long-term suppression of hiv-1c virus production in human

Long-term suppression of HIV-1C virus production in human peripheralblood mononuclear cells by LTR heterochromatization with a short

double-stranded RNA

Anand Singh, Jayanth K. Palanichamy†, Pradeep Ramalingam, Muzaffer A. Kassab, Mohita Bhagat, Raiees Andrabi,Kalpana Luthra, Subrata Sinha‡ and Parthaprasad Chattopadhyay*

Department of Biochemistry, All India Institute of Medical Sciences, New Delhi, 110029, India

*Corresponding author. Tel: +91-11-2654-6748; Fax: +91-11-2658-8663; E-mail: [email protected]†Present address: Department of Pathology & Laboratory Medicine, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095-1732, USA.

‡Present address: National Brain Research Center, Manesar, Gurgaon, Haryana, 122050, India.

Received 5 April 2013; returned 15 May 2013; revised 29 July 2013; accepted 2 August 2013

Objectives: A region in the conserved 5′ long terminal repeat (LTR) promoter of the integrated HIV-1C provirus wasidentified for effective targeting bya short double-stranded RNA (dsRNA) to cause heterochromatization leading toa long-lasting decrease in viral transcription, replication and subsequent productive infection in human host cells.

Methods: Small interfering RNAs (siRNAs) were transfected into siHa cells containing integrated LTR-luciferase re-porterconstructs and screened forefficiencyof inducing transcriptional gene silencing (TGS). TGSwas assessed byadual luciferase assay and real-time PCR. Chromatin modification at the targeted region was also studied. The ef-ficacyof potent siRNAwas then checked for effectiveness in TZM-bl cells and human peripheral blood mononuclearcells (PBMCs) infected with HIV-1C virus. Viral Gag-p24 antigen levels were determined by ELISA.

Results: One HIV-1C LTR-specific siRNA significantly decreased luciferase activity and its mRNA expression with nosuch effect on HIV-1B LTR. This siRNA-mediated TGS was induced by histone methylation, which leads to hetero-chromatization of the targeted LTR region. The same siRNA also substantially suppressed viral replication in TZM-blcells and human PBMCs infected with various HIV-1C clinical isolates for≥3 weeks after a single transfection, evenof a strain that had a mismatch in the target region.

Conclusions: We have identified a potent dsRNA that causes long-term suppression of HIV-1C virus productionin vitro and ex vivo by heritable epigenetic modification at the targeted C-LTR region. This dsRNA has promisingtherapeutic potential in HIV-1C infection, the clade responsible for more than half of AIDS cases worldwide.

Keywords: HIV-1, small interfering RNA, transcriptional gene silencing, epigenetics, RNAi

IntroductionTranscription of the HIV-1 provirus genome, and hence viral replica-tion, is regulated by the interaction of viral regulatory proteins andcellular transcription factors with the long terminal repeat region(5′ LTR) of the provirus, a transcriptional promoter of HIV.1 –3 It isreported that the LTRs of different HIV-1 subtypes show significantvariation in sequences and transcription factor binding sites, whichinfluence the transcriptional activity of the LTR (Figure 1a andFigure S1, available as Supplementary data at JAC Online).4 –6 TheHIV-1C LTR has three NF-kB binding sites, whereas only two NF-kBbinding sites are present in the majority of other subtypes, such assubtype B LTR. Previous studies have shown that the additionalNF-kB binding site within subtype C LTR is associated with increasedtranscriptional activity and viral replication of HIV-1C.7 –9

The RNA interference (RNAi) pathway represents an emergingpotential therapeutic approach for the treatment of HIV-1.10

Double-stranded RNA (dsRNA) or small interfering RNA (siRNA),the effector molecule of the RNAi pathway, leads to sequence-specific cleavage of complementary mRNA, which is known aspost-transcriptional gene silencing (PTGS).11,12 Some dsRNAs tar-geting the promoter region of a gene can induce DNA CpG islandsand/or histone (H3K9 and H3K27) methylation of the targetedlocus, resulting in the silencing of gene expression by a processcalled transcriptional gene silencing (TGS).13 – 17 TGS operates viaheritable epigenetic modification of the targeted promoter lociand has potential to silence genes for longer duration than PTGS,as the continued presence of the effector siRNA is no longerrequired, contrary to the situation in PTGS.18 Previously, we demon-strated silencing of the locus control region of human papilloma

# The Author 2013. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.For Permissions, please e-mail: [email protected]

J Antimicrob Chemother 2014; 69: 404–415doi:10.1093/jac/dkt348 Advance Access publication 10 September 2013

404Downloaded from https://academic.oup.com/jac/article-abstract/69/2/404/711046by gueston 12 February 2018

http://jac.oxfordjournals.org/lookup/suppl/doi:10.1093/jac/dkt348/-/DC1

virus (HPV-16) in cervical carcinoma cell lines by the same mechan-ism using siRNA.19

While the majority of studies on the effect of siRNA on HIV-1treatment are focused on subtype B, a predominant clade in theUSA and Western Europe accounting for only �10% of the totalworldwide HIV-1 infection, subtype C infection, which predominatesin Africa, India and other parts of Asia and accounts for .50% of theworldwide HIV-1 infection, has received less attention.20 –22Recent-ly, siRNAtargetingtheconservedNF-kBbindingsitesof theenhancerin the U3 region of HIV-1B 5′ LTR has been shown to induce TGS andcause the suppression of viral replication.23–25 However, a similarlocus for TGS of HIV-1C has not been identified so far.

siRNA-mediated TGS is reported to be a highlysequence-specificphenomenon, where even a two to three nucleotide mismatch inthe homology of siRNA and the target sequence is not able to

induce effective silencing.23 Sometimes, shifting of the targetregion even by a single nucleotide can alter the modulatoryeffect of siRNAs.19,26 Sequence alignment of HIV-1B and HIV-1C5′ LTRs reveals significant variation in nucleotide sequence andCpG sites in the enhancer and core promoter of the U3 region(Figure S1).4 – 6 Thus, we hypothesized that siRNA effectiveagainst HIV-1B LTR might not be effective against HIV-1C LTR dueto sequence variation in the target site. We have identified ansiRNA that induces heterochromatization of C-LTR, which leads tothe silencing of downstream gene expression and causes suppres-sion of viral replication and marked reduction in the apoptosis ofHIV-1C-infected human peripheral blood mononuclear cells(PBMCs). This siRNA is also effective against HIV-1C LTR promotershaving a common one-base mismatch in the target site. In future,this dsRNA may serve as a therapeutic approach to suppress clade

C-LTR

U3 region(a) (b)

(d)(c)

(e) (f)

Enhancer

NF-KBIII NF-KBII NF-KBI SP1III SP1II SP1I

Core promoter

+1

TSS

B-LTR

pcDNA3.1 C-LTR Luciferase

Luciferase

C-Tat

B-Tat

B-LTR

CMV

CMV

pcDNA3.1

pGL3-Basic

pGL3-Basic

1.61.2

1

0.8

0.6

0.4

0.2

07 14

Days after infection

7 – 21 days post-transfection luciferase mRNA

expression with S4-dsRNA

Control0.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4After 48 h of transfection

Lucif

era

se a

cti

vit

y

S1 S2 S3 S4 S5 S6

21

Control

S4-siRNA

1.4

1.2

1

0.8

0.6

0.4

0.2

0Control

Lucif

era

se a

cti

vit

y

Ex

pre

ssio

n r

ati

o

After 72 h of transfection

S1 S2 S3 S4 S5 S6

siRNA-3 (S3)

siRNA-2 (S2)

siRNA-1 (S1)

5’C-LTR

siRNA-6 (S6)

siRNA-5 (S5)

siRNA-4 (S4)

AGAAGGGACTTTCCGCTGGGACTTTCCACTTGGGGCGTTCCAGGAGGAGTGGTCTG

NF-kBIII NF-kBII NF-kBI SP1III

Figure 1. siRNA target sites in HIV-1C 5′ LTR and screening of six siRNAs identifies an siRNA causing TGS. (a) Schematic representation of the U3 region ofHIV-1Cand HIV-1B 5′ LTR, highlighting the transcription start site (TSS) and transcription factor binding sites (NF-kB and SP1). (b) siRNA sequences targetingNF-kB and SP1 binding sites in the enhancerand core promoter region of C-LTR. (c) Outline of HIV-1 subtype C LTR (S-B253)- and B LTR (K03455)-driven fireflyluciferase reporter constructs (C-LTR-luciferase and B-LTR-luciferase) and subtype C and B Tat protein expression cassette with CMV promoter inpGL3-basic-based vector. Dual luciferase assay showing a significant decrease in luciferase activity (firefly/Renilla luciferase) after (d) 48 h (P¼0.01)and (e) 72 h (P¼0.02) of S4-siRNA transfection in siHa (C-LTR-Luci+Tat) cells. Luciferase activity is expressed as a ratio of firefly to Renilla luciferasenormalized to scrambled control siRNA. (f) Real-time PCR showing S4-siRNA-mediated silencing of luciferase mRNA expression was sustained over aperiod of 3 weeks (P,0.001). Expression ratio was calculated with respect to 18S, PPIA, GAPDH and b-actin by REST software.

Suppression of HIV-1C virus production by dsRNA

405

JAC

Downloaded from https://academic.oup.com/jac/article-abstract/69/2/404/711046by gueston 12 February 2018


C isolate, which predominantly exists in India, Africa and otherparts of Asia.

Methods

Ethics statementThis study was approved bythe Ethics Committee of the All India Institute ofMedical Sciences (ref. no. A-63/4.12.2006). Blood from healthy donors wasdrawn after written informed consent.

Construction of LTR-luciferase reporter and Tatexpression vectorspcDNA3.1 (Invitrogen, Carlsbad, CA, USA)-based bicistronic LTR reportervectors expressing secreted alkaline phosphatase (SEAP) and enhancedgreen fluorescent protein (EGFP) downstream from the HIV-1C LTR (pC-LTR-SEAP-IRES-EGFP) or HIV-1B LTR (pB-LTR-SEAP-IRES-EGFP)27 were usedto generate the C-LTR- and B-LTR-luciferase (firefly) reporter constructs, re-spectively. The full-length C-LTR (EF178612) and B-LTR (K03455) of thebicistronic reporter originated, respectively, from the S-B253 clinicalisolate and the pHIV-CATreporter vector (no. 2619, AIDS Research and Ref-erence Reagent Program at NIH).27 The firefly luciferase gene was retrievedfrom the pGL3-basic vector (Promega) using NheI and XbaI restriction sitesand directionally cloned between NheI and XbaI sites of pC-LTR-SIE orpB-LTR-SIE after eliminating the SEAP-IRES-EGFP cassette to generate theC-LTR- or B-LTR-luciferase reporter construct.

The pGL3-basic-based subtype-specific CMV-Tat expression vector wasgenerated by isolating the CMV-C-Tat and CMV-B-Tat cassette frompcDNA3.1-based pcDNA C-Tat and B-Tat using MluI and XbaI, and clonedbetween the same restriction sites of the pGL3-basic vector backboneafter removing the firefly luciferase gene. The full-length subtype C and BTat originated, respectively, from an Indian seropositive donor (BL43/02)and a reference molecular clone pYU2 (catalogue no. M2393, AIDSResearch and Reference Reagent Program at NIH).27 All the recombinantconstructs were confirmed by DNA sequencing and restriction digestion.

The LTR bicistronic reporter constructs (pC-LTR-SIE and pB-LTR-SIE) andpcDNA3.1-based Tat expression vectors (pcDNA C-Tat and pcDNA B-Tat)were a gift from Dr Udaykumar Ranga (Molecular Virology Laboratory, Mo-lecular Biology and Genetics Unit, JNCASR, Bangalore, India).

Cell cultureThe siHa/LTR luciferase cells and TZM-bl cells used in this study were main-tainedinDulbecco’smodifiedEagle’smedium(Sigma–Aldrich,Germany)sup-plemented with 10% fetal calf serum (FCS; BioWest, USA), 3.7 g/L sodiumbicarbonate and 10 mg/mL ciprofloxacin and incubated in 5% CO2 at 378C.

Stable transfectionAt day 0, 2×105 siHa cells/25 cm2 flask (Corning, NY, USA) were plated. After24 h, cells were co-transfected with the C-LTR/B-LTR-luciferase reporterconstruct (C-LTR-Luci/B-LTR-Luci) and the pGL3-basic C-Tat/B-Tat vector ina 1:10 ratio (200:2000 ng) using Lipofectamine 2000

TM

(Invitrogen) accord-ing to the manufacturer’s protocol. Transfected cells were cultured underG418 (Sigma–Aldrich) selection pressure, at a concentration of 700 mg/mLduring medium replenishment starting from the day after transfection. TheLTR reporter- and Tat expression vector-positive colonies were isolatedusing cloning cylinders (Corning) and expanded under selection pressure.

siRNA design and synthesisSix siRNAs were designed with thymine dinucleotide 3′ overhangs (dTdT)targeting the HIV-1C LTR. Characterization of TF binding sites to C-LTR

was done using the Transcription Element Search System, availableonline at http://www.cbil.upenn.edu/cgi-bin/tess/tess. One control siRNAwith a randomized sequence was also designed that had no target or hom-ology to any other human sequence, as checked by NCBI’s BLAST software.siRNA was synthesised by Eurofins MWG (Germany). The siRNA sequencesare given in Table S1 (available as Supplementary data at JAC Online).

siRNA transfectionCells were plated at 40000 cells/well in a 24-well plate, 1×105 cells/well in a6-well plate, 2×105 cells/25 cm2 flask or 1×106 cells/75 cm2 flask. After24 h, cells were transfected using a concentration of 50 nM of specific orcontrol siRNA using Oligofectamine (Invitrogen, USA) according to the man-ufacturer’s instructions.

Dual luciferase assaysThese were performed according to the manufacturer’s instructions(Promega, USA) using a luminometer (Sirius, Berthold Detection Systems).siHa cells stably expressing the firefly luciferase gene downstream of theHIV-1C/B LTR promoterand the C/B-Tat protein downstream of the CMVpro-moter were co-transfected with siRNA targeted to the LTR region along witha Renilla luciferase vector (pRL-TK vector, Promega) as an internal control.The LTR-driven firefly luciferase activity was normalized to backgroundRenilla luciferase activity. The ratio of luciferase activity (firefly/Renilla) ofcontrol dsRNA transfected cells was set to 100%, and relative luciferase ac-tivity of other dsRNA transfected cells calculated accordingly.

Real-time PCRRNA was isolated from cells at particular timepoints by using Trizol reagent(Sigma–Aldrich). The RNA was DNase (MBI Fermentas, USA) treated andquantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Sci-entific, USA). One microgram of RNA was reverse transcribed using randomdecamers and MMLV-RT (MBI Fermentas). All real-time PCRs were per-formed on a Rotor-Gene 6000 real-time PCR machine (Corbett Research,Australia) using gene-specific primers. Taq Master Mix with SYTO 9 greenfluorescent dye (Invitrogen, USA) was used to amplify and detect the re-spective DNA during the reaction. The thermal cycling conditions startedwith 1 min initial denaturation at 958C, followed by 40 cycles of 958C for15 s, 608C for 15 s and 728C for 30 s. The specificityof the real-time PCR pro-ducts was confirmed by melt curve analysis and agarose gel electrophor-esis. Accurate quantification of gene expression by real-time PCR ispossible by averaging the geometric mean of multiple internal controlgenes and using them as a reference.28 Therefore, four reference genes,namely 18S, PPIA, GAPDH and b-actin, were used. Relative quantificationof the genes was done using the Relative Expression Software Tool(REST).29 All primer sequences used in the experiment are listed inTable S2 (available as Supplementary data at JAC Online).

Cell proliferation assayCell proliferation wasmeasured using the CellTiter 96 AQueous One SolutionCell Proliferation Assay kit (Promega) according to the manufacturer’sinstructions.

Micrococcal nuclease digestion/chromatin accessibilityreal-time PCR (MNase/CHART-PCR) assayThe MNase/CHART-PCR assay was carried out as described previously.30

Confluent cells were scraped and pelleted by centrifugation at 2000 rpmfor 10 min at 48C. Then, 105 cells were washed in ice-cold PBS and resus-pended in 200 mL of cold NP40 lysis buffer [10 mM NaCl, 10 mM Tris-Cl

Singh et al.


http://www.cbil.upenn.edu/cgi-bin/tess/tess






(pH 7.4), 3 mM MgCl2, 0.5% NP40, 0.15 mM spermine and 0.5 mM spermi-dine], followed by incubation on ice for 5 min and pelletingdown of nucleibycentrifuging at 3000 rpm for 5 min. Isolated nuclei were resuspended in200 mL of digestion buffer. One hundred microlitres of suspended nucleiwas kept as undigested and the remaining 100 mL was digested with 2 Uof MNase enzyme for 10 min. DNA was isolated from undigested anddigested samples using an RBC genomic DNA isolation kit (Real Genomics,Taiwan). The targeted C-LTR region was amplified using primers listed inTable S2 in a Rotor-Gene 6000 real-time PCR machine and the heterochro-matized centrosome region of chromosome 16 was used as a referencegene for the analysis. The ratio of undigested (UD) to digested (D) DNA ofregion of interest (GOI) and positive standard chromosome 16 centromericregion (CHR16) was calculated using the DDCt method, {2^ [Ct value of CHR16

(UD) 2 Ct value of GOI (UD)] / 2^ [Ct value of CHR16 (D) 2 Ct value of GOI (D)]}.

Chromatin immunoprecipitation (ChIP) assaysChIPassays fordimethylatedH3K9andtrimethylatedH3K27histonetailsweredone using an EZ-ChIP

TM

kit (Millipore). Input DNA and chromatin immunopre-cipitated with dimethylated H3K9 antibody (mAbcam1220), trimethylatedH3K27 antibody (mAbcam6002) and control mouse IgG antibody (Upstate)were amplified using specific primers for the targeted HIV-1C LTR region on aRotor-Gene 6000 real-time PCR machine. The percentage of enrichmentafter immunoprecipitation was calculated as described previously.31

Bisulfite treatment and PCR sequencingGenomic DNA was isolated from cells transfected with dsRNA using a Pure-geneR blood core kit (Qiagen) and 500 ng was bisulfite treated using anEpiTect Bisulfite Kit (Qiagen, Germany). Nested PCR was done for the amp-lification of the target region and primers for bisulfite-treated DNA weredesigned from http://bisearch.enzim.hu/. The inner primers were M13tagged and sequencing was done using universal M13 primers.

Histone deacetylase (HDAC) and DNA methyl transferase(DNMT) inhibitionInhibition of HDAC or DNMT was done byadding 300 nM trichostatin (TSA) or5mM 5-aza-2-deoxycytidine (AZA) dissolved in DMSO, to the respectiveculture medium. No significant change was observed in cell morphologyand proliferation under these conditions. Transfection of siRNA was doneafter 48 h of AZA/TSA treatment of cells or AZA/TSA treatment of cellswas done after 72 h of siRNA transfection.

HIV infection and siRNA transfection of TZM-bl cellsTZM-bl cells (3×105) in a 25 cm2 flask were infected with the HIV-1Cprimary isolates (AIIMS 201, 212, 254 and 261) using a TCID50 1000 and in-fection was allowed to establish for 3 days (where TCID50 stands for 50%tissue culture infective dose). HIV infection was done by mixing of virusstock of the HIV-1C primary isolate with the cell culture and leaving for3 days.32 On day 4 of infection, cells were trypsinized and washed threetimes, and reseeded at 1×105 cells/well in a 6-well plate. After 24 h,infected cells were transfected with S4 or control siRNA (50 nM) using Oligo-fectamine (Invitrogen) according to the manufacturer’s instructions.

HIV infection and dsRNA transfection of human PBMCsHuman PBMCs from healthy HIV-1-negative donors were isolated usingFicoll-Hypaque according to standard procedures. Isolated PBMCs were cul-tured in RPMI-1640 medium supplemented with 10% FCS and activatedwith 1 mg/mL phytohaemagglutinin (PHA) for 3 days in the presence ofIL-2 (100 U/mL) at 378C. PHA- and IL-2-stimulated PBMCs were subjectedto infection with the HIV-1C primary isolates (AIIMS 201, 212, 254 and 261)

using a TCID50 1000. HIV infection was done by mixing of virus stock of theHIV-1C primary isolate with a PHA- and IL-2-stimulated PBMC culture andleaving for 3 days.32 On day 4 of infection, cells were washed three timeswith PBS and infected cells were plated at 2×106 cells/mL in a 6-well plate.Cells were transfected with S4 orcontrol dsRNA (50 nM) using Oligofectamine.No viral p24 was detected in the culture supernatant on the day of transfec-tion(day0oftransfection).At0,4,7,14and21 daysafter transfection,culturesupernatants were removed and viral Gag-p24 was measured using an HIV-1p24 ELISA kit (Xpress-Bioscience Life, USA). Every seventh day, uninfectedPHA- and IL-2-stimulated PBMCs suspended in fresh medium were thenadded to one-half volume of culture medium to replenish the dead cells.

Western blot analysisAfter siRNA transfection, PBMCs were washed with PBS and lysed with triplelysis buffercontaining a protease inhibitorcocktail. Protein lysate was quan-tified by using the bicinchoninic acid protein assay (BCA Protein Assay Kit,Pierce). Equal amounts of protein were resolved on 5%–12% SDS–PAGEgels and transferred to nitrocellulose membranes. The immunoblots wereblocked with 4% BSA for 2 h at room temperature in TBS. The antibodiesused for immunoblotting were anti-b-actin (Cell Signaling Technology,USA) and anti-HIV-1 p24 (sc-69728, Santa Cruz Biotechnology). Specificproteins were detected by using appropriate secondary antibodies labelledwith alkaline phosphatase and BCIP/NBT (Promega) as the substrate.

Caspase-3 assayThe caspase-3 activity of HIV-1C-infected PBMCs after 1 week of dsRNAtransfection was measured using a caspase-3 assay kit (Promega) accord-ing to the manufacturer’s instructions.

Generation of mutant C-LTR-luciferase (M-I, M-II andM-III) reporter constructs and luciferase reporter assayafter transient transfectionDifferent C-LTR-luciferase reporter constructs having mutations within thetarget sequence of S4-siRNA were generated using a Phusion Site-DirectedMutagenesis Kit (Thermo Scientific, USA) according to the manufacturer’sinstructions. Mutant C-LTR-luciferase reporters M-I and M-II with singlemutations were generated using a wild-type C-LTR-luciferase reporter(C-LTR-luciferase) construct as a template and 5′-phosphorylated muta-genic primers. The C-LTR-luciferase reporter M-I was generated usingprimers M1 and M2, while the C-LTR-luciferase reporter M-II was generatedusing primers M3 and M4. Similarly, the C-LTR-luciferase reporter M-III withtwo mutations was generated by using primers M5 and M6. All mutagenicprimer sequences used in the site-directed mutagenesis are listed inTable S3 (available as Supplementary data at JAC Online).

Luciferase expression was measured from siHa cells co-transfected withsiRNA and wild-type C-LTR-luciferase reporter/mutant C-LTR-luciferase re-porter (M-I, M-II, M-III) construct along with C-Tat expression vector(CMV-C-Tat) and Renilla luciferase vector. Briefly, siHa cells were plated at1×105 cells/well in a 6-well plate (Corning). After 24 h, cells were transfectedwith 50 nM siRNA and then after 20 h with a mixture of 1 mg ofC-LTR-luciferase reporter, 200 ng of C-Tat vector and 10 ng of Renilla vectorper well. Both transfections were done in serum-free Opti-MEM media (Invi-trogen, USA) using Oligofectamine according to the manufacturer’s instruc-tions. Luciferase activity was measured from transfected siHa cells after 72 hof reporter vector transfection by dual luciferase assay.

Statistical analysisAll dual luciferase assay experiments were performed in triplicate andrepeated three times. The DNA methylation, p24 ELISA, caspase-3,


407

JAC



http://bisearch.enzim.hu/




MNase and ChIP assay experiments were repeated at least twice. The dataare presented as the mean+SD. Significance in the differences was deter-minedusing Student’s t-test. P,0.05 wastaken as significant and P,0.001as highly significant.

Sequence dataGenBank accession numbers of LTR of the HIV-1C isolates are as follows:KC197029 (AIIMS 201), KC197030 (AIIMS 212), KC197032 (AIIMS 254)and KC197033 (AIIMS 261).

Results

Screening of siRNAs targeting the HIV-1C LTR promoterfor down-regulation of downstream coding sequences

Six siRNAs were synthesized that targeted two regions within theenhancer and core promoter region of the U3 promoter ofHIV-1C LTR, each region encompassing one CpG site. Of these,three siRNAs [siRNA-1 (S1), siRNA-2 (S2) and siRNA-3 (S3)],shifted in position by a single nucleotide, were homologous tothe NF-kB-II and -III binding sites while the other three siRNAs[siRNA-4 (S4), siRNA-5 (S5) and siRNA-6 (S6)], also differing in pos-ition by a single nucleotide, targeted the NF-kB-I and SP1-IIIbinding sites (Figure 1b).

siHa cells, stably expressing the firefly luciferase gene down-stream of the HIV-1C LTR promoter (C-LTR-Luci) and subtypeC-Tat protein downstream of the CMV promoter (CMV-C-Tat)(Figure 1c), were transfected with different siRNAs (Figure 1b)and screened by the dual luciferase assay at different timepoints.siHa (C-LTR-Luci+Tat) reporter cells stably expressing the Tatgene were confirmed by RT–PCR and HIV-1C LTR-driven luciferasegene expression in response to Tat was checked by luciferase assay(Figure S2, available as Supplementary data at JAC Online).S4-siRNA was found to decrease luciferase activity maximallyby 50% (P¼0.01) and 60% (P¼0.02) at 48 and 72 h post-transfection, respectively, in comparison with control dsRNA(Figure 1d and e). S4-siRNA-mediated silencing was sustainedover a period of 3 weeks (Figure 1f). S2-siRNA, which targeted aregion in C-LTR homologous to a region that was successfully tar-geted in B-LTR by PromA-siRNA, did not have any significanteffect on C-LTR (Figure 1d and e). The reduction in reporter gene ex-pression in the presence of Tat is an indicator of the efficacy of thesiRNA in conditions resembling human infection.

S4-siRNA does not induce cytotoxicity or an interferonresponse

A cell proliferation assay was performed to assess whether trans-fection of S4-siRNA resulted in non-specific cytotoxic effects. Nosignificant change was observed in the rate of proliferation of re-porter cells transfected with either S4-siRNA (P.0.4) or controlsiRNA (P.0.5) in comparison with mock-transfected cells(Figure S3a, available as Supplementary data at JAC Online).

It is reported that transfection of siRNA can induce sequence non-specific off-target effects by triggering an interferon response in eu-karyoticcellseitherbyactivationof thePKR/RNaseLpathwayorbyac-tivation of the endosomal Toll-like receptor (TLR) pathway.33,34 Aninterferon response can be confirmed by 50–500-fold up-regulationof2′,5′-oligoadenylatesynthetase-1(OAS1),awell-knowninterferon

response marker.35 No significant increase was observed in OAS1mRNA levels after S4-siRNA or control siRNA transfection in compari-son with mock transfection at different timepoints (P.0.05)(Figure S3b, available as Supplementary data at JAC Online).

S4-siRNA-mediated TGS is specific to HIV-1C

siHa cells containing integrated (C-LTR-Luci+Tat/B-LTR-Luci+Tat)constructs were used to check the specificity of S4-siRNA. Aftertransfection, S4-siRNA showed a significant (P,0.05) decrease inthe luciferase activity of C-LTR-Luci+Tat cells after 3 days but nosignificant change was observed in B-LTR-Luci+Tat cells(Figure 2a). This specific down-regulation of the luciferase genewas also confirmed at the mRNA level (P,0.001) after S4-siRNAtransfection (Figure 2b).

In a previous study, an siRNA (PromA) targeting the NF-kBsequences of HIV-1B LTR (Figure 2c) was demonstrated to induceTGS.23,24 Here, we observed that PromA-siRNA significantly(P,0.05) reduced the luciferase activity of B-LTR-Luci+Tat cellsbut no significant decrease was observed in C-LTR-Luci+Tat cells(Figure 2a). This was also confirmed at the luciferase mRNA level(Figure 2b).

We also checked the efficacyof another siRNA (B-siRNA), target-ing the B-LTR, which corresponds to the target region of S4-siRNA inC-LTR (Figure 2c). B-siRNA did not show any significant decrease inthe luciferase activity and luciferase mRNA level in C-LTR as well asB-LTR reporter cells in the presence of the Tat protein (Figure 2aand b).

TGS of the HIV-1C LTR promoter involves H3K9and H3K27 methylation and heterochromatizationof the targeted locus

The 5′ LTR of HIV-1 is flanked by two nucleosomes: nuc-0 at the 5′

end in the U3 region spans nt 40–200 and nuc-1 that is juxtaposedto the transcriptional start site encompassing nt 465–610 in theR-U5 region (Figure 3a).36 – 38 The chromatin state of the targetedregion was checked by MNase/CHART-PCR assay.30

After transfection of siHa (C-LTR-Luci+Tat) reporter cells withS4-siRNA, there was a significant reduction in the accessibility ofthe targeted LTR region to MNase digestion in comparison withthe control siRNA (P,0.001), while no significant change wasobserved in mock- and B-siRNA-transfected cells (Figure 3b). Thissuggested that the repression of transcriptional activity of C-LTRby S4-siRNA was associated with heterochromatization of the tar-geted locus.

Furthermore, epigenetic chromatin modifications such asdimethylation of H3K9 (H3K9me2) and trimethylation of H3K27(H3K27me3) of the histone tail, the marks of silent chromatin,were investigated at the targeted region. ChIP assay showed 3.5-and 4.5-fold enrichment of H3K9me2 and H3K27me3, respectively(P,0.001 and P,0.01), at the targeted LTR region in siHa(C-LTR-Luci+Tat) reporter cells after S4-siRNA transfection in com-parison with control siRNA-transfected cells, but no significant en-richment was observed in mock- and B-siRNA-transfected cells(Figure 3c). Bisulfite treatment of genomic DNA of siHa(C-LTR-Luci+Tat) cells after single transfection of S4-siRNA fol-lowed by PCR and sequencing did not show methylation of cytosineat the targeted and nearby CpG sites at day 4 and even at day 10 of

Singh et al.





transfection (Figures S4 and S5, available as Supplementary dataat JAC Online).

After treatment of siHa (C-LTR-Luci+Tat) reporter cells with TSA(HDAC inhibitor) or AZA (DNMT inhibitor) for 48 h before S4-siRNAtransfection, AZA-treated cells still showed a significant (P,0.05)decrease in luciferase activity, while cells treated with TSA showedno change in luciferase activity (P¼0.32) (Figure 4a). The cellstreated with only DMSO (the solvent for TSA and AZA) for 48 h fol-lowed by S4-siRNA transfection showed a significant decrease(P,0.001) in luciferase activity, indicating that the DMSO solventalone did not affect TGS (Figure 4a). In another experiment, reactiva-tion of HIV-1C LTR promoter activity (P¼0.07) was observed in siHa(C-LTR-Luci+Tat) reporter cells after 6 days of S4-siRNA transfectionwhen treated withTSA after 3 days of S4-siRNAtransfection,butcellstreated with AZA did not show up-regulation of luciferase activity(P¼0.01) or reactivation of the heterochromatized HIV-1C LTR pro-moter (Figure S6, available as Supplementary data at JAC Online).

Decrease in virus production in the HIV-1C-infectedTZM-bl cell line on treatment with S4-siRNA

TZM-bl cells expressing CD4, CXCR4 and CCR5 were used to study theeffect of S4-siRNA-mediated TGS on HIV-1C viral production. TZM-blcells were infected with different HIV-1C clinical isolates [AIIMS 201,212, 254 and 261; AIIMS 212 with a nucleotide difference in thetarget region (Figure 4b and Figure S7, available as Supplementarydata at JAC Online)] and transfected once with siRNAs as describedin the Methods section. Viral p24 antigen levels were determined inthe culture supernatants at different timepoints over 2 weeks as anindicator of viral infection. There was a 50%–60% reduction in thep24 level observed on day 4 of S4-siRNA transfection (day 8 post-infection) in comparison with control siRNA-transfected cell culturesin all four HIV-1C isolates. On day 7 of transfection (day 11 post-infection), 70%–80% suppression of productive infection wasobserved and was sustained for ≥14 days of transfection (day 18post-infection) (Figure 4c). It was also observed that the S4-siRNA

1.4(a)

(b)

(c)

1.2

1

0.8

0.6

0.4

0.2

0

1.6

1.4

1.2

1

0.8

0.6

0.4

0.2

0

Ex

pre

ssio

n r

ati

o

Control Prom-A B-siRNA S4-siRNA

Control Prom-A B-siRNA S4-siRNA

Luciferase assay

Luciferase mRNA expression

Lucif

era

se a

cti

vit

y

C-LTR-Luci + Tat

B-LTR-Luci + Tat

C-LTR-Luci + Tat

B-LTR-Luci + Tat

5’ C-LTR CTGACACAGAAGGGACTTTCCGC–TGGGACTTTCCACTTGGGGCGTTCCA–GGAGGAGTGGTCT5’ B-LTR

** * ** * * * * * * *CTGACATCG–A––G–CTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCT

siRNA-4 (S4)

PromA–siRNA

B siRNA

Figure 2. S4-siRNA is specific to HIV-1C LTR. (a) After S4-siRNA transfection, there was a significant (P,0.05) decrease in luciferase activity ofC-LTR-Luci+Tat siHa cells after 3 days but not in B-LTR-Luci+Tat siHa cells post-transfection, while PromA-siRNA was only active on the B-LTRconstruct. B-siRNA targeting the B-LTR region corresponding to the S4-siRNA target region in C-LTR was also not effective in HIV-1B LTR.(b) siRNA-specific effect on HIV-1C LTR- and HIV-1B LTR-driven luciferase gene expression at the mRNA level. (c) Sequence alignment of C-LTR (S-B253)and B-LTR (HXB2) and comparison of the target sequences of different siRNAs. CpG dinucleotides, the susceptible sites of methylation, are in bold.Asterisks indicate mismatches and - symbols represent gaps.


409

JAC







can also tolerate a single-base mismatch in the target sequence ofthe AIIMS 212 strain (Figure 4b) and suppress viral production in themutated target strain (Figure 4c).

Inhibition of HIV-1C replication in infected human PBMCsin primary culture by S4-siRNA

The efficacy of S4-siRNA-mediated TGS of HIV-1C virus in suppres-sing viral replication in an ex vivo system was further checked inhuman PBMC primary culture after infection with HIV-1C primaryisolates from different patients. PHA- and IL-2-stimulated PBMCswere infected with four different HIV-1C clinical isolates and trans-fected once with siRNAs as described in the Methods section. Viralp24 levels were determined in culture supernatants at differenttimepoints over 3 weeks as a measure of viral replication. Therewas a 60%–70% reduction in the p24 level observed on day 4 ofS4-dsRNA transfection (day 7 post-infection) in comparison withthe control siRNA-transfected culture in all four HIV-1C isolates.At day 7 of transfection (day 10 post-infection), almost 90% sup-pression of productive infection was observed and this suppression

was sustained for ≥21 days of transfection (24 days post-infection) (Figure 5a). Western blot analysis also showed thatHIV-1-specific Gag-p24 was markedly decreased in PBMC culturetreated with S4-siRNA compared with control siRNA-transfectedculture at day 7 of transfection (day 10 post-infection)(Figure 5b). We did not observe an siRNA-induced interferon re-sponse by the PKR/RNaseL pathway or by TLR activation in HIV-1C-infected PBMCs after transfection (Figure S7).

Reduction in caspase activity in infected PBMCs aftertreatment with S4-siRNA

The pathogenesis of HIV-1 is associated with enhanced apoptosis ofHIV-infected CD4 Tcells and bystander uninfected Tcells.39,40There-fore, caspase-3 activity, a marker of apoptosis and cell-associatedHIV infection, was monitored in HIV-infected PBMC culture aftertransfection. After S4-siRNA transfection, a significant reduction(P¼0.004) in caspase-3 activity was observed in HIV-1C-infectedPBMCs in comparison with control siRNA-transfected cells onday 7 of transfection (day 10 post-infection), while control

Modulatory region Enhancer Core promoter

SP1

RvFw

S4-siRNA

5’ C-LTR

(a)

(b)

(c)

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0.0

6.0

5.0

4.0

3.0

2.0

1.0

0.0

Mock

Ch

rom

ati

n a

cce

ssib

ilit

y

(un

dig

est

ed

/dig

est

ed

)R

ela

tive

en

rich

me

nt

Control siRNA

Chromatin accessibility to MNase measured by

CHART-PCR (day 4 of transfection)

ChIP assay for H3K9me2 and H3K27me3

on day 4 of transfection

S4-siRNA B-siRNA

Mock Control siRNA S4-siRNA B-siRNA

H3K27me3

H3K9me2

nuc-0 nuc-1NF-KB +1

R U5

Figure 3. S4-siRNA induces heterochromatization of the HIV-1C LTR promoter. (a) Schematic diagram of nucleosome positions in the 5′ LTR of HIV-1C andprimer binding sites (Fw and Rv) used for the MNase and ChIPassay. (b) On day 4 of S4-siRNA transfection, there was a significant decrease (P,0.001) in theaccessibility of the targeted LTR region to MNase digestion in siHa cells (C-LTR-Luci+Tat). (c) S4-siRNA induces methylation of histone tails. The ChIP assayshowed a 3.5- and 4.5-fold enrichment of H3K9me2 and H3K27me3, respectively (P,0.001 and P,0.01), at the targeted LTR region in comparison withcontrol siRNA.

Singh et al.



siRNA-transfected cells showed significant up-regulation (P¼0.004)of caspase-3 activity compared with uninfected cells. This furtherdemonstrates the protective effect of S4-siRNA in HIV-1C infectionin PBMC culture (Figure 5c).

Analysis of mismatch or mutation tolerance in the targetsequence of S4-siRNA

It was observed that S4-siRNA suppressed the viral production ofthe AIIMS 212 strain, which had one mismatch in the target se-quence (Figures 4c and 5a). After analysis of the variation of thetarget sequence in different HIV-1C strains in the GenBank (NCBI)

database (Figure S8, available as Supplementary data at JACOnline), we checked the efficacy of our S4-siRNA in down-regulating C-LTR having two of the common single-base mis-matches and also a target with double-base mismatches. ThreeC-LTR-luciferase reporter constructs with mutation in the targetsitewere used along with awild-type C-LTR-luciferase reportercon-struct to check the tolerance of mismatch in the target sequence ofS4-siRNA-induced TGS (Figure 6a). To check the mutation tolerancein the S4-siRNA target site, siHa cells were co-transfected witheither wild-type or mutant C-LTR-luciferase reporter constructand siRNA as described in the Methods section. We observedthat S4-siRNA significantly reduced the luciferase activity of the

1.4

(a)

(b)

(c)

1.2

1.0

0.8

0.6

0.4

0.2

0.0DMSO control AZA

Inhibition of reduction of HIV-1C promoter

activity by S4-siRNA after TSA treatment

AIIMS 201 AIIMS 212

AIIMS 254 AIIMS 261

NC

201-mock

201-control

201-S4 siRNA

NC

212-mock

212-control

212-S4 siRNA

NC

261-mock

261-control

261-S4 siRNA

700

600

500

400

300

200

100

0

0 4 7 14

Time post-transfection (days)

0 4 7 14


0 4 7 14


0 4 7 14


p2

4 (

pg

/mL

)

700

600

500

400

300

200

100

0

p2

4 (

pg

/mL

)

700

800

600

500

400

300

200

100

0

p2

4 (

pg

/mL

)

700

800

600

500

400

300

200

100

0

p2

4 (

pg

/mL

)

TSA

Mock

S4–dsRNA TGGGGCGTTCCAGGAGGAG

...................

.................T.

...................

...................

AIIMS 201

AIIMS 212

AIIMS 254

AIIMS 261

S4-siRNA

Control siRNA

Lucif

era

se a

cti

vit

y

NC

254-mock

254-control

254-S4 siRNA

Figure 4. S4-siRNA-induced TGS is independent of DNA methylation. (a) Luciferase activity of siHa reporter cells (C-LTR-Luci+Tat) after AZA and TSAtreatment followed by siRNA transfection. S4-siRNA-mediated TGS was inhibited by TSA treatment but not by AZA. The equivalent amount of DMSOadded to the cells was used as a control. (b) S4-siRNA target sequence in the LTR of different HIV-1 clade C isolates (AIIMS 201, 212, 254 and 261).(c) TZM-bl cells were infected with different HIV-1C clinical isolates (AIIMS 201, 212, 254 and 261) at TCID50 1000. On day 4 of infection, cells weredetached and washed three times, and reseeded. After 24 h (day 5 of infection), the cells were transfected with siRNA (control or S4); mock (withoutsiRNA) served as a positive control and uninfected cells served as a negative control (NC). At 0, 4, 7 and 14 days after transfection, HIV-1-specific viralp24 protein was measured in culture supernatant using an HIV-1 p24 ELISA kit.


411

JAC




C-LTR-luciferase wild-type reporter by 70% (P¼0.002) in compari-son with control siRNA (Figure 6b). In mutant C-LTR reporter con-structs, S4-siRNA showed down-regulation of luciferase activityby 60% (P¼0.01) in the C-LTR-luciferase M-I reporter and almost40% (P¼0.03) in the C-LTR-luciferase M-II reporter (Figure 6b).However, wedid not observe anysignificant reduction in the lucifer-ase activity of the C-LTR-luciferase M-III reporter (P¼0.87) thathad two mismatches in the target site (Figure 6b).

DiscussionHighly active antiretroviral therapy has been proven to reduce viralreplication and emergence of drug-resistant variants of HIV-1, but

escape variants still continue to surface after prolonged treatment.Suppression of HIV-1 replication by siRNA-mediated PTGS of struc-tural and accessory genes of HIV-1 has been attempted, but theeffect was transient.41 – 43 TGS, on the other hand, by causing het-erochromatization of the promoter, can result in the suppression ofall viral transcripts even when the effector siRNA has beendegraded in the cell. TGS may also have promising applicationagainst quasispecies virus in chronic HIV infection and would be ef-fective because of the conserved 5′ LTR promoter.

TGS of HIV-1 by dsRNA targeting the conserved region of 5′

LTR would be an ideal approach to suppress viral transcriptionand thereby its productive infection. The 5′ LTR of HIV-1 is thecommon promoter for all viral genes, so inhibition of viral

3000(a)

(b)

(c)

NC

201-mock

201-control

201-S4 siRNA

NC

254-mock

Mock Control S4 siRNA NC

NC Control siRNA S4-siRNA

p24

1.8

Ca

spa

se-3

ac

tivit

y

(fo

ld c

ha

ng

e)

1.61.41.2

10.80.60.40.2

0

β-actin

254-control

254-S4 siRNA

NC

261-mock

261-control

261-S4 siRNA

NC

212-mock

212-control

212-S4 siRNA

2500

2000

1500

1000

500

00 4 7 14 21


0 4 7 14 21


0 4 7 14 21

P = 0.30

P = 0.004P = 0.004


0 4 7 14 21


AIIMS 201 AIIMS 212

AIIMS 254AIIMS 261

p2

4 (

pg

/mL

)

3000

2500

2000

1500

1000

500

0

p2

4 (

pg

/mL

)

3000

2500

2000

1500

1000

500

0

p2

4 (

pg

/mL

)

2500

2000

1500

1000

500

0

p2

4 (

pg

/mL

)

Figure 5. Inhibition of viral replication and caspase activity in HIV-1C-infected human PBMCs after S4-dsRNA transfection. (a) PHA- and IL-2-stimulatedhealthy PBMCs were infected with TCID50 1000 of different HIV-1C clinical isolates (AIIMS 201, 212, 254 and 261). Three days later (day 4 of infection), cellswerewashed and transfected with siRNA (control or S4); mock (without dsRNA) served as a positive control and uninfected cells served as a negative control(NC). At 0, 4, 7, 14 and 21 days after transfection, the viral p24 level was measured in the culture supernatant using ELISA. (b) Western blot analysis of viralp24 protein and b-actin expression in cell lysates of PBMCs infected with an HIV-1C isolate (AIIMS 201) at day 7 of transfection (day 10 post-infection).(c) Caspase-3 activity of cells infected with the AIIMS 201 isolate was measured on day 7 of transfection (day 10 post-infection) using a caspase-3assay kit. There is a significant reduction in caspase-3 activity, indicating cells are also protected from apoptosis.

Singh et al.


transcription should reduce the chances for the generation ofmutations and, therefore, the emergence of escape variants,which limits the effectiveness of the PTGS approach.44 There arereports demonstrating prolonged TGS of HIV-1B in the LTR reportersystem as well as in the HIV-1 susceptible cell line by an siRNA tar-geting the NF-kB binding sites of the HIV-1B 5′ LTR.23 – 25,45

We have identified one potent dsRNA (S4-siRNA) that couldinduce TGS in the HIV-1C LTR-luciferase reporter system for alonger period of 21 days (Figure 1d–f) without causing cytotoxicity.dsRNA can elicit an interferon response by the PKR/RNaseL and/orTLR pathway to cause a very high increase in OAS1. No increase inOAS1 was noted in our siHa-luciferase reporter cells as well asHIV-1C-infected human PBMCs. Hence, S4-siRNA does not appearto activate the TLR pathway or PKR/RNaseL pathway in reportercells and human PBMCs. It was observed that S4-siRNA-directedTGS is highly clade specific and does not elicit TGS in the HIV-1BLTR. We have also found that the previously reported PromA-siRNA,which caused efficient TGS in HIV-1B virus by heterochromatizationand DNA methylation,14,23,24 failed to do so in HIV-1C virus. Thetarget region of PromA-siRNA in HIV-1C LTR has three mismatchesand absence of the CpG site, while the S4-siRNA target sequencein HIV-1B LTR has four mismatches and absence of the CpG site(Figure 2c). This is the most likely explanation for the siRNA-specificTGS of HIV-1Cand HIV-1B, because TGS is a highlysequence-specificphenomenon and we have demonstrated that a shift of the targetsite by one or more bases causes a dramatic reduction of the

observed effect. This indicates the same region in these twoclades is differently amenable towards TGS by dsRNA.

S4-siRNA-mediated TGS was associated with the heterochro-matization of the targeted promoter region, which led to a closedchromatin structure. This heterochromatization was measuredby MNase accessibility, which showed reduced accessibility ofMNase after S4-siRNA transfection (Figure 3b). The heterochroma-tin structure induced by S4-siRNAwas directed by epigenetic modi-fication, i.e. H3K27 trimethylation and H3K9 dimethylation, aroundthe targeted region (Figure 3c). Mock, control and B-siRNA-trans-fected siHa reporter cells did not show histone methylation anddecreased chromatin accessibility. Treatment with an HDAC inhibi-tor, TSA, both before and after S4-siRNA transfection preventedand reversed the TGS effect, respectively. No DNA methylationwas observed at the targeted promoter region on days 4 and 10post-transfection, and inhibition of DNMT by AZA had no effecton TGS. Taken together, these data suggest that S4-siRNA-mediated TGS can occur independent of DNA methylation. Wehave previously demonstrated that a similar phenomenon occursduring TGS of the E6 and E7 integrated oncogenes of HPV-16.19

While TGS of HIV-1B bysiRNA has been demonstrated in primaryhuman CD4+ T cells,46 in the natural history of disease, HIV caninfect various types of PBMCs. We therefore checked the effect ofS4-siRNA in both an in vitro and an ex vivo system using TZM-blcells and human PBMCs after infecting them with various clinicalHIV-1C isolates. We found that S4-siRNA targeting the HIV-1C

1.40

(b)

(a)

1.20

1.00

0.80

0.60

0.40

0.20

0.00

Mo

ck

C-LTR (wild-type)

Lucif

era

se a

cti

vit

y

Luciferase assay of wild-type/mutant C-LTR luciferase reporter after

siRNA transfection

(i) C–LTR (wild-type) TGGGGCGTTCCAGGAGGAG

(ii) C–LTR (M–I) A..................

(iii) C–LTR (M–II) ..............G....

(iv) C–LTR (M–III) ............C.G....

C-LTR (M-I) C-LTR (M-II) C-LTR (M-III)

Co

ntr

ol

siR

NA

S4

siR

NA

Co

ntr

ol

siR

NA

S4

siR

NA

Mo

ck

Co

ntr

ol

siR

NA

S4

siR

NA

Mo

ck

Co

ntr

ol

siR

NA

S4

siR

NA

Mo

ck

Figure 6. Transient C-LTR-luciferase reporter assay for analysis of effect of common mutations in the target site after S4-siRNA treatment. (a) Schematicrepresentation of mutations in the S4-siRNAtarget site of C-LTR-luciferase constructs: (i) wild-type,no mutation; (ii) M-I, T�A mutation atfirst position of 5′

end; (iii) M-II, A�G mutation at fifth position from 3′ end; and (iv) M-III, G�C and A�G mutations at seventh and fifth positions, respectively, from 3′ end.(b) Luciferase assay performed in siHa cells co-transfected with the C-LTR-luciferase reporter construct and siRNA (control or S4); mock (without siRNA).After S4-siRNA transfection, a significant decrease in luciferase activity was observed in siHa cells transfected with the C-LTR-luciferase wild-type, nomismatch, construct (P¼0.002) and C-LTR-luciferase M-I (P¼0.01) and C-LTR-luciferase M-II (P¼0.03) reporter single-mismatch constructs incomparison with control siRNA. No significant down-regulation in luciferase activity was observed after S4-siRNA transfection in siHa cells transfectedwith the C-LTR-luciferase M-III reporter double-mismatch construct (P¼0.87).


413

JAC


LTR promoter profoundly suppresses viral transcription and pro-ductive HIV-1C infection in TZM-bl cells (Figure 4c) and also inprimary human PBMCs, which was sustained for ≥21 days aftersingle transfection (Figure 5a). The suppression of HIV-1C infectionin PBMCs is also accompanied by reduced cellular p24 level andcaspase-3 activity, which are associated with the pathogenesisof HIV-1 (Figure 5b and c). The ability of the S4-siRNA to protectHIV-1C-infected PBMCs from apoptotic death also demonstratesits effectiveness against a range of primary clade C isolates. AnHIV-1 clade C isolate (AIIMS 212) with a single nucleotide differ-ence in the target sequence at the penultimate position (A�T)was also effectively neutralized (Figures 4b and c and 5a). Analysisof different clade C strains (Figure S8) showed that this targetregion is invariant in �50% of cases, while there was only asingle base difference in the rest. Since live viruses with such muta-tions were not available to us, except the AIIMS 212 strain, wemutated a base in the target region by site-directed mutagenesisat sites that were found to be commonly mutated in the HIV-1Cdatabase. It was observed that S4-siRNA can tolerate single-basemismatch at the first position of the 5′ end of the target sequence,which is common in many HIV-1C strains (Figure 6). Mutation ormismatch towards the central region (fifth position from the 3′

end) of the S4-siRNA target is also tolerated, while two mutationsin the target sequence are not. The ability of the S4-siRNA to toler-ate single-base mismatch at the 5′ or 3′ end along with theobserved position specificity enhances its ability for potentialtherapy of HIV-1C infection and indicates it can be effective inHIV quasispecies that arise during chronic infection.

In summary, we have identified a potent dsRNA that was con-firmed to establish heterochromatization of the transcriptionallyactive integrated HIV-1C 5′ LTR promoter, leading to the down-regulation of viral gene expression and replication for ≥21 daysafter single transfection in ex vivo experiments. This heritable chro-matin remodelling, viral gene silencing and long-term reduction inproductive viral infection in a range of primary clade C viral isolates(one with a nucleotide difference at the target region), as inducedby the dsRNA, strengthens the prospect of its usage as an alternateor combinatorial therapeutic approach with classical drugs for thetreatment of HIV-1C-infected patients in the future.

AcknowledgementsWe would like to acknowledge Dr Udaykumar Ranga for providing HIV-1 LTRand Tat vector constructs (pC-LTR-SIE, pB-LTR-SIE, pcDNA C-Tat and pcDNAB-Tat) and Mr Pappu Prasad and Mr Satish for their technical support. Aresearch fellowship to A. S. from UGC and a first year research fellowshipto A. S. from NACO are gratefully acknowledged.

FundingThis work was supported by a grant from the Department of Biotechnology(DBT), Govt of India, Sanction No. BT/01/COE/05/13, BT/PR13733/AGR/36/667/2010 and AIIMS Intramural Research Grant A-061/2012.

Transparency declarationsNone to declare.

Supplementary dataFigures S1–8 and Tables S1–3 are available as Supplementary data at JACOnline (http://jac.oxfordjournals.org/).

References1 Ramırez de Arellano E, Soriano V, Alcamil J et al. New findings ontranscription regulation across different HIV-1 subtypes. AIDS Rev 2006;8: 9–16.

2 Centlivre M, Sommer P, Michel M et al. HIV-1 clade promoters stronglyinfluence spatial and temporal dynamics of viral replication in vivo. J ClinInvest 2005; 115: 348–58.

3 De Arellano ER, Soriano V, Holguın A. Genetic analysis of regulatory,promoter, and TAR regions of LTR sequences belonging to HIV type 1non-B subtypes. AIDS Res Hum Retroviruses 2005; 21: 949–54.

4 Montano MA, Novitsky VA, Blackard JT et al. Divergent transcriptionalregulation among expanding human immunodeficiency virus type 1subtypes. J Virol 1997; 71: 8657–65.

5 Baar MPD, Ronde AD, Berkhout B et al. Subtype-specific sequencevariation of the HIV type 1 long terminal repeat and primer-binding site.AIDS Res Hum Retroviruses 2000; 16: 499–504.

6 Rodriguez MA, Shen C, Ratner D et al. Genetic and functionalcharacterization of the LTR of HIV-1 subtypes A and C circulating in India.AIDS Res Hum Retroviruses 2007; 23: 1428–33.

7 Naghavi MH, Schwartz S, Sonnerborg A et al. Long terminal repeatpromoter/enhancer activity of different subtypes of HIV type 1. AIDS ResHum Retroviruses 1999; 15: 1293–303.

8 Jeeninga RE, Hoogenkamp M, Armand-Ugon M et al. Functionaldifferences between the long terminal repeat transcriptional promotersof human immunodeficiency virus type 1 subtypes A through G. J Virol2000; 74: 3740–51.

9 Roof P, Ricci M, Genin P et al. Differential regulation of HIV-1 clade-specificB, C, and E long terminal repeats by NF-kB and the Tat transactivator.Virology 2002; 296: 77–83.

10 Turner A-MW, Morris KV. Transcriptional gene silencing as a genetictherapy for HIV-1. Future HIV Therapy 2008; 2: 339–49.

11 Fire A, Xu S, Montgomery MK et al. Potent and specific geneticinterference by double-stranded RNA in Caenorhabditis elegans. Nature1998; 391: 806–11.

12 Hammond SM, Bernstein E, Beach D et al. An RNA-directed nucleasemediates post-transcriptional gene silencing in Drosophila cells. Nature2000; 404: 293–6.

13 Morris KV. Small interfering RNA-induced transcriptional gene silencingin human cells. Science 2004; 305: 1289–92.

14 Suzuki K, Juelich T, Lim H et al. Closed chromatin architecture is inducedby an RNA duplex targeting the HIV-1 promoter region. J Biol Chem 2008;283: 23353–63.

15 Hawkins PG, Santoso S, Adams C et al. Promoter targeted small RNAsinduce long-term transcriptional gene silencing in human cells. NucleicAcids Res 2009; 37: 2984–95.

16 Janowski BA, Huffman KE, Schwartz JC et al. Involvement of AGO1 andAGO2 in mammalian transcriptional silencing. Nat Struct Mol Biol 2006; 13:787–92.

17 Kim DH, Villeneuve LM, Morris KV et al. Argonaute-1 directssiRNA-mediated transcriptional gene silencing in human cells. Nat StructMol Biol 2006; 13: 793–7.

18 Morris KV. Long antisense non-coding RNAs function to direct epigeneticcomplexes that regulate transcription in human cells. Epigenetics 2009; 4:296–301.

Singh et al.










19 Palanichamy JK, Mehndiratta M, Bhagat M et al. Silencing of integratedhuman papillomavirus-16 oncogenes by small interfering RNA-mediatedheterochromatization. Mol Cancer Ther 2010; 9: 2114–22.

20 Geretti AM. HIV-1 subtypes: epidemiology and significance for HIVmanagement. Curr Opin Infect Dis 2006; 19: 1–7.

21 Arien KK, Vanham G, Arts EJ. Is HIV-1 evolving to a less virulent form inhumans? Nat Rev Microbiol 2007; 5: 141–51.

22 Hemelaar J, Gouws E, Ghys PD et al. Global and regional distribution ofHIV-1 genetic subtypes and recombinants in 2004. AIDS 2006; 20:W13–23.

23 Suzuki K, Ishida T, Yamagishi M et al. Transcriptional gene silencing ofHIV-1 through promoter targeted RNA is highly specific. RNA Biol 2011; 8:1035–46.

24 Suzuki K, Shijuuku T, Fukamachi T et al. Prolonged transcriptionalsilencing and CpG methylation induced by siRNAs targeted to the HIV-1promoter region. J RNAi Gene Silencing 2005; 1: 66–78.

25 Turner AMW, De La Cruz J, Morris KV. Mobilization-competentlentiviral vector-mediated sustained transcriptional modulation of HIV-1expression. Mol Ther 2008; 17: 360–8.

26 Mehndiratta M, Palanichamy JK, Pal A et al. CpG hypermethylation of theC-myc promoter by dsRNA results in growth suppression. Mol Pharm 2011;8: 2302–9.

27 Siddappa NB, Kashi VP, Venkatramanan M et al. Gene expressionanalysis from human immunodeficiency virus type 1 subtype C promoterand construction of bicistronic reporter vectors. AIDS Res HumRetroviruses 2007; 23: 1268–78.

28 Vandesompele J, De Preter K, Pattyn F et al. Accurate normalization ofreal-time quantitative RT-PCR data by geometric averaging of multipleinternal control genes. Genome Biol 2002; 3: research0034.

29 Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool(REST) for group-wise comparison and statistical analysis of relativeexpression results in real-time PCR. Nucleic Acids Res 2002; 30: e36.

30 Graffmann N, Santourlidis S, Christ J et al. Direct and quantitativeanalysis of chromatin accessibility by MIRECAL–a Micrococcus nuclease/real-time PCR chromatin accessibility assay with locus specificity. AnalBiochem 2006; 354: 308–10.

31 Haring M, Offermann S, Danker Tet al. Chromatin immunoprecipitation:optimization, quantitative analysis and data normalization. Plant Methods2007; 3: 11.

32 Conley AJ, Gorny MK, Kessler JA et al. Neutralization of primary humanimmunodeficiency virus type 1 isolates by the broadly reactive anti-V3monoclonal antibody, 447–52D. J Virol 1994; 68: 6994–7000.

33 Sledz CA, Holko M, De Veer MJ et al. Activation of the interferon system byshort-interfering RNAs. Nat Cell Biol 2003; 5: 834–9.

34 Sioud M. Innate sensing of self and non-self RNAs by Toll-like receptors.Trends in Molecular Medicine 2006; 12: 167–76.

35 Fish RJ, Kruithof EKO. Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors. BMC Mol Biol2004; 5: 9.

36 Verdin E, Paras P Jr, Van Lint C. Chromatin disruption in the promoter ofhuman immunodeficiency virus type 1 during transcriptional activation.EMBO J 1993; 12: 3249–59.

37 Van Lint C, Emiliani S, Ott M et al. Transcriptional activation andchromatin remodeling of the HIV-1 promoter in response to histoneacetylation. EMBO J 1996; 15: 1112–20.

38 Schiralli Lester GM, Henderson AJ. Mechanisms of HIV transcriptionalregulation and their contribution to latency. Mol Biol Int 2012; 2012: 1–11.

39 Badley AD, Pilon AA, Landay A et al. Mechanisms of HIV-associatedlymphocyte apoptosis. Blood 2000; 96: 2951–64.

40 Cummins NW, Badley AD. Mechanisms of HIV-associated lymphocyteapoptosis: 2010. Cell Death Dis 2010; 1: e99.

41 Morris KV, Chung CH, Witke W et al. Inhibition of HIV-1 replication bysiRNA targeting conserved regions of gag/pol. RNA Biol 2005; 2: 17–20.

42 Novina CD, Murray MF, Dykxhoorn DM et al. siRNA-directed inhibition ofHIV-1 infection. Nat Med 2002; 8: 681–6.

43 Lee NS, Dohjima T, Bauer G et al. Expression of small interfering RNAstargeted against HIV-1 rev transcripts in human cells. Nat Biotechnol2002; 20: 500–5.

44 Das AT, Brummelkamp TR, Westerhout EM et al. Human immuno-deficiency virus type 1 escapes from RNA interference-mediatedinhibition. J Virol 2004; 78: 2601–5.

45 Yamagishi M, Ishida T, Miyake A et al. Retroviral delivery of promoter-targeted shRNA induces long-term silencing of HIV-1 transcription.Microbes Infect 2009; 11: 500–8.

46 Turner A-MW, Ackley AM, Matrone MA et al. Characterization of anHIV-targeted transcriptional gene-silencing RNA in primary cells. HumGene Ther 2012; 23: 473–83.


415

JAC


long-term suppression of hiv-1c virus production in human

Documents