < 0.05; NS, no statistical significance. Error bars represent SEM.


We cultured bone marrow monocytes (BMMs) from WT or

Tnks2�/� mice in the presence of increasing doses of RANKL

for the suboptimal period of 3 days and observed an enhanced

rate of in vitro osteoclastogenesis intermediate between WT

and Sh3bp2KI/KI macrophages (Figure 5A, rows 1–3). Because

TNKS and TNKS2 have overlapping essential function during

embryonic development (Chiang et al., 2008), we conjectured

that TNKS may also participate in 3BP2 negative regulation in

osteoclasts. We observed that both tnks and tnks2 mRNAs are

expressed during osteoclast differentiation (Figure 5B) and

demonstrated that TNKS can bind to and PARsylate 3BP2

when coexpressed in HEK293T cells (Figures 1E and S4A). We

therefore depleted tnks mRNA in the Tnks2�/� BMMs using

a lentivirus shRNA specific for tnks (Figure 5C) and observed

that BMMs lacking both TNKS and TNKS2 underwent acceler-

ated osteoclastogenesis closely resembling the activated osteo-

clast phenotype observed in cherubism osteoclasts (Figure 5A,

row 4). Moreover, we noted that in TNKS/TNKS2-depleted cells,

SRC, SYK, and VAVwere highly phosphorylated and 3BP2 levels

were elevated (Figures 5D, lane 4 and 5E, lane 4, row 4). These

results were observed with a second tnks-depleting hairpin lenti-

virus (data not shown). These data demonstrate that both Tank-

yrase family proteins participate in the repression of 3BP2

protein levels and the control of SRC, SYK, and VAV activation

in macrophages and osteoclasts. Lastly, we observed that WT

macrophages depleted of RNF146 similarly underwent acceler-

ated osteoclastogenesis with elevated 3BP2 levels reminiscent

of the Sh3bp2KI/KI or Tankyrase-depleted macrophages (Figures

5F, 5G, and S4B). This effect was dependent on 3BP2 as

RNF146 depletion in 3BP2 knockout cells had little effect on

in vitro osteoclastogenesis. RNF146 therefore controls osteo-

clast activity by regulating 3BP2 levels in an ADP-ribose-depen-

dent manner.

Tankyrase Inhibition Promotes Osteoclastogenesisand TNF-a Secretion by MacrophagesTo determine whether the activated osteoclast phenotype

observed in cells depleted of TNKS/TNKS2 was dependent on

3BP2, we applied the nonselective PARP inhibitor PJ-34 or the

recently described TNKS/TNKS2-specific inhibitor IWR-1

(Chen et al., 2009; Huang et al., 2009) to either WT or 3BP2-

deficient BMMs cultured under osteoclastogenic conditions.

Exposure of WT BMMs to either PJ-34 or IWR-1 resulted in

acceleration of osteoclast formation compared to untreated

control cells (Figure 6A, top row). 3BP2-deficient BMMs,

however, were completely resistant to the pro-osteoclast effects

of either inhibitor (Figure 6A, bottom row), demonstrating that

(C) tnks mRNA levels in Tnks2�/� osteoclasts infected with scrambled or tnks-sp

(D and E) TNKS/TNKS2-depleted osteoclasts express elevated levels of phospho

primary osteoclasts in (A) were probed with phosphospecific antibodies against S

shown (E).

(F) RNF146-deficient osteoclasts phenocopy cherubism osteoclasts. BMMs from

shRNA were grown in CSF-1 (30 ng/ml) and RANKL (5 ng/ml) for 3 days the

comparison. Experiments were performed in triplicate. Scale bars: 50 mm.

(G) RNF146-depleted osteoclasts express elevated levels of 3BP2. Lysates fr

(shrnf146-1 and shrnf146-2) or a scrambled shRNA (shscm) were probed by wes

See also Figure S4.

3BP2 is the relevant Tankyrase target in these inhibition studies.

Osteoclasts treated with either PJ-34 or IWR-1 exhibited

increased levels of phosphorylated SRC, SYK, and VAV and

elevated levels of 3BP2 protein compared to control cells

(Figures 6B, lanes 1–3 and 6C, row 4, lanes 1–3). Moreover,

SRC, SYK, and VAV failed to become phosphorylated in cells

lacking 3BP2 treated with PARP inhibitors (Figure 6B, lanes

4–6), demonstrating that 3BP2 is an obligate factor required for

SRC pathway activation in osteoclast differentiation. We next

tested the effect of Tankyrase inhibition on basal TNF-a produc-

tion in macrophages. We observed that WT macrophages

treated with CSF-1 and IWR-1 for 36 hr secreted 2-fold higher

levels of TNF-a compared with vehicle controls (Figure 6D) and

at levels similar to Sh3bp2KI/KI-derived macrophages, whereas

there was no induction of TNF-a observed in treated

Sh3bp2�/�-derived macrophages. These data provide conclu-

sive evidence that TNKS/TNKS2 negatively regulate the activa-

tion of SRC and its downstream targets SYK and VAV in osteo-

clasts by controlling the abundance of 3BP2. Moreover,

genetic depletion or pharmacologic inhibition of Tankyase re-

sulted in an increased response of myeloid cells to CSF-1, an

effect phenocopied by the Sh3bp2KI/KI-derived monocytes.

To test whether SRC activity is required for Tankyrase- and

3BP2-mediated osteoclast differentiation, we applied the SRC

inhibitors AZD0530 or PP1 to WT or Sh3bp2KI/KI-derived

macrophages under osteoclastogenic conditions. Incubation

with either inhibitor blocked osteoclast formation of both WT

and Sh3bp2KI/KI-derived BMMs (Figure 6E). Moreover, addition

of these SRC inhibitors to WT BMM cultures treated with the

PARP inhibitor IWR-1 similarly blocked osteoclast formation

(Figure 6F). Taken together, the results demonstrate that

SRC is required as a downstream effector of the Tankyrase-

3BP2 signaling module and that hyperactivation of osteoclasts

mediated by stabilized 3BP2 can be antagonized by SRC

inhibition.

Radiation Chimeric Mice that Lack TNKS/TNKS2Copy the Phenotype of Sh3bp2KI/KI MiceOur observations suggest that Tankyrase proteins may have

a physiologic role in regulating bone homeostasis, in myelomo-

nocytic expansion, and in controlling inflammatory cytokines

as observed in the Sh3bp2KI/KI mice. We predicted that mice

lacking Tankyrases within the bone marrow compartment would

recapitulate these features of the cherubism mice. We analyzed

the trabecular bone volume and serum TNF-a levels of 22-week-

old Tnks2�/� mice and observed no difference in these parame-

ters compared to age-matched WT littermate controls

ecific shRNA retrovirus as determined by qPCR. Error bars represent SEM.

rylated SRC, SYK, and VAV and increased levels of 3BP2 protein. Lysates from

RC, SYK, or VAV (D). The total protein levels as determined by western blot are

WT or Sh3bp2�/� mice infected with scrambled shRNA or RNF146-specific

n TRAP stained. Cultured osteoclasts from Sh3bp2KI/KI mice are shown for

om primary osteoclasts expressing two different RNF146-targeting shRNAs

tern blot for 3BP2 protein expression.


Figure 6. Tankyrase Inhibition Enhances Osteoclastogenesis in a 3BP2-Dependent Manner

(A) BMMs harvested fromWT or Sh3bp2�/� mice were grown under osteoclastogenic conditions in the presence of IWR-1 (2 mM) or PJ34 (2 mM) and then TRAP

stained. Scale bars: 50 mm.

(B and C) Osteoclasts grown in the presence of IWR-1 or PJ-34 express elevated levels of activated SRC, SYK, and VAV and increased protein levels of 3BP2.

Lysates from cells treated as in (A) were blottedwith phosphospecific antibodies against SRC, SYK, or VAV, as in Figure 5D. (C) SRC, SYK, VAV, and 3BP2 protein

levels as determined by western blot are shown.

(D) TNF-a levels in the supernatant of primary macrophages incubated for the indicated times with CSF-1 in the presence or absence of IWR-1 (2 mM). Error bars

represent SEM.

(E) BMMs harvested fromWT and Sh3bp2KI/KI mice were cultured under osteoclastogenic conditions in the presence of the SRC inhibitors AZD0530 (0.5 mM) or

PP1 (5 mM) then TRAP stained. Scale bars: 50 mm.

(F) WT BMMs were cultured under osteoclastogenic condition in the presence of IWR-1 and either AZD0530 (0.5 mM) or PP1 (5 mM) then TRAP-stained. Scale

bars: 50 mm.


(Figures S5A–S5C). The failure of Tnks2�/� mice to show a cher-

ubism-like phenotype could be the result of the redundant func-

tion of TNKS in the hematopoietic compartment. To test whether

loss of both TNKS and TNKS2 in the hematopoietc system could

recapitulate the cherubism phenotype, we created chimeric

mice in which TNKS was knocked down in the Tnks2�/� back-

ground. We depleted TNKS by RNAi-mediated knockdown

with a lentivirus harboring a Tnks-specific shRNA in lineage-

depleted Tnks2�/� bone marrow cells (C57Bl/6, CD45.2). In-

fected bone marrow cells were then injected into lethally

irradiated, syngeneic (CD45.1) recipient mice. Wild-type trans-

plantation control chimeric mice were generated from CD45.2-

derived bone marrow cells infected with a lentivirus expressing

a scrambled shRNA hairpin (Figure 7A). Fifteen weeks after

transplantation, we evaluated engraftment by measuring the

percentage of CD45.2-positive leukocytes in the peripheral

blood. Both WT control and TNKS/TNKS2-depleted bone

marrow engrafted at similar levels of 38% of peripheral blood

leukocytes (Figure 7B). TNKS/TNKS2-deficient chimeras

showed a trend toward expansion of the CD11b-positive myelo-

monocytic cells compared to WT chimeras (30% versus 14% of

blood leukocytes, respectively; p = 0.16) (Figure 7C), suggesting

that TNKS/TNKS2 are required to restrain expansion of the

myelomonocytic lineage. We then analyzed the trabecular

bone volume/total bone volume ratio (BV/TV) of the chimeric

mice from each group by microcomputer tomography (mCT).

Relative to the WT chimeric mice, we observed that the TNKS/

TNKS2 chimeric mice had a dramatic reduction in trabecular

bone volume of 33% (Figure 7D). TRAP staining of tibias of

TNKS/TNKS2-deficient chimeras showed a profound increase

in TRAP-positive cells compared to WT chimeras (red stain, Fig-

ure 7E). Histomorphometric analysis showed a 2-fold increase in

the ratio of osteoclast surface to total bone surface and a 70%

increase in osteoclast number per bone surface in TNKS/

TNKS2-deficient chimeras (Figures 7F and 7G). We next exam-

ined the in vitro culture properties of osteoclasts from both

sets of chimeric mice and observed enhanced osteoclastogene-

sis of BMMs derived from TNKS/TNKS2 chimeric mice, charac-

teristic of the cherubism phenotype (Figure 7H). These data

provide strong genetic evidence that ablation of TNKS/TNKS2

in vivo phenocopies the hallmark features of bone loss and acti-

vated osteoclasts characteristic of cherubism.

DISCUSSION

In this study, we uncover an enzyme-substrate relationship

between the PARP Tankyrase and 3BP2, a signaling adaptor

protein upstream of SRC kinases, which is mutated in cherub-

ism. Tankyrase-mediated poly(ADP-ribosyl)ation promotes

3BP2 turnover by targeting it to the ubiquitin-proteasome

machinery. We show that mutations that give rise to cherubism

stabilize 3BP2 and thereby increase its signaling potential to

drive osteoclast differentiation characteristic of the cellular

dysfunction underlying cherubism. We examined whether cher-

ubism mutations might confer neomorphic properties to 3BP2

that are responsible for the cherubism phenotype. We observed

that overexpression of the WT 3BP2 protein was sufficient to

induce osteoclast formation (even in the absence of RANKL)

and elevated TNF-a secretion in macrophages, two critical

featuresof thecherubismphenotype. Thesedataargue that stabi-

lization of 3BP2protein is the basis for the hypermorphic behavior

of cherubism variants of 3BP2 and provide an explanation for the

autosomal-dominant inheritance of the disease. The ability of

overexpressed 3BP2 to manifest cherubism-like effects is there-

fore not likely to be due to a neomorphic property of the protein

resulting from these mutations but rather is due to the intrinsic

accentuated property of the WT 3BP2 protein. Cherubism muta-

tions reside within a Tankyrase-recruiting peptide motif in 3BP2

and abolish recognition of 3BP2 by Tankyrase. In an accompa-

nyingmanuscript (Guettler et al., 2011),weprovideacrystal struc-

ture of the 3BP2 peptide bound to a TNKS2 ankyrin repeat and

determine the general rules for substrate recognition by Tankyr-

ase. It is important to note that all of the known cherubism muta-

tions described to date (Lietman et al., 2006) violate these rules,

providing further evidence for the role of disrupted Tankyrase

binding as the cause of cherubism. We have highlighted the

importance of this interaction by showing that interference with

Tankyrase expression or activity in vitro similarly leads to

enhanced 3BP2 expression and to hyperactivated osteoclasts

and increased TNF-a production by monocytes. Lastly, we have

shown that the characteristic cherubism features of bone loss,

increasednumbersof in situTRAP-positiveosteoclasts, andmye-

lomonocytic expansion can be recapitulated in vivo in TNKS/

TNKS2-deficient bone marrow chimeric mice.

These studies have highlighted that 3BP2 is a concentration-

limited factor required for SRC activation in osteoclasts and

that modulation of the steady-state levels of 3BP2 tightly

controls SRC activity and downstream signaling proteins in

these cells. We demonstrated that SRC inhibition blocked osteo-

clastogenesis associated with cherubism or Tankyrase-inhibited

BMMs, suggesting that SRC lies downstream of 3BP2 or is

a generally required component for osteoclast formation. These

studies also suggest that therapeutic use of SRC kinase inhibi-

tors might benefit cherubism patients.

The biologic function of the Tankyrase proteins is complicated

by the multiplicity of identified binding proteins. Mice lacking

TNKS or TNKS2 develop normally through embryogenesis.

However, adult Tnks�/� mice suffer from a metabolic disorder

(Yeh et al., 2009), whereas Tnks2�/� mice have a short stature

phenotype (Chiang et al., 2006; Hsiao et al., 2006). Mice lacking

both TNKS and TNKS2 die in utero at post-coital day 10, demon-

strating that Tankyrase proteins have an essential but redundant

function during embryonic development (Chiang et al., 2008).

TNKS was originally identified as a negative regulator of the telo-

merase inhibitor TRF1/TERF1 (Smith et al., 1998). TRF1/TERF1

is similarly regulated by ADP-ribosylation and ubiquitin-medi-

ated proteolysis (Chang et al., 2003). More recently, Tankyrases

have been identified as positive regulators of the Wnt/b-catenin

pathway through their capacity to negatively regulate AXIN

through ADP-ribosylation and ubiquitylation (Huang et al.,

2009). Both TNKS and TNKS2 bind to the mitotic spindle regu-

lator NUMA, but TNKS alone is required for NUMA ribosylation

and proper mitotic spindle organization (Chang et al., 2005).

TNKS and TNKS2 bind to a common set of proteins, including

insulin-responsive amino peptidase (IRAP), TAB182, and

FBP17, all of whom share a common RXXPDG-binding motif


Figure 7. Radiation Chimeric Mice, which Lack Tankyrase, Phenocopy Features of Cherubism

(A) 106 Tnks2�/� lineage-depleted bone marrow cells (C57Bl/6, CD45.2) were infected with a lentivirus harboring a Tnks-specific shRNA and then injected

together with 105 CD45.1 WT bone marrow cells into lethally irradiated, syngeneic (CD45.1) recipients (TNKS/2 chimera). WT control chimeric mice were

generated from CD45.2-derived bone marrow cells infected with a lentivirus expressing a scrambled shRNA hairpin (WT chimera).

(B) Fifteen weeks after transplantation, engraftment was measured by the percentage of CD45.2-positive leukocytes in the peripheral blood.

(C) Percentage of donor monocytes (CD45.2+CD11b+) in chimeric mice is shown. WT, n = 4; TNKS/2, n = 5; *p < 0.16.


that is similar to the 3BP2 Tankyrase-binding peptide sequence

mutated in cherubism. In the accompanying manuscript (Guet-

tler et al., 2011), we identify sequence rules for tight binding of

targeting peptides by Tankyrase, which may facilitate the identi-

fication of previously unknown Tankyrase substrates.

Tankyrase inhibition has been proposed as a strategy to treat

Wnt-dependent tumors (Huang et al., 2009). However, the estab-

lished role for SRC in controlling osteoclast and macrophage

function (Boyce et al., 1992), in addition to its role in potentiating

tumorigenesis, suggests that sustained pharmacologic inhibition

of Tankyrase proteins might lead to the untoward effects of oste-

oporosis, myelomonocytic-mediated inflammation, or tumor

promotion. Our studies also raise the possibility that high expres-

sion of 3BP2 or loss of function of Tankyrase may contribute to

highly active SRC observed in some human cancers (Du et al.,

2009; Hynes, 2000; Irby and Yeatman, 2000; Talamonti et al.,

1993; Wiener et al., 2003).

We investigated the manner in which 3BP2 ribosylation is

coupled to ubiquitylation. Several distinct PAR-binding motifs

have recently been described, including the PAR-bindingmacro-

domain (Karras et al., 2005), a basic and hydrophobic rich motif

capable of PAR recognition present in p53, histones, and XRCC1

(Gagne et al., 2003; Pleschke et al., 2000), and a poly(ADP-

ribose)-binding zinc finger (PBZ) motif present in the proteins

Aprataxin PNK-like factor (APLF) and Checkpoint Protein with

FHA and RING domains (CHFR) (Ahel et al., 2008). Recently,

RNF146 has been shown to mediate the ubiquitylation of Axin2

in a ADP-ribose-dependent fashion (Zhang et al., 2011). We

show here that RNF146 binds to 3BP2 but not to cherubism

mutants and that binding is dependent on Tankyrase activity.

We show that depletion of RNF146 results in the accumulation

of 3BP2 and provokes accelerated osteoclastogenesis in

a manner observed in cherubism osteoclasts or in osteoclasts

lacking Tankyrase proteins. These data identify the E3 ligase

RNF146 as a 3BP2-dependent regulator of osteoclast activity.

It appears increasingly likely that RNF146 generally recognizes

ribosylated Tankyrase substrates.

We have identified ADP-ribosylation as a regulatory switch

that controls 3BP2 protein levels as a mechanism to modulate

SRC kinase activity and downstream signaling molecules in

osteoclasts. The necessity to maintain strict control of the

3BP2/SRC signaling module is underscored in homozygous

cherubism mutations in mice, where uncoupling of 3BP2 from

Tankyrase-mediated negative regulation results in lethality as

a result of systemic myelomonocytic cell infiltration into skin

and visceral organs. We have demonstrated that loss of this

regulatory pathway is the basis of the molecular mechanism

underlying cherubism pathogenesis. Cherubism thus represents

an example of a human developmental disease resulting from

a defect in ADP-ribosylation.

(D) mCT reconstruction of the trabecular bone of WT or TNKS/2 chimeric mice 15

volume fraction (BV/TV) are shown (right). WT, n = 4; TNKS/2, n = 5; *p < 0.05.

(E) TRAP staining of tibias of WT and TNKS/2 chimeric mice.

(F and G) Histomorphometric analysis of (F) osteoclast surface to bone surface (O

WT and TNKS/2 chimeric mice 15 weeks after transplantation of donor cells. WT

(H) BMMs harvested from WT or TNKS/2 chimeric mice were grown under osteo

Error bars represent SEM. See also Figure S5.

EXPERIMENTAL PROCEDURES

Mice

Sh3bp2KI/KI mice were a kind gift from Dr. Bjorn Olsen (Harvard School of

Medicine, Boston, MA, USA). Derivation of Sh3bp2�/� mice has been

previously described (Chen et al., 2007). Tnks2�/� mice were a kind gift from

Dr Richard Hodes (National Institutes of Health, Bethesda, MD, USA).

Chimeric Mice

Bone marrow cells fromWT or Tnks2�/� mice (CD45.2) were lineage depleted.

106 lineage-depleted WT or Tnks2�/� bone marrow cells were infected with

pLKOTRC 020 lentivirus (TRC consortium, Broad Institute, Cambridge, MA,

USA) and then injected together with 105 CD45.1 recipient bone marrow cells

into the tail veins of 8-week-old irradiated (9Gy) B6.SJL recipient mice. Percent

chimerism was evaluated by flow cytometry for the percent CD45.2+ lympho-

cytes in the peripheral blood. For details, see the Extended Experimental

Procedures.

Microcomputed Tomography

mCT (SkyScan) was performed on tibias of chimeric mice 15 weeks after injec-

tion. For details, see the Extended Experimental Procedures.

Bone Marrow Cultures

Nucleated bone marrow cells were purified from mice femora and tibia. Oste-

oclast differentiation was induced by culturing nonadherent cells in the

presence of RANKL and CSF-1. Tartrate-resistant acid phosphatase (TRAP)

staining was performed using the Sigma reagent (386A) according tomanufac-

turer protocol. For experiments with bone marrow-derived macrophages,

nonadherent cells were cultured for 3 days in the presence of CSF-1. For

details, see the Extended Experimental Procedures.

TNF-a ELISA

TNF-a in cultured medium was measured using a TNF-a ELISA kit (eBio-

science) according to the manufacturer protocol.

Retroviral Transduction

BMMs were infected with PLKO.1 for 48 hr in the presence of 8 mg/ml poly-

brene (Sigma). Infected cells were selected in puromycin (1.6 mg/ml) for

3 days and then replated for osteoclast differentiation assay. For details, see

the Extended Experimental Procedures.

GST-Fusion Peptide Construction and Binding Assay

GST-fusion peptides encompassing either WT or cherubism mutant residues

413–418 of 3BP2 were purified and eluted from glutathione Sepharose beads

using standard procedures. HEK293T cells expressing Flag-TNKS2 were

lysed, and recombinant GST-3BP2 WT or cherubism peptide fusion proteins

were added to the lysates. Tankyrase binding to the GST-3BP2 peptides

was then determined by western blot. For details, see the Extended Experi-

mental Procedures.

Immunoprecipitation and Western Blotting

Transfected cells were lysed and precleared with protein A/G Sepharose, then

the lysates were incubated with the indicated antibody. For reprecipitation

experiments, immune complexes were dissociated in heated 1% SDS buffer

cooled and then incubated in 20 mM iodoacetamide prior to dilution with

1 ml of lysis buffer and addition of the secondary antibody for reprecipitation.

See the Extended Experimental Procedures.

weeks after injection (left). mCT-derived measurements of the trabecular bone

cS/BS) and (G) osteoclast number to bone perimeter (N.Oc/BS) in the tibias of

, n = 3; TNKS/2, n = 5; *p < 0.01. Error bars represent SEM.

clastogenic conditions and TRAP stained. Scale bars: 50 mm.


In Vitro PARP Assay

TNKS2, 3BP2 WT, or cherubism mutants were transiently expressed in

HEK293T cells for 48 hr, and then cells were lysed. 3BP2 immune complexes

were washed in 100 ml of PARP reaction buffer (50 mM Tris.HCl, pH 8.0, 4 mM

MgCl2, 0.2 mM dithiothreitol) and incubated in 100 ml of PARP reaction buffer

containing 25 mCi of [32P]NAD+ (1000 Ci/mmol; GE Healthcare) for 30 min at

25�C. Following completion of the PARP reaction, beads were washed and

proteins resuspended in sample buffer, fractionated by SDS-PAGE, and the

gels dried prior to detection by autoradiography.

Statistical Analysis

Data are presented as means ± standard error of the mean (SEM). Statistic

significance was determined by Student’s t test. p value < 0.05 was consid-

ered statistically significant.

Further detailed descriptions of the RAC-GTP pull-down assay, in vitro

kinase assay, reagents and antibodies, and real-time PCR are in the Extended

Experimental Procedures.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Extended Experimental Procedures and

five figures and can be found with this article online at doi:10.1016/j.cell.

2011.10.045.

ACKNOWLEDGMENTS

This work was supported by a grant from the Terry Fox Research Institute

(TFPP Grant #20003), by the Canadian Cancer Society Research Institute,

and by the Ontario Ministry of Health and Long Term Care. The views ex-

pressed do not necessarily reflect those of the OMOHLTC. R.R. is supported

by the AmgenChair for Cancer Research from the PMHF at the Ontario Cancer

Institute, Princess Margaret Hospital. N.L. was supported by the Arthritis

Centre for Excellence Fellowship, University of Toronto. Y.U. was supported

by the Charles H. Hood Foundation, Inc., Boston, MA and research grant

R01DE020835 from the National Institutes of Health. We thank Gerald Gish

for providing the peptides and Sebastian Geuttler for assistance with the fluo-

rescence polarization experiments. We thank Ben Neel and Norman Iscove for

discussion regarding the chimera experiments. We thank Mauricio Medrano

for graphic design. We thank Frank Sicheri, Sebastian Geuttler, Ernst Reichen-

berger, Gregg Morin, Vuk Stambolic, and Ben Neel for critical reading of the

manuscript.

Received: March 11, 2010

Revised: April 4, 2011

Accepted: October 18, 2011

Published: December 8, 2011

REFERENCES

Ahel, I., Ahel, D., Matsusaka, T., Clark, A.J., Pines, J., Boulton, S.J., and West,

S.C. (2008). Poly(ADP-ribose)-binding zinc finger motifs in DNA repair/check-

point proteins. Nature 451, 81–85.

Boyce, B.F., Yoneda, T., Lowe, C., Soriano, P., and Mundy, G.R. (1992).

Requirement of pp60c-src expression for osteoclasts to form ruffled borders

and resorb bone in mice. J. Clin. Invest. 90, 1622–1627.

Chang, P., Coughlin, M., and Mitchison, T.J. (2005). Tankyrase-1 polymeriza-

tion of poly(ADP-ribose) is required for spindle structure and function. Nat. Cell

Biol. 7, 1133–1139.

Chang, W., Dynek, J.N., and Smith, S. (2003). TRF1 is degraded by ubiquitin-

mediated proteolysis after release from telomeres. Genes Dev. 17, 1328–1333.

Chen, B., Dodge, M.E., Tang, W., Lu, J., Ma, Z., Fan, C.W., Wei, S., Hao, W.,

Kilgore, J., Williams, N.S., et al. (2009). Small molecule-mediated disruption of

Wnt-dependent signaling in tissue regeneration and cancer. Nat. Chem. Biol.

5, 100–107.


Chen, G., Dimitriou, I.D., La Rose, J., Ilangumaran, S., Yeh, W.C., Doody, G.,

Turner, M., Gommerman, J., and Rottapel, R. (2007). The 3BP2 adapter protein

is required for optimal B-cell activation and thymus-independent type 2

humoral response. Mol. Cell. Biol. 27, 3109–3122.

Chiang, Y.J., Hsiao, S.J., Yver, D., Cushman, S.W., Tessarollo, L., Smith, S.,

and Hodes, R.J. (2008). Tankyrase 1 and tankyrase 2 are essential but redun-

dant for mouse embryonic development. PLoS ONE 3, e2639.

Chiang, Y.J., Nguyen, M.L., Gurunathan, S., Kaminker, P., Tessarollo, L., Cam-

pisi, J., and Hodes, R.J. (2006). Generation and characterization of telomere

length maintenance in tankyrase 2-deficient mice. Mol. Cell. Biol. 26, 2037–

2043.

Cicchetti, P., Mayer, B.J., Thiel, G., and Baltimore, D. (1992). Identification of

a protein that binds to the SH3 region of Abl and is similar to Bcr and

GAP-rho. Science 257, 803–806.

de la Fuente, M.A., Kumar, L., Lu, B., and Geha, R.S. (2006). 3BP2 deficiency

impairs the response of B cells, but not T cells, to antigen receptor ligation.

Mol. Cell. Biol. 26, 5214–5225.

Deckert, M. (2006). [The adaptor protein 3BP2 in leukocyte signaling]. Med.

Sci. (Paris) 22, 1081–1086.

Deckert, M., and Rottapel, R. (2006). The adapter 3BP2: how it plugs into

leukocyte signaling. Adv. Exp. Med. Biol. 584, 107–114.

Du, J., Bernasconi, P., Clauser, K.R., Mani, D.R., Finn, S.P., Beroukhim, R.,

Burns, M., Julian, B., Peng, X.P., Hieronymus, H., et al. (2009). Bead-based

profiling of tyrosine kinase phosphorylation identifies SRC as a potential target

for glioblastoma therapy. Nat. Biotechnol. 27, 77–83.

Gagne, J.P., Hunter, J.M., Labrecque, B., Chabot, B., and Poirier, G.G. (2003).

A proteomic approach to the identification of heterogeneous nuclear ribonu-

cleoproteins as a new family of poly(ADP-ribose)-binding proteins. Biochem.

J. 371, 331–340.

Guettler, S., LaRose, J., Petsalaki, E., Gish, G., Scotter, A., Pawson, T., Rotta-

pel, R., and Sicheri, F. (2011). Structural basis and sequence rules for substrate

recognition by Tankyrase explain the basis for cherubism disease. Cell 147,

this issue, 1340–1354.

Hsiao, S.J., Poitras, M.F., Cook, B.D., Liu, Y., and Smith, S. (2006). Tankyrase

2 poly(ADP-ribose) polymerase domain-deleted mice exhibit growth defects

but have normal telomere length and capping. Mol. Cell. Biol. 26, 2044–2054.

Huang, S.M., Mishina, Y.M., Liu, S., Cheung, A., Stegmeier, F., Michaud, G.A.,

Charlat, O., Wiellette, E., Zhang, Y., Wiessner, S., et al. (2009). Tankyrase inhi-

bition stabilizes axin and antagonizes Wnt signalling. Nature 461, 614–620.

Hynes, N.E. (2000). Tyrosine kinase signalling in breast cancer. Breast Cancer

Res. 2, 154–157.

Irby, R.B., and Yeatman, T.J. (2000). Role of Src expression and activation in

human cancer. Oncogene 19, 5636–5642.

Jones, W.A., Gerrie, J., and Pritchard, J. (1950). Cherubism—familial fibrous

dysplasia of the jaws. J. Bone Joint Surg. Br. 32-B, 334–347.

Karras, G.I., Kustatscher, G., Buhecha, H.R., Allen, M.D., Pugieux, C., Sait, F.,

Bycroft, M., and Ladurner, A.G. (2005). The macro domain is an ADP-ribose

binding module. EMBO J. 24, 1911–1920.

Levaot, N., Simoncic, P.D., Dimitriou, I.D., Scotter, A., La Rose, J., Ng, A.H.,

Willett, T.L., Wang, C.J., Janmohamed, S., Grynpas, M., et al. (2011). 3BP2-

deficient mice are osteoporotic with impaired osteoblast and osteoclast func-

tions. J. Clin. Invest. 121, 3244–3257.

Lietman, S.A., Kalinchinko, N., Deng, X., Kohanski, R., and Levine, M.A. (2006).

Identification of a novel mutation of SH3BP2 in cherubism and demonstration

that SH3BP2 mutations lead to increased NFAT activation. Hum. Mutat. 27,

717–718.

Pleschke, J.M., Kleczkowska, H.E., Strohm, M., and Althaus, F.R. (2000).

Poly(ADP-ribose) binds to specific domains in DNA damage checkpoint

proteins. J. Biol. Chem. 275, 40974–40980.

Sada, K., Miah, S.M., Maeno, K., Kyo, S., Qu, X., and Yamamura, H. (2002).

Regulation of FcepsilonRI-mediated degranulation by an adaptor protein

3BP2 in rat basophilic leukemia RBL-2H3 cells. Blood 100, 2138–2144.

http://dx.doi.org/doi:10.1016/j.cell.2011.10.045

http://dx.doi.org/doi:10.1016/j.cell.2011.10.045

In

a

W

M

ty

c

Y

A

a

Z

M

d

Cell Biol. 13, 623–629.

Smith, S., Giriat, I., Schmitt, A., and de Lange, T. (1998). Tankyrase, a

poly(ADP-ribose) polymerase at human telomeres. Science 282, 1484–1487.

Talamonti, M.S., Roh, M.S., Curley, S.A., and Gallick, G.E. (1993). Increase in

activity and level of pp60c-src in progressive stages of human colorectal

cancer. J. Clin. Invest. 91, 53–60.

Tiziani, V., Reichenberger, E., Buzzo, C.L., Niazi, S., Fukai, N., Stiller, M.,

Peters, H., Salzano, F.M., Raposo do Amaral, C.M., and Olsen, B.R. (1999).

The gene for cherubism maps to chromosome 4p16. Am. J. Hum. Genet.

65, 158–166.

Ueki, Y., Tiziani, V., Santanna, C., Fukai, N., Maulik, C., Garfinkle, J., Ninomiya,

C., doAmaral, C., Peters, H., Habal, M., et al. (2001). Mutations in the gene en-

coding c-Abl-binding protein SH3BP2 cause cherubism. Nat. Genet. 28,

125–126.

Ueki, Y., Lin, C.Y., Senoo, M., Ebihara, T., Agata, N., Onji, M., Saheki, Y.,

Kawai, T., Mukherjee, P.M., Reichenberger, E., and Olsen, B.R. (2007).

C

creased myeloid cell responses to M-CSF and RANKL cause bone loss

nd inflammation in SH3BP2 ‘‘cherubism’’ mice. Cell 128, 71–83.

iener, J.R., Windham, T.C., Estrella, V.C., Parikh, N.U., Thall, P.F., Deavers,

.T., Bast, R.C., Mills, G.B., and Gallick, G.E. (2003). Activated SRC protein

rosine kinase is overexpressed in late-stage human ovarian cancers. Gyne-

ol. Oncol. 88, 73–79.

eh, T.Y., Beiswenger, K.K., Li, P., Bolin, K.E., Lee, R.M., Tsao, T.S., Murphy,

.N., Hevener, A.L., and Chi, N.W. (2009). Hypermetabolism, hyperphagia,

nd reduced adiposity in tankyrase-deficient mice. Diabetes 58, 2476–2485.

hang, Y., Liu, S., Mickanin, C., Feng, Y., Charlat, O., Michaud, G.A., Schirle,

., Shi, X., Hild, M., Bauer, A., et al. (2011). RNF146 is a poly(ADP-ribose)-

irected E3 ligase that regulates axin degradation and Wnt signalling. Nat.

ell 147, 1324–1339, December 9, 2011 ª2011 Elsevier Inc. 1339

Supplemental Information

EXTENDED EXPERIMENTAL PROCEDURES

Chimeric MiceBonemarrow cells fromWT or Tnks2�/�mice (CD45.2) were lineage depleted using rat antibodies targeting CD3, CD19, Gr1, Ter119

(BioLegend) and CD4, CD8a, CD127, B220 (eBioscience). Lineage-positive cells were immobilized using sheep anti-rat coated Dy-

nabeads (Invitrogen). 106 lineage-depleted WT or Tnks2�/� bone marrow cells were infected with pLKOTRC 020 lentivirus (TRC

consortium, Broad Institute) expressing scrambled (scm) or TNKS-specific (tnks) shRNAs, respectively, at an multiplicity of infection

of 50 and then injected together with 105 CD45.1 recipient bone marrow cells into the tail veins of 8-week-old irradiated (9Gy) B6.SJL

recipient mice. Percent chimerism was evaluated by flow cytometry for the percentage of CD45.2+ lymphocytes in the peripheral

blood. The percent CD45.2+CD11b+ monocytes in the peripheral blood was analyzed by flow cytometry 15 weeks after injection.

Microcomputed TomographymCT (SkyScan) was performed on tibias of chimeric mice 15 weeks after injection. Analysis of trabecular bone was performed over

a 0.6 mm length, below the proximal growth plate. Each image was reconstructed from 65, 9.3 mm slices below the growth plate, and

trabecular morphometric parameters were determined according to standard protocols (Parfitt et al., 1987). A fixed density threshold

was determined using a pair of calibration phantoms (SkyScan).

Bone Marrow CulturesBone marrow cells were treated with ACK red cell lysis buffer (0.15 M NH4Cl, 10 mM KHC03, 0.1 mM Na2EDTA in distilled H2O).

Adherent cells were removed after 12 hr of culture in a-MEM and 10% FBS and the nonadherent cells plated at 106 cells/ml and

cultured for 3 days in the presence of human recombinant CSF-1 (30 ng/ml). Osteoclast differentiation was induced by culturing non-

adherent cells in CSF-1 (10 ng/ml) for 2 days and then replating cells at a density of 5 3 105 cells/cm2 in the presence of RANKL

(40 ng/ml) (R & D Systems) and CSF-1 (30 ng/ml) for 5 additional days. Tartrate-resistant acid phosphatase (TRAP) staining was per-

formed using a kit from Sigma (386A) according to manufacturer protocol. The PARP inhibitors IWR-1 (Sigma) or PJ-34 (Sigma) were

added to the cultures at a concentration of 2 mM.Src inhibitors AZD0530 andPP1were at concentrations of 0.5 mMand 5 mM, respec-

tively. For derivation of BMMs, cells were cultured with a-MEM and 10%FBS for 2–12 hr, then nonadherent cells were cultured for

3 days in the presence of 50 ng/ml CSF-1. TNF-a protein secretion in the supernatant of WT, Sh3bp2KI/KI, or Sh3bp2�/�-derivedmacrophages was determined by ELISA. Macrophages were treated with CSF-1 (100 ng/ml) or vehicle control and IWR-1 (2 mM)

for 36 hr prior to analysis.

Retroviral TransductionpLKO.1 and pLKO TRC020 lentiviral vectors expressing shRNAs targeting tnks (sh15 or sh16), rnf146, or nonspecific shRNA

sequence were transiently transfected into HEK293T cells together with pMD2.G and psPAX2 (Addgene) using FuGENE transfection

reagent (Roche). The virus was collected 48 hr after transfection. BMMs were infected with PLKO.1 for 48 hr in the presence of 8 mg/

ml polybrene (Sigma). Infected cells were selected in puromycin (1.6 mg/ml) for 3 days and then replated for osteoclast differentiation

assay. Lineage-depleted cells were infected with pLKO TRC020 for 48 hr at a multiplicity of infection (moi) of 50 in the presence of

4 mg/ml polybrene (Sigma) and then injected into recipient mice.

C-terminal tagged Flag-3BP2 or Flag-3BP2P416Rwere subcloned in the pMX IRES Puromycin vector, followed by the transfection

into the HEK293GPG packaging cell line for the production of VSV-G pseudotyped retrovirus. Viral culture supernatants were

collected, filtered through 0.45 mm membrane filter, and stored in �80�C. Raw264.7 cells were cultured in DMEM containing 10%

FBS at a density of 7 3 105 cells per 100 mm culture dish and incubated with viral supernatant containing polybrene (8 mg/ml) for

48 hr, then selected in puromycin (10 mg/ml) for 3 days. 4 3 104 RAW264.7 cells infected cells were plated in 96-well culture plates.

After 24 hr of culture 2 3 104 cells were plated on 12-well plates and cultured without RANKL for 6 days, followed by the TRAP

staining.

GST-Fusion Peptide Construction and Binding AssayGST-fusion peptides encompassing residues 413–418 from either WT 3BP2 or 3BP2 cherubism mutants R413Q, P416H, or G418R

were cloned into the pGEX4T1 vector (Stratagene, La Jolla, CA, USA) using BamHI and XhoI sites. Competent BL21 bacteria (Stra-

tagene) were transformed grown in LB medium containing 50 mg/ml ampicillin at 37�C. Expression of recombinant protein was

induced by adding 1 mM isopropyl-b-D-thiogalactopyranoside (IPTG) to cultures at room temperature for 4 hr. Bacteria pellets

were lysed in PBS containing 1% TX-100, 1 mM DTT, and protease inhibitors. Recombinant protein was immobilized on glutathione

Sepharose beads, washed then eluted with 50mM reduced glutathione (0.1M Tris-HCl, pH 7.4), and eluted from glutathione Sephar-

ose beads using standard procedures. Recombinant peptide fusion proteins (2 mg) were added to lysates from HEK293T cells trans-

fected with Flag-TNKS2. Protein complexes were washed on glutathione Sepharose resin, separated by 8% SDS-PAGE gel and

probed with anti-Flag antibodies by western blot.

Cell 147, 1324–1339, December 9, 2011 ª2011 Elsevier Inc. S1

Immunoprecipitation and Western BlottingTransfected HEK293T cells were lysed in 1%Triton X-100, 25mMTris-HCl, pH 7.5, 5mMEDTA, 100mMNaCl, 1mMNa3VO4, 10 mM

MG132, and protease inhibitor cocktail EDTA free (Pierce), precleared with protein A/G Sepharose. For UbK48 western blots, the

lysis buffer also contained 1 mM ADP-HPD and 5 mM NEM. Immune complexes were separated by 8% SDS-PAGE prior to western

blot analysis. For reprecipitation experiments, immune complexes were dissociated in 1% SDS buffer and heated to 68�C. 20 mM

iodoacetamide was then added prior to dilution with lysis buffer and addition of the second antibody for reprecipitation.

RAC-GTP Pull-Down AssayPrimary bone marrow osteoclasts derived from WT or Sh3bp2KI/KI mice were lysed in RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM

NaCl, 2 mM EDTA, 1% NP-40, 0.1% SDS) and complete protease inhibitor tablets (Roche), and lysates were incubated with 3 mg of

either GST or PAK-GST protein. Complexes were immobilized on glutathione Sepharose beads, separated by 8% SDS-PAGE and

transferred to Immobilon P (Millipore) membranes. Themembraneswere blockedwith 5%drymilk powder in 0.2%PBST and probed

with an anti-RAC1 antibody. The filters were incubated with the secondary horseradish peroxidase-conjugated antibody and devel-

oped using ECL Plus (GE Healthcare, Uppsala, Sweden).

In Vitro Kinase AssayPrimary bonemarrow osteoclasts derived fromWT or Sh3bp2KI/KImice were lysed in kinase lysis buffer (50mMHEPES (N-2-hydrox-

ethylpiperazine-N’-2-ethanesulfonic acid) [pH 7.5], 150 mM NaCl, 1.5 mM MgCl2, 1.0 mM EGTA, 1.0% Triton X-100, 10% glycerol,

10 mM NaF, 2 mM Na3VO4, 10 mM sodium pyrophosphate, and complete protease inhibitor tablets [Roche]). Anti-SYK or anti-SRC

antibodies coupled to agarose beads (Calbiochem) were added to lysates. Immune complexes were washed twice with lysis buffer

and three times with kinase wash buffer (200 mMHEPES, PH 7.4, 1 mMMnCl2 1 mMDTT, and 100 mM sodium orthovanadate). Four

microliters of kinase reaction buffer (100 mM HEPES, pH 7.4, 5 mM MnCl2, 5 mM DTT, and 500 mM sodium orthovanadate), One

microliter of acid-denatured enolase, 1 ml of [g�32P]ATP (10 mCi/ml), and 14 ml ddH2O was added to beads. The reactions proceeded

at 30�C for threeminutes andwere terminated by adding 5 ml of 63 sample buffer and boiling for 3min. The samples were resolved by

SDS-PAGE, fixed in ethanol, and treated with 1M KOH for 1 hr at 55�C. The gel was dried and bands analyzed using Li-Cor Phos-

phoimager and quantified with GelQuant software. The specific kinase activity was calculated as the ratio of the intensities of the

autophosphorylation signal to the level of protein expression of SRC.

Reagents and AntibodiesUnless stated otherwise, all chemicals were purchased from Sigma (Oakville, ON, Canada). IWR-1 and XAV-939 were purchased

from Tocris Bioscience. Antibodies were obtained from the following sources: anti-pY416 SRC family, anti-pY386 SYK (Cell Signaling

Technologies-CST), anti-SRC antibodies (CST), anti-SYK (CST and A. Veillette, Clinical Research Institute of Montreal), anti-RAC1

(BD Transduction Labs), anti-Actin, anti-Flag M2, anti-Myc (Sigma), anti-VAV1, anti-pY174 VAV, anti-GST (Santa Cruz Biotechnol-

ogies), anti-HA (Roche), anti-polyADP-ribose (PAR) (BD PharMingen), anti-UbK48 (Millipore), anti-HSP70 (Abcam), 3BP2 antibodies

(Deckert et al., 1998). Glutathione, Protein-A, and Protein-G Sepharose beads were purchased from GE Healthcare (Uppsala, Swe-

den). Complete protease inhibitor cocktail tablets (-EDTA) were from Roche Diagnostics (Mannheim, Germany). PJ34 was from

Alexis Biochemicals (San Diego, CA, USA).

Plasmid Constructs and Site-Directed MutagenesisFull-length Tnks2 cDNA (was a kind gift from G. Morin, Michael Smith Genome Sciences Centre, Vancouver) was cloned into the

V180pLP vector. Full-length Tnks cDNA (was a kind gift from Dr. Nai-Wen Chi, University of California, San Diego, CA, USA) was

cloned into the pFlag-CMV-2 expression vector (Sigma) or into the pEF6/Myc-His vector (Invitrogen) using BamHI and XbaI sites.

Full-length mouse Sh3bp2 cDNA was cloned into the p3XFlag-CMV-10 vector (Sigma) using BamHI restriction sites. pcDNA4-TO

HA RNF146 (was a kind gift from Feng Cong, Novartis).

To construct Flag WT degron and Flag Mut degron nucleotides encoding the following sequences: GSGSGS—

LPHLQRSPPDGQSFRS (WT) and GSGSGS—LPHLQQSPPDGQSFRS (cherubism) were cloned into the KpnI BamHI sites of p3X

flag CMV10. The R413Q 3BP2 mutant was then cloned in frame in the EcoRI and KpnI sites. Flag-3BP2 1–420, Flag-3BP2 372-

stop and Flag-3BP2 407-stop were generated by performing PCR reaction with primers flanking the corresponding amino acids

in 3BP2, introducing a BamHI and EcoRI restriction sites and then cloning into these sites in the p3XFlag-CMV-10 vector. Mutations

were introduced using aQuick-changemutagenesis kit (Stratagene) according to themanufacturer’s instructions. pLKO.1 (Addgene)

or pLKO TRC020 (The RNAi consortium) was used to express tnks,rnf146 or Scrambled shRNAs. The following target sequences

were used: tnks sh15: CGTCTCTTAGAGGCATCGAAA, tnks sh16:GCTAGATGTGTTGGCTGATAT rnf146: TGCACAGTAACTGAAG

TTTAA and shscrambled: CCTGAGATGTATGAGGTACAT

Real-Time PCR for tnks/2, rnf146, and sh3bp2 TranscriptsmRNA was extracted from BMMs using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Real-time PCR reactions used Taq-man

Universal Master Mix (Applied Biosystems) and an ABI Prism 7900 sequence detection system. RNA concentrations were calculated

S2 Cell 147, 1324–1339, December 9, 2011 ª2011 Elsevier Inc.

relative to Glyceraldehyde 3-phosphate Dehydrogenase (GAPDH) expression. FAM-Sh3bp2, Tnks, Tnks2, rnf146, and VIC-Gapdh

labeled probes were obtained from Applied Biosystems (Taqman assays).

Transient TransfectionsHuman embryonic kidney cells (HEK293T) were grown in DMEM containing 10% FBS, 100 U/ml penicillin, and 100 mg/ml strepto-

mycin. Cells were grown at 37�C in a humidified atmosphere of 5% (vol/vol) CO2 in air. Transient transfections were performed

with either PolyFect Transfection Reagent (QIAGEN) or lipoD293 (Froggabio) according to manufacturer protocols.

SUPPLEMENTAL REFERENCES

Deckert, M., Tartare-Deckert, S., Hernandez, J., Rottapel, R., and Altman, A. (1998). Adaptor function for the Syk kinases-interacting protein 3BP2 in IL-2 gene

activation. Immunity 9, 595–605.

Parfitt, A.M., Drezner, M.K., Glorieux, F.H., Kanis, J.A., Malluche, H.,Meunier, P.J., Ott, S.M., and Recker, R.R.; Report of the ASBMRHistomorphometry Nomen-

clature Committee. (1987). Bone histomorphometry: standardization of nomenclature, symbols, and units. J. Bone Miner. Res. 2, 595–610.


Figu

3BP

TNK

TNK

for T

S4

re S1. Characterization of TNKS2 Binding to 3BP2, Related to Figure 1

2 binds to the ankyrin repeat region of TNKS2. GST (lane 2) or GST-tagged 3BP2 (lanes 3–7) were coexpressed with Flag-TNKS2 (lanes 2, 3), Flag-

S2DN-1 lacking first half of the ankyrin region (lane 4), Flag-TNKS2DN-2 lacking the second half of the ankyrin region including the SAM domain (lane 5), Flag-

S2DANK lacking the entire ankyrin region (lane 6), or Flag-TNKS2DSAM lacking the SAMdomain (lane 7). 3BP2was precipitated from cell lysates and probed

NKS2 by western blot. Glutathione beads served as a control (lane 1). The levels of 3BP2 and TNKS2 are shown below in the lower two panels.

Cell 147, 1324–1339, December 9, 2011 ª2011 Elsevier Inc.

Figure S2. The N Terminus and C Terminus of 3BP2 Contain ADP-Ribosylated Sites and 3BP2 ADP-Ribosylation, and Destabilization Is

Sensitive to the Position of the Tankyrase-Binding Sequence, Related to Figure 2

(A) An N-terminal fragment (Flag-3BP2 1–420) and two distinct C-terminal fragments (Flag-3BP2 372–stop, Flag-3BP2 372-stop) of 3BP2 are ADP-ribosylated by

TNKS2 in HEK293T cells. A scheme of the ectopic expressed constructs is shown below (circles = Flag tag, PH = Pleckstrin homology domain, triangle = WT

degron sequence, SH2 = Src homology 2 domain).

(B) The cherubismmutant chimeric protein 3BP2R423Q-WT degron harbouring theWT Tankyrase binding sequence at its C-terminal restores Tankyrase binding

but is insensitive to Tankyrase-induced destabilization. Controls include the cherubismmutant Flag-3BP2R423Q and the chimeric protein Flag-3BP2R423Q-Mut

degron with the cherubismmutant degron fused to the C terminus. Neither were able to bind Tankyrase. A scheme of the ectopic expressed constructs is shown

below (circle = Flag tag, PH = Pleckstrin homology domain, X = cherubism mutant degron sequence, SH2 = Src homology 2 domain, triangle = WT degron

sequence).

(C and D) The Flag-3BP2R423Q-WT degron protein with restored Tankyrase binding was none-the-less unable to be efficiently PARsylated by either TNKS (C) or

TNKS2 (D).


Figure S3. TNKS2 Induces 3BP2 Destabilization and Ubiquitylation, Related to Figure 3

(A) Wild-type but not cherubism mutant 3BP2 protein levels are sensitive to TNKS2 expression. GST-3BP2 (lanes 1–4) or the cherubism mutant GST-3BP2-

R413Q (lanes 5–8) was coexpressed with increasing amounts of the TNKS2 expression plasmid in HEK293T cells. Lysates were probed for expression of GST-

3BP2 (row 1) or TNKS2 (row 2). Actin loading controls are shown (row 3).

(B) 3BP2 protein levels are insensitive to expression of TNKS2DPARP. GST-3BP2was coexpressedwith increasing amounts of the PARP domain-deleted TNKS2

mutant (TNKS2DPARP) plasmid in HEK293T cells. Lysates were probed for expression of GST-3BP2 (row 1) or TNKS2DPARP (row 2). GST3BP2was precipitated

and probed for TNKS2DPARP (row 3). The amount of GST3BP2 immunoprecipitated is shown (row 4). Tubulin loading controls are shown (row 5).

(C) 3BP2 is directly ubiquitylated in the presence of TNKS2. HEK293T cells were cotransfected with HA-Ub, Flag-3BP2, and either Myc-tag peptide (Myc) (lane 1)

orMyc-TNKS2 (lane 2) in the presence of the proteasome inhibitors LLNL andMG132. After lysis, 3BP2was precipitated using an anti-Flag-specific antibody. The

protein complexes were then dissociated in 1% SDS heated to 68�C and after dilution with lysis buffer, ubiquitylated proteins were reprecipitated with an HA-

specific antibody. The protein complexwas resolved by SDS-PAGE and probed for 3BP2with the anti-Flag antibody bywestern blotting. The levels of the TNKS2,

3BP2 and Actin are shown in the lower three panels.

(D) rnf146-specific shRNAs effectively deplete rnf146 transcript levels in HEK293T cells. rnf146 mRNA levels in HEK293T transfected with one of three rnf146-

specific shRNAs (shrnf1-3) or controls shRNAs (shgfp and shrfp) as determined by qPCR. Error bars represent SEM.


Figure S4. 3BP2 ADP-Ribosylation Is Stimulated by TNKS, Related to Figure 5

(A) Flag-3BP2 but not the cherubism mutant Flag-3BP2R413Q is ADP-ribosylated by TNKS. HEK293T cells were cotransfected with Myc-TNKS (lanes 2 and 4)

and either Flag-3BP2R413Q (lanes 2) or Flag-3BP2 (lanes 4). Controls include the Myc-tag peptide coexpressed with Flag-3BP2R413Q (lane 1) or Flag-3BP2

(lane 3). After lysis, Flag-3BP2 was immunoprecipitated and probed with anti-PAR-specific antibodies. The level of precipitated 3BP2 protein is shown in the

second panel. The expression of TNKS, 3BP2, and actin in lysates are shown in the lower three panels.

(B) rnf146-specific shRNAs effectively deplete rnf146 transcript levels in osteoclasts. rnf146 mRNA levels in WT or Sh3bp2�/� osteoclasts infected with

a retrovirus expressing either a scrambled or rnf146-specific shRNA as determined by qPCR. Error bars represent SEM.


Figure S5. Analysis of Trabecular Bone Volume and Serum TNF-a Levels in Tnks2�/�, Related to Figure 7

(A) mCT reconstruction of the trabecular region below the distal femurs growth plate of 5-month-old WT and Tnks2�/� mice.

(B) mCT-derived measurements of the trabecular bone volume fraction (BV/TV), n = 4.

(C) Serum TNF-a levels in 22-week-old WT and Tnks2�/� mice as determined by ELISA. n = 4. Error bars represent SEM.


loss of tankyrase-mediated destruction of 3bp2 is the underlying pathogenic mechanism of cherubism

Documents

3bp2 mutations

cherubism mutations

3bp2 cherubism mutant

adaptor protein 3bp2

3bp2 adaptor protein

3bp2 protein levels

3bp2 binding

3bp2 function