LONG WAVE ULTRASOUND MAY ENHANCE BONE

REMODELLING BY ALTERING THE OPG/RANKL

RATIO IN HUMAN OSTEOBLAST-LIKE CELLS

ABHIRAM MADDI (BDS, Manipal Academy of Higher Education, India)

A THESIS SUBMITTED

FOR THE DEGREE OF MASTER OF SCIENCE

DEPARTMENT OF ORAL AND MAXILLOFACIAL SURGERY

FACULTY OF DENTISTRY

NATIONAL UNIVERSITY OF SINGAPORE

2005

2

Supervisor: A/P Ho Kee Hai BDS (Singapore) FDSRCPS (Glasgow) FAMS (Singapore) Consultant Dept. of Oral and Maxillofacial Surgery National University of Singapore Co-Supervisors: Dr Sajeda Meghji BSc, MPhil, PhD (London) Reader in Oral Biology Eastman Dental Institute for Oral Health Care Sciences University College London Professor Malcolm Harris DSc, MD, FDSRCS, FRCS (Edin) Dept. of Oral and Maxillofacial Surgery Barts and The London School of Medicine and Dentistry

3

Dedication I would like to dedicate this thesis to my family, my friends and most importantly to my mentors whose constant support and motivation made this work possible

4

Acknowledgements I would like to thank my supervisor A/P Ho Kee Hai for his constant help,

guidance and enthusiasm throughout my candidature. I am grateful to him and

the Faculty of Dentistry for sponsoring my training at the Eastman Dental

Institute, UCL, London where the in vitro work was done. I warmly acknowledge

Dr Sajeda Meghji, my co-supervisor, under whose guidance I had received

training for molecular research techniques like ELISA and Real Time PCR and

the experience gained is an asset for my future research career. I cannot thank

enough Professor Malcolm Harris also a co-supervisor who has been a constant

motivating factor apart from being a great teacher to me; he has helped me

evolve in my research thinking. I also acknowledge the help and guidance of my

fellow researchers at the Eastman, Dr Ali Reza, Dr Rachel Williams, Dr Lindsay

Sharp, Dr Hesham Khalil and Dr Wendy Heywood for teaching me cell culture

and laboratory techniques. I would also like to thank my colleagues and support

staff at the Dentistry research labs, DSO for their constant help. I would finally

like to acknowledge the National University of Singapore for endowing me with

the NUS Research Scholarship and the President’s Graduate Fellowship and

would like to congratulate it for impartially selecting foreign students and

grooming their talents.

5

Declaration I hereby declare that this dissertation is original to the best of my knowledge and

does not contain any material, which has been submitted previously for any other

degree or qualification.

Abhiram Maddi

6

Table of Contents Dedication………………………………………………………………………………..3 Acknowledgements……………………………………………………………………..4 Declaration……………………………………………………………………………… 5 Table of Contents……………………………………………………………………….6 List of Abbreviations…………………………………………………………………....9 List of Symbols…………………………………………………………………………10 List of Figures…………………………………………………………………………..11 List of Tables…………………………………………………………………………...12 Abstract..………………………………………………………………………………. 13 CHAPTER I. Introduction……………………………………………………………15

1. Osteoradionecrosis

1.1 Definition…………………………………………………………….16

1.2 Incidence……………………………………………………………16

1.3 Site of Incidence…………………………………………………...16

1.4 Classification of osteoradionecrosis……………………………..16

1.5 Etiopathogenesis…………………………………………………..17

1.6 Risk Factors………………………………………………………..19

1.7 Time of Development of osteoradionecrosis…………………...19

1.8 Diagnosis of osteoradionecrosis…………………………………19

1.9 Investigation of osteoradionecrosis………………………………20

1.10 Management of ORN…………………………………………….21

7

2. Therapeutic Ultrasound…………………………………………………….24

2.1 Historical…………………………………………………………….25

2.2 Physical Characteristics…………………………………………...27

2.3 Terminology…………………………………………………………28

2.4 Ultrasound Wave Form……………………………………………29

2.5 Ultrasound Transmission through tissues……………………….30

2.6 Absorption and Attenuation……………………………………….32

2.7 Therapeutic Ultrasound and Tissue Healing……………………34

2.8 Effect of Ultrasound on Tissue repair…………………………….37

2.9 The Ultrasound Apparatus………………………………………...39

3. Bone Remodeling and TNFR Superfamily……………………………………42

3.1 Bone Remodelling………………………………………………….42

3.2 RANKL……………………………………………………………....44

3.3 RANK………………………………………………………………..45

3.4 OPG………………………………………………………………….47

3.5 TNF-α………………………………………………………………..48

CHAPTER II. Hypothesis and Aims……………………………………………….49

CHAPTER III. Materials and Methods…………………………………………….50

1 Cell Culture……………………………………………………………50

2 Ultrasound Experiment………………………………………………52

8

3 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)...55

4 Quantitative Real Time PCR (Q PCR)…………………………......59

5 Immunochemistry…………………………………………………….60

6 Statistical Analysis……………………………………………………61

CHAPTER IV. Results………………………………………………………………62

1. Effect of Ultrasound on osteoprotegerin (OPG) and receptor

activator for NF-қB ligand (RANKL) mRNA and protein

production…………………………………………………………..62

2. Effect of Ultrasound on the mRNA and protein production of TNF-α in human osteoblast like cells…………………………….67 3. Effect of Ultrasound on the expression of alkaline phosphatase (ALP) and osteocalcin (OCN) in human osteoblast like cells….68

CHAPTER V. Discussion……………………………………………………………72

8.1 Introduction…………………………………………………………72

8.2 Discussion of Methodology……………………………………….75

8.3 Discussion of Results……………………………………………..77

CHAPTER VI. Conclusion............................................................................... ..79

Bibliography.......................................................................................................80

Paper Publications from this thesis………………………………………………98

9

List of Abbreviations ALP Alkaline Phosphatase DNA Deoxyribo Nucleic Acid ELISA Enzyme Linked Immunosorbant Assay GAPDH Glyceraldehyde Phosphate DeHydrogenase RNA Ribo Nucleic Acid mRNA Messenger RNA NCP Non collagenous protein OB Osteoblast OC Osteoclast OCN Osteocalcin OPG Osteoprotegerin ORN Osteoradionecrosis PCR Polymerase Chain Reaction Q-PCR Quantitative Polymerase Chain reaction RANK Receptor Activator of NF-қB

RANKL Receptor Activator of NF-қB Ligand RT-PCR Reverse Transcriptase Polymerase Chain Reaction TNF-α Tumor Necrosis Factor alpha US Ultrasound

10

List of Symbols λ Wave length µg Micrograms pg Picograms n Frequency ml Milli-litre µl Micro-litre V Velocity Hz Hertz w Watts

11

List of Figures Figure 1 Shape of the Ultrasound Beam…………………………………………29

Figure 2 Rarefaction of the Ultrasound Beam…………………………………..32

Figure 3 The Long Wave Ultrasound Machine………………………………….39 Figure 4 The Ultrasound Transducer…………………………………………….40 Figure 5 An Electric Field re-aligns the dipoles in a Piezo-electric crystal…..41

Figure 6 Current understanding of preosteoblastic / stromal cell regulation of

Osteoclastogenesis……………………………………………………..46

Figure 7 US treatment being performed in a sterile air-flow chamber………..52

Figure 8 The administration of US……………………………………………….53

Figure 9 Schematic of the Ultrasound Experiment……………………………..54

Figure 10 Pictures of gel analysis of RT-PCR products of GAPDH and OPG..62 Figure 11 OPG mRNA expression at various time points………………...…......63 Figure 12 OPG protein levels………………………….……………………………64 Figure 13 RANKL protein levels………………….………………………………...66 Figure 14 TNF-α protein levels.…………………………………………………….67 Figure 15 Pictures of gel analysis of RT-PCR products of GAPDH and OCN..68 Figure 16 OCN protein levels……………………………………………………….69 Figure 17 ALP mRNA expression at various time points………...………………70

12

List of Tables Table 1 Approximate Velocities of Ultrasound through Selected Materials…...31

Table 2 Primer Sequences for RT-PCR…………………………………………..58

Table 3 Summary of Results………………………………………………………..71

13

Abstract

Osteoradionecrosis (ORN) of the mandible has been a formidable long term

complication of radiotherapy, instituted for the treatment of tumors of the head

and neck region. The un-restorable decayed teeth in the mandible in the path of

radiation have to be removed, but whether before or after radiation, such

extractions can still lead to ORN. Its mainstream prophylaxis and treatment is

Hyperbaric oxygen therapy (HBO), which is expensive and not accessible to all

the patients.

Therapeutic Ultrasound (US) has been shown to promote repair in bone fractures

and soft tissue injuries in in vivo studies in rats and humans. In vitro studies have

shown that long wave US treated osteoblasts, fibroblasts and macrophages

increased synthesis of growth factors which play prominent roles in angiogenesis

and healing. The cytokines, TNF-α (tumor necrosis factor alpha), receptor

activator of NF-κB Ligand (RANKL) and osteoprotegerin (OPG) have been

shown to act directly or indirectly on osteogenic cells and their precursors

to control differentiation, resorption and bone formation. RANKL and TNF-α

promote osteoclast differentiation and thus bone resorption whereas OPG

promotes osteoblast differentiation and also competes with RANKL for the

receptor activator of NF-κB (RANK) receptor present on the osteoclast. Human

osteoblast cell line (MG63 cells) were treated with long wave (45 KHz ,

intensity-30mW/cm2) continuous ultrasound (US) and incubated for various

time periods following the treatment. The reverse transcriptase polymerase

14

chain reaction (RT-PCR) technique was used for observing genetic

expression and real time PCR for quantitative analysis of the genetic

expression of RANKL and OPG along with alkaline phosphatase (ALP), an

early bone marker and osteocalcin (OCN), a late marker. ELISA was

performed to estimate the amount of the cytokine released into the culture

media, following US treatment. The osteoblasts responded to US by

significantly upregulating both the OPG mRNA and protein levels. There

was no RANKL mRNA expression observed in both the US and control

groups and the protein levels were also very low in both groups and

significantly low in the US group. There was also no TNF-α expression and

the TNFα protein levels were insignificant. ALP and OCN mRNA were

significantly up regulated in the US group.

To my knowledge this is the first study that shows the effect of US on OPG and

RANKL. US appears to up regulate OPG and may down regulate RANKL

production. From these findings, we conclude that therapeutic ultrasound may

increase bone regeneration by altering the OPG/RANKL ratio in the bone

micro-environment.

15

CHAPTER I

INTRODUCTION

1. Osteoradionecrosis (ORN)

Radiotherapy is an essential treatment modality for oral and head and neck

malignant neoplasms. Unfortunately it induces alterations in the normal tissues,

resulting in early and long term complications. Mandibular osteoradionecrosis is

the most common long term complication of radiotherapy with a variable

incidence ranging from 2 to 44.2%. With adequate prevention the incidence is

still around 2-5% (Reher et al.)

Osteoradionecrosis (ORN) of the mandible was for a long time considered as an

osteomyelitis of the irradiated bone resulting from a triad of radiation, trauma and

infection. Marx and Klinge redefined this concept and pointed out that

osteoradionecrosis is not a primary infection of the bone; rather it is induced by a

metabolic and tissue haemostatic deficiency due to radiation induced cellular

injury. In 1983, Marx at the University of Miami described a rational foundation

idea, namely radiation tissue hypoxia, hypovascularity and hypocellularity, tissue

breakdown and chronic non-healing wounds as the main pathogenesis for ORN.

Bras et al., have reported that the radiation induced obliteration of the inferior

alveolar artery is the dominant factor in the onset of osteoradionecrosis leading

to an ischaemic necrosis of bone. Marx et al., also showed that micro-organisms

are not the primary causative factor, but play a role only as contaminants in

osteoradionecrosis.

16

1.1 Definition

Many definitions have been attributed to ORN over the years but a definition

given by Hutchinson in 1996 seems to be the most sensible, which states that

“ORN is an area of exposed bone in the mouth or on the face for more than two

months in a previously irradiated field in the absence of recurrent tumour”.

1.2 Incidence

There is a great variance in the incidence rates of ORN in the literature.

According to the most recent study done by Sulaiman et al, 2003 the incidence of

ORN was 2% among 187 cancer patients who underwent 951 dental extractions

with only 7 patients treated with HBO therapy prophylactically.

1.3 Site of Incidence

The mandible is the most common site of incidence of ORN probably because it

is often necessary to deliver a high dose of radiation to tumors of the tongue and

floor of the mouth and also probably as the blood supply is less abundant as

compared to the maxilla. Furthermore most maxillary tumors are treated

surgically before or after radiotherapy.

1.4 Classification of ORN

Coffin in 1983 examined 2853 patients who received radiotherapy for head and

neck malignancies and suggested that ORN develops in two forms a) Minor and

b) Major. The Minor form is considered to be a series of small sequestra which

17

separate spontaneously after varying periods of time and can be seen clinically

but not radiologically. The Major form occurs when necrosis involves the entire

thickness of the jaw and a pathological fracture is inevitable. This form is very

obvious radiologically.

1.5 Etiopathogenesis

Many theories have been formulated to explain the etiology of ORN since its first

observation in 1920s but the most accepted one originates from the work done

by Marx in 1983.

The Radiation, Trauma and Infection Theory

In 1970 Meyer named the classical triad of ORN as “radiation, trauma and

infection”. He described the role of trauma as a portal of entry for the oral

bacterial flora into the underlying bone.

The theory of non-healing wound due to Hypoxic-Hypovascular-

Hypocellular tissue

Marx in 1983 examined the traditional concept of the pathophysiology of ORN

described by Meyer questioning the occurrence of ORN without trauma or

infection. He studied 26 cases of ORN from which 12 en bloc resection

specimens were cultured and stained for micro-organisms. The microbiology

reports showed that all specimens were infected superficially but no organisms

could be cultutred from the deep, so called infected bone of ORN. The

18

histological findings observed by Marx showed endothelial death, hyalinization

and thrombosis of vessels with a fibrotic periosteum. Osteoblasts and osteocytes

were deficient with fibrosis of the marrow spaces. The overall result was a

composite tissue, which is hypovascular and hypocellular and was proven to be

hypoxic compared with non-irradiated tissue by direct measurement .

Current Concepts

Bilal et al, have found in a histological study of human specimens with ORN as

well as in specimens subjected to just 36 Gy radiation after a few weeks interval,

a loss of vitality of osteocytes. Marx et al and Rosenberg et al 2003 have

reported a type of osteonecrosis occurring in patients using bisphosphonates,

which bears characteristic resemblance to ORN. These osteonecrosis patients

have undergone suppression of osteoclasia with biphosphonates.

Bisphosphonates could reduce osteoclastic bone resorption through: (a) inhibition

of osteoclast recruitment to the bone surface; (b) inhibition of osteoclast activity

on the bone surface; (c) shortening of the osteoclast life span; and (d) alteration

of the bone or bone mineral in ways which reduce, by a pure physicochemical

and not a cellular mechanism, the rate of its dissolution. The first three effects

could be due to direct action on the osteoclast, or indirectly via the cells which

modulate osteoclast activity. So ORN might be the result of early cellular effects

of radiation.

.

19

1.6 Risk Factors

• Tumour size and location

• Radiation dose

• Local Trauma

• Dental Extractions

• Infection

• Immune defects

• Malnutrition

Many patients abuse alcohol and tobacco and are in poor general medical

condition, which together with poor nutritional status and lack of oral hygiene may

place them at a higher risk of ORN.

1.7 Time of Development of ORN

The time of development of ORN following radiation can be variable but the

majority of cases occur between 4 months and 2 years. Gowgiel in 1960 noted

that ORN of the mandible develops within 2 years of irradiation. Clayman in 1997

found that the highest risk for ORN was between 4 and 12 months following

irradiation.

1.8 Diagnosis of ORN

The diagnosis of ORN is primarily based on the clinical signs of ulceration of the

mucous membrane with exposure of necrotic bone. The lesion may be

20

accompanied by symptoms of pain, dysesthesia, fetor oris, dysguesia and food

impaction in the area (Braumer et al, 1979; Epstein et al, 1987).

Marx and Johnson (1987) found the following diagnostic signs to correlate with

increased signs of radiation tissue injuries:

• Induration of tissue

• Mucosal radiation telangiectasias

• Loss of facial hair growth

• Cutaneous atrophy

• Cutaneous flaking and keratinization

• Profound xerostomia

• Profound taste loss

1.9 Investigation of ORN

ORN can be investigated by many techniques but the ideal investigative tool

according to Hutchinson (1996) should be able to offer the following:

1. Record quantitatively and qualitatively the severity and extent

2. Monitor the progress of treatment

3. Predict patients at risk

4. Predict risk factors more confidently

5. Permit comparisons of treatment regimens

6. Predict the level of bone damage above which surgery is essential

21

The following investigations would be useful:

1. Radiography, CT and MRI

2. Nuclear medicine

3. Ultrasonography

4. Transcutaneous and transmucosal oximetry

5. Near Infrared Spectroscopy

1.10 Management of ORN

The aims of the treatment are elimination of pain and associated infections,

achieve vascularisation and mucosal/skin coverage, improvement of mouth

function (opening, speech, mastication) and the elimination of deformity (fistulas,

bone exposures and pathological fractures).

The various treatment options for osteoradionecrosis are as follows –

1. Antibiotics and curettage.

2. Hyperbaric oxygen (HBO) therapy with or without surgery.

3. Debridement and local flaps.

4. Resection and reconstruction.

5. Therapeutic Ultrasound (US) - Most recently described (Harris 1992, Refer et

al, 1997, 1998, Doan et al., 1999)

Dental management of patients who are about to receive therapeutic radiation

involving the jaws, remains a perplexing problem. The unrestorable decayed

22

teeth in the mandible which come in the path of radiation have to removed,

whether before or after radiation and can lead to osteoradionecrosis.

Conservative Management

According to Scully and Epstein (1996), conservative management with

medication and local wound care help in resolving 60% of the cases.

Maintenance of good oral hygiene with the use of 0.02% chlorhexidene mouth

washes after meals and constant saline washes are a must. Debris should be

washed/irrigated and sequestra should be allowed to separate spontaneously or

gently removed, since any surgical interference may encourage extension of the

necrotic process because of the lack of normal bone repair. Though ORN is not

primarily an infectious process, tetracyclines have been recommended because

of their selective uptake by bone (Rankow and Weissman, 1971). Penicillin has

also been used, because of the involvement of oral bacteria in the superficial

contamination (Marx et al 1985). Morton and Simpson, 1986 recommend packs

of BIPP (Bismuth and Iodoform Paraffin paste) for covering small areas of

exposed bone and delicate granulation tissue for keeping necrotic bone cavities

clean.

Hyperbaric Oxygen (HBO) therapy

HBO is administered as 20 sessions of 90 minutes each, breathing 100%

humidified oxygen at 2.4 atmospheres absolute pressure before surgery and 10

sessions after surgery. The empirical use of HBO to promote neovascularity and

23

neocellularity in irradiated and other sclerotic bone conditions has had success,

though usually as an adjunctive preparation to resection and reconstruction.

Marx has confirmed the value of hyperbaric oxygen as an adjunct to promote

neovascularity and neocellularity but recommends radical excision and

reconstructive surgery for 70% of the cases. Both the adjunctive HBO therapy

and surgery are a formidable experience to the patient who has already had

extensive surgery and other therapies for the malignant neoplasm. The major

disadvantages of HBO are that it is time consuming and expensive and most of

the previous studies done to prove its efficacy are uncontrolled. Also HBO

therapy is hazardous in patients with chronic emphysematous lung disease

which is not uncommonly associated with oral cancer.

According to Clayman it costs 1.5 million dollars to treat 100 patients with HBO.

In Singapore the cost of HBO therapy per person for 30 sessions is 7800 Sing $

at the rate of 260 S$ per session (Tan Tok Seng Hospital). A multicentre

randomized, placebo-controlled, double blind trial done by Annane et al showed

that the patients treated with HBO not only failed to benefit from the treatment but

also they had an unfavourable outcome as compared to the patients treated with

placebo. Similarly Cawood et al have recently shown in 329 patients that HBO

did not improve the integration outcome of titanium implants in irradiated jaws

(unpublished). Coulthard et al, in their review on the therapeutic use of HBO for

irradiated dental implant patients, have clearly mentioned that there is no

24

substantial evidence for the use of HBO and that more randomized controlled

trials are required to determine its effectiveness.

Ultrasound (US) Therapy

It is obvious that HBO could not cure many cases of ORN and moreover it is too

expensive to use it as a prophylactic measure in oral cancer patients receiving

radiotherapy. The cost of HBO for a single patient is enough for buying at least 5

US machines which are readily available, economic and easy to apply. US has

been proven to enhance bone formation, angiogenesis and synthesis of growth

factors and cytokines which are essential to bone metabolism.

Surgery

Surgery is very often a treatment option for ORN. Surgical options start with the

removal of small sequestra and increase depending on the case to

sequestrectomy, alveolectomy with primary closure, closure of oro-cutaneous

fistulae and flaps to cover the area. In extreme cases large resections and hemi-

mandibulectomies are performed and the bone should be reconstructed

preferably with a bone source with its own blood supply, like fibula or iliac crest

vascularized flaps.

2. Therapeutic Ultrasound Disturbed bone healing may occur as a side-effect of various therapies like

osteotomies, bone grafting, distraction osteogenesis and radiation therapy. Over

the years various interventions have been used to stimulate the healing process

25

and among them ultrasound remains distinguished by being non-invasive and

easy to apply. Ultrasound has been traditionally used in the field of physiotherapy

to treat soft tissue disorders by deep heating the tissues using intensities of 0.5

to 3 watts/cm². The intensities used for bone healing are considerably lower than

those used in physiotherapy because of the risk of over-heating the bone.

2.1 Historical

It was in 1880 when Jacques and Pierre Curie first observed that certain crystals

generated electricity when distorted. This observed effect which was called the

piezo-electric effect when reversed resulted in the emission of a high frequency

sound wave which we call the ultrasonic wave or precisely as ultrasound. The

crystals when subjected to an alternating current, expand and contract resulting

in the production of ultrasound. Paul Langevin (France, 1926), during the First

World War, used this effect in the detection of submarines. He was also the first

to observe the biological effects of ultrasound; fish introduced into a tank with

strong ultrasound field died after a period of violent motions and investigators

experienced pain of considerable severity when they thrust their hands into the

tank.

Pohlman in Germany,1938, was the first to construct an ultrasound device to

treat patients and found that patients with lower back pain, myalgias and

neuralgias responded favorably to treatment of the affected areas for 5 to 10

minutes daily for 10 days using a frequency of 800 kHz and an intensity of 4 to 5

26

mW/cm². The first reported successes to ultrasound treatment lead to the

widespread medical use of ultrasound, however, the influence of ultrasound on

bone received little attention at first as bone was considered a limitation to the

use of ultrasound and studies concerning the influence of ultrasound on bone

focused mainly on bone damage.

In 1950, Maintz published the first study in which the relationship between

ultrasound and bone healing was investigated. In three month old rabbits, a piece

of the radius was resected bilaterally and the ultrasound treatment regimen

involved exposure to different intensities for different time periods. A frequency of

800 kHz was used. The resected sites were examined histologically and

radiologically. Exposures to ultrasound at higher intensities showed a reduction

and arrest of callus formation and detachment of epiphysis. The untreated legs

healed without complications. Interestingly lower doses did cause osteogenesis

at a site distant from the resected site and ultrasound application and also the

simultaneously exposed ulnae showed sub-periosteal osteogenesis. The study

did not show any accelerated healing of bone. However, similar treatment

regimens showed positive effects on callus formation in another study which

involved bilateral femoral fractures in rabbits (De Nunno, 1952). In a controlled

study in rabbits by Carradi and Cozzolino, 1952 continuous wave 800 kHz

ultrasound of 1.5 W/cm² was found to stimulate the formation of callus in radial

fractures. Strauß in 1948 reported an accelerated healing of chronic

osteomyelitis due to gun-shot wounds in human subjects. Two cases of

27

osteoradionecrosis, were reported by Halsscheidt et al, 1949, in which

ultrasound treatment led to the covering of the non-healing bone with fresh

granulation tissue, followed by the formation of a sequester and healing of the

defects. Knoch in 1965 successfully treated 31 patients with different types of

fracture non-unions with ultrasound. 27 recalcitrant non-unions were successfully

treated by Xavier and Duarte in 1983 using pulsed ultrasound at an intensity of

30mW/cm². A double blind study done using SAFHS (Sonic Accelerated Fracture

Healing System) showed that ultrasound reduced the time to union by 38% in 61

dorsally angulated fractures (Kristiansen et al., 1997). There was no difference in

the healing rates between treatment and placebo groups during a 75 day course

of SAFHS treatment in tibial fractures fixed with a locked intramedullary nail

(Emami et al., 1999). The presence of the intramedullary nail may be the reason

for failure of ultrasound in this study because metals in the path of the beam

increase the local temperatures resulting in thermal effects coming into play.

2.2 Physical Characteristics of Ultrasound

Sound waves are longitudinal waves consisting of areas of compression and

rarefaction. Particles of a material, when exposed to a sound wave will oscillate

about a fixed point rather than move with the wave itself. As the energy within the

sound wave is passed to the material, it will cause oscillation of the particles of

that material. An increase in the molecular vibration in the tissue can result in

heat generation, and ultrasound (US) can be used to produce thermal changes in

the tissues. In addition to thermal changes, the vibration of the tissues appears to

28

have effects which are generally considered to be non thermal in nature. As the

US wave passes through a material (the tissues), the energy levels within the

wave will diminish as energy is transferred to the material. The energy absorption

and attenuation characteristics of US waves have been documented for several

types of tissue.

2.3 Terminology:

Frequency - the number of times a particle experiences a complete

compression/rarefaction cycle in 1 second.

Wave Length - the distance between two equivalent points on the waveform in

the particular medium.

Velocity - the velocity at which the wave (disturbance) travels through the

medium. In a saline solution, the velocity of US is approximately 1500 metre sec-1

compared with approximately 350 metre sec-1

in air (sound waves can travel

more rapidly in a denser medium). The velocity of US in most tissues is thought

to be similar to that in saline. These three factors are related, but are not

constant for all types of tissue. Average figures are most commonly used to

represent the passage of US in the tissues. The mathematical representation of

the relationship is V = F. λ where V is velocity, F is frequency and λ is the

wavelength.

29

2.4 US Waveform

The US beam is not uniform and changes in its nature with distance from the

transducer. The US beam nearest the treatment head is called the Near field, the

Interference field or the Frenzel zone. The behaviour of US in this field is far from

regular, with areas of significant interference. The US energy in parts of this field

can be many times greater than the output set on the machine (possibly as much

Figure 1 Shape of the Ultrasound Beam

[Stewart C Bushong, Radiological Science for Technologists, 8th Edition, 2004]

as 12 to 15 times greater). The size (length) of the near field can be calculated

using d2

/4λ where d is the diameter of the transducer crystal and λ, the US wave

length according to the frequency being used.

As an example, a crystal with a diameter of 25mm operating at 1 MHz will have a

near field/far field boundary where Boundary = 12.5mm2

/1.5mm ≈ 10cm thus the

near field (with greatest interference) extends for approximately 10 cm from the

treatment head when using a large treatment head and 1 MHz US. When using

30

higher frequency US, the boundary distance is even greater. Beyond this

boundary lies the Far Field or the Fraunhofer zone. The US beam in this field is

more uniform and gently divergent. The ‘hot spots’ noted in the near field are not

significant. For the purposes of therapeutic applications, the far field is effectively

out of reach.

One quality indicator for US applicators (transducers) is a value attributed to the

Beam Nonuniformity Ratio (BNR). This gives an indication of this near field

interference. It describes numerically the ratio of the intensity peaks to the mean

intensity. For most applicators, the BNR would be approximately 4 - 6 (i.e. that

the peak intensity will be 4 or 6 times greater than the mean intensity). Because

of the nature of US, the theoretical best value for the BNR is thought to be

around 4.0 though some manufacturers claim to have overcome this limit and

effectively reduced the BNR of their generators to 1.0.

2.5 Ultrasound Transmission through the Tissues

All materials (tissues) will present impedance to the passage of sound waves.

The specific impedance of a tissue will be determined by its density and

elasticity. In order for the maximal transmission of energy from one medium to

another, the impedance of the two media needs to be the same. Clearly in the

case of US passing from the generator to the tissues and then through the

different tissue types, this can not actually be achieved. The greater the

difference in impedance at a boundary, the greater the reflection that will occur,

31

and therefore, the smaller the amount of energy that will be transferred. The

difference in impedance is greatest for the steel/air interface which is the first one

that the US has to overcome in order to reach to body. To minimise this

difference, a suitable coupling medium has to be utilised. If even a small air gap

exists between the transducer and the skin the proportion of US which will be

reflected approaches 99.998% which in effect means that there will be no

transmission.

Table.1 Approximate Velocities of Ultrasound through Selected Materials

The coupling media used in this context include water, various oils, creams and

gels. Ideally, the coupling medium should be fluid so as to fill all available

spaces, relatively viscous so that it stays in place, have impedance appropriate

to the media it connects, and should allow transmission of US with minimal

absorption, attenuation or disturbance. At the present time the gel based media

appear to be preferable to the oils and creams. Water is a good medium and can

be used as an alternative but clearly it fails to meet the above criteria in terms of

32

its viscosity. In addition to the reflection that occurs at a boundary due to

differences in impedance, there will also be some refraction if the wave does not

strike the boundary surface at 90°. Essentially, the direction of the US beam

through the second medium will not be the same as its path through the original

medium - its pathway is angled. The critical angle for US at the skin interface

appears to be about 15°. If the treatment head is at an angle of 15° or more to

Figure.2 Rarefaction of the Ultrasound Beam

[Stewart C Bushong, Radiological Science for Technologists, 8th Edition, 2004]

the plane of the skin surface, the majority of the US beam will travel through the

dermal tissues (i.e. parallel to the skin surface) rather than penetrate the tissues

as would be expected.

2.6 Absorption and Attenuation:

The absorption of US energy follows an exponential pattern - i.e. more energy is

absorbed in the superficial tissues than in the deep tissues. In order for energy to

33

have an effect it must be absorbed, and at some point this must be considered in

relation to the US dosages applied to achieve certain effects.

Because the absorption (penetration) is exponential, there is (in theory) no point

at which all the energy has been absorbed, but there is certainly a point at which

the US energy levels are not sufficient to produce a therapeutic effect. As the US

beam penetrates further into the tissues, a greater proportion of the energy will

have been absorbed and therefore there is less energy available to achieve

therapeutic effects. The half value depth is often quoted in relation to US and it

represents the depth in the tissues at which half the surface energy is available.

This will be different for each tissue and also for different US frequencies. To

achieve a particular US intensity at depth, account must be taken of the

proportion of energy which has been absorbed by the tissues in the more

superficial layers.

As the penetration (or transmission) of US is not the same in each tissue type, it

is clear that some tissues are capable of greater absorption of US than others.

Generally, the tissues with the higher protein content will absorb US to a greater

extent, thus tissues with high water content and low protein content absorb little

of the US energy (e.g. blood) whilst those with a lower water content and a

higher protein content will absorb US far more efficiently. It has been suggested

that tissues can therefore be ranked according to their tissue absorption.

34

Although cartilage and bone are at the upper end of this scale, the problems

associated with wave reflection mean that the majority of US energy striking the

surface of either of these tissues is likely to be reflected. The best absorbing

tissues in terms of clinical practice are those with high collagen content –

Ligament, Tendon, Fascia, Joint Capsule, Scar Tissue (Watson 2000, Ter Haar

99, Nussbaum 1998, Frizzel & Dunn 1982)

The application of therapeutic US to tissues with a low energy absorption

capacity is less likely to be effective than the application of the energy into a

more highly absorbing material. Recent evidence of the ineffectiveness of such

an intervention can be found in Wilkin et al (2004) whilst application in tissue that

is a better absorber will, as expected, result in a more effective intervention (e.g.

Leung et al 2004).

2.7 Therapeutic Ultrasound & Tissue Healing

One of the therapeutic effects for which ultrasound has been used is in relation

to tissue healing. It is suggested that the application of US to injured tissues will,

amongst other things, speed the rate of healing & enhance the quality of the

repair. The therapeutic effects of US are generally divided into:

• Thermal Effects

• Non-Thermal Effects

35

Thermal Effects:

In thermal mode, it will be most effective in heating the dense collagenous

tissues and will require a relatively high intensity, preferably in continuous mode

to achieve this effect. Both Nussbaum (1998) and Ter Haar (1999) have

provided some useful review material with regards the thermal effects of

ultrasound. Comparative studies on the thermal effects of ultrasound have been

reported by several authors (e.g. Draper et al 1993, 1995) with some

interesting, and potentially useful results. It is too simplistic to assume that with

a particular treatment application there will either be thermal or non thermal

effects. It is almost inevitable that both will occur, but it is furthermore

reasonable to argue that the dominant effect will be influenced by treatment

parameters, especially the mode of application i.e. pulsed or continuous. Baker

et al (2001) have argued the scientific basis for this issue coherently.

US can be used to selectively raise the temperature of particular tissues due to

its mode of action. Among the more effectively heated tissues are periosteum,

collagenous tissues (ligament, tendon & fascia) & fibrotic muscle (Dyson 1983).

If the temperature of the damaged tissues is raised to 40-45°C, then a

hyperaemia will result, the effect of which will be therapeutic. In addition,

temperatures in this range are also thought to help in initiating the resolution of

chronic inflammatory states (Dyson & Suckling 1978). Having made these

comments, most authorities currently attribute a greater importance to the non-

36

thermal effects of U/S as a result of several investigative trials in the last 15

years or so.

Non-Thermal Effects:

The non-thermal effects of US are now attributed primarily to a combination of

Cavitation and Acoustic Streaming (te Haar 99, Baker et al 2001, Williams

1987). There appears to be little by way of convincing evidence to support the

notion of Micromassage though it does sound rather appealing.

Cavitation in its simplest sense relates to the formation of gas filled voids within

the tissues & body fluids. There are 2 types of cavitation - Stable & Unstable

which have very different effects. Stable Cavitation occurs at therapeutic doses

of US. This is the formation & growth of gas bubbles by accumulation of

dissolved gas in the medium. They take approximately 1000 cycles to reach

their maximum size. The cavity acts to enhance the acoustic streaming

phenomena and as such would appear to be beneficial. Unstable (Transient)

Cavitation is the formation of bubbles at the low pressure part of the US cycle.

These bubbles then collapse very quickly releasing a large amount of energy

which is detrimental to tissue viability. There is no evidence at present to

suggest that this phenomenon occurs at therapeutic levels if a good technique

is used.

37

Acoustic Streaming is described as a small scale eddying of fluids near a

vibrating structure such as cell membranes & the surface of stable cavitation

gas bubble (Dyson & Suckling 1978). This phenomenon is known to affect

diffusion rates & membrane permeability. Sodium ion permeability is altered

resulting in changes in the cell membrane potential. Calcium ion transport is

modified which in turn leads to an alteration in the enzyme control mechanisms

of various metabolic processes, especially concerning protein synthesis &

cellular secretions.

The result of the combined effects of stable cavitation and acoustic streaming is

that the cell membrane becomes ‘excited’ i.e, up regulated, thus increasing the

activity levels of the whole cell. The US energy acts as a trigger for this process,

but it is the increased cellular activity which is in effect responsible for the

therapeutic benefits of the modality (Watson 2000, Dinno et al 1989, Leung et al

2004).

Micromassage is a mechanical effect which appears to have been attributed

less importance in recent years. In essence, the sound wave traveling through

the medium will cause the molecules to vibrate, possibly enhancing tissue fluid

interchange & affecting tissue mobility.

2.8 Effect of Ultrasound on Tissue Repair

The application of ultrasound during the inflammatory, proliferative and repair

phases is of value not because it changes the normal sequence of events, but

because it has the capacity to stimulate or enhance these normal events and

38

thus increase the efficiency of the repair phases (ter Haar 1999). It would

appear that if a tissue is repairing in a compromised or inhibited fashion, the

application of therapeutic ultrasound at an appropriate dose will enhance this

activity. If the tissue is healing ‘normally’, the application will, it would appear,

speed the process and thus enable the tissue to reach its endpoint faster than

would otherwise.

Cellular Effects of Ultrasound There is an evidence of increased uptake of calcium ions by fibroblasts exposed

to the therapeutic levels of ultrasound which may be due to the action of shear

forces on the plasma membrane, produced by acoustic streaming in stable

cavities. Temporary increase in the intracellular calcium ions could act as a

signal for changes in the cell activity leading to a cascade of events as a result of

which wound healing is accelerated (Young et al., 1990)

For example in fibroblasts, the protein synthesis is stimulated by ultrasound

therapy, in platelets the release of serotonin and presumably the stimulators of

wound healing such as platelet derived growth factor (PDGF) is induced, in mast

cells the release of histamine is stimulated, and in macrophages growth factor

release is increased. The observed acceleration of wound healing following

exposure to ultrasound therapy could be due to the collective effects of these

cellular events (Doan et al., 1999).

Ultrasound stimulates bone formation It was shown by Doan et al in 1999 that therapeutic ultrasound induces in-vitro

cell proliferation, collagen/non-collagenous protein production, bone formation

39

and angiogenesis. Therapeutic angiogenesis can be used to reduce unfavorable

tissue effects caused by local hypoxia, including osteoradionecrosis and to

enhance tissue repair. Though US enhances bone formation it is not completely

understood as to how it acts at the molecular level.

2.9 Ultrasound Apparatus

The ultrasound apparatus consists of two parts, a generator and a ceramic

transducer mounted in the treatment applicator. The transducer converts the high

Fig.3 The Long Wave Ultrasound Machine; produces intensities from 5 to 50

mW/sq.cm at a 45 KHz frequency; produced and marketed by Orthosonics Ltd,

Devonshire, UK.

40

frequency alternating current from the generator into the ultrasound pressure

waves. The ultrasound machine is calibrated in two criteria – frequency and

intensity. Frequency is measured in mega Hertz (Mhz) where 1 hz is equal to 1

cycle per second. The intensity of the wave energy is measured in Watts per

centimeter square (W/cm2). Recently a new device has been developed that,

instead of using the traditional frequencies of 1 to 3 MHz, uses “long wave”

ultrasound at 45 KHz. This wave penetrates the tissues, reaching areas as deep

as several centimeters, instead of millimeters as with the megahertz machines.

To minimize heating effects it uses low intensities (5 to 50 mW/cm2).

The Ultrasound Transducer

A transducer converts one form of energy to another. The ultrasound transducers

Figure.4 Ultrasound Transducer

41

convert electrical energy to ultrasonic energy. The crystal is the active portion of

the transducer. The backing block is used to dampen the oscillations to form

finite pulses and establish pulse length.

Piezoelectric Crystals

These are materials which change in physical dimension when an electric field is

applied. Most commonly used material for these crystals is Lead Zirconate

Figure.5 An Electric Field re-aligns the dipoles in a Piezo-electric crystal.

A – unaligned crystal, B – Crystal aligned by electricity.

[Christensen’s Physics of Diagnostic Radiology, pg.328]

42

Titanate(PZT). Quartz is a naturally occurring piezoelectric material studied by

the Curies and used commonly in therapeutic ultrasound transducers. The

thickness of the crystal determines the resonant frequency. Transducers are

generally designed to operate at a frequency corresponding to twice the

thickness of the crystal.

3. Bone Remodelling and Tumor necrosis factor alpha receptor (TNFR) superfamily 3.1 Bone remodelling Bone remodeling is a continuous, life long process of bone resorption and bone

formation that renews the skeleton while maintaining its structure. It is a complex

phenomenon which results from the activities of osteogenic cells like osteoblasts

and osteocytes and the osteolytic osteoclasts. Osteoblasts make bone whereas

osteoclasts resorb (Teitelbaum et al., 1997), but the two processes are

inseparable.

Osteoclasts are differentiated cells whose path of development from

monocyte/macrophage precursors to multinucleated cells includes various stages

like proliferation, differentiation, fusion and activation. These events are under

the influence of hormones and cytokines like interleukins, tumor necrosis factor

alpha (TNF-α), transforming growth factor beta (TGF-β) and prostaglandin E2

which act in concert (Teitelbaum et al.,2000). The recently discovered receptor

activator of NF-қβ ligand (RANKL), an essential cytokine for osteoclastogenesis,

has led to a better understanding of osteoclast cell biology and has provided

43

important insights into the pathogenesis of human metabolic bone diseases

(Lacey et al, 1998).

Osteoblasts are bone forming cells derived from bone marrow and are

transformed into osteocytes over a period of time when they get trapped in

mineralized bone. Osteoblasts and osteoclasts are closely related in time and

space. After receiving a stimulus (mechanical load, growth factors, hormones)

osteoclastic cells appear on the bone surface and resorb the mineral

components of bone (Blair et al., 1998). Osteoblasts when stimulated by

osteoclastic contacts and/or osteoclastic soluble factors, deposit osteoid

substance at the resorption site, thereby initiating new bone formation.

Osteoblasts also control mineralization (KT Steeve et al., 2004).

Osteoclastogenic Factors The development of osteoclasts is controlled by osteoclastogenic factors

synthesized by osteoblasts, like RANKL, OPG and TNF-α. RANKL (also known

as TRANCE / OPGL / ODF) which is expressed on the surface of stromal bone

marrow cells and osteoblasts, plays a central role in osteoclastogenesis by

providing an essential signal to OC progenitors through the membrane-anchored

receptor, RANK (Hofbauer et al., 2000). Signal transduction through RANK (Hsu

et al., 1999, Hofbauer et al., 2000) leads to OC differentiation and functional

activation (Yasuda et al., 1998,1999). This signaling pathway can be disrupted by

a naturally occurring decoy receptor for RANKL, termed osteoprotegerin (OPG),

44

which blocks the interaction between RANKL and RANK (Yasuda et al., 1998).

Bone formation in principle can be assessed by the relative ratio of OPG to

RANKL. TNF-α is one of the most potent osteoclastogenic cytokines produced in

inflammation (Kwan Tat S et al., 2004, Warden et al., 2001). TNF-α is

responsible for stimulating osteoclastic resorption both in vitro (Reher et al.,

2002) and in vivo (Warden et al., 2001). TNF-α exerts its osteoclastogenic effect

by activating NF-κB through an intracellular mechanism overlapping that of

RANKL (Lacey et al., 1999). TNF-α potently activates osteoclasts, through a

direct action independent of RANKL but strongly synergistic with RANKL (Lacey

et al., 1999). TNF-α and RANKL, whether acting individually or in combination,

exert a real impact on osteoclast differentiation (Naruse et al., 2000).

3.2 RANKL (receptor activator of NF-қB ligand)

RANKL is a protein with 317 amino-acids. It belongs to the TNF super-family and

is largely expressed in bone, bone marrow and lymphoid tissue. The

predominant role of this cytokine in bone physiology is the stimulation of

osteoclastic differentiation/activation and the inhibition of osteoclast apoptosis

(Khosla et al., 2001). RANKL in association with macrophage-colony stimulating

factor (M-CSF) is necessary and sufficient for the complete differentiation of

osteoclastic precursors into mature osteoclasts. RANKL knock-out mice present

a severe a severe osteopetrosis and a total loss of osteoclasts (Yasuda et al.,

1998). RANKL exists both in soluble and membranous forms (Ikeda et al., 2001).

The soluble form, which corresponds to the c-terminal part of the membranous

45

RANKL, may be produced either directly by the cell through an alternative

splicing followed by an excretion in the extra-cellular medium or by a protelytic

cleavage of membranous RANKL. Different proteases have been proposed to

carry out this cleavage, like, tumor necrosis factor converting enzyme (TACE),

the membranous metalloprotease MT1-MMP and recently the A disintegrin and

metalloprotease 19 (Armstrong et al., 2002). The ectodomain structure of the

protein RANKL is made up of a homotrimer. The structural form of RANKL,

necessary for the interaction between RANKL and its specific receptor RANK,

binds to three RANK molecules (Lam et al., 2001).

The protein kinase C (PKC) pathway plays an important role in the regulation of

RANKL mRNA expression in osteoblasts. The protein kinase A (PKA) pathway

may also have an important involvement since the effects of parathyroid

hormone (PTH) on RANKL mRNA expression in murine bone marrow cultures

depends on the PKA pathway (Lee et al., 2002). It has been proposed that

RANKL would act through phospholipase C to release Ca(2+) from intracellular

stores, thereby accelerating the nuclear translocation of NF-қβ and promoting

osteoclast survival (Komarova et al., 2003).

3.3 RANK (receptor activator of NF-қB ligand)

RANK is a transmembrane protein of 616 amino-acids. It belongs to the TNF

superfamily and is expressed primarily on cells of the monocyte/macrophage

lineage including osteoclast precursors, B and T cells, dendritic cells and

46

fibroblasts (Khosla et al., 2001). It is also present on the surface of matur

osteoclasts. Like other TNFR-related proteins, RANK is known to activate a

cascade of intracellular signaling events, including the recruitment of TNFR-

Figure.6 Current understanding of preosteoblastic/stromal cell regulation of

osteoclastogenesis (S.Khosla, 2001)

associated factor proteins (TRAF), activation of transcription factors (NF-қβ, AP-1

and NFAT2), activation of mitogen activated protein kinases cascades (MAPK-

47

like, ERK, JNK and p38) and induction of Src- and phosphatidylinositol 3-kinase-

dependent Akt activation (Lee et al., 2003).

3.4 OPG (osteoprotegerin)

OPG, which is synthesized as a protein of 401 amino-acids, is cleaved to give a

380 amino-acids mature protein (Khosla et al., 2001). It is released in its soluble

form by stromal cells/osteoblasts after losing its transmembrane and cytoplasmic

domains. Thus OPG differs from other TNFR superfamily members which remain

mainly membrane associated (Tan et al., 1997). In contrast to RANKL, OPG

knock-out mice are osteoporotic (Mizumo et al., 2002). OPG acts as a decoy

receptor for RANKL and down-regulates the RANKL signaling through RANK. It

represents an antagonist endogenous receptor that neutralizes the biological

effects of all forms of RANKL and thus acts as an inhibitor for resorption. It has

also been reported that OPG can directly inhibit osteoclast activity, independently

of RANKL, through interactions with still uncharacterized receptors present on

osteoclasts (Hakeda et al., 1998). The biological effects of OPG on bone cells

include inhibition of terminal stages of osteoclast differentiation, suppression of

mature osteoclast activation and induction of apoptosis.

Bone remodeling appears to be mainly controlled by the OPG/RANKL balance in

the bone micro-environment. Any imbalance in the RANKL to OPG ratio can lead

to an excessive bone resorption or in contrast an excessive bone formation.

48

3.5 TNF-α

TNF-α, a multifunctional cytokine is produced by activated macrophages. The

soluble TNF-α (mature protein) is released, under physiological conditions, by a

proteolytic cleavage of the precursor proTNF-α, a type II transmembrane protein,

at the Ala76-Val77 bond. TACE is the protease responsible for this cleavage.

TNF-α is one of the most potent osteoclastogenic cytokines produced in

inflammation. TNF-α mediates RANKL stimulation of osteoclast differentiation

through an autocrine mechanism (Zou et al., 2001). It has been shown that TNF-

α causes bone loss in periodontitis, orthopaedic implant loosening and other

forms of chronic inflammatory osteolysis (Bingham et al., 2002). TNF-α is

associated with various cell signaling systems via two types of cell surface

receptors, namely TNFR I and TNFR II. Both receptors are expressed on a wide

variety of cell types including bone marrow hematopoietic cells (Sato et al.,

1997). TNFR I is known to mediate most of the biological properties of TNFα

such as programmed cell death and activation of NF-қβ. In contrast TNFR II

lacks a death domain, therefore TNFR II is involved in an antiapoptotic effect of

TNF-α whereas TNFR I is involved in both apoptotic and antiapoptotic signaling.

49

CHAPTER II HYPOTHESIS AND AIMS Null Hypothesis

1. Therapeutic ultrasound does not enhance bone remodeling by enhancing OPG/RANKL ratio in vitro

2. Therapeutic ultrasound does not affect transcription and translation of TNF

alpha in vitro

3. Therapeutic ultrasound does not affect the transcription of bone markers ALP and OCN

Alternate Hypothesis

1. Therapeutic ultrasound enhances bone remodelling by enhancing OPG/RANKL ratio in vitro

2. Therapeutic ultrasound does affect transcription and translation of TNF

alpha in vitro

3. Therapeutic ultrasound does affect the transcription of bone markers ALP and OCN

Specific Aims

To find out whether ultrasound enhances bone remodeling in vitro by

1. enhancing the transcriptional and translational levels of OPG 2. decreasing the transcriptional and translational levels of RANKL

3. decreasing the transcriptional and translational levels of TNF alpha

50

CHAPTER III

MATERIALS AND METHODS 1. Cell culture

MG63 cell line

MG63 (ATCC® Number: CRL-1427 ™) which is a human osteosarcoma cell line

characterized for its osteoblast like properties (Takeuchi et al 1995) was used in

this study. In vitro studies of osteoblast behavior use either primary osteoblasts

or osteogenic osteosarcoma cell lines. Osteosarcoma cell lines have a high turn-

over rate while retaining the basal characteristics of primary osteoblasts. They

can help us in understanding the osteoblast function because they represent

clonal populations derived from specific stages of the osteopath lineage. Clover

et al in 1994 showed that MG63 cells were suitable models for studying integrin

sub-unit expression, cell adhesion and for investigating the regulation and

expression of osteocalcin. They also found that proliferation and alkaline

phosphatase activity exhibited by MG63 were not representative of primary bone

cell cultures.

Bu et al in 2003 studied the expression of TNFs and signaling and non-signaling

TNF receptors in human osteoblasts derived from mesenchymal stem cells and

well characterized osteosarcoma, MG63 with unamplified gene screening. They

found a remarkable similarity in mRNA expression between MG63 and non-

transformed osteoblasts. They suggested that in the un-stimulated state, the

51

overall expression of TNF related proteins (OPG, RANKL, TNFα etc) in primary

osteoblasts overlaps extensively with that in a transformed cell line like MG63.

All cell culture procedures were performed in a sterile air-flow chamber. Cells

were cultured in 75 sqcm tissue culture flasks (Sarstaed) in Dulbecco’s minimum

essential medium (DMEM, Gibco BRL) supplemented with 10% heat inactivated

fetal calf serum (Sigma), 2mmol L-glutamine (Sigma) and 100U/ml each of

penicillin/streptomycin (Gibco BRL) and incubated at 37ºc. The cells reached

confluency usually within 3 days and the culture medium was removed from the

flask and the cell layer was washed using PBS to remove excess culture medium

and dead cells. The cell layer was then trypsinized using 2 ml of trypsin

(Invitrogen) in PBS (Gibco RL), excess trypsin removed and the flasks incubated

at 37ºc for 5 to 10 minutes. Once the cell layer separated 10 ml of culture

medium was added to each flask to stop the action of trypsin. The cell

suspension was then collected in 25 ml plastic tubes (Sarstaed) and subjected to

centrifugation at 1800g for 10 minutes. The supernatant was removed and the

cells resuspended in 25 ml culture medium. The cells were then counted in a

Neubar chamber and distributed at 5 x 105 cells/well in six-well culture plates

(Sarstaed) and incubated for at least 24 hours before being subjected to

ultrasound treatment.

52

2. The Ultrasound Experiment

Ultrasound treatment was done in a sterile airflow chamber. The 45 kHz long

wave ultrasound machine used in this study was a Phys-Assist unit supplied by

Figure.7 US treatment being performed in a sterile air-flow chamber

Orthosonics Ltd (Ashburton, Devon). The six well plates containing the MG63

cells were suspended in a water bath set to a temperature of 37ºc. The water

bath was internally lined with rubber in order to absorb the excess ultrasound

waves and prevent them from reflecting. The ultrasound transducer head was

fixed to a stand which in turn was fixed to a rotator set to 30-40 revs/minute to

prevent standing wave formation (standing waves are formed due to reflection of

ultrasound waves when the transducer head is held stationary and will result in

53

bone resorption in human subjects due to localized concentration of energy). The

transducer head was immersed in the culture medium present in the well. Each

well had 5 ml of culture medium which allowed a distance of 5 mm between the

transducer head and the cells.

An intensity of 30mW/cm² was used for treating the cells. The MG63 cells were

subjected to ultrasound treatment for 5 minutes as previously described by Doan

et al 1999. The cells were incubated at 37ºc for 0*, 3, 6, 12, 18 and 24 hour time

periods after ultrasound treatment (*incase of the 0 hour time point the cultures

were not incubated at all and the cells were harvested or supernatant collected

immediately after ultrasound treatment). The controls were sham-sonicated prior

Figure.8 Administration of US to each cell culture well of a 6 well-plate.

54

to incubation. The wells were sonicated or sham-sonicated (the transducer was

applied to the control wells but with the ultrasound machine switched off) in

triplicates. The culture plates were made to float in a water-bath maintained at

37ºc. The US transducer-head was immersed in the cell culture supernatant and

rotated using a rotator/shaker to distribute the US waves equally. The transducer

head was sterilized with alcohol wipes (Azowipe) and allowed to dry completely

between treatments to make sure there was no introduction of alcohol into the

culture medium.

Figure.9 Schematic of the Ultrasound Experiment (Reher et al., 2002)

55

3. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) RNA

Extraction

RNA extraction from the sonicated and control cultures was done immediately at

the end of the incubation time point using TRIzol reagent (Invitrogen, UK),

according to the manufacturer’s instructions. The supernatant from the treated

and control wells was either collected (for ELISA) or discarded and the cells were

washed with PBS to remove the remaining medium. 500 µl TRIzol was added to

each well and incubated at room temperature for about 5 to 10 minutes. The cell

lysate was collected in 1.5 ml Eppendorf tubes (Sarstaed) and transferred to -

70ºc where it could be stored for up to 1 month. 200µl chloroform was added to

the tubes containing lysate and mixed by inversion of the tubes for 20 seconds

and incubated at room temperature for 3 minutes. The tubes were then

centrifuged at 12500g and 4ºc for 15 minutes. This results in phase separation of

RNA, DNA and protein in the top, middle and bottom layers respectively. The top

aqueous layer containing RNA was carefully pipetted and transferred to a fresh

Eppendorf tube to which 1 ml of isopropanol was added and the tubes were

incubated at -20ºc for at least 10 minutes. Isopropanol helps in precipitating the

RNA. The tubes were then centrifuged at 12500g for 10 minutes to get a pellet of

RNA. The supernatant was carefully discarded from the tube and 1 ml of 75%

ethanol added. The tubes were then centrifuged at 7500g for 10 minutes

following which the supernatant was discarded and the pellets were allowed to

air dry. The pellets once dry were suspended in 50 µl of DEPC-water and

quantified by measuring the absorbance at 260nm and 280nm. A ratio of 1.8 to

56

2.0 between the readings at 260 and 280nm was considered as ideal. At 260 nm,

an absorbance unit of 1 is equivalent to 40ng/ml of RNA.

DNase Treatment

All the samples were DNase treated irrespective of the spectrophotometric

readings. DNase treatment was done using RQ1 DNase (Promega) according to

the manufacturer’s protocol. The reaction was set up as follows:

• Up to 8µl RNA

• 1µl RQ1 DNase 10x reaction buffer

• 1µg RQ1 RNase-free DNase

• Nuclease-free water to a 10µl final volume

The sample was incubated for 30 minutes at 37ºc and 1 µl RQ1 DNase stop

solution added to terminate the reaction, followed by a 10 minute incubation

period at 65ºc to inactivate the DNase. Samples were stored at -70ºc until use.

Reverse Transcription (RT)

It was carried out using SuperScript II RT (Invitrogen) according to the

manufacturer’s instructions. The cDNA synthesis reaction was set up as follows:

• 100ng/reaction RNA template

• 0.1µg oligo (dt) (Promega)

• 0.5mM dNTP mix

• Up to 5 µl of double distilled water

57

The reaction mix was incubated at 65ºc for 5 minutes and quick chilled at 4ºc for

at least 5 minutes. The reaction mixture was then transferred to a tube containing

the following reagents:

• 5x reaction buffer

• o.1M dTT

• 1 µl RNAse OUT

The samples were incubated at 42ºc for 2 minutes. After incubation, 1µl of

SuperScript II Reverse Transcriptase was added to make a final volume of 20 µl

and the samples were incubated at 42ºc for 50 minutes followed by 70ºc for 15

minutes. The cDNA thus obtained was stored at -20ºc until use.

Polymerase Chain Reaction (PCR)

PCR was carried out on cDNA generated from total RNA. Add the following to a

PCR reaction tube for a final reaction volume of 25 microlitre:

• 2.5 µl 10X PCR buffer

• 1.5 µl 50mM MgCl2

• 0.5 µl 10 mM dNTP Mix

• 1 mM amplification primer 1

• 1 mM amplification primer 2

• 0.2 µl Taq DNA polymerase (5U/µl)

• 1 µl cDNA

• Up to 25 µl double distilled water

Amplification was performed in an Eppendorf master cycler gradient PCR

machine programmed for the following cycles:

58

• 94ºc for 2 minutes – 1cycle

• 94ºc for 30 seconds, Annealing temperature for 30 seconds, 72ºc for 30

seconds – 28 to 35 cycles

• 72º for 7 minutes – 1 cycle

RT-PCR was performed to assess the expression of OPG, RANKL, TNF-α and

OCN. The house keeping gene GAPDH was used as the internal control in this

study. The oligonucleotide primers (Sigma) and the annealing temperatures used

to amplify the different genes under study are shown in the following table:

Table.2 Primer Sequences and cycle conditions for RT-PCR

Gene Accession no. Sequence Cycling conditions Amplicon GAPDH BC013310.1 F: GAAGTGGAAGGTCGGAGTC 94˚C 1min 313 bp R: GAAGATGGTGATGGGATTTC 57˚C 1min 72˚C 1min

29 cycles OCN NM_199173 F: GGCCAGGCAGGTGCGAAGC 95˚C 30s 255 bp R: GCCAGGCCAGCAGAGCGACAC 70˚C 30s

72˚C 30s 35 cycles

OPG NM002546 F: AGACTTTCCAGCTGCTGA 94˚C 1min 469 bp R: GGATCTCGCCAATTGTGA 57˚C 1min 72˚C 1min 29 cycles RANKL AF019047 F: CAGGAGACCTAGCTACAGA 94˚C 40s 381 bp R: CAAGGTCAAGAGCATGGA 55˚C 40s 72˚C 40s 29 cycles TNF-α BC000053 F: GTGGCAGTCTCAAACTGA 94˚C 40s 332 bp R: TATGGAAAGGGGCACTGA 55˚C 40s 72˚C 40s 29 cycles ______________________________________________________________________________________

59

Agarose gel electrophoresis of DNA Agarose gels were generally made up as 1.5 % multi purpose agarose (Roche,

Lewes, UK) in TAE buffer (0.04M Tris-acetic acid, 10mM EDTA pH8.0). The

agarose/TAE solution was heated in a microwave on full power (750 W) for 1

minute and cooled to about 50ºc. Then 2 µl of a 10 mg/ml solution of ethidium

bromide was added and the gel solution poured into a gel former and a comb

inserted. When set the gel was placed into an electrophoresis tank, the comb

removed and 1x TAE added. Care was taken to cover the surface of the gel with

the running buffer. Samples to be electrophoresed were mixed with 6x sample

loading buffer (Promega) and loaded into the wells with a micropipette. The gel

was electrophoresed 5-10 volts/cm for approximately ½ hour until the dye had

migrated two thirds of the length of the gel. The PCR products were visualized on

a UV transilluminator.

4. Quantitative Real Time PCR (QPCR)

Real Time PCR was performed for RANKL, OPG and ALP. GAPDH was used

as the endogenous control. TaqMan real-time quantitative PCR was performed

using TaqMan PCR chemistry and the ABI 7300 Real Time PCR system (Applied

Biosystems) according to manufacturer’s instructions. The real-time reactions

were run using the TaqMan Universal PCR Master Mix (Applied Biosystems) with

300 nM of each primer and 200 nM of probe, in a total volume of 25 µl. The real-

time PCR program parameters were as follows: 50 °C for 2 min; 95 °C for

10 min; then 40 cycles of 95 °C for 15 s and 60 °C for 60 s. The concentration of

60

each experimental sample was calculated relative to that of the endogenous

control (GAPDH) using ABI software.

5. Immunochemistry

ELISA assays were performed for RANKL (Peprotech, London, UK), TNF-alpha

(Immunotools, Germany), OPG (R&D Systems Europe Ltd) and OCN

(NovoCalcin Immunoassay kit, Metra Biosystems). Microtitre plates (NUNC) were

coated with 100 µl/well of coating antibody at 1µg/ml in PBS (140 mM NaCl, 2.7

mM KCl, 1.5 mM KH2PO4, 8.1 mM Na2HPO4, pH 7.2) and incubated overnight at

4˚C or room temperature according to the manufacturer’s instructions. The

plates were washed three times with wash buffer (0.5-0.05% Tween in PBS,

pH 7.2 to7.4) to remove unbound antibody and blocked using blocking

buffer (1% BSA in PBS) for 1 hour . The plates were then washed and

incubated at room temperature with Standards and Samples for 1 hour ,

followed by incubation with detection antibody. The plates were washed

and Avidin peroxidase HRP (Dako Ltd, 1:2000) was added to each well

and the plates incubated for 20 minutes. The plates were then washed and

developed with 100µl/well of colour reagent (0.4 mg OPD, and 0.4 µl of

30% H2O2 in 1 ml of 0.1M citric acid phosphate buffer, pH 5.0). The

reaction was stopped within 15 to 30 minutes with 100 µl of 1 M H2SO4

and the absorbance measured on an MRX II microplate reader (Dynex

Technologies) at a wave length 450 nm.

61

6. Statistical Analysis

The statistical difference between the Ultrasound treated and control groups was

determined using the Student’s T-test for a two-tailed distribution and pooled

variance on SPSS software. This allowed a comparison of the treated and control

groups at individual time points.

62

CHAPTER IV

RESULTS

1. Effect of Ultrasound on osteoprotegerin (OPG) and receptor activator for NF-қB lignand (RANKL) mRNA and protein production Detection of OPG transcription levels by RT-PCR and Q-PCR assays

The RT-PCR assay showed OPG transcription in both ultrasound treated and

control groups but the bands seemed to be more prominent in the former. To

consolidate with those findings the QPCR assay showed an OPG up regulation

at all time points but more significantly at 0h, 12h, 18h and 24h after incubation

when compared to the control group.

_______US Control_____ 0 3 6 12 18 24 0 3 6 12 18 24

a) GAPDH

b) OPG

Figure.10 Pictures of gel analysis of RT-PCR products of a) GAPDH, b) OPG.

US promoted OPG mRNA levels at 0, 6, 18 and 24h prominently while the

control group showed expression at 12, 18 and 24h time points. The MG63 cells

(5x105/well) were treated with 30mW/cm2 intensity from a 45 KHz machine

for 5 minutes. The cells were then incubated for six time periods before RNA

extraction. GAPDH was used as the internal control.

63

Figure.11 US promoted OPG mRNA levels of MG63 significantly at 0h,

12h, 18h and 24h. The MG63 cells (5x105/well) were treated with

30mW/cm2 intensity from a 45 KHz machine for 5 minutes. The cells were

then used for assessment of mRNA levels at 0h, 3h, 6h, 12h, 18h and

24h after US treatment. The graphs were plotted with relative expression of

OPG mRNA with respect to GAPDH, the internal control. (■ ultrasound group, □

control group, * shows significance at p<0.05, **shows significance at p<0.01)

0

0.5

1

1.5

2

2.5

3

3.5

0 3 6 12 18 24

Time (Hours)

OP

G m

RN

A

* * * *

*

*

64

OPG protein levels detected by ELISA assay

OPG protein secretion was observed in both the ultrasound and control groups

but seemed to be significantly up regulated after 3h and 24h as compared to the

control. After 0h and 12h the OPG levels seemed to be lower for the ultrasound

group, though not significantly.

50

150

250

350

450

550

650

750

850

950

0 3 6 12 18 24Time (hours)

OP

G p

g/m

l

Figure.12 US promoted OPG protein levels at 3h and 24h. The MG63 cells

(5x105/well) were treated with 30mW/cm2 intensity from a 45 KHz machine

for 5 minutes. The supernatant was then used for the assessment of

protein levels at 0h, 3h, 6h, 12h, 18h and 24h after US treatment. (■

ultrasound group, □ control group, *shows significance at p<0.05, ** shows

significance at p<0.01)

*

*

65

Detection of RANKL transcription levels by RT-PCR and Q-PCR assays

The effect of ultrasound on RANKL transcriptional levels was investigated using

RT-PCR and Q-PCR. No RANKL expression was observed in untreated MG63

cells, which is consistent with previous studies. It was also observed that

ultrasound did not induce RANKL transcription in MG63 cells (data not shown).

RANKL protein levels detected by ELISA assay

The secretion of RANKL by MG63 cells as a result of ultrasound treatment was

detected using ELISA. It was found that the RANKL protein levels were very low

when compared to OPG. The RANKL levels secreted by ultrasound-treated

MG63 cells appeared to be significantly lower than levels produced by control

cells.

66

0

5

10

15

20

25

30

35

40

0 3 6 12 18 24

Time (Hours)

RA

NK

L p

g/m

l

Figure.13 RANKL protein levels were significantly less at 6h, 12h, 18h and

24h time points in the ultrasound treated group as compared to the controls

which showed no RANKL protein production at all . But in general RANKL levels

were quite low as compared to OPG protein levels. The MG63 cells

(5x105/well) were treated with 30mW/cm2 intensity from a 45 KHz machine

for 5 minutes. The supernatant was then used for the assessment of

protein levels at 0h, 3h, 6h, 12h, 18h and 24h after US treatment. (■

ultrasound group, □ control group, *shows significance at p<0.05, ** shows

significance at p<0.01)

* *

* *

*

*

67

2. Effect of Ultrasound on the mRNA and protein production of TNF-α in human osteoblast like cells TNF-α transcription was not observed in either the ultrasound or control group

(data not shown) and the protein secretion was also very low (0.5-12 pg/ml).

0

5

10

15

20

25

0 3 6 12 18 24

Time (Hours)

TN

F-a

lpha p

g/m

l

Figure 14 - TNF-α levels did not change significantly following ultrasound

treatment. TNF-α levels were very low as compared to OPG. The MG63 cells

(5x105/well) were treated with 30mW/cm2 intensity from a 45 KHz machine

for 5 minutes. The supernatant was then used for the assessment of

protein levels at 0h, 3h, 6h, 12h, 18h and 24h after US treatment. (■

ultrasound group, □ control group, *shows significance at p<0.05, ** shows

significance at p<0.01)

68

3. Effect of Ultrasound on the expression of alkaline phosphatase (ALP) and osteocalcin (OCN) in human osteoblast like cells Differentiated cell function was assessed by the expression of ALP and

Osteocalcin, markers that are representative of early and late stages of

osteoblast maturation and bone matrix production respectively (Malaval et al.,

1994). ALP is expressed by pre-osteoblasts and osteoblasts before the

expression of osteocalcin (Sandberg et al., 1993) whereas osteocalcin binds

hydroxyapaitte and is produced by osteoblasts just before and during matrix

mineralization (Salter et al., 2000)

_______US Control_____ 0 3 6 12 18 24 0 3 6 12 18 24

a) GAPDH

b) OCN

Fig.15 – Pictures of gel analysis of RT-PCR products of a) GAPDH, b) OCN. US

promoted OCN mRNA levels of osteoblasts prominently at all the time points

while there was no expression observed in the control group at all time points.

The MG63 cells (5x105/well) were treated with 30mW/cm2 intensity from a

transcriptionally up regulated in the ultrasound group when initially analyzed by

RT PCR assay but as the bands (not shown) were not clearly demarcated Q

PCR was performed. Q PCR showed that ALP was up regulated by ultrasound at

all time points but significantly after 0h, 6h, 18h and 24h.

69

Osteocalcin was also up-regulated transcriptionally by ultrasound at all time

points (fig.15). To complement the mRNA levels OCN protein levels were

significantly elevated at 3, 6, 12, 18 and 24 time points in US treated cultures as

compared to controls (fig.16). OCN protein levels in the treatment group

gradually increased from 0 to 18 hours and appeared to stabilize at 24 hours.

0

20

40

60

80

100

0 3 6 12 18 24Time (Hours)

OC

N p

g/m

l

Figure.16 US promoted OCN protein levels at 3h, 6h, 12h, 18h and 24h time

points. MG63 cells (5x105/well) were treated with 30mW/cm2 intensity from

a 45 KHz machine for 5 minutes. The supernatant from the cultures was

then used for assessment of protein levels at 0h, 3h, 6h, 12h, 18h and

24h after US treatment. (■ ultrasound group, □ control group, * shows

significance at p<0.05, **shows significance at p<0.01)

* *

* *

* *

* * * *

70

ALP seemed to be transcriptionally upregulated in the ultrasound group at all

time points but significantly after 0h, 6h, 18h and 24h time points.

0

0.5

1

1.5

2

2.5

0 3 6 12 18 24Time (Hours)

AL

P m

RN

A

Figure.17 US promoted ALP mRNA levels at 0h, 6h, 18h and 24h time points.

MG63 cells (5x105/well) were treated with 30mW/cm2 intensity from a 45

KHz machine for 5 minutes. The cells were then used for assessment of

mRNA at 0h, 3h, 6h, 12h, 18h and 24h after US treatment. The graphs

were plotted with relative expression of ALP mRNA with respect to GAPDH, the

internal control. (■ ultrasound group, □ control group, * shows significance at

p<0.05, **shows significance at p<0.01)

* * * *

*

*

*

71

Table.3 Summary of Results

Ultrasound Treated Control Target Factor/Marker

mRNA Protein mRNA Protein

ALP OCN OPG RANKL TNFα

Elevated significantly at 0,6,12,18 and 24 hours Elevated significantly at 0, 3, 6, 12, 18 and 24 hours Elevated significantly at 0, 12, 18 and 24 hours Not Detected Not Detected

--------- Elevated significantly at 3, 6, 12, 18 and 24 hours Elevated significantly at 3 and 24 hours Detected at 6 hours Detected but Inconclusive

Less than US cultures at all time points Not detected Less than US cultures at all time points Not Detected Not detected

--------- Detected at 0, 3, 6, 12, 18 and 24 hours but not significant Detected at 0 and 12 hours but not significant Elevated at 0, 3, 6, 12, 18 and 24 hour time points significantly Detected but Inconclusive

72

CHAPTER V

DISCUSSION

1. Introduction

One of the aims of this study is to explore why US has proved to be empirically

invaluable for the treatment of conditions like fracture non-unions,

osteoradionecrosis (ORN) etc. ORN of the mandible is the most common long

term complication of radiation treatment commonly administered in oral and head

and neck malignant neoplasms. Dental management of patients who are about to

receive therapeutic radiation involving the jaws, remains a problem. The non-

restorable decayed teeth in the mandible which come in the path of radiation

have to be removed, whether before or after radiation and can lead to

osteoradionecrosis. Marx et al., in 1982 had suggested that hypocellularity,

hypoxia and hypovascularization resulting in non-healing wound are the

etiopathogenesis for ORN. There is a sequestration of the cortical bone of the

mandible eventually leading to pathological fracture if left untreated. Sometimes

the bone is sequestrated externally. The patient suffers from mucositis, difficulty

in eating solid food, pain due to sequestration, difficulty in speech and other

symptoms. The empirical use of HBO to promote neovascularity and

neocellularity in irradiated and other sclerotic bone conditions has had

questionable success, though usually as an adjunctive preparation to resection

and reconstruction. Unfortunately few centers have access to hyperbaric oxygen

and the treatment is time consuming and not without hazards for the patient. For

73

example, it is impossible to employ HBO therapy in patients with chronic

emphysematous lung disease which is not uncommonly associated with oral

cancer. Moreover it is expensive.

Subsequently to this Dyson (1982) introduced the use of ultrasound as a simple

means of promoting neovascularity and neocellularity in ischemic tissues (Young

and Dyson 1990). Ultrasound along with other physical modalities of generating

energy like pulsed high frequency electromagnetic stimulation have been

employed to facilitate healing in intractable conditions varying from varicose

ulcers to fracture non-unions.

Therapeutic US was shown by Harris et al, 1992 to be effective in treating

osteoradionecrosis of the jaw. It has two types of effects on tissues, thermal and

non-thermal. The thermal effects of US are commonly used in physiotherapy for

the treatment of acute injuries, strains and pain relief where as the non-thermal

effects are useful in the stimulation of tissue regeneration, healing of varicose

ulcers, and protein synthesis in human fibroblasts. It also induces bone formation

in vitro, by stimulating protein synthesis and cytokine production in human

osteoblasts, fibroblasts and monocytes. It induces in vitro cell proliferation,

collagen and non-collagen protein production and angiogenesis. It stimulates

bone repair and enhances fracture healing in animals. It also enhances fracture

healing in humans. Most recently US has been successfully used for enhancing

healing following distraction osteogenesis in humans.

74

Though the therapeutic value of US in promoting bone formation has already

been established, the mechanism at the molecular level is not completely

understood. In this study we investigated the in vitro release of growth factors in

MG63 (osteoblasts-like cells from an osteosarcoma cell line) following ultrasound

treatment. The main objective of this study is to explain why US can effectively

enhance bone healing clinically and to provide evidence which will establish it as

a conservative and economic mode of treatment for ORN.

Long wave US therapy is mechanical energy administered as acoustical

pressure waves. Mechanical stimulation has been found to raise the adaptive

modeling response of the bone micro-environment by the induction of anabolic or

cytokine molecules. Previous studies have demonstrated that US can raise the

osteogenic response of OBs through the induction of nitric oxide, prostaglandin

E2 and growth factors.

Bone remodeling is regulated by the receptor activator of nuclear factor-kappa B

ligand (RANKL) which is a transmembrane ligand expressed in osteoblasts. It

binds to RANK, which is expressed in osteoclast progenitor cells, and induces

osteoclastogenesis. OPG, a decoy receptor for RANKL, also binds to RANKL,

and competitive binding of RANKL with RANK or OPG. The OPG/RANKL/RANK

cytokine system is essential for bone biology and alterations of this system can

lead to excess bone resorption or formation.

75

The importance of OPG and RANKL as regulators of osteoclastogenesis is well

recognised. Injections of exogenous RANKL induce osteoporosis with increased

serum calcium levels in mice and targeted ablation of RANKL in mice leads to

osteopetrosis. The inhibition of osteoclastogenesis by OPG, the decoy receptor

for RANKL, has also been demonstrated and elevated OPG levels in transgenic

mice cause increased bone mineral density whereas targeted ablation of OPG

results in mice developing early onset osteoporosis. The expression of OPG and

RANKL are developmentally regulated. OPG increases during osteoblast

differentiation whereas RANKL expression is inversely related to the degree of

osteoblast differentiation. TNF-α is a well established resorptive factor which

induces osteoclast differentiation directly or in synergy with RANKL.

OCN and ALP are markers for bone mineralization in osteoblasts. OCN is a

highly specific osteoblast marker produced during bone formation and its primary

structure is highly conserved in vertebrates.

The molecular mechanisms of long wave US on bone remodeling are still not

completely understood. In the present study we examined the effect of long wave

US on MG63 cells for the expression and release of the cytokines; OPG, RANKL

and TNF-α which control bone formation and bone resorption.

2. Discussion of Methodology MG63 cells which are human osteoblast like cells belonging to a human

osteosarcoma cell line were used in this study. Cells were cultured in 75 sqcm

76

tissue culture flasks and incubated at 37ºc till they reached confluency. Once

confluent the cells were passaged and cultured in new flasks. These cells

reached confluency in 3 days time. The cells were then distributed into 6 well

culture plates at 5x105 cells per well and incubated for 24 hours before

ultrasound treatment. The ultrasound experiment was performed in a sterile air-

flow chamber in order to prevent contamination of the cell culture.

The tissue culture flasks were suspended in water contained in a water bath

maintained at 37ºc and restrained from movement by using a sterile glass rod.

The water bath was internally lined with rubber to prevent the ultrasound waves

from reflecting back to the well plates. The ultrasound tranducer head which was

suspended from a stand was immersed in the culture medium to a point from

where it was 5 mm from the cells. The stand holding the transducer head was

placed on a rotator working at 30 rotations per minute to prevent standing wave

formation in the culture. The transducer head was wiped with alcohol before

every immersion.

The cells were treated with 30 mW/cm2 intensity for 5 minutes and incubated for

0, 3, 6, 12, 18 and 24 hour time periods. At the end of these time periods the cell

culture supernatant was collected for analysis of protein production and the cells

were used to extract RNA and used in RT-PCR and real Time PCR analysis. We

wanted to see if ultrasound had an early effect on the transcription and

translation of OPG, RANKL, TNF-alpha and bone markers, so we chose the first

77

24 hour time period after ultrasound treatment. The cultures were treated with

ultrasound in triplicates for each time point and the experiment was repeated at

least twice. Both ELISA and real Time PCR techniques were performed and

analysed under expert guidance.

This study began by examining the transcriptional expression of the cytokines

OPG, RANKL and TNF-α and the late bone marker, OCN in MG63 cells following

ultrasound treatment by RT-PCR assay. The RT-PCR method only allowed us to

conclude that the cytokines and bone markers were expressed or not expressed.

The levels of expression could not be estimated. So QPCR assay was

performed to quantify the transcriptional levels of the genes of interest. ELISA

was also performed in order to analyze the amount of cytokine secreted into the

supernatant from the cell cultures treated with US.

3. Discussion of Results

QPCR results showed that OPG mRNA production increased immediately (0 hr)

after ultrasound treatment as compared to control. The mRNA levels at

subsequent time points of 3, 6, 12 and 18 hrs remained more or less the same

for the treatment group. Only the 24 hr mRNA levels in the treatment group were

considerably lower. The control OPG mRNA levels which were very low at time

0hr rose to a high at 3 hrs and started falling gradually at the subsequent time

points till 18hrs and rose again at 24 hrs. But the treatment group had

significantly higher levels of OPG mRNA at 0, 12, 18 and 24 hrs following

78

treatment. Ultrasound appears to have an immediate and nearly sustained effect

on OPG transcription which dropped only at 24 hrs suggesting that 24 hourly

treatment with ultrasound could be highly effective.

Both ELISA and QPCR confirmed the up regulation of OPG by MG63 cells during

the first 24 hours following ultrasound treatment. RANKL transcription was not

affected by ultrasound and the protein levels were low as compared to OPG but

significantly low in the ultrasound group.

TNF-α is a potent osteoclastogenic factor but there was no TNF-α expression

observed in MG63 as a result of ultrasound treatment and the TNF-α protein

secretion was very low (0.5 – 12pg/ml) and the standard error was high for all

time points suggesting non-specific binding of the HRP to the elisa plate, due to

low target protein, leading to a high variability. Looking at whole protein using

western blotting or flow cytometric analysis for bound protein might be useful in

predicting whether ultrasound affects TNF-α.

Both ALP and OCN mRNA were expressed significantly at various time points

during the 24 hours in the ultrasound group as compared to the controls. OCN

protein levels were elevated in a similar fashion to the mRNA levels in the US

treated samples at all time points except the 0 hour; this could be due to the time

difference between transcription and translation. Elevated levels of OCN and

ALP are an indication that ultrasound promotes bone mineralization.

79

CHAPTER VI CONCLUSION

Based on the results from the present study we concluded that therapeutic

ultrasound may enhance bone formation by up-regulating OPG mRNA and

protein and possibly by preventing RANKL release in osteoblasts. By controlling

osteoclast differentiation ultrasound affects bone remodeling in favor of bone

formation which is observed as an up regulation of the bone markers ALP and

OCN.

80

Bibliography

Amelin AZ, Lotsova EI, Petukhova LI: Morphological characteristics of bones

regenerated under the effect of ultrasound. Mechanika Polimerov 6: 1121-1122,

1978.

Armstrong DG, Jude EB. The role of matrix metalloproteinases in wound healing.

J Am Podiatr Med Assoc. 2002 Jan;92(1):12-8. Review

Bingham CO 3rd. The pathogenesis of rheumatoid arthritis: pivotal cytokines

involved in bone degradation and inflammation. J Rheumatol Suppl. 2002

Sep;65:3-9. Review.

Bradnock KB, Law HT, Roscor K. A quantitative comparative assessment of the

immediate response to high frequency ultrasound and low frequency ultrasound

(‘long wave therapy’) in the treatment of acute ankle sprains. Physiotherapy

1996; 82;78-84.

Bras J, de Jonge H K, van Merkesteyn J P. Osteoradionecrosis of the mandible:

pathogenesis. Am J Otolaryngol. 1990 ; 11(4): 244-50

81

Bu R, Borysenko CW, Li Y, Cao L, Sabokbar A, Blair HC. Expression and

function of TNF-family proteins and receptors in human osteoblasts. Bone. 2003

Nov; 33:760-770.

Bucay N, Sarosi I, Dunstan CR, Morony S, Tarpley J, Capparelli C, Scully S, Tan

HL, Xu W, Lacey DL, Boyle WJ, Simonet WS. Osteoprotegerin-deficient mice

develop early onset osteoporosis and arterial calcification. Genes Dev. 1998 1;

12:1260-1268.

Clayman L. Management of dental extractions in the irradiated jaws: A protocol

without Hyperbaric Oxygen therapy. Journal of Oral maxillofacial Surgery 1997,

55;275-281.

Clover J, Gowen M. Are MG-63 and HOS TE85 human osteosarcoma cell lines

representative models of the osteoblastic phenotype? Bone. 1994 ;15:585-591.

Dinno MA, Dyson M, Young SR, Mortimer AJ, Hart J, Crum LA. The significance

of membrane changes in the safe and effective use of therapeutic and diagnostic

ultrasound. Phys Med Biol. 1989 Nov;34(11):1543-52. Review.

Doan N, Reher P, Meghji S, Harris M. In vitro effects of therapeutic ultrasound on

cell proliferation, protein synthesis and cytokine production by human fibroblasts,

osteoblasts and monocytes. J Oral Maxillofac Surg 1999; 57:409-419.

82

Draper DO, Sunderland S, Kirkendall DT, Ricard M. A comparison of

temperature rise in human calf muscles following applications of underwater and

topical gel ultrasound. J Orthop Sports Phys Ther. 1993 May;17(5):247-51.

Draper DO, Castel JC, Castel D. Rate of temperature increase in human muscle

during 1 MHz and 3 MHz continuous ultrasound. J Orthop Sports Phys Ther.

1995 Oct;22(4):142-50.

Duarte LR. The stimulation of bone growth by Ultrasound. Arch Orthop Trauma

Surg. 1983;101: 153-159.

Dunn F, Law WK, Frizzell LA. Nonlinear ultrasonic propagation in biological

media. Br J Cancer Suppl. 1982 Mar;45(5):55-8

Dyson M, Pond JB, Joseph J, Warwick R. The stimulation of tissue regeneration

by means of ultrasound. Clin Sci 1968; 35:273-285.

Dyson M, Franks C, Suckling J. Stimulation of healing of varicose ulcers by

ultrasound. Ultrasonics 1976; 14: 232-236.

Dyson M, Suckling J. Stimulation of tissue repair by ultrasound: a survey of the

mechanisms involved. Physiotherapy. 1978 Apr;64(4):105-8.

83

Dyson M. Non-thermal cellular effects of Ultrasound. British Journal of Cancer

1982, 45, 165-171.

Dyson M, Brookes M. Stimulation of bone repair by ultrasound. Ultrasound Med

Biol 1983; 9: 50.

Dyson M. Role of ultrasound in wound healing; in Kloth LC, McCullochJM,

Feedar JA (eds) Wound Healing, Alternatives in Management. Philadelphia, P A

Davis 1990 259-285.

El-Mowafi H, Mohsen M. The effect of low-intensity pulsed ultrasound on callus

maturation in tibial distraction osteogenesis.

Int Orthop. 2005 Feb 1; [Epub ahead of print]

Enwemeka CS, Rodriguez O, Mendosa S. the biomechanical effects of low-

intensity ultrasound on healing tendons. Ultrasound Med Biol 1990; 16: 801-807.

Fuller K, Murphy C, Kirstein B, Fox SW, Chambers TJ. TNFalpha potently

activates osteoclasts, through a direct action independent of and strongly

synergistic with RANKL. Endocrinology. 2002; 143 (3):1108-1118.

84

Fyfe MC, Chahl LA. Mast cell degranulation: A possible mechanism of

therapeutic ultrasound. Ultrasound Med Biol 1982; 8 (suppl.1):62-66.

Gori F, Hofbauer LC, Dunstan CR, Spelsberg TC, Khosla S, Riggs BL.The

expression of osteoprotegerin and RANK ligand and the support of osteoclast

formation by stromal-osteoblast lineage cells are developmentally regulated.

Endocrinology. 2000; 141: 4768-4776.

Hakeda Y, Kobayashi Y, Yamaguchi K, Yasuda H, Tsuda E, Higashio K, Miyata

T, Kumegawa M.Osteoclastogenesis inhibitory factor (OCIF) directly inhibits

bone-resorbing activity of isolated mature osteoclasts. Biochem Biophys Res

Commun. 1998 Oct 29;251(3):796-801.

Harris M. The conservative management of osteoradionecrosis of the mandible

with ultrasound therapy. Br J Oral Maxillofac Surg. 1992; 30; 313.

Harvey W, Dyson M, Pond JB, Grahame R. The stimulation of protein synthesis

in human fibroblasts by therapeutic ultrasound. Rheumatol Rehab 1975; 14: 237.

Heckman JD, Ryaby JP, McCabe J, Frey JJ, Kilcoyne RF. Acceleration of tibial

fracture-healing by non-invasive, low-intensity pulsed ultrasound. J Bone Joint

Surg Am. 1994; 76:26-34.

85

Hofbauer LC, Khosla S, Dunstan CR, Lacey DL, Boyle WJ, Riggs BL. The roles

of osteoprotegerin and osteoprotegerin ligand in the paracrine regulation of bone

resorption. J Bone Miner Res. 2000; 15 (1):2-12.

Hofbauer LC, Heufelder. The role of receptor activator of nuclear factor-kappaB

ligand and osteoprotegerin in the pathogenesis and treatment of metabolic bone

diseases. J Clin Endocrinol Metab 2000; 85; 2355-2363.

Hogan RDB, Burke KM, Franklin TD. The effect of ultrasound on the

micovascular hemo dynamics in skeletal muscle: Effects during ischaemia.

Microvasc Res 1982; 23;370-379

Hsu H, Lacey DL, Dunstan CR, Solovyev I, Colombero A, Timms E, Tan HL,

Elliott G, Kelley MJ, Sarosi I, Wang L, Xia XZ, Elliott R, Chiu L, Black T, Scully S,

Capparelli C, Morony S, Shimamoto G, Bass MB, Boyle WJ. Tumor necrosis

factor receptor family member RANK mediates osteoclast differentiation and

activation induced by osteoprotegerin ligand. Proc Natl Acad Sci USA, 1999; 96:

3540-3545.

Ikeda T, Utsuyama M, Hirokawa K. Expression profiles of receptor activator of

nuclear factor kappaB ligand, receptor activator of nuclear factor kappaB, and

osteoprotegerin messenger RNA in aged and ovariectomized rat bones.

J Bone Miner Res. 2001 Aug;16(8):1416-25.

86

Kalle Aitasalo. A modified protocol for early treatment of osteomyelitis and

osteoradionecrosis of the mandible. Head & Neck 1998 August; 411-417.

Khosla S. Minireview: the OPG/RANKL/RANK system. Endocrinology. 2001

Dec;142(12):5050-5. Review.

Klug V W, W G Franke, H G Knoch. Scintigraphic control of bone fracture healing

under ultrasonic stimulation: An experimental study. Eur. J. Nucl. Med. 11: 494-

497, 1986.

Komarova SV, Pilkington MF, Weidema AF, Dixon SJ, Sims SM. RANK ligand-

induced elevation of cytosolic Ca2+ accelerates nuclear translocation of nuclear

factor kappa B in osteoclasts. J Biol Chem. 2003 Mar 7;278(10):8286-93. Epub

2002 Dec 20.

Kong YY, Yoshida H, Sarosi I, Tan HL, Timms E, Capparelli C, Morony S,

Oliveira-dos-Santos AJ, Van G, Itie A, Khoo W, Wakeham A, Dunstan CR, Lacey

DL, Mak TW, Boyle WJ, Penninger JM. OPGL is a key regulator of

osteoclastogenesis, lymphocyte development and lymph-node organogenesis.

Nature. 1999 28; 397 (6717):315-323.

87

Konig A, Mulhbauer RC, Fleisch H. Tumor necrosis factor alpha and interleukin 1

stimulate bone resorption in vivo as measured by [³H] urinary tetracycline

excretion from prelabeled mice. J Bone Mineral Res 1988; 3: 621-627.

Krembau FW: Physical considerations. In: Biological Effects of Ultraound, ed by

WL Nyborg and MC Ziskin, New York, Churchill Livingston, 1985, pp 14-16.

Kwan Tat S, Padrines M, Theoleyre S, Heymann D, Fortun Y. IL-6, RANKL, TNF-

α/IL-1: interrelations in bone resorption pathology. Cytokine and Growth Factor

Reviews 2004; 15; 49-60.

Lam J, Nelson CA, Ross FP, Teitelbaum SL, Fremont DH. Crystal structure of

the TRANCE/RANKL cytokine reveals determinants of receptor-ligand specificity.

J Clin Invest. 2001 Oct;108(7):971-9.

Lanyon LE. Osteocytes, strain detection, bone modeling and remodeling. Calcif

Tissue Int. 1993; 53(Suppl 1):102-107.

Lacey DL, Timms E, Tan HL, Kelley MJ, Dunstan CR, Burgess T, Elliott R,

Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E,

Capparelli C, Eli A, Qian YX, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo

J, Delaney J, Boyle WJ. Osteoprotegerin ligand is a cytokine that regulates

osteoclasts differentiation and activation.Cell. 1998 17; 93:165-176.

88

Lai CF, Feng X, Nishimura R, Teitelbaum SL, Avioli LV, Ross FP, Cheng SL.

Transforming growth factor-beta up-regulates the beta 5 integrin subunit

expression via Sp1 and Smad signaling. J Biol Chem. 2000 Nov

17;275(46):36400-6.

Lee SK, Lorenzo JA. Regulation of receptor activator of nuclear factor-kappa B

ligand and osteoprotegerin mRNA expression by parathyroid hormone is

predominantly mediated by the protein kinase a pathway in murine bone marrow

cultures. Bone. 2002 Jul;31(1):252-9.

Lee ZH, Kim HH. Signal transduction by receptor activator of nuclear factor

kappa B in osteoclasts. Biochem Biophys Res Commun. 2003 May

30;305(2):211-4. Review.

Leung KS, Cheung WH, Zhang C, Lee KM and Lo HK. Low Intensity pulsed

ultrasound stimulates osteogenic activity of human periosteal cells. Clin Orthop

2004; 418: 253-259.

Lotsova E I, Amelia A Z: An experimental study of ultrasonic influence upon the

healing of bone lesions. Kuroortologia I Fizioterapiia 14: 20-22, 1977

89

Maier A gaggi Akieman H Santler G Anneg U Fell B karcher H Smolle – Juttner

FM Freihs GB. Review of severe osteoradionecrosis treated by surgery alone

and with post operative hyperbaric oxygenation. British Journal of Oral and

Maxillofacial Surgery.2000, 38 (3) 173-6.

Malaval L, Modrowski D, Gupta A K, Aubin J E. Cellular expression of bone-

related proteins during in vitro osteogenesis in rat bone marrow stromal cell

cultures. J Cell Physiol. 1994 Mar;158(3):555-72.

Marx RE, Ames JR. The use of hyperbaric oxygen therapy in bony reconstruction

of the irradiated and tissue deficient patient. Journal of Oral and Maxillofacial

Surgery. 1982; 40, 412-420

Marx RE. A new concept in the treatment of osteoradionecrosis. Journal of Oral

and Maxillofacial Surger. 1983, 41, 351-357.

Mizuno A, Amizuka N, Irie K, Murakami A, Fujise N, Kanno T, Sato Y, Nakagawa

N, Yasuda H, Mochizuki S, Gomibuchi T, Yano K, Shima N, Washida N, Tsuda

E, Morinaga T, Higashio K, Ozawa H. Severe osteoporosis in mice lacking

osteoclastogenesis inhibitory factor/osteoprotegerin. Biochem Biophys Res

Commun. 1998 29; 247: 610-615.

90

Mizuno A, Kanno T, Hoshi M, Shibata O, Yano K, Fujise N, Kinosaki M,

Yamaguchi K, Tsuda E, Murakami A, Yasuda H, Higashio K. Transgenic mice

overexpressing soluble osteoclast differentiation factor (sODF) exhibit severe

osteoporosis. J Bone Miner Metab. 2002;20(6):337-44.

Mont MA, Pilla AA, Tenreiro RA, et al.: The effects of ultrasonic stimuation on

fresh fracture repair in rabbits. Trans Orthop Res Soc 12: 97, 1987.

Mortimer A J, Dyson M. The effect of therapeutic ultrasound on calcium uptake in

fibroblasts. Ultrasound Med Biol 1988, 14, 499-506.

Naruse K, Mikuni-Takagaki Y, Azuma Y, Ito M, Oota T, Kameyama K, Itoman M.

Anabolic response of mouse bone-marrow-derived stromal cell clone ST2 cells to

low-intensity pulsed ultrasound. Biochem Biophys Res Commun. 2000 5;

268:216-220.

Nolte PA, Klein-Nulend J, Albers GHR, Marti RK, Semeins CM, Goei SW, Burger

EH. Low intensity ultrasound stimulates endochondral ossification in vitro. J

Orthop Res 19: 301-307; 2001.

Nolte PA, Van der krans A, Patka P. Low intensity ultrasound in the treatment of

of non-unions. J Trauma 2001; 51:693-703.

91

Nussbaum E. The influence of ultrasound on healing tissues. J Hand Ther. 1998

Apr-Jun;11(2):140-7. Review.

Nyborg W L. Ultrasonic microstreaming and related phenomenon. Br. J. Cancer

45 (suppl): 156-160, 1982.

Pilla AA, Mont MA, Nasser PR, et al. Non-invasive low intensity pulsed

ultrasound accelerates bone healing in the rabbit. Journal of Orthopaedic Trauma

1990;4: 246-253.

Paul M Lambert, Nancy Intriere and Ralph Eichstaedt. Management of

extractions in irradiated jaws: A protocol with Hyperbaric oxygen therapy. Journal

of Oral Maxillofacial Surgery 1997, 55; 268-274.

Reher P, Elbeshir el-NI, Harvey W, Meghji S, Harris M. The stimulation of bone

formation in vitro by therapeutic ultrasound. Ultrasound Med Biol. 1997; 23:1251-

8.

Reher P, Doan N, Bradnock B, Meghji S, Harris M. Effect of ultrasound on the

production of IL-8, basic FGF and VEGF. Cytokine. 1999; 11: 416-23.

92

Reher P, Harris M, Whiteman M, Hai HK, Meghji S.Ultrasound stimulates nitric

oxide and prostaglandin E2 production by human osteoblasts. Bone. 2002;

31:236-241.

Robertson VJ, Baker KG. A review of therapeutic ultrasound: effectiveness

studies. Phys Ther. 2001 Jul;81(7):1339-50. Review

Ryaby JT, Bachner EJ, Bendo JA, Dalton PE, Tannebaum S, Pilla AA. Low

intensity pulsed ultrasound increases calcium incorporation in both differentiating

cartilage and bone cell cultures. Trans Orthop Res Soc 1989; 14-15.

Salter DM, Wallace WH, Robb JE, Caldwell H, Wright MO. Human bone cell

hyperpolarization response to cyclical mechanical strain is mediated by an

interleukin-1beta autocrine/paracrine loop. J Bone Miner Res. 2000; 15 :1746-

1755.

Sandberg MM, Aro HT, Vuorio EI. Gene expression during bone repair. Clin

Orthop. 1993 Apr; (289):292-312.

Sato T, Selleri C, Anderson S, Young NS, Maciejewski JP. Expression and

modulation of cellular receptors for interferon-gamma, tumour necrosis factor,

and Fas on human bone marrow CD34+ cells. Br J Haematol. 1997

May;97(2):356-65.

93

Shedden R, Dunham J, Bitensky L, et al. Changes in alkaline phosphatase

activity in periosteal cells in healing fractures. Calcif Tissue Res. 1976; 22:19-25.

Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen

HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R,

Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L,

Hughes TM, Hill D, Pattison W, Campbell P, Boyle WJ. Osteoprotegerin: a novel

secreted protein involved in the regulation of bone density.Cell. 1997 18; 89:309-

319.

Stewart C Bushong. Radiological Science for Technologists, 8th Edition, 2004.

Sun JS, Hong RC, Chang WH et al. In vitro effects of low-intensity ultrasound

stimulation on the bone cells. J Biomed Mater Res. 2001; 57: 449-456.

Takeuchi Y, Fukumoto S, Matsumoto T. Relationship between actions of

transforming growth factor (TGF)-beta and cell surface expression of its

receptors in clonal osteoblastic cells. J Cell Physiol. 1995 Mar;162(3):315-21

94

Tan KB, Harrop J, Reddy M, Young P, Terrett J, Emery J, Moore G, Truneh A.

Characterization of a novel TNF-like ligand and recently described TNF ligand

and TNF receptor superfamily genes and their constitutive and inducible

expression in hematopoietic and non-hematopoietic cells.

Gene. 1997 Dec 19;204(1-2):35-46.

Teitelbaum SL, Tondravi MM, Ross FP. Osteoclasts, macrophages and the

molecular mechanism of bone resorption. J Leuk Biol 1997; 61; 381-388.

Ter Haar G. Therapeutic ultrasound. Eur J Ultrasound. 1999 Mar;9(1):3-9.

Review.

Thomson BM, Mundy GR, Chambers TJ. Tumor necrosis factors alpha and beta

induce osteoblastic cells to stimulate osteoclastic bone resorption. J Immunol.

1987 1; 138 (3):775-779.

Tsai CL, Chang WH, Liu TK. Preliminary studies of duration and intensity of

ultrasonic treatments on fracture repair.Chin J Physiol. 1992;35:21-26.

Udagawa N, Takahashi N, Yasuda H, Mizuno A, Itoh K, Ueno Y, Shinki T,

Gillespie MT, Martin TJ, Higashio K, Suda T. Osteoprotegerin produced by

osteoblasts is an important regulator in osteoclast development and function.

Endocrinology. 2000;141:3478-3484.

95

Wang SJ, Lewallen DG, Bolander ME, Chao EY, Ilstrup DM, Greenleaf JF. Low

intensity ultrasound treatment increases strength in a rat femoral fracture model.

J Orthop Res. 1994;12:40-47.

Warden SJ, Bennell KL, Matthews B, Brown DJ, McMeeken JM, Wark JD.

Efficacy of low-intensity pulsed ultrasound in the prevention of osteoporosis

following spinal cord injury. Bone. 2001; 29:431-436.

Watson JT, Moed BR, Karges DE, Cramer KE. Pilon fractures. Treatment

protocol based on severity of soft tissue injury. Clin Orthop Relat Res. 2000

Jun;375:78-90.

Webster D F, Harvey W, Dyson M, Pond JB. The role of ultrasound-induced

cavitation in the in vitro stimulation of collagen synthesis in human fibroblasts.

Ultrasonics 1980, 18, 33-37.

Webster DF, Pond JB, Dyson M, Harvey W. The role of cavitation in the in vitro

stimulation of protein synthesis in human fibroblasts by ultrasound. Ultrasound

Med Biol 1978; 4: 343-351

96

Wilkin LD, Merrick MA, Kirby TE, Devor ST. Influence of therapeutic ultrasound

on skeletal muscle regeneration following blunt contusion. Int J Sports Med. 2004

Jan;25(1):73-7.

Williams A R. Production and transmission of ultrasound. Physiotherapy 73(3):

113-116; 1987.

Yang KH, Parvizi J, Wang SJ, Lewallen DG, Kinnick RR, Greenleaf JF, Bolander

ME. Exposure to low-intensity ultrasound increases aggrecan gene expression in

a rat femur fracture model. J Orthop Res. 1996;14:802-809.

Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S,

Tomoyasu A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K,

Udagawa N, Takahashi N, Suda T. Osteoclast differentiation factor is a ligand for

osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to

TRANCE/RANKL. Proc Natl Acad Sci USA 1998; 95; 3597-3602.

Yasuda H, Shima N, Nakagawa N, Mochizuki SI, Yano K, Fujise N, Sato Y, Goto

M, Yamaguchi K, Kuriyama M, Kanno T, Murakami A, Tsuda E, Morinaga T,

Higashio K. Identity of osteoclastogenesis inhibitory factor (OCIF) and

osteoprotegerin (OPG): A mechanism by which OPG/OCIF inhibits

osteoclastogenesis in vitro. Endocrinology 1998; 39: 1329-1337.

97

Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Goto M, Mochizuki

SI, Tsuda E, Morinaga T, Udagawa N, Takahashi N, Suda T, Higashio K. A novel

molecular mechanism modulating osteoclast differentiation and function. Bone

1999; 25; 109-113.

Young S R. The effect of therapeutic ultrasound on the biological mechanisms

involved in dermal repair. London: University of London; 1988. PhD Thesis.

Young S R, Dyson M. Effect of therapeutic ultrasound on the healing of full-

thickness excised skin lesions. Ultrasonics. 1990 May;28(3):175-80.

Zou W, Hakim I, Tschoep K, Endres S, Bar-Shavit Z. Tumor necrosis factor-

alpha mediates RANK ligand stimulation of osteoclast differentiation by an

autocrine mechanism. J Cell Biochem. 2001 Jun 26-Jul 25;83(1):70-83.

98

Paper Publication from this thesis

1. Maddi A, Kee Hai H, Ong S T, Sharp L, Harris M, Meghji S. Long wave

ultrasound may enhance bone regeneration by altering the

OPG/RANKL ratio in human osteoblast -like cells. (accepted by BONE,

e-pub ahead of print)

Research Conferences Work from this thesis has been presented at the following conferences: 1. Gordon Research Conference, “Bones and Teeth”, July10-15 2005,

University of New England, Biddeford, Maine, USA.

2. 2nd Joint Conference of ECTS (European Calcified Tissue Society) and IBMS

(International Bone and Mineral Society), Geneva, Switzerland June 2005.