ORIGINAL ARTICLE

Loblolly pine arginase responds to arginine in vitro

Received: 17 December 2002 / Accepted: 19 February 2003 / Published online: 1 April 2003� Springer-Verlag 2003

Abstract Following germination of loblolly pine (Pinustaeda L.) seeds, storage proteins in the embryo andmegagametophyte are broken down to provide nitrogen,in the form of amino acids, to the developing seedling. Asubstantial portion of the free amino acids released inthis process is arginine. Arginine is hydrolyzed in thecotyledons of the seedling by the enzyme arginase (EC3.5.3.1), which is under developmental control. It hasbeen shown previously that the seedling is able to initiatearginase gene expression in vitro in the absence of themegagametophyte, however, presence of the megaga-metophyte causes a greater accumulation of arginaseprotein and mRNA. Using an in vitro culture system weshow that arginine itself may be responsible forup-regulating arginase activity. Application of exoge-nous arginine to cotyledons of seedlings germinated inthe absence of the megagametophyte caused an increasein total shoot pole arginase activity as well as arginasespecific activity. Arginine was also able to inducearginase mRNA accumulation in the same tissue.

Keywords Arginase Æ Arginine Æ Loblolly pine tissueculture Æ Pinus taeda Æ Seedling development

Abbreviations DIC30: days in culture at30�C Æ DIC30+M: days in culture at 30�C in thepresence of the megagametophyte Æ DIC30)M: days inculture at 30�C in the absence of the megagametophyte

Introduction

In the loblolly pine seed, the majority of the seed storageproteins are found in the haploid megagametophytetissue surrounding the diploid embryo. The megaga-metophyte tissue contains 85% of these proteins, theremainder being distributed throughout the embryo(Groome et al. 1991, Stone and Gifford 1997). Seedstorage proteins of conifers are typically rich in theamino acid arginine. In loblolly pine seeds arginineaccounts for 23.4 molar % of the amino acids andapproximately half of the total nitrogen in the megaga-metophytic storage proteins (King and Gifford 1997).Other conifers are similar in this regard including mar-itime pine (Pinus pinaster) (Allona et al. 1994), jack pine(Pinus banksianna) (Durzan and Chalupa 1968; Ramiahet al. 1971), Eastern white pine (Pinus strobus)(Feirer 1995), and Douglas fir (Pseudotsuga menziesii)(Feirer 1995).

Following germination, the megagametophyte seedstorage proteins are broken down releasing free aminoacids (Groome et al. 1991; King and Gifford 1997).These amino acids, including arginine, do not accumu-late in the megagametophyte, but are moved across thecorrosion cavity to the embryo where arginine levelsincrease in the seedling throughout early seedling growth(King and Gifford 1997). Storage protein hydrolysis inthe megagametophyte continues until the proteinreserves have been exhausted and the products moved tothe seedling (Stone and Gifford 1997). The embryonicseed storage proteins also break down following germi-nation, generating seedling-derived free amino acids.Interestingly, storage protein hydrolysis in the seedlingappears to occur independently of the same processoccurring in the megagametophyte (Todd and Gifford2002).

In order for the nitrogen stored within arginine tobe utilized by the plant it must first be metabolized byarginase (L-arginine amidinohydrolase, EC 3.5.3.1),forming urea and the non-protein amino acid

Planta (2003) 217: 610–615DOI 10.1007/s00425-003-1022-7

Christopher D. Todd Æ David J Gifford

C.D. Todd (&) Æ D.J. GiffordDepartment of Biological Sciences,University of Alberta, CW 405,Biological Sciences Building,Edmonton, Alberta, T6G 2E9, CanadaE-mail: toddc@missouri.eduTel.: +1-573-8847151

Present address: C.D. ToddDepartment of Biochemistry,University of Missouri — Columbia,117 Schweitzer Hall, Columbia, MO 65211, USA

ornithine. Urea is broken down by the enzyme urease(urea amidohydrolase, EC 3.5.1.5) to produce am-monia and carbon dioxide. The resulting ammoniumcan then be assimilated through the action of gluta-mine synthetase (GS; EC 6.3.1.2) (Miflin and Lea1976; Lea and Ireland 1999). In conifer seedlings thisoccurs through the action of two cytosolic forms ofGS (Avila et al. 1998; Canovas et al. 1998). Ornithinecan undergo several different metabolic conversionsresulting in production of glutamate, proline or poly-amines (Verma and Zhang 1999).

Regulation of plant arginases following germinationis still not understood well. To date, only three fulllength plant arginase cDNAs have been reported,those for Arabidopsis (Krumpleman et al. 1995),soybean (Goldraij et al. 1998) and loblolly pine (Toddet al. 2001b). It has been demonstrated that increasesin arginase activity following germination of soybeanis matched by an increase in arginase mRNA levels(Goldraij and Polacco 1999). In loblolly pine, arginaseenzyme activity increases following germination and istemporally coordinated with break-down of the seedstorage proteins and increases in the seedling freeamino acid pool (King and Gifford 1997). Arginaseprotein and transcript levels also increase during thesame time period (Todd et al. 2001b). Loblolly pinearginase activity, protein accumulation and geneexpression are localized primarily in the shoot pole,the expanding cotyledons and shoot apices, whichremain in contact with the megagametophytethroughout early seedling growth until the megaga-metophytic storage reserves are exhausted (King andGifford 1997; Todd et al. 2001a, 2001b). This suggeststhat arginase is involved in metabolizing arginine forstorage or transport throughout the plant. Likewise, aconsiderable asparagine pool accumulates in loblollypine seedlings during early seedling growth (King andGifford 1997), consistent with a model for coniferseedling nitrogen utilization that was proposed byAvila et al. (2001).

Using an in vitro culture system we have demon-strated previously that arginase gene expression is ableto be induced within the embryo itself without inputfrom the megagametophyte, but that presence of themegagametophyte up-regulates arginase expressionduring the later stages of early seedling growth (Toddand Gifford 2002). Here we utilize the same in vitrosystem to examine the role of free arginine in the regu-lation of arginase activity and gene expression.

Materials and methods

Seed material and culture conditions

Loblolly pine seed was a gift from Mead-Westvaco (Summerville,S.C.) and was stored at )20�C until use. Seeds were surface ster-ilized as described in Todd et al. (2001b) prior to dissection. Matureembryos were cultured with and without their associated megaga-metophytes as described in Todd and Gifford (2002).

Application of exogenous arginine to in vitro grown seedlings

After 6 days in culture at 30�C (DIC30), seedlings were misted witha 100 mM arginine solution (pH 7.5) until the cotyledons werecovered with a thin layer of solution. Previous experiments deter-mined that this concentration was optimal for eliciting a response(data not shown). Seedlings were incubated in the presence of theexogenous arginine for up to 24 h before being collected asdescribed above. Control seedlings were sprayed with de-ionizedwater.

Assay of cell-free arginase activity

Arginase activity in cell-free extracts was assayed as described byKing and Gifford (1997). Extracts were prepared as describedpreviously (Todd and Gifford 2002). For each assay a fresh ureastandard curve (0–20 lg/ml) was prepared immediately prior touse. Enzyme activity is expressed in nkat.

RNA extraction and Northern analysis and RT-PCR

RNA extraction, electrophoresis and Northern analysis was per-formed as described in Todd and Gifford (2002). Signals were de-tected on Kodak X-OMAT AR film. RT-PCR was performedusing a Qiagen OneStep RT-PCR kit in a MJ Research minicycler(MJ Research, Watertown, Mass.) according to the manufacturer’sinstructions. The primer sequences 5¢CCGCGACTGAGAAAGGGAAAGAATTG and 5¢CCAGGTGCAAATGCCGGATCAAG were used to amplify a 510-bp arginase fragment in amultiplex RT-PCR reaction using the primers 5¢TGCTGAAATGTGCTAAGAGATGCCAAGAT and 5¢CTTAGTGGTGGTTCTACCATGTTTCCTGG to co-amplify a 260-bp fragment of aloblolly pine b-actin gene (GenBank accession no. AY172979).RT-PCR was performed from 10 ng shoot pole total RNA. Thereaction conditions consisted of a 30-min reverse transcription stepat 50�C followed by 15 min at 95�C to denature the reverse tran-scriptases and activate the thermostable polymerase. Amplificationwas achieved from 30 cycles consisting of 1 min at 94�C, 1 min at57�C and 1 min at 72�C. A final extension step at 72�C for 10 minwas performed and the products were held at 4�C until they wereseparated on a 1% agarose gel and visualized by ethidium bromidestaining. Conditions were optimized for amplification and visual-ization of the 0 mM arginine-treated sample.

Protein extraction and quantification, SDS-PAGE,and immunoblotting

Protein extraction was performed as described in Groome et al.(1991). Extracted protein was quantified by the method of Lowry etal. (1951) using bovine serum albumin as the standard. Proteinseparation by SDS-PAGE, immunoblotting and chemiluminescentdetection was performed as described in Todd and Gifford (2002).

Results and discussion

Growth of seedlings in culture

Intact embryos were cultured as de-coated seeds(embryo+megagametophyte; +M) or as isolatedembryos (embryo alone; )M) as described in Todd andGifford (2002). Germination was completed after2 DIC30+M and 2 DIC30)M. In culture, the megaga-metophyte storage proteins break down followinggermination and are exhausted between 8 and 10 DIC30

611

(Todd and Gifford 2002). By 10 DIC30 the megaga-metophyte reserves have been depleted and the tissue isshed from the cotyledons (Fig. 1a). Absence of themegagametophyte had a marked negative influence onboth seedling length (Fig. 1) and fresh weight (Todd andGifford 2002).

We chose 6 DIC30 as the stage to do our manipula-tions for three reasons. First, after 6 days in culture theembryonic storage proteins have been exhausted (Toddand Gifford 2002), therefore any additional arginineaccumulating in the embryo is likely from an externalsource (megagametophyte or experimental manipula-tions). Secondly, by 6 DIC30+M, the cotyledons havenot yet expanded out of the megagametophyte (Fig. 1a).Free amino acids from the megagametophyte areabsorbed throughout the shoot pole (cotyledons plusshoot apices). Though those seedlings cultured with themegagametophyte showed greater radicle extension, at

this stage the shoot pole is of similar size in seedlingsgrown with or without the megagametophyte since thecotyledons have not yet elongated (Fig. 1a). Mostimportantly, after 6 days in the presence of the mega-gametophyte (6 DIC30+M), arginase transcript is mostabundant, but in the absence of the megagametophyte(6 DIC30)M), arginase transcript is extremely low(Todd and Gifford 2002). This allows us to look at thesame tissue, at the same age, in which arginase geneexpression is either very high (6 DIC30+M) or low(6 DIC30)M).

Maintenance of arginase gene expression by arginine

It has been shown previously that removal of themegagametophyte tissue from loblolly pine seedlingsgrown in vitro caused a substantial decrease in arginasetranscript abundance. Arginase mRNA was undetect-able between 12 and 24 h after megagametophyteremoval (Todd and Gifford 2002). To test the hypothesisthat this decrease was due to lack of arginine influx fromthe megagametophyte, seedlings were cultured for6 days in the presence of the megagametophyte tissueand then had their associated megagametophyte tissuesremoved. Seedlings were sprayed with water or 100 mMarginine, incubated for 12–24 h and total shoot poleRNA was extracted. Arginase transcript levels weredetected by Northern blotting (Fig. 2). After 24 h in theabsence of the megagametophyte, no arginase messagewas detected in those seedlings sprayed with water(Fig. 2, lane B); however, after 12 h in contact with

Fig. 1a, b Growth of seedlings with and without megagameto-phytes. a Left to right 4–10 days in culture at 30�C (DIC30)seedlings cultured with (top, +M) and without the megagameto-phyte (bottom, )M). DIC indicated along the bottom. Scalebar=1.0 cm. b Increases in seedling length are shown in thepresence (d) and absence (s) of the megagametophyte tissue underculture conditions at 30�C. Mean seedling length is expressed incm±SE

Fig. 2 Effect of arginine on transcript abundance after megaga-metophyte removal. Megagametophytes were removed after6 DIC30 and then seedlings were sprayed with 100 mM arginineor water. Lane A Shoot pole transcript abundance after6 DIC30+M. Lane B Transcript abundance 24 h after megaga-metophyte removal when sprayed with water. Lane C Transcriptabundance 12 h after megagametophyte removal and argininespraying; lane D transcript abundance 24 h after megagameto-phyte removal and arginine spraying. RNA was ethidium bromidestained following electrophoresis to ensure RNA integrity andequal loading (shown below); 10 lg total RNA loaded per lane. Blotdepicted is a representative of additional blots performed withindependent RNA samples

612

100 mM arginine, arginase transcript levels were stillobserved (Fig. 2, lane C) and remained so for up to 24 h(Fig. 2, lane D).

Induction of arginase by arginine

Since arginine is able to partially substitute for themegagametophyte in maintaining arginase transcriptabundance in the shoot pole we investigated if arginine isable to induce arginase in tissues where arginase activityand gene expression is low. Isolated embryos were cul-tured for 6 days in the absence of the megagametophyte(6 DIC30)M). It has been shown previously in the ab-sence of the megagametophyte tissue, that after 6 daysthe embryonic storage protein reserves have beenexhausted and that arginase gene expression hasdeclined to near zero (Todd and Gifford 2002). After6 days the seedlings were sprayed with 100 mM argi-nine, collected 24 h later and assayed for shoot polearginase enzyme activity, protein levels and transcriptabundance.

Addition of 100 mM arginine caused a 78% increasein total arginase activity in the tissue (Fig. 3a) and a65% increase in arginase specific activity (Fig. 3b).There was only a minor increase in arginase proteinlevels in the shoot pole (Fig. 3c). However, it is impor-tant to note that though enzyme activity and mRNA arelow in these seedlings, arginase protein is still relativelyabundant. This is consistent with out previous obser-vations in loblolly pine seedlings, both in vitro (Toddand Gifford 2002) and in seedlings germinated from seed(Todd et al. 2001b). This long-lived protein may be post-translationally down-regulated or inactivated as thestorage reserves and seedling arginine pools are depleted(Todd et al. 2001b).

After culturing for 6 days in culture in the absence ofthe megagametophyte and sprayed with water, little orno arginase mRNA was detectable by Northern blotting(Fig. 4a). A very low level of arginase message wasdetected by RT-PCR (Fig. 4b). Spraying the seedlingswith 100 mM arginine caused an increase in arginasetranscript abundance in the shoot pole, observable witheither detection method, but did not cause an increase inoverall gene expression as demonstrated by the intensityof the co-amplified internal control (Fig. 4b).

In previous work we have demonstrated that thepresence of the megagametophyte acts as a positiveregulator of arginase gene expression, increasing argin-ase mRNA during the latter stages of early seedlinggrowth, presumably by continuing to supply argininefrom the megagametophyte to the cotyledons (Todd andGifford 2002). Here we have shown that when themegagametophyte is removed the rapid decline inarginase transcript is mitigated by replacing the mega-gametophyte tissue with arginine (Fig. 2). Disappear-ance of the arginase message in the absence of themegagametophyte may be attributed to the depletion ofthe seedling’s arginine pool. It appears that the enzyme’s

substrate, arginine, is sufficient to maintain steady statearginase mRNA levels, likely due to maintaining higharginine levels in the shoot pole.

When isolated embryos are cultured without themegagametophyte, enzymatic activity and mRNA levelsare low when compared to those seedlings grown in thepresence of the megagametophyte, though significantprotein remains in the tissue, having accumulatedimmediately following germination (Todd and Gifford2002). Typically, arginase protein levels remain high in

Fig. 3a, b Effect of arginine on arginase activity. Seedlings weregrown for 6 days in culture in the absence of the megagametophyte(6 DIC30)M) and then sprayed with either water (0 mM) or100 mM arginine and sampled after 24 h. a Arginase enzymeactivity per seed part (cotyledons plus shoot apex) in nkat.b Arginase specific activity in nkat (mg protein)-1. Values showndetermined from two independent experiments each assayed induplicate+SE. c Arginase protein levels, 6 lg protein loaded perlane. Primary antibody dilution used was 1:15 000. Blot shown is arepresentative of additional blots performed with independentprotein samples

613

the tissue after the message declines, suggesting a slowprotein turnover rate (Todd et al. 2001b; Todd andGifford 2002). This residual protein may be present in aninactive or partially inactive form and may be a mech-anism to avoid a futile urea cycle (Polacco and Holland1993; Goldraij and Polacco 1999). When arginine wassupplied to seedlings cultured in the absence of themegagametophyte tissue (6 DIC30)M) arginase enzymeand transcript levels increased, with a very small increasein protein levels (Figs. 3, 4). The increase in enzymaticactivity observed may be due, in part, to activation ofpre-existent arginase protein. This is similar to the lichenEvernia prunasti, where the presence of arginine upre-gulates the activity of a constitutively expressed arginase(Martin-Falquina and Legaz 1984). Arginine also clearlyinduced the accumulation of arginase transcript (Fig. 4),as occurs in some fungal systems where arginase geneexpression is induced in response to cellular argininelevels (Davis 1986).

Yu and Cho (1997) have shown that soybean axesincubated with exogenous arginine show substantial in-creases in arginase activity. Goldraij and Polacco (1999)reported that arginase is not induced by arginine insoybean cotyledons during seed development, though alow level arginase activity must be present, as demon-strated by urea accumulation in urease negative seed-lings. These two studies utilized different tissues(cotyledons vs. axes) and different developmental stagesand neither study examined arginase response to argi-nine at the molecular level. The data generated using

cultured pine embryos clearly demonstrate that argininecauses an induction of arginase at both the enzymaticand transcriptional level following seed germination.This is the first direct experimental evidence of thisrelationship in plants.

We have previously proposed a model of arginaseregulation whereby arginine derived from embryonicseed storage proteins induces arginase following germi-nation and arginine derived from megagametophyticstorage protein breakdown is responsible for up-regu-lating arginase during the latter stages of early seedlinggrowth. No specific signal is required from the megaga-metophyte in order to initiate arginase gene expression inthe seedling (Todd and Gifford 2002). That arginase islocated primarily in the cotyledons, rather thanthroughout the seedling, suggests that arginine metabo-lism is required prior to movement of arginine-derivednitrogen throughout the plant, supporting the model ofAvila et al. (2001). Here we have clearly demonstratedthat arginine itself is capable of both maintainingarginase RNA levels in tissues where the message is rel-atively abundant as well as inducing arginase transcriptaccumulation when steady state levels are low. It appearsthat arginase responds directly to tissue arginine levels,possibly at both molecular and biochemical levels. Thenature and specificity of this interaction will be the sub-ject of further study. Having identified an inducibleconifer gene, which is also developmentally regulated, weare currently endeavoring to isolate the loblolly pinearginase promoter and determine the mechanismthrough which this activation occurs.

Acknowledgements This work was supported by a Natural Sciencesand Engineering Research Council of Canada grant(no. OGP0002240) to D. J. G.; C. D. T. was the recipient of aNatural Sciences and Engineering Research Council Postgraduatescholarship and an I. W. Killam Memorial Scholarship from theUniversity of Alberta.

References

Allona I, Collada C, Casado R, Aragoncillo C (1994) 2S arginine-rich proteins from Pinus pinaster seeds. Tree Physiol 14:211–218

Avila C, Garcia-Gutierez A, Crespillo R, Canovas FM (1998)Effects of phosphoinotricin treatment on glutamine synthetaseisoforms in Scots pine seedlings. Plant Physiol Biochem 36:857–863

Avila C, Suarez MF, Gomez-Maldonado J, Canovas FM (2001)Spatial and temporal expression of two cytosolic glutaminesynthetase genes in Scots pine: functional implications on ni-trogen metabolism during early stages of conifer development.Plant J 25:93–102

Canovas FM, Canton FR, Garcıa-Gutierrez A, Gallardo F,Crespillo R (1998) Molecular physiology of glutamine andglutamate biosynthesis in developing conifer seedlings. PhysiolPlant 103:287–294

Davis RH (1986) Compartmental and regulatory mechanisms inthe arginine pathways of Neurospora crassa and Saccharomycescerevisiae. Microbiol Rev 50:280–313

Durzan DJ, Chalupa V (1968) Free sugars, amino acids, and sol-uble proteins in the embryo and female gametophyte of jackpine as related to climate at the seed source. Can J Bot 46:417–428

Fig. 4a, b Induction of arginase by arginine. a Northern blot fromwater sprayed (0 mM) and 100 mM arginine sprayed 6 DIC30)Mshoot pole total RNA; 10 lg loaded per lane. RNA was ethidiumbromide stained following electrophoresis to ensure RNA integrityand equal loading (not shown). b Multiplex RT-PCR of the samesamples from 10 ng total RNA showing 510-bp arginase fragmentand 260-bp actin fragment. Data shown are representative ofadditional experiments performed with independent RNA samples

614

Feirer RP (1995) The biochemistry of conifer embryo development:amino acids, polyamines and storage proteins. In: Jain S, GuptaPK, Newton R (eds) Somatic embryogenesis in woody plants,vol 1. Kluwer, Dordrecht, pp 317–336

Goldraij A, Polacco JC (1999) Arginase is inoperative in develop-ing soybean embryos. Plant Physiol 119:297–303

Goldraij A, Coello P, Polacco J (1998) Nucleotide sequence of acDNA encoding a soybean axes arginase (accession no.AF035671) (PGR98–016). Plant Physiol 116:87

Groome MC, Axler SR, Gifford DJ (1991) Hydrolysis of lipid andprotein reserves in loblolly pine seeds in relation to proteinelectrophoretic patterns following imbibition. Physiol Plant83:99–106

King JE, Gifford DJ (1997) Amino acid utilization in seeds ofloblolly pine during germination and early seedling growth. I.Arginine and arginase activity. Plant Physiol 113:1125–1135.

Krumpelman PM, Freyermuth SK, Cannon JF, Fink GR, PolaccoJC (1995) Nucleotide sequence of Arabidopsis thaliana arginaseexpressed in yeast. Plant Physiol 107:1479–1480

Lea PJ, Ireland RJ (1999) Nitrogen metabolism in higher plants.In: Singh BK (ed) Plant amino acids: biochemistry and bio-technology. Dekker, New York, pp 1–47

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Proteinmeasurement with the Folin phenol reagent. J Biol Chem193:265–275

Martin-Falquina A, Legaz ME (1984) Purification and propertiesof the constitutive arginase of Evernia prunasti. Plant Physiol76:1065–1069

Mifflin BJ, Lea PJ (1976) The pathway of nitrogen assimilation inplants. Phytochemistry 15:873–885

Polacco JC, Holland, MA (1993) Roles of urease in plant cells. IntRev Cytol 145:65–103

Ramiah PK, Durzan DJ, Mia AJ (1971) Amino acids, solubleproteins, and isozyme patterns of peroxidase during the ger-mination of jack pine. Can J Bot 49:2151–2161

Stone SL, Gifford DJ (1997) Structural and biochemical changes inloblolly pine (Pinus taeda L.) seeds during germination andearly seedling growth. I. Storage protein reserves. Int J Plant Sci158:727–737

Todd CD, Gifford DJ (2002) The role of the megagametophyte inmaintaining loblolly pine (Pinus taeda L.) seedling arginasegene expression in vitro. Planta 215:110–118

Todd CD, Cooke JEK, Gifford DJ (2001a) Purification andproperties of loblolly pine (Pinus taeda L.) arginase from ger-minated seedlings. Plant Physiol Biochem 39:1037–1045

Todd CD, Cooke JEK, Mullen RT, Gifford DJ (2001b) Regulationof loblolly pine (Pinus taeda L.) arginase in developing seedlingtissue during germination and early seedling growth. Plant MolBiol 45:555–565

Verma DPS, Zhang C (1999) Regulation of proline and argininebiosynthesis in plants. In: Singh BK (ed) Plant aminoacids: biochemistry and biotechnology. Dekker, New York,pp 249–265

Yu GH, Cho YD (1990) Relationship between induced arginaseactivity and the level of free amino acids and polyamines in theexcised embryonic axes of germinating soybean seeds. J PlantPhysiol 153:226–229

615