lithium inhibits tumorigenic potential of pda cells ... · lithium inhibits tumorigenic potential...

Lithium Inhibits Tumorigenic Potential of PDA Cellsthrough Targeting Hedgehog-GLI Signaling PathwayZhonglu Peng1, Zhengyu Ji2¤, Fang Mei2, Meiling Lu1, Yu Ou1*, Xiaodong Cheng2*

1 State Key Laboratory of Natural Medicines and School of Life Science and Technology, China Pharmaceutical University, Nanjing, China, 2Department of Pharmacology

and Toxicology, The University of Texas Medical Branch, Galveston, Texas, United States of America

Abstract

Hedgehog signaling pathway plays a critical role in the initiation and development of pancreatic ductal adenocarcinoma(PDA) and represents an attractive target for PDA treatment. Lithium, a clinical mood stabilizer for mental disorders,potently inhibits the activity of glycogen synthase kinase 3b (GSK3b) that promotes the ubiquitin-dependent proteasomedegradation of GLI1, an important downstream component of hedgehog signaling. Herein, we report that lithium inhibitscell proliferation, blocks G1/S cell-cycle progression, induces cell apoptosis and suppresses tumorigenic potential of PDAcells through down-regulation of the expression and activity of GLI1. Moreover, lithium synergistically enhances the anti-cancer effect of gemcitabine. These findings further our knowledge of mechanisms of action for lithium and providea potentially new therapeutic strategy for PDA through targeting GLI1.

Citation: Peng Z, Ji Z, Mei F, Lu M, Ou Y, et al. (2013) Lithium Inhibits Tumorigenic Potential of PDA Cells through Targeting Hedgehog-GLI SignalingPathway. PLoS ONE 8(4): e61457. doi:10.1371/journal.pone.0061457

Editor: Jingwu Xie, Indiana University School of Medicine, United States of America

Received January 26, 2013; Accepted March 9, 2013; Published April 23, 2013

Copyright: � 2013 Peng et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work is supported by the ‘‘111 Project’’ from the Ministry of Education of China. The funders had no role in study design, data collection andanalysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected] (XC); [email protected] (YO)

¤ Current address: Wellman Center for Photomedicine, Massachusetts General Hospital, Boston, Massachusetts, United States of America

Introduction

Pancreatic ductal adenocarcinoma (PDA), characterized by

extreme aggressiveness, poor prognosis and high lethality, stands

as the fourth leading cause of cancer-related death in the United

States and shows little improvement in survival over the past 30

years [1]. PDA is reflective to current chemotherapeutic treat-

ments as agents effective for other cancer types offer very limited

survival benefit for PDA patients [2,3,4,5,6]. Surgical resection

and gemcitabine chemotherapy are the main clinical treatment

options for PDA patients based on the stage of diagnosis. Five-year

relative survival rate for ,20% of the PDA patients feasible for

surgical resection is less than 20%, while the five-year relative

survival rate of all stages patients is less than 6% [1,7]. Therefore,

a better understanding of PDA pathophysiology and the de-

velopment of novel therapeutic options are urgently needed.

Hedgehog signaling pathway (Hh pathway), initially discovered

in Drosophila to be important for the development of fruit fly body

fragmentation, is a key regulator of animal development [8,9].

This pathway in human starts with an intercellular ligand,

hedgehog (HH) molecule, from autocrine and paracrine secretion.

In the absence of HH ligand, a membrane receptor protein called

patched (PTCH) represses the activity of another transmembrane

receptor smoothened (SMO). Binding of HH ligand to PTCH

releases the repression of SMO by the PTCH, and transduces the

extracellular signal by activating downstream GLI zinc finger

transcription factors 1 (GLI1), a hallmark of the activation of Hh

pathway [10,11].

Abnormal activation of the Hh pathway promotes the growth,

proliferation, migration, invasion, angiogenesis and tumorigenic

potential of cancer cells, and has been implicated in many human

cancers [12,13]. In pancreatic cancer patients, dysregulation of Hh

pathway is not only present in PDA, but also in its precursor,

pancreatic intraepithelial neoplasia (PanIN), suggesting that this

pathway is an important early and late mediator of pancreatic

cancer tumorigenesis [14]. Moreover, abnormal activation of the

Hh pathway can be enhanced and sustained by mutations in key

components of the canonical Hh pathway or by abnormal HH

ligand in tumor microenvironment, as well as from noncanonical

‘‘cross talking’’ between Hh pathway and other pathways, such as

the RAS/RAF/MEK/ERK pathway [15,16]. Aberrant Hh

pathway plays critical roles in the occurrence and development

of epithelial mesenchymal transition (EMT) [17], oncogenic

transformation and angiogenesis [18] in PDA. While suppression

of Hh pathway by SMO inhibitors such as cyclopamine has been

used as a therapeutic strategy for cancer, a significant fraction of

GLI1 activation in PDA is driven by a SMO-independent

mechanism [19], suggesting that direct inhibition of GLI1 protein

may be a more effective route to suppress Hh pathway activation

[20,21] in PDA.

Lithium ions, a classical mood stabilizer, have been used in the

clinical treatment of bipolar disorder and other mental disorders

for more than half a century [22]. Lithium acts on a panel of

molecular targets, majority of which are metal-dependent en-

zymes, such as glycogen synthase kinase 3 (GSK3a and GSK3b)[23,24,25], protein kinase B (PKB) [25], inositol monophosphatase

(IMPase) [26], phosphoglucomutase [26] and bisphosphate 39-

nucleotidase (BPNT1) [27], presumably via direct competition

with Mg2+ [28]. Although lithium is mainly used to treat mental

disorders, it targets not only the nerve cells. Several reports have

PLOS ONE | www.plosone.org 1 April 2013 | Volume 8 | Issue 4 | e61457

shown that lithium salts are effective for inhibiting glioma cell [29],

colorectal cancer cell [30], medulloblastoma cell [31], hepatocel-

lular carcinoma cell [32] and other cancer cells [33]. In fact, it has

been suggested that lower cancer prevalence observed in mental

patients is likely due to benefit from protection of lithium

treatment [34]. At the molecular level, lithium has been shown

to inhibit the growth and/or tumorigenicity of cancer cells by

modulating the biologic activities of many cancer related genes, for

example, STAT3 [35], b-catenin/WNT [30,31], TNF [33] and

FASL [36], and P53 [37].

In this study, we report that lithium inhibits cell proliferation

and tumorigenic potential of PDA cells in vitro through suppressing

the stability of GLI1 protein. Moreover, lithium synergizes the

efficacy of gemcitabine on PDA. These novel findings expand our

knowledge of lithium’s biological functions and provide a new

therapeutic potential of lithium for the treatment of PDA.

Results

Lithium Inhibited Cell Proliferation and ImpairedTumorigenic Potential of PDA CellsTo investigate the effect of lithium on PDA cell proliferation,

PANC-1 and AsPC-1 cells were treated with different doses of

lithium chloride for one to three days and cells viabilities were

determined. As shown in Figure 1A & B, treatment with lithium

chloride, but not sodium chloride, markedly inhibited the

proliferation of PANC-1 and AsPC-1 cells in a dose- and time-

dependent manner. To further test if lithium treatment inhibits the

tumorigenic potential of PDA cells, we performed colony

formation assay, which is a test for oncogenic transformation

in vitro. We observed that cell colonies were fewer and smaller for

PANC-1 treated with lithium chloride than those from the control

group with identical sodium chloride concentration in a doses-

dependent manner (Fig. 1C).

Lithium Induced Apoptosis and Cell Cycle Arrest of PDACellsTo test the effects of lithium on cell cycle progression and

survival of PDA cells, we performed flow cytometric analyses of

PANC-1 and AsPC-1 cells after 12 hours and 24 hours treatment

with 20 mM lithium chloride. As shown in Figure 2, lithiumchloride treatment led to a significant increase in S-phase cell

population and a decrease in population of G0/G1 phase in a time-

dependent manner. Similarly, the percentage of apoptotic PDA

cells was increased by lithium chloride treatment in a time-

dependent manner (Fig. 3). These data suggested that growth

inhibition of PDA cells by lithium was at least partly due to S-

phase cell cycle arrest and apoptosis.

Lithium Repressed Hedgehog Signaling ActivityAbnormal Hh pathway plays an important role in PDA

initiation and development. To determine whether lithium

suppresses PDA cell proliferation through modulating the activity

of Hh pathway, PANC-1 cells were treated with different

concentrations of lithium chloride (10 mM, 20 mM, 40 mM) for

24 hours, and real-time PCR was carried out to monitor the

expression levels of SHH, PTCH1, SMO, FU, SUFU, GLI1 and Hh

pathway target gene HHIP and CCND1. As shown in Figure 4A,the mRNA levels of HHIP, CCND1 and PTCH1 were markedly

decreased, suggesting that the activity of Hh pathway was

downregulated. This is consistent with the fact that the expression

of SHH, SMO and GLI1, the positive regulators of Hh pathway,

were also significantly reduced. On the other hand, the expression

of FU and SUFU were not significantly influenced by lithium

treatment. To determine if lithium was capable of repressing Hh

pathway directly, GLI-mediated luciferase activity was monitored,

and the results showed that GLI-luciferase activities decreased in

response to lithium treatment in a doses-dependent manner in

AsPC-1 cells (Fig. 4B).

Lithium Modulated the Cellular Protein Levels of GLI1To determine if lithium suppressed Hh pathway through

modulating the cellular expression of GLI1, endogenous GLI1

proteins in PANC-1 cell were monitored using anti-GLI1

antibody. Immunoblotting analysis showed that endogenous

GLI1 level was decreased in PANC-1 cell after 18 hours of

treatment with 20 mM lithium chloride (Figure 5A). Since

lithium is an inhibitor of glycogen synthase kinase 3 beta (GSK3b)that is known to suppressed Hh pathway by promoting ubiquitin/

proteasome-dependent degradation of GLI1, our results were

quite unexpected as logically lithium should up-regulate GLI1

expression by inhibiting GSK3b. Hence, we followed the time-

dependent dynamic expression of GLI1 and b-catenin in response

to lithium treatment. While the level of b-catenin was increased

persistently as expected (Fig. 5B), the endogenous GLI1 protein

levels showed a biphasic expression pattern. They were up-

regulated initially at 3 and 6 hours but down-regulated sub-

sequently in PANC-1 cell (Fig. 5C). To further confirm the

dynamic effects of lithium on modulating cellular levels of GLI1,

we ectopically expressed the full-length GLI1 tagged with a C-

terminal Myc epitope in PANC-1 and HEK293 cells. These cells

were incubated with 20 mM lithium chloride 48 hours post-

transfection, and the expression level of GLI1-Myc was monitored

using anti-Myc-Tag antibody. As shown in Figure 5D, the

expression of GLI1-Myc protein in both of PANC-1 and HEK293

cells followed a similar biphasic pattern as the endogenous GLI1.

Taken together, our results suggest that lithium treatment

promotes the degradation of GLI1 protein, consequently leads to

the inactivation of Hh pathway in PDA cells.

Lithium Synergized with Gemcitabine’s SuppressiveEffects on Cell Viability and Tumorigenic Potential of PDACellsTo determine if lithium-mediated Hh pathway suppression can

synergize with gemcitabine to inhibit PDA cell proliferation, we

followed cell viabilities of PANC-1 and AsPC-1 cells after

treatment with lithium chloride (20 mM), gemcitabine (200 nM)

or lithium chloride plus gemcitabine. The cell viabilities of both

cell lines were significantly reduced by the combination treatment

as compared to those of single agent treatment (Fig. 6A).Furthermore, the effect of lithium and gemcitabine combination

on the tumorigenic potential of PANC-1 cell was investigated by

colony formation assay. While gemcitabine dose-dependently

suppressed the number and size of PANC-1 colonies, lithium

significantly enhanced inhibitory effect of gemcitabine (Fig. 6B).These data suggest that lithium synergizes with gemcitabine’s

suppressive effects on cell viability and tumorigenic potential of

PDA cells.

Discussion

The development of PDA is associated with the accumulation of

genetic mutations and abnormal signaling pathways, including the

KRAS, JAK/STAT, EGF, TGF-b/SMAD and Hh pathway

[38,39,40]. Hh pathway inhibition has been proven to be an

effective anti-cancer therapeutic strategy, and several antagonists

targeting SMO have been developed and show efficacy in

preclinical studies and clinical trials in humans [41,42,43,44].

Lithium Inhibits Hedgehog-GLI Signaling Pathway


Figure 1. Lithium chloride suppresses the proliferation of PDA cells and impairs tumorigenic potential of PANC-1 cell. (A) Cellproliferation of PANC-1 cells and AsPC-1 cells after treatment with various concentrations of LiCl for 48 h. (B) Cell proliferation of PANC-1 cells andAsPC-1 cells after treatment with various concentrations of LiCl for indicated times. Data (Mean 6 SEM) were representative of three independentexperiments in triplicate. P values are indicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001. (C) Tumorigenic potential of PANC-1cells as monitored by colony formation after treatment with various concentrations of LiCl.doi:10.1371/journal.pone.0061457.g001



Figure 2. Lithium chloride induces cell cycle arrest in PANC-1 cells and AsPC-1 cells. PANC-1 cells (A) and AsPC-1 cells (B) were treated with20 mM LiCl and analyzed by ow cytometry with PI staining. Data (Mean 6 SEM) were representative of three independent experiments. P values areindicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001.doi:10.1371/journal.pone.0061457.g002

Figure 3. Lithium chloride induces apoptosis of PANC-1 cells and AsPC-1 cells. PANC-1 cells (A) and AsPC-1 cells (B) were treated with20 mM LiCl and analyzed by flow cytometry with Annexin V-FITC/PI staining. Viable cells are Annexin V-FITC and PI negative (quadrant Q4), whileapoptotic cells are Annexin V-FITC positive and PI negative (quadrant Q3); necrotic cells are Annexin V-FITC and PI positive (quadrant Q2), anddamaged cells are Annexin V-FITC negative and PI positive (quadrant Q1). Data (Mean6 SEM) were representative of three independent experiments.P values are indicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001.doi:10.1371/journal.pone.0061457.g003



Recent studies demonstrate that it is sufficient to inhibit the growth

of PDA through blocking GLI1 activity with RNAi technology or

medicinal compounds [19,45]. GLI1, can be phosphorylated by

cAMP-dependent protein kinase (PKA), casein kinase I (CKI) and

GSK3b, which in turn results in b-TRCP-mediated protein

degradation by the ubiquitin-proteasome system [46,47], which

provides us a direction by targeting GLI1 on PDA therapy.

GSK3b is a proline-directed serine-threonine kinase, involved in

many cellular processes, such as metabolism, neuronal develop-

ment, and body pattern formation [48], and GSK3b signaling has

also been implicated in mental illness and tumor formation.

Lithium, an effective GSK3b inhibitor, has been used in treating

depression and bipolar disorder for many years [22]. Recently, it

has been shown that inhibition of GSK3b promotes apoptosis in

glioma cells and PDA cells [49,50], and sensitizes PANC-1 cells to

gemcitabine [51]. In addition, lithium induces apoptosis of

a variety of cancer cells [36,52]. At present, the mechanism of

lithium-mediated anti-cancer activity is not clear.

In this study, we investigated the effect of lithium on Hh

pathway in PDA cells. To our surprise, our results showed that the

expression and activity of GLI1 in PDA cells were significantly

down-regulated after treatment with lithium for 18 hours. Since

GSK3b is known to promote ubiquitin-proteasome mediated GLI

degradation, one would expect that inhibition of GSK3b by

lithium should up-regulate cellular GLI levels. A more careful

analysis revealed a biphasic regulation in which GLI1 protein

levels were indeed increased initially following lithium treatment

up to 6 hours. On the basis of these observations, coupled with the

fact that in addition to directly phosphorylate GLI1, GSK3b is

also known to control protein translation through direct suppres-

Figure 4. Lithium chloride represses Hh signaling activity. (A) Real-time PCR analysis of mRNA expression levels of components of the Hhsignaling pathway in PANC-1 cells treated with different concentrations of LiCl for 24 h. Data (Mean 6 SEM) were representative of threeindependent experiments. P values are indicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001. (B) GLI-luciferase activities in AsPC-1 cells transfected with GLI-luciferase reporter and treated with different concentrations of LiCl for 18 h. Data (Mean 6 SEM) were representative ofthree independent experiments. P values are indicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001.doi:10.1371/journal.pone.0061457.g004

Figure 5. Lithium chloride regulates cellular levels of GLI1. (A) Levels of GLI1 protein in PANC-1 cell treated with 20 mM LiCl or 20 mM NaClfor 18 h. (B) Time-dependent accumulation of b-Catenin protein level in PANC-1 cell treated with 20 mM LiCl. (C) Time-dependent change of GLI1protein level in PANC-1 cell treated with 20 mM LiCl. (D) Time-dependent change of Myc-GLI1 expression in PANC-1 cells and HEK293 cells treatedwith 20 mM LiCl. These cells were treated with LiCl for indicated time. Data (Mean 6 SEM) were representative of three independent experiments. Pvalues are indicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001.doi:10.1371/journal.pone.0061457.g005



sion of EIF2b [53] and indirect suppression of MTOR [54], we

deduce that the inhibition of GSK3b by lithium increases GLI1

cellular levels initially via blocking ubiquitin-proteasome mediated

GLI degradation and releasing the inhibition of protein synthesis.

At present, the long-term inhibitory effect of lithium on GLI1 is

not clear. While we could not completely rule out the possibility

that lithium-induced reduction of GLI1 over longer time course

may be an indirect consequence of SHH and SMO down-

regulation (Fig. 4A). However, this scenario is most unlikely based

on existing literature. Nolan-Stevaux and colleagues report that

multistage development of PDA tumors is not affected by the

deletion of Smo in the pancreas, suggesting a Smo-independent

mechanism in which autocrine Shh–Ptch–Smo signaling is not

required in pancreatic ductal cells for PDA progression [19]. This

finding, coupled with the fact that more than 50% of PDA cells

lines with sustained Hh signaling activity are resistant to SMO

antagonist cyclopamine [14], implicates alternative means of GLI

regulation by KRAS and TGF-b in PDA [15,19]. Nevertheless,

parallel observation of dual regulation involving GSK3b inhibition

has been reported. Sun et al. show that 24-hour lithium treatment

blocks prostate cancer cells at the S phase while lithium treatment

for 6 hours promotes cells to pass through S phase [55]. Since

GSK3b also promotes the degradation of E2F target gene cyclin E

(CCNE) [56], it is most likely that CCNE may be also transiently

increased at the beginning of lithium treatment, which facilitates

the G1/S transition. On the other hand, it has been shown that

Figure 6. Lithium chloride synergizes with gemcitabine in reducing cell viability and tumorigenic potential of PDA cells. (A) Growthinhibition of PANC-1 and AsPC-1 cells after treatment with 20 mM LiCl, 200 nM gemcitabine and combination of LiCl and gemcitabine. Data (Mean6SEM) were representative of three independent experiments. P values are indicated by asterisks (relative to control): *P,0.05, **P,0.01, ***P,0.001.(B) Tumorigenic potential of PANC-1 cells as monitored by colony formation after treatment with LiCl, gemcitabine and combination of LiCl andgemcitabine.doi:10.1371/journal.pone.0061457.g006

Table 1. Primers for Real-time PCR.

Genes Forword primer (59-39) Reverse primer (59-39)

GLI1 CTCCCGAAGGACAGGTATGTAAC CCCTACTCTTTAGGCACTAGAGTTG

PTCH1 TCGAGACCAACGTGGAGGAG CCGAGTCCAGGTGTTGTAGG

HHIP TTCCATACCAAGGAGCAACC TCTTGCCACTGCTTTGTCAC

SHH CGGGAAGAGGAGGCACCCCA GTACTTGCTGCGGTCGCGGT

CCND1 AGAAGGAGGTCCTGCCGTCC GGTCCAGGTAGTTCATGGCC

FU ACTCTGAGCAGACTTTGCGGAG CCATCCAAGACAACCTGCTGTG

SUFU AGAGTGCCGCCGCCTTTACC ACGGGCTGCATCTGTGGGTC

SMO CAGGAGGAAGCGCACGGCAA TGCAGCGCAGGAAGTCAGGC

GAPDH TGTGGGCATCAATGGATTTGG ACACCATGTATTCCGGGTCAAT

doi:10.1371/journal.pone.0061457.t001



long-term GSK3b inhibition by GSK3b specific inhibitor TDZD-

8, lithium, or GSK3b siRNA disrupts the E2F-DNA interaction

and suppresses the expression of E2F target genes CDC6, cyclin A

(CCNA), CCNE and CDC25C [55]. Down-regulation of these DNA-

replication related gene leads to G1/S arrest as reported and also

shown in our study. Since E2F is a known target gene of GLI [57],

the reported effects of lithium on E2F suppression and the cell

cycle may depend on down-regulation of GLI1. We are currently

actively testing this hypothesis.

In summary, we show for the first time that lithium inhibits Hh

pathway through down-regulation of cellular GLI1 such that it

blocks cell proliferation, induces cell-cycle arrest, promotes

apoptosis and reduces tumorigenic potential of PDA cells.

Moreover, lithium synergistically enhances the anti-cancer effect

of gemcitabine. These novel findings extend our knowledge of

mechanisms of action for lithium and provide a potentially new

therapeutic strategy for PDA.

Materials and Methods

Cell Culture and TransfectionPDA cell lines PANC-1 and AsPC-1, and HEK293 were

obtained from the Cell Bank of Type Culture Collection of

Chinese Academy of Science (Shanghai, China). PANC-1 and

HEK293 cell lines were cultured in DMEM and AsPC-1 cell line

was in RPMI-1640 medium (Gibco/BRL) supplemented with

10% fetal calf serum (PAA, Austria) at 37uC under 5% humidified

CO2. Transfection was performed using Lipofectamine 2000

reagent (Invitrogen) according to the manufacturer’s instructions.

Cell Viability AnalysisGrowth-phase PDA cells were seeded in 96-well plates at

a density of 46103 cells/well (PANC-1) or 16104 cells/well

(AsPC-1), respectively. The cells were treated with various

concentration of LiCl (Calbiochem) and gemcitabine (Tocris) the

next day for 0–3 days and six replications were performed for each

treatment. Ten microliters of Cell Counting Kit-8 (CCK-8)

solution (Dojindo Laboratories) were added to each well and

incubated at 37uC for 2–6 hours. The absorbance of each well at

450 nm was determined using a plate reader and the growth

curves were then plotted accordingly. Each experiment was

performed independently three times.

Colony Formation AssaySingle cell suspension of growth-phase PANC-1 cell was seeded

in 6-well plates (16103 cells/well) or 12-well plates (56102 cells/

well). After 24 hours incubation, cells were treated with various

concentrations of LiCl and gemcitabine. Fresh medium with

corresponding concentration of LiCl and gemcitabine were added

every 5 days to replace the old medium. Two weeks later, the

medium was aspirated off and the cells colonies were washed with

PBS twice, then fixed for 15 minutes with methanol and stained

with crystal violet (0.1% crystal violet in 20% methanol), and

visualized using a microscope.

Apoptosis and Cell Cycle AnalysesPANC-1 and AsPC-1 cells were distributed into 12-well plates

at a density of 26105 cells/well, incubated with 20 mM LiCl. At

the indicated time, cells were trypsinized and harvested by

centrifugation, washed once with a buffer containing 10 mM

Hepes, 140 mM NaCl, 2.5 mM CaCl2 and stained with Annexin

V-FITC and propidium iodide (PI) in the dark at room

temperature for 15 minutes, then analyzed using by flow

cytometry (FACScan; Becton-Dickinson). Data were analyzed

using the FlowJo software. For cell cycle analysis, the DNA

contents of cells stained with PI and determined by ow cytometry.

Data were analyzed using the ModFit software package. Each

experiment was performed independently at least three times.

Immunoblotting AnalysisCells were seeded in 6-well plates (56105 cells/well) and treated

with LiCl the next day. At the indicated time, lysis buffer

containing 62.5 mM Tris pH 6.8, 2% sodium dodecylsulfate, 10%

Glycerol, 0.01% bromophenol blue (300 ml/well) was used to

harvest cellular proteins. The protein samples from lysates with

2% b-mercaptoethanol added were separated using 8% sodium

dodecylsulfate–polyacrylamide gel electrophoresis (SDS-PAGE)

and transferred onto polyvinylidene difluoride (PVDF) membranes

(Millipore). After being blocked with 5% non-fat dry milk in TBST

(Tris buffered saline buffer containing 0.1% Tween-20) at room

temperature for 1 hour, the PVDF membranes were incubated

with individual primary antibodies (anti-Myc-Tag, anti-GLI1, Cell

Signaling Technology; anti-a-Tubulin, Sigma; anti-b-catenin,Santa Cruz) at 4uC overnight, followed by corresponding HRP-

conjugated secondary antibody at room temperature for 45

minutes. Protein bands were detected by ECL Western Blotting

Detection System (Millipore). Each experiment was performed

independently at least three times.

Real-time PCR AssayTotal RNA was extracted from PANC-1 cell treated with LiCl

at different concentrations using TRIzol reagent (Invitrogen).

cDNA was synthesized using the TaKaRa RNAiso Reagent

(TaKaRa) according to the manufacturer’s instructions. Real-time

PCR for GAPDH, GLI1, SHH, HHIP, PTCH1, SMO, FU, SUFU

and CCND1 was performed on an Applied Biosystems stepone plus

Sequence Detection System (Applied Biosystems) using SYBR

green dye and primers as described in Table 1. For quantification,

the relative mRNA level of specific gene expression was calculated

using the 22DDCt method with GAPDH level as the control. Each

experiment was performed independently at least three times.

Luciferase Reporter Gene AssayGLI luciferase reporter construct (8639 GLI BSwt-luc) was

kindly provided by Dr. Hisato Kondoh [58]. AsPC-1 cells were

transiently transfected with the GLI-luc plasmid and the SV40-

Renilla control plasmid using Lipofectamine 2000 (Invitrogen)

according to the manufacturer’s instructions. Twenty-four hours

post-transfection, cells were treated with various concentration of

LiCl for 18 hours. Luciferase activity was determined with the dual

luciferase reporter assay system (Promega Corporation, WI)

according to the manufacturer’s instruction, and normalized to

renilla luciferase activity as a control for transfection efficiency.

Each experiment was repeated at least three times with similar

results.

Statistical AnalysisResults were presented as mean6S.E.M. Statistical significance

between groups was analyzed by one-way ANOVA followed with

the Student–Newman–Keuls multiple comparisons tests. A P-

value of ,0.05 was considered significant.

Author Contributions

Conceived and designed the experiments: ZP ZJ FM YO XC. Performed

the experiments: ZP ZJ FM ML. Analyzed the data: ZP ZJ FM YO XC.

Wrote the paper: ZP XC.



References

1. Siegel R, Naishadham D, Jemal A (2012) Cancer statistics, 2012. CA

Cancer J Clin 62: 10–29.2. Kim R (2011) FOLFIRINOX: a new standard treatment for advanced

pancreatic cancer? Lancet Oncol 12: 8–9.3. Philip PA (2008) Improving treatment of pancreatic cancer. Lancet Oncol 9: 7–

8.

4. Van Cutsem E, Vervenne WL, Bennouna J, Humblet Y, Gill S, et al. (2009)Phase III trial of bevacizumab in combination with gemcitabine and erlotinib in

patients with metastatic pancreatic cancer. J Clin Oncol 27: 2231–2237.5. Van Cutsem E, Verslype C, Grusenmeyer PA (2007) Lessons learned in the

management of advanced pancreatic cancer. J Clin Oncol 25: 1949–1952.

6. Moore MJ, Goldstein D, Hamm J, Figer A, Hecht JR, et al. (2007) Erlotinib plusgemcitabine compared with gemcitabine alone in patients with advanced

pancreatic cancer: a phase III trial of the National Cancer Institute of CanadaClinical Trials Group. J Clin Oncol 25: 1960–1966.

7. Hidalgo M (2010) Pancreatic cancer. N Engl J Med 362: 1605–1617.8. McMahon AP, Ingham PW, Tabin CJ (2003) Developmental roles and clinical

significance of hedgehog signaling. Curr Top Dev Biol 53: 1–114.

9. Lewis EB (1978) A gene complex controlling segmentation in Drosophila.Nature 276: 565–570.

10. Zhao Q, Beck A, Fraidenraich D (2010) A direct, non-canonical pathway forHedgehog proteins in the endothelium. Cell Cycle 9: 647–648.

11. Blotta S, Jakubikova J, Calimeri T, Roccaro AM, Amodio N, et al. (2012)

Canonical and non canonical Hedgehog pathway in the pathogenesis of multiplemyeloma. Blood 120: 5002–5013.

12. Berman DM, Karhadkar SS, Maitra A, Montes De Oca R, Gerstenblith MR, etal. (2003) Widespread requirement for Hedgehog ligand stimulation in growth of

digestive tract tumours. Nature 425: 846–851.13. Xie J, Murone M, Luoh SM, Ryan A, Gu Q, et al. (1998) Activating

Smoothened mutations in sporadic basal-cell carcinoma. Nature 391: 90–92.

14. Thayer SP, di Magliano MP, Heiser PW, Nielsen CM, Roberts DJ, et al. (2003)Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis.

Nature 425: 851–856.15. Ji Z, Mei FC, Xie J, Cheng X (2007) Oncogenic KRAS activates hedgehog

signaling pathway in pancreatic cancer cells. J Biol Chem 282: 14048–14055.

16. Wang Y, Ding Q, Yen CJ, Xia W, Izzo JG, et al. (2012) The crosstalk ofmTOR/S6K1 and Hedgehog pathways. Cancer Cell 21: 374–387.

17. Xu X, Zhou Y, Xie C, Wei SM, Gan H, et al. (2012) Genome-Wide ScreeningReveals an EMT Molecular Network Mediated by Sonic Hedgehog-Gli1

Signaling in Pancreatic Cancer Cells. PLoS One 7: e43119.18. Soleti R, Benameur T, Porro C, Panaro MA, Andriantsitohaina R, et al. (2009)

Microparticles harboring Sonic Hedgehog promote angiogenesis through the

upregulation of adhesion proteins and proangiogenic factors. Carcinogenesis 30:580–588.

19. Nolan-Stevaux O, Lau J, Truitt ML, Chu GC, Hebrok M, et al. (2009) GLI1 isregulated through Smoothened-independent mechanisms in neoplastic pancre-

atic ducts and mediates PDAC cell survival and transformation. Genes Dev 23:

24–36.20. Mazumdar T (2011) The GLI genes as the molecular switch in disrupting

Hedgehog signaling in colon cancer. oncotarget 2: 638–645.21. Lauth M, Bergstrom A, Shimokawa T, Toftgard R (2007) Inhibition of GLI-

mediated transcription and tumor cell growth by small-molecule antagonists.Proc Natl Acad Sci U S A 104: 8455–8460.

22. Johnson G, Gershon S (1999) Early North American research on lithium.

Aust N Z J Psychiatry 33 Suppl: S48–53.23. Cohen P, Goedert M (2004) GSK3 inhibitors: development and therapeutic

potential. Nat Rev Drug Discov 3: 479–487.24. Klein PS, Melton DA (1996) A molecular mechanism for the effect of lithium on

development. Proc Natl Acad Sci U S A 93: 8455–8459.

25. Mora A, Sabio G, Risco AM, Cuenda A, Alonso JC, et al. (2002) Lithium blocksthe PKB and GSK3 dephosphorylation induced by ceramide through protein

phosphatase-2A. Cell Signal 14: 557–562.26. Quiroz JA, Gould TD, Manji HK (2004) Molecular effects of lithium. Mol

Interv 4: 259–272.

27. Spiegelberg BD (2005) Alteration of Lithium Pharmacology through Manipu-lation of Phosphoadenosine Phosphate Metabolism. J Biol Chem 280: 5400–

5405.28. Freland L, Beaulieu JM (2012) Inhibition of GSK3 by lithium, from single

molecules to signaling networks. Front Mol Neurosci 5: 14.29. Nowicki MO, Dmitrieva N, Stein AM, Cutter JL, Godlewski J, et al. (2008)

Lithium inhibits invasion of glioma cells; possible involvement of glycogen

synthase kinase-3. Neuro Oncol 10: 690–699.30. Vidal F, de Araujo WM, Cruz AL, Tanaka MN, Viola JP, et al. (2011) Lithium

reduces tumorigenic potential in response to EGF signaling in human colorectalcancer cells. Int J Oncol 38: 1365–1373.

31. Ronchi A, Salaroli R, Rivetti S, Della Bella E, Di Tomaso T, et al. (2011)

Lithium induces mortality in medulloblastoma cell lines. Int J Oncol 37: 745–752.

32. Erdal E, Ozturk N, Cagatay T, Eksioglu-Demiralp E, Ozturk M (2005) Lithium-mediated downregulation of PKB/Akt and cyclin E with growth inhibition in

hepatocellular carcinoma cells. Int J Cancer 115: 903–910.

33. Beyaert R, Vanhaesebroeck B, Suffys P, Van Roy F, Fiers W (1989) Lithium

chloride potentiates tumor necrosis factor-mediated cytotoxicity in vitro and

in vivo. Proc Natl Acad Sci U S A 86: 9494–9498.

34. Cohen Y, Chetrit A, Cohen Y, Sirota P, Modan B (1998) Cancer morbidity in

psychiatric patients: influence of lithium carbonate treatment. Med Oncol 15:

32–36.

35. Zhu Z, Kremer P, Tadmori I, Ren Y, Sun D, et al. (2011) Lithium suppresses

astrogliogenesis by neural stem and progenitor cells by inhibiting STAT3

pathway independently of glycogen synthase kinase 3 beta. PLoS One 6:

e23341.

36. Kaufmann L, Marinescu G, Nazarenko I, Thiele W, Oberle C, et al. (2011) LiCl

induces TNF-alpha and FasL production, thereby stimulating apoptosis in

cancer cells. Cell Commun Signal 9: 15.

37. Mao CD, Hoang P, DiCorleto PE (2001) Lithium inhibits cell cycle progression

and induces stabilization of p53 in bovine aortic endothelial cells. J Biol Chem

276: 26180–26188.

38. Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N, et al. (1988) Most

human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell

53: 549–554.

39. Levy L, Hill CS (2005) Smad4 dependency defines two classes of transforming

growth factor {beta} (TGF-{beta}) target genes and distinguishes TGF-{beta}-

induced epithelial-mesenchymal transition from its antiproliferative and

migratory responses. Mol Cell Biol 25: 8108–8125.

40. Kayed H, Kleeff J, Osman T, Keleg S, Buchler MW, et al. (2006) Hedgehog

signaling in the normal and diseased pancreas. Pancreas 32: 119–129.

41. Chen JK (2002) Inhibition of Hedgehog signaling by direct binding of

cyclopamine to Smoothened. Genes & Development 16: 2743–2748.

42. Daniel D. Von Hoff MD, Patricia M LoRusso, D.O., etal. (2009) Inhibition of

the Hedgehog Pathway in Advanced Basal-Cell Carcinoma. N Engl J Med 361:

1164–1172.

43. Merchant AA, Matsui W (2010) Targeting Hedgehog – a Cancer Stem Cell

Pathway. Clinical Cancer Research 16: 3130–3140.

44. Low JA, de Sauvage FJ (2010) Clinical experience with Hedgehog pathway

inhibitors. J Clin Oncol 28: 5321–5326.

45. Fu J, Rodova M, Roy SK, Sharma J, Singh KP, et al. (2013) GANT-61 inhibits

pancreatic cancer stem cell growth in vitro and in NOD/SCID/IL2R gamma

null mice xenograft. Cancer Lett 330: 22–32.

46. Huntzicker EG, Estay IS, Zhen H, Lokteva LA, Jackson PK, et al. (2006) Dual

degradation signals control Gli protein stability and tumor formation. Genes

Dev 20: 276–281.

47. Jiang J (2006) Regulation of Hh/Gli signaling by dual ubiquitin pathways. Cell

Cycle 5: 2457–2463.

48. Plyte SE, Hughes K, Nikolakaki E, Pulverer BJ, Woodgett JR (1992) Glycogen

synthase kinase-3: functions in oncogenesis and development. Biochim Biophys

Acta 1114: 147–162.

49. Kotliarova S, Pastorino S, Kovell LC, Kotliarov Y, Song H, et al. (2008)

Glycogen synthase kinase-3 inhibition induces glioma cell death through c-

MYC, nuclear factor-kappaB, and glucose regulation. Cancer Res 68: 6643–

6651.

50. Marchand B, Tremblay I, Cagnol S, Boucher MJ (2012) Inhibition of glycogen

synthase kinase-3 activity triggers an apoptotic response in pancreatic cancer

cells through JNK-dependent mechanisms. Carcinogenesis 33: 529–537.

51. Shimasaki T, Ishigaki Y, Nakamura Y, Takata T, Nakaya N, et al. (2012)

Glycogen synthase kinase 3beta inhibition sensitizes pancreatic cancer cells to

gemcitabine. J Gastroenterol 47: 321–333.

52. Schotte P, Van Loo G, Carpentier I, Vandenabeele P, Beyaert R (2001) Lithium

sensitizes tumor cells in an NF-kappa B-independent way to caspase activation

and apoptosis induced by tumor necrosis factor (TNF). Evidence for a role of the

TNF receptor-associated death domain protein. J Biol Chem 276: 25939–25945.

53. Welsh GI, Miller CM, Loughlin AJ, Price NT, Proud CG (1998) Regulation of

eukaryotic initiation factor eIF2B: glycogen synthase kinase-3 phosphorylates

a conserved serine which undergoes dephosphorylation in response to insulin.

FEBS Lett 421: 125–130.

54. Inoki K, Ouyang H, Zhu T, Lindvall C, Wang Y, et al. (2006) TSC2 integrates

Wnt and energy signals via a coordinated phosphorylation by AMPK and GSK3

to regulate cell growth. Cell 126: 955–968.

55. Sun A, Shanmugam I, Song J, Terranova PF, Thrasher JB, et al. (2007) Lithium

suppresses cell proliferation by interrupting E2F-DNA interaction and sub-

sequently reducing S-phase gene expression in prostate cancer. Prostate 67: 976–

988.

56. Welcker M, Singer J, Loeb KR, Grim J, Bloecher A, et al. (2003) Multisite

phosphorylation by Cdk2 and GSK3 controls cyclin E degradation. Mol Cell 12:

381–392.

57. Regl G, Kasper M, Schnidar H, Eichberger T, Neill GW, et al. (2004) The zinc-

finger transcription factor GLI2 antagonizes contact inhibition and differenti-

ation of human epidermal cells. Oncogene 23: 1263–1274.

58. Sasaki H, Hui C, Nakafuku M, Kondoh H (1997) A binding site for Gli proteins

is essential for HNF-3beta floor plate enhancer activity in transgenics and can

respond to Shh in vitro. Development 124: 1313–1322.



lithium inhibits tumorigenic potential of pda cells ... · lithium inhibits tumorigenic potential...

Documents