lincoln university digital - connecting repositories · neethu maria jose lincoln university 2015 ....

Lincoln University Digital Thesis

Copyright Statement

The digital copy of this thesis is protected by the Copyright Act 1994 (New Zealand).

This thesis may be consulted by you, provided you comply with the provisions of the Act and the following conditions of use:

you will use the copy only for the purposes of research or private study you will recognise the author's right to be identified as the author of the thesis and

due acknowledgement will be made to the author where appropriate you will obtain the author's permission before publishing any material from the

thesis.

i

ISOLATION, SCREENING AND CHARACTERIZATION OF PROBIOTIC

ISOLATES FROM COMMERCIAL DAIRY FOOD AND BOVINE RUMEN

A thesis

submitted in partial fulfilment

of the requirements for the Degree of

Doctor of Philosophy

at

Lincoln University

by

Neethu Maria Jose

Lincoln University

2015

ii

Declaration

I hereby declare that this thesis contains no material which has been accepted for the award

of any other degree in any university, and that to the best of my knowledge, contains no

copy or paraphrase material published or written by any other person, except where due

reference is made in the text of this thesis. All the results presented in this thesis are solely

my work, unless stated otherwise. The exceptions were as follows: DNA sequencing data

was obtained with the help of staff at the Bio- protection Department, Lincoln University.

The Caco- 2 studies were done with the help of the staff at University of Otago. Gas liquid

chromatography technique used in analysis of fatty acids and gas chromatography- mass

spectrophotometry technique used in volatile compounds analysis was carried out with the

help of technical staff at Lincoln University. All the samples for DNA sequencing, Caco- 2

studies and fatty acid analysis and volatile compounds analysis were prepared by me. This

thesis is less than 100, 000 words in length, exclusive of tables, figures and appendices. Parts

of this thesis (slightly modified to meet journal requirements) has been published in

journals, accepted for publication and / or presented in advance of submission of this thesis.

Neethu Maria Jose

Department of Wine, Food and Molecular Biosciences,

Faculty of Agriculture and Life Sciences

iii

Publications

Refereed Published Papers

Jose, N.M., Bunt, C.R., & Hussain, M.A. (2014). Implications of antibiotic resistance in

probiotics. Food Reviews International, 31, 52-62.

Jose, N.M., Bunt, C.R., & Hussain, M.A. (2015). Comparison of microbiological and probiotic

characteristics of lactobacilli isolates from dairy food products and bovine rumen contents.

Microorganisms, 3, 198-212.

Sumitted Refereed Papers

Jose, N.M., Bunt, C.R., & Hussain, M.A. Effects of glyphosate on rumen isolates in vitro.

Drafted Papers

Jose, N.M., Bunt, C.R., & Hussain, M.A. Analysis of the adherence and permeability

properties of potentially probiotic dairy vs rumen lactobacilli isolates to human Caco- 2 cells.

Refereed Conference Podium Presentations

Low pH tolerance and antibiotic resistance in lactobacilli isolates: Annual New Zealand

Microbiological Society Conference, University of Waikato, Hamilton, New Zealand; 26-28

November, 2013.

Screening of lactobacilli isolates from dairy food products and bovine rumen contents for

application as probiotics: Annual New Zealand Microbiological Society Conference, Victoria

University, Wellington, New Zealand; 18-21 November, 2014.

iv

Refereed Conference Poster Presentations

Comparison of adherence properties and antibiotic resistance in potential probiotic lactic

acid bacteria isolated from dairy products and bovine rumen contents: Asia- Pacific

Probiotics Conference, Lincoln University, Christchurch, New Zealand; 20-21 October, 2014.

Comparative proteomic analysis of L. plantarum and L. rhamnosus cells exposed to acid and

bile stresses: International Journal of Food Science and Technology 50th celebration

conference, Lincoln University, Christchurch, New Zealand; 17-19 February, 2015.

Academic presentations

Developing NOVEL PROBIOTIC bacteria: the answer to many underlying health questions: An

oral three minute presentation at the Lincoln University Thr3sis competition, Lincoln

University, Christchurch, New Zealand; May 2014.

Universal or application specific probiotics. An oral three minute presentation at the Lincoln

University Thr3sis competition, Lincoln University, Christchurch, New Zealand; May 2015.

Contribution of authors

Dr. Malik A. Hussain was the principal supervisor and Dr. Craig R. Bunt was the associate

supervisor for this PhD research mentioned in the above publications. Neethu Maria Jose

planned and performed the experiments and wrote the papers and presentations.

v

Abstract of a thesis submitted in partial fulfilment of the

requirements for the Degree of Doctor of Philosophy.

Abstract

ISOLATION, SCREENING AND CHARACTERIZATION OF PROBIOTIC ISOLATES

FROM FOOD AND RUMEN

by

Neethu Maria Jose

Probiotics are beneficial bacteria which either imparts overall general well being in

the host or has intended specific applications such as treating selected health conditions for

example; gut inflammation in humans, enhancing the feed conversion and body weight gain

in livestock or suppressing transmissible dieases in poultry. There is increasing demand for

probiotics; to meet this demand new sources for probiotic bacteria isolation and extensive

routine screening studies carried out in laboratories are required. This leads to new

candidates being selected and tested for efficacy in animal models for applications in the

health, foods, food production and neutraceutical industries.

The key question investigated by this thesis was; can novel probiotic candidates be

isolated from dairy food products and the bovine rumen?

Initially twenty dairy food isolates and thirty bovine rumen isolates were collected.

Phenotypic characterization (Gram staining and colony morphology) of these isolates

identified twenty- six isolates for further evaluation. All dairy food isolates were found to be

Gram- positive and colony morphologies indicating they were likely to be lactic acid bacteria.

Only six of the thirty bovine rumen isolates met these criteria, this was not surpising

considering the vast range of microbial species present in the bovine rumen.

vi

The twenty- six isolates (twenty from dairy food and six from the bovine rumen) were

investigated for their survival at low pH and in the presence of bile salts. These conditions

were selected as they are major challenges probiotic bacteria encounters during gastro-

intestinal tract transit following injestion by farmed livestock or humans. Ten isolates (five

each from dairy food and the bovine rumen) were identified as having good adhesion and

survival at low pH and in the presence of bile salts. The high proportion of bovine rumen

isolates (five of six) found to have good potential probiotic characteristics reflects perhaps

their being isolated from an environment where such characteristics would be condusive to

survival.

Species identification of these ten isolates confirmed all were Lactobacillus species.

Extensive testing to further characterize the probiotic potential of the ten isolates included;

inhibition of pathogens, resistance to antibiotics, biosafety (absence of haemolytic activity),

adhesion (BATH test), carbohydrate fermentation, survival at low pH, and high bile salt

concentrations. This testing identified two isolates (isolate MI 13 from dairy food and isolate

RC 2 from the bovine rumen) for further evaluation.

The two isolates were characterized in terms of their adhesion to and permeability

across gut Caco- 2 cells. These isolates were also characterized under standard and stressed

(low pH and high bile salts) conditions by proteomic assessment of protein expression

changes, production of volatile fatty acids and composition of fatty acid methyl esters.

A key conclusion from this research is that potential probiotic candidates can be

isolated from commercial dairy food products and the bovine rumen. The data obtained

from the screening tests indicates that overall the rumen isolates displayed better in vitro

probiotic characteristics and isolates MI 13 and RC 2 shows promising potential for further

development as a novel probiotic.

Keywords: probiotic, dairy food product, bovine rumen, lactobacilli, screening,

antibiotics, antimicrobial, BATH test, Caco- 2 adhesion, Caco- 2 permeability, PCR, DNA

vii

sequencing, proteomics, 1 D SDS PAGE, voaltile fatty acids, GC- MS, fatty acid methyl esters,

GLC

viii

Acknowledgements

I wish to thank, first and foremost, my supervisor Dr. Malik A. Hussain for his

guidance, encouragement, support and advice throughout the course of this study. I owe

him a great debt of gratitude for allowing me to do research under him. I could not have

imagined having a better advisor and mentor for my PhD study. I consider myself lucky to

have worked with him.

I am sincerely thankful to Dr. Craig R. Bunt for agreeing to co- supervise my project.

Completing thesis writing would have been all the more difficult were it not for the critiques,

valuable suggestions, and editing provided by him. Also, I am thankful to him for his

significant help with statistical analysis. I very much appreciate his enthusiasm, intensity and

vast knowledge in the subject. He offered me advise whenever I needed them.

Voltile fatty acid compounds and fatty acid methyl ester studies would not have been

possible, hadn’t I received the GC- MS and GLC technical support from the technical staff,

Jason Breitmeyer and Richard Hider. I share the credit of this work with them, who guided

me with their valuable feedback.

I owe my deepest gratitude to laboratory manager, Omega Amoafo who was very

friendly and always approachable for any support. I am indebted to my colleagues and

friends whom I have met as part of my study, for their moral support, the stimulating

discussions we had and for all the fun we had together during our study.

And most of all, it gives me great pleasure in acknowledging the unconditional love

and support I received from my husband, Eby Mohan, and son, Ryan Eby. My husband has

been my pillar of strength in all stages of this PhD and it is his hard work that helped me in

paying my tuition fees. Though too little to understand what mamma was doing, my little

boy has always adjusted and been patient in all circumstances. His smiling innocent face

always calmed me in difficult situations and made me face all challenges with confidence.

This thesis is dedicated to them. Also special thanks to my family back in India, especially my

ix

parents, M.U. Jose and Besy Jose, my sister, Nithya Jose and father in law, Mohan Abraham

who have been very supportive and motivated me to complete my PhD.

Last but not the least, thanks to God the Almighty for having given me this

opportunity in life. It is only due to His grace that I have made my way through all the tests

and troubles in life over the years. May His name be always exalted, honoured and glorified.

x

Table of Contents

Abstract ....................................................................................................................................... v

Acknowledgements ................................................................................................................... viii

Table of Contents ......................................................................................................................... x

List of Tables ............................................................................................................................. xiii

List of Figures ............................................................................................................................. xiv

Chapter 1 Introduction ............................................................................................................... 20

1.1 Thesis structure ............................................................................................................................ 20

1.2 Significance of this research ........................................................................................................ 20

1.3 Research objectives ..................................................................................................................... 21 1.3.1 Isolation of potential probiotic bacteria from two sources ............................................ 22 1.3.2 Preliminary screening of isolates .................................................................................... 22 1.3.3 Identification and selective screening of the ten most promising isolates .................... 22 1.3.4 Final characterization of one isolate from the dairy food and the bovine rumen for

specific properties ........................................................................................................... 22

Chapter 2 Review of Literature.................................................................................................... 24

2.1 Probiotics ..................................................................................................................................... 24 2.1.1 Definition of probiotics ................................................................................................... 24 2.1.2 Ideal probiotic characteristics ......................................................................................... 25 2.1.3 Probiotic bacteria in use ................................................................................................. 25 2.1.4 Foods containing probiotics ............................................................................................ 29

2.2 Safety of probiotics: routine screening tests adapted ................................................................. 31

2.3 Applications of probiotics ............................................................................................................ 31 2.3.1 Human health benefits ................................................................................................... 32 2.3.2 Farmed livestock applications ......................................................................................... 34

2.4 Future developments of probiotic research ................................................................................ 36

2.5 Implications of antibiotic resistance in probiotics: review paper ................................................ 36

Chapter 3 Materials and methods ............................................................................................... 48

3.1 Materials ...................................................................................................................................... 48 3.1.1 Bacterial isolates ............................................................................................................. 48 3.1.2 Chemicals ........................................................................................................................ 48 3.1.3 Reagents .......................................................................................................................... 48 3.1.4 Stock solutions ................................................................................................................ 50 3.1.5 Buffers ............................................................................................................................. 51 3.1.6 Microbiological media ..................................................................................................... 51 3.1.7 MRS broth substituted with bile salts for bile salts tolerance assay .............................. 52 3.1.8 Antibiotic discs ................................................................................................................ 53 3.1.9 Oxidase strips .................................................................................................................. 54 3.1.10 Pathogens ........................................................................................................................ 54 3.1.11 Standards and working solutions for VFA analysis using GC- MS ................................... 55 3.1.12 Reagents and standards for FA analysis using GLC ......................................................... 56

3.2 Methodology ................................................................................................................................ 56 3.2.1 General methods............................................................................................................. 56 3.2.2 Inoculum preparation ..................................................................................................... 57

xi

3.2.3 Storage of isolates ........................................................................................................... 57 3.2.4 Gram staining .................................................................................................................. 57 3.2.5 Carbohydrate fermentation ............................................................................................ 58 3.2.6 Determination of growth ................................................................................................ 59 3.2.7 Determination of viable count ........................................................................................ 59 3.2.8 Disc diffusion method ..................................................................................................... 59 3.2.9 Well diffusion method .................................................................................................... 59 3.2.10 Extraction of genomic DNA ............................................................................................. 60 3.2.11 Quantification of extracted DNA ..................................................................................... 61 3.2.12 Polymerase chain reaction (PCR) .................................................................................... 61 3.2.13 Agarose gel electrophoresis ............................................................................................ 62 3.2.14 DNA sequencing .............................................................................................................. 62 3.2.15 Preparation of bacterial suspension for proteomics analysis by gel electrophoresis .... 62 3.2.16 Whole cell protein extraction ......................................................................................... 63 3.2.17 Cytosolic protein extraction ............................................................................................ 63 3.2.18 Protein quantification ..................................................................................................... 64 3.2.19 1- D SDS PAGE ................................................................................................................. 64

Chapter 4 Isolation, identification and screening of potential probiotic lactic acid bacteria isolates....................................................................................................................................... 65

4.1 Introduction ................................................................................................................................. 65

4.2 Methods ....................................................................................................................................... 67 4.2.1 Isolation of isolates from dairy food products and bovine rumen contents .................. 67 4.2.2 Purification of isolates..................................................................................................... 68 4.2.3 Storage of isolates ........................................................................................................... 70 4.2.4 Oxidase test ..................................................................................................................... 70 4.2.5 pH tolerance of isolates .................................................................................................. 70 4.2.6 Bile salt tolerance ............................................................................................................ 71 4.2.7 Extraction of DNA from gram- positive bacteria ............................................................. 71 4.2.8 Polymerase chain reaction (PCR) .................................................................................... 71 4.2.9 Supplementary methods for paper reported in section 4.3.7 ........................................ 72

4.3 Results and discussion ................................................................................................................. 76 4.3.1 Morphological characteristics ......................................................................................... 76 4.3.2 Gram nature of isolates .................................................................................................. 76 4.3.3 pH tolerance of isolates .................................................................................................. 79 4.3.4 Bile salts tolerance of isolates ......................................................................................... 81 4.3.5 Agarose gel electrophoresis ............................................................................................ 83 4.3.6 DNA sequencing .............................................................................................................. 85 4.3.7 Comparison of microbiological and probiotic characteristics of probiotic lactobacilli

isolates from dairy food products and animal rumen contents ..................................... 97

4.4 Conclusions ................................................................................................................................ 113

Chapter 5 Characterization of selected probiotic isolates for specific properties ..........................114

5.1 Introduction ............................................................................................................................... 114

5.2 Methods ..................................................................................................................................... 117 5.2.1 1 D SDS PAGE profiles of whole cell proteins and cytosolic proteins ........................... 117 5.2.2 Identification of VFA compounds.................................................................................. 117 5.2.3 Identification of FA methyl esters ................................................................................. 119 5.2.4 Statistical analysis for VFA compounds and FA methyl esters production ................... 120 5.2.5 Characterization of antimicrobial compounds produced by lactobacilli ...................... 121

5.3 Results and discussion ............................................................................................................... 123

xii

5.3.1 1 D SDS PAGE whole cell protein and cytosolic protein profiles of dairy food isolate, MI 13 and rumen isolate, RC 2 ...................................................................................... 123

5.3.2 Identification of VFA compounds produced under low pH and bile salts stressed conditions using HS- SPME GC- MS ............................................................................... 128

5.3.3 Identification of fatty acid methyl esters produced under low pH and bile salts stressed conditions using GLC ....................................................................................... 130

5.3.4 Determination of antimicrobial compounds produced by lactobacilli ......................... 133 5.3.5 Analysis of the adherence and permeability properties of potentially probiotic dairy

vs rumen lactobacilli isolates to human Caco- 2 cells ................................................... 139 5.3.6 Effect of glyphosate on rumen isolates in vitro ............................................................ 151 5.3.7 Supplementary results for paper reported in section 5.3.7 ......................................... 160

5.4 Conclusions ................................................................................................................................ 161

Chapter 6 General discussion and conclusion..............................................................................162

6.1 General discussion ..................................................................................................................... 162

6.2 Conclusion .................................................................................................................................. 166

6.3 Future directions ........................................................................................................................ 168

References ............................................................................................................................... 170

Appendix A Sources of laboratory instrumentation, equipment and chemicals ............................187

Appendix B Gentra Puregene Yeast/ Bacterial kit contents .........................................................193

Appendix C Assessment of DNA purity using nanodrop ...............................................................194

Appendix D PCR primers ............................................................................................................195

Appendix E PCR reaction mix .....................................................................................................196

Appendix F Protein standard curve constructed by using BCA kit ................................................197

Appendix G Statistical analysis for BATH test ..............................................................................199

Appendix H Statistical analysis for adhesion studies ...................................................................202

Appendix I Statistical analysis for permeability studies ...............................................................203

Appendix J Quantification parameters for the seven analytes and four deuterated standards .....204

Appendix K Example of a GLC chromatogram .............................................................................205

Appendix L Conference abstracts ...............................................................................................206

xiii

List of Tables

Table 2.1 General screening criteria for an ideal probiotic microorganism (modified from Gupta & Garg, 2009). Those highlighted in bold have been selected as key characteristics for evaluation in this thesis. ..................................................................................... 26

Table 2.2 Lactobacillus, Bifidobacterium and other genera bacteria and yeast species reported as probiotics (modified from Gupta & Garg, 2009). ................................................... 27

Table 2.3 Proposed mode of action on human health and wellbeing for a limited list of probiotic bacteria. .................................................................................................................. 33

Table 2.4 Possible probiotic bacteria for farmed livestock and proposed modes of action. ............ 35 Table 3.1 Ingredient lists of fermented dairy food products as stated on the product label. .......... 50

Table 3.2 Antibiotic, abbreviation and concentration (g) per disk as used for the antibiotic sensitivity of each lactic acid isolate. ........................................................................ 54

Table 3.3 Pathogen and source as used to test sensitivity of each lactic acid isolate. .................... 55 Table 3.4 Carbohydrate and type of sugar used to evaluate the carbohydrate fermentation by

the lactic acid isolates. ............................................................................................. 58 Table 3.5 PCR reaction cycle for three primers. A: Primer 1- Aci I and Aci II, B: Primer 2- Pr I and

Pr II, C: Primer 3- 16-1A and 23-1B. ........................................................................... 61 Table 4.1 Genetic identity of each isolate as established by NCBI BLAST. ...................................... 96 Table 5.1 Inhibition halo presence or absence and its corresponding indication depending on the

treatment applied to the supernatant. ....................................................................122 Table 5.2 Volatile fatty acids detected in bacterial broth using HS- SPME and Shimadzu QP- 2010

GC- MS. ..................................................................................................................128 Table 5.3 List of fatty acid methyl esters detected by GLC. ..........................................................131 Table 5.4 Inhibition zone of Lactobacillus isolates against E. coli for each supernatant treatment.134 Table 5.5 Inhibition zone of Lactobacillus isolates against E. aerogenes for each supernatant

treatment. ..............................................................................................................135 Table 5.6 Inhibition zone of Lactobacillus isolates against S. menston for each supernatant

treatment. ..............................................................................................................136 Table 5.7 Inhibition zone of Lactobacillus isolates against S. aureus for each supernatant

treatment. ..............................................................................................................137 Table 5.8 Inhibition zone of Lactobacillus isolates against L. monocytogenes for each

supernatant treatment. ..........................................................................................138

xiv

List of Figures

Figure 4.1 Flowchart illustrating isolation, purification and storage of isolates for future use as stock cultures. ......................................................................................................... 69

Figure 4.2 Carbohydrate utilization of isolates. Purple colour indicates a negative (no carbohydrate metabolism) result, while a colour change from purple to yellow indicates a positive (carbohydrate metabolism) result. ............................................. 73

Figure 4.3 Test for haemolytic activity. Negative control no culture (top), Salmonella and Listeria positive controls (middle) and Lactobacilli RC 2 (bottom) as a typical example for all isolates examined. ................................................................................................... 74

Figure 4.4 Lactobacilli isolates MI 7, MI 10, RC 13 and RC 25 as typical examples of growth of isolates on MRS agar. ............................................................................................... 77

Figure 4.5 Lactobacilli isolates MI 6, MI 10, RC 13 and RC 30 as typical examples of isolate Gram staining. .................................................................................................................. 78

Figure 4.6 Growth (optical density) of dairy food (MI) and bovine rumen (RC) isolates at various pH after 24 h. .......................................................................................................... 80

Figure 4.7 Growth (optical density) of dairy food (MI) and bovine rumen (RC) isolates at bile salt concentrations after 24 h. ........................................................................................ 82

Figure 4.8 Agarose gels of PCR products obtained from primer Aci I and Aci II primer. M denotes 1kb plus DNA ladder. In (A) lane 1-MI 7, lane 2-MI 10, lane 3-MI 13, lane 4- MI 17, lane 5- MI 18 and lane 6- non template control. In (B) lane 1- MI 6, lane 2- MI 20, lane 3- RC 2, lane 4- RC 5 and lane 5- non template control. In (C) lane 1- RC 7, lane 2- RC 13, lane 3- RC 25, lane 4- RC 30 and lane5- non template control. ..................... 83

Figure 4.9 Agarose gels of PCR products obtained from primer Pr I and Pr II primer. M denotes 1kb plus DNA ladder. In (A) lane 1-MI 7, lane 2-MI 10, lane 3-MI 13, lane 4- MI 17, lane 5- MI 18 and lane 6- non template control. In (B) lane 1- MI 6, lane 2- MI 20, lane 3- RC 2, lane 4- RC 5 and lane 5- non template control. In (C) lane 1- RC 7, lane 2- RC 13, lane 3- RC 25, lane 4- RC 30 and lane 5- non template control. .................... 84

Figure 4.10 Agarose gels of PCR products obtained from primer 16-1A and 23-1B primer. M denotes 1kb plus DNA ladder. In (A) lane 1-MI 7, lane 2-MI 10, lane 3-MI 13, lane 4- MI 17, lane 5- MI 18 and lane 6- non template control. In (B) lane 1- RC 2, lane 2- RC 7, lane 3- RC 13, lane 4- RC 30 and lane 5- non template control. In (C) lane 1- MI 6, lane 2- MI 20, lane 3- RC 2, lane 4- RC 25 and lane 5- non template control. .............. 84

Figure 4.11 Sequence obtained by amplification of the 16S- 23S rRNA gene (intergenic spacer region) of Lactobacillus isolate MI 6 using primers 16-1A (F) and 23-1B (R). A PCR product of approximately 715 bp was amplified. ...................................................... 86



Figure 4.14 Sequence obtained by amplification of the 16S- 23S rRNA gene (intergenic spacer region) of Lactobacillus isolate MI 13 using primers 16-1A (F) and 23-1B (R). A PCR product of approximately 1049 bp was amplified. .................................................... 89


Figure 4.16 Sequence obtained by amplification of the 16S- 23S rRNA gene (intergenic spacer region) of Lactobacillus isolate RC 2 using primers 16-1A (F) and 23-1B (R). A PCR product of approximately 726 bp was amplified. ...................................................... 91

xv





Figure 5.1 One- dimensional SDS- PAGE protein profile of whole cell proteins from MI 13 culture. The marked bands highlighted in lanes 4 and 5 showed changes in protein expression. Protein ladder marker (M); reference culture grown in standard MRS broth sampled after 24 h (lane 1); culture grown in standard MRS broth sampled after OD reaches 1.5- 2 approx. 8- 10 h (lane 2 and 3); culture grown in MRS broth of pH 3.5 a and pH 3.5 b sampled at 16 h (lane 4 and 5); culture grown in MRS broth containing 3.5% bile salts a and 3.5% bile salts b sampled at 16 h (lane 6 and 7). ......124

Figure 5.2 One- dimensional SDS- PAGE protein profile of cytosolic proteins from MI 13 culture. The marked bands highlighted in lanes 4, 5, 6 and 7 showed changes in protein expression. Protein ladder marker (M); reference culture grown in standard MRS broth sampled after 24 h (lane 1); culture grown in standard MRS broth sampled after OD reaches 1.5- 2 approx. 8- 10 h (lane 2 and 3); culture grown in MRS broth of pH 3.5 a and pH 3.5 b sampled at 16 h (lane 4 and 5); culture grown in MRS broth containing 3.5% bile salts a and 3.5% bile salts b sampled at 16 h (lane 6 and 7). ......125

Figure 5.3 One- dimensional SDS- PAGE protein profile of whole cell proteins from RC 2 culture. The marked bands highlighted in lanes 4, 5, 6 and 7 showed changes in protein expression. Protein ladder marker (M); reference culture grown in standard MRS broth sampled after 24 h (lane 1); culture grown in standard MRS broth sampled after OD reaches 1.5- 2 approx. 8- 10 h (lane 2 and 3); culture grown in MRS broth of pH 3.5 a and pH 3.5 b sampled at 16 h (lane 4 and 5); culture grown in MRS broth containing 3.5% bile salts a and 3.5% bile salts b sampled at 16 h (lane 6 and 7). ......126

Figure 5.4 One- dimensional SDS- PAGE protein profile of cytosolic proteins from RC 2 culture. The marked bands highlighted in lanes 4, 5, 6 and 7 showed changes in protein expression. Protein ladder marker (M); reference culture grown in standard MRS broth sampled after 24 h (lane 1); culture grown in standard MRS broth sampled after OD reaches 1.5- 2 approx. 8- 10 h (lane 2 and 3); culture grown in MRS broth of pH 3.5 a and pH 3.5 b sampled at 16 h (lane 4 and 5); culture grown in MRS broth containing 3.5% bile salts a and 3.5% bile salts b sampled at 16 h (lane 6 and 7). ......127

Figure 5.5 Different volatile fatty acid compounds produced by MI 13 and RC 2 under standard and pH and bile salts stress conditions. Columns with different letters differ significantly (p<0.05). ..............................................................................................129

Figure 5.6 Types of fatty acid methyl esters produced by MI 13 and RC 2 under standard and pH and bile salts stress conditions. Columns with different letters differ significantly (p<0.05). .................................................................................................................132

Figure 5.7 Gram stain images showing adhesion of lactobacilli isolates and E. coli on 2 week Caco- 2 cell cultures observed under oil-immersion (100x) microscope. A- rumen isolate, L. plantarum 16, B- dairy isolate, L. rhamnosus LOCK 908, C- E.coli, D- rumen isolate, L. plantarum 16 and E.coli, E- dairy isolate, L. rhamnosus LOCK 908 and E. coli. ........................................................................................................................160

Figure 5.8 Average number of adhered bacteria to two week old Caco- 2 cells. Standard error of the mean bars (n=4). ...............................................................................................161

xvi

SYMBOLS AND ABBREVIATIONS

The following abbreviations have been used throughout this thesis:

% percentage

µg microgram

µl microlitre

0C degree Celsius

1 DE one dimensional gel electrophoresis

ACVM Agricultural Compounds and Veterinary Medicine

ATCC American Type Culture Collection

ATP adenosine triphosphate

BATH bacterial adherence to hydrocarbons

BCA bicinchoninic acid

BHI brain heart infusion medium

BLASTN basic local alignment search tool for nucleic acids

BSA bovine serum albumin

BWG body weight gain

CFS cell free supernatant

CFU colony forming unit

DIGE difference gel electrophoresis

DNA deoxyribonucleic acid

dNTPs deoxyribose nucleotide triphosphates

EDTA ethylene diamine tetra acetic acid

EI electron impact

ESR Institute of Environmental Science and Research

eV electron volt

xvii

FAO Food and Agriculture Organization

FCR feed conversion ratio/ rate

FID flame ionisation detector

FAME fatty acid methyl esters

g gram

GC- MS gas chromatography- mass spectrophotometry

GLC gas liquid chromatography

GOS galacto oligo saccharides

GRAS generally regarded as safe

h hour

HCL hydrochloric acid

HS- SPME headspace- solid phase micro extraction

Hsps heat shock proteins

kDa kilodalton

LAB lactic acid bacteria

LRI linear retention indices

M molar

mg milligram

MgCl2 magnesium chloride

min minute

ml millilitre

mM millimolar

MPI Ministry for Primary Industries

MRS de Man, Rogosa and Sharpe medium

MW molecular weight

N normality

xviii

NA nutrient agar medium

NaCl sodium chloride

NaOH sodium hydroxide

NCBI National Centre for Biotechnology Information

nm nano meter

NSLAB non starter lactic acid bacteria

NZ New Zealand

OD optical density

PAGE polyacrylamide gel electrophoresis

PBS phosphate buffered saline

PCR polymerase chain reaction

pH potential hydrogen

RBCs red blood cells

RO reverse osmosis

rpm rotations per minute

rRNA ribosomal ribo nucleic acid

s second

SDS sodium dodecyl sulfate

sps. species

subsp. sub- species

TBE tris/ borate/ EDTA buffer

Tris 2- Amino- 2- hydroxymethyl- propane- 1, 3- diol

UK United Kingdom

USA United States of America

uv ultra- violet

V volt

xix

VFA volatile fatty acids

w/ v weight by volume

WHO World Health Organization

WR working reagent

20

Chapter 1

Introduction

1.1 Thesis structure

This thesis comprises of six chapters. Chapter one contains a concise summary of the

research study and states the research objectives. Chapter two includes a comprehensive

literature review notable in this field of research. A published review article on antibiotics

has also been included at the end of this chapter. Chapter three lists the materials and

provides a brief description of the methods used in this research. Chapters four and five are

experimental chapters, which have been published/ submitted/ drafted for publication prior

to the submission of this thesis to journals. In these chapters the experimental methodology

have been explained in greater detail, than which is allowed in the journal articles. The peer

reviewed published/ submitted/ drafted papers are assigned at the end of the respective

chapters. In chapter six, all the results from the experimental chapters have been brought

together for discussion and overall conclusions. This chapter ends on a note suggesting

future directions for taking this work forward.

1.2 Significance of this research

Lactic acid bacteria (LAB) are widely used as probiotics in the agro- food industry. The

use of probiotics to improve overall wellbeing of humans and animals is increasing sharply.

There have been extensive studies describing screening characteristics of potential probiotic

lactobacilli from diverse sources such as traditional dairy food, swine origin, cheese, infant

gut microbiota etc. (Bao et al. 2010; Guo et al. 2010; Zago et al. 2011; Kirtzalidou et al.

2011). However, not enough work has been done describing the comparison of probiotic

properties of isolates coming from different origins. Therefore this research was undertaken

to compare the potential probiotic characteristics of LAB isolates belonging to two different

environments. Bovine rumen isolates were well adapted to grow and survive in the ruminant

digestive system while the dairy food isolates were capable of surviving the food processing

conditions.

21

This PhD research exploits the probiotic potential of LAB isolates using in vitro

screening tests and at the same time study the characterization of specific probiotic

properties. Not all LAB can be used in probiotic applications. They have to be first screened

for probiotic abilities in vitro, followed by in vivo studies; before use as probiotics.

Investigating the probiotic abilities, stress responses, adhesion and permeability studies of

the isolates form a crucial part of this research. 1D SDS PAGE proteomic profiles, fatty acid

profiles and metabolomic profiles of selected lactobacilli isolates under standard growth

conditions and stress conditions have been developed; all the above mentioned features

cannot be studied by the use of genomics.

1.3 Research objectives

This thesis investigates commercially available dairy foods and the bovine rumen as

sources of novel probiotic bacteria. The objectives of the thesis were to isolate and screen

for promising novel probiotic bacteria. Four key objectives of the thesis were as follows:

The research undertaken for this PhD attempted to isolate potential probiotic

organisms form commercial dariy foods and the bovine rumen. Commercial dairy foods

labelled as containing probiotics were excluded from this research. Thus any potential

probiotics isolated would be microorganims that had not been intentially introduced but

rather endigenous to the system form with they were recovered. This includes, for example

the non- starter lactic acid bacteria (NSLAB) which dominate the cheese microbiota and

contribute to the development of final characteristics of cheese during ripening stage.

Objectives

Objective 1: Isolation of potential probiotic bacteria from two sources

Objective 2: Preliminary screening of isolates

Objective 3: Identification and selective screening of the ten most promising isolates

Objective 4: Final characterisation of one isolate from the dairy food and the bovine

rumen for specific properties

22

1.3.1 Isolation of potential probiotic bacteria from two sources

Commercial dairy food was identified as a potential source for probiotic bacteria due

to such products being widely reported in the literature to contain such bacteria. The bovine

rumen was identified as a potential source of probiotic bacteria as it has received far less

attention than other sources such as commercial dairy food and would possibly produce a

novel probiotic that would be ideally adapted for use in farmed livestock. Screening

identified twenty and thirty isolates from commercial dairy foods and the bovine rumen

respectively. It was likely more could have been isolated, however; the total number of fifty

was deemed likely to be a suitable pool from which potential novel probiotic bacteria could

be isolated. Chapter 4 provides a detailed explanation of the origin of isolates and the

isolation techniques adopted.

1.3.2 Preliminary screening of isolates

Isolates were categorised as LAB depending on their colony morphology and Gram

stain nature. Twenty from dairy food and six from the bovine rumen were further

characterized by pH and bile salt tolerance. The preliminary tests undertaken in selection of

potential candidates for further investigation has been explained in chapter 4 of this thesis.

1.3.3 Identification and selective screening of the ten most promising isolates

Five each form dairy food and the bovine rumen were characterized for their

antibiotic, antimicrobial and haemolytic activity, different pH and bile salt concentrations,

adhesion (BATH test), carbohydrate fermentation, and species identification by polymerase

chain reaction (PCR) amplification followed by sequence comparison using basic local

alignment search tool for nucleic acids (BLASTN). The details of the screening tests adopted

have been described in chapter 4.

1.3.4 Final characterization of one isolate from the dairy food and the bovine rumen for specific properties

Six specific properties of the final two lactobacilli isolates were further characterized

and studied in detail in chapter 5. This included the adhesion and permeability studies using

23

Caco- 2 cells, one dimensionl sodium dodecyl sulphate polyacrylamide gel elctrophoresis (1D

SDS PAGE) proteomic profiles, comparison of volatile fatty acids (VFA) produced, comparison

of the fatty acid methyl esters (FAME) profiles and determination of antimicrobial

compounds production.

24

Chapter 2

Review of Literature

2.1 Probiotics

Microorganisms have been used for many centuries to preserve foods, although only

in the previous century has the science of this process been understood. Elie Metchnikoff, a

Russian scientist working at the Pasteur Institute in Paris is credited with calling attention to

the health benefits of yoghurt. His hypothesis was that LAB in the yoghurt counteracts the

harmful putrefying bacteria in the intestines. Metchnikoff’s work can be regarded as the

birth of probiotics, i.e. microbes ingested with the aim of promoting good health. In this

respect, probiotics are gaining widespread recognition as new prevention strategies or

therapies for multiple gastrointestinal diseases. Some LAB strains have clearly been shown

to exert beneficial health effects. However, these effects are known to be strain specific and

the underlying molecular mechanisms remain poorly understood (Senok et al. 2005;

Oelschlaeger 2010). Therefore, scientific evidence that would help understand the

mechanisms behind the activities of probiotics that stand the best chance of success are of

great interest. This includes data from epidemiological studies, in vitro and in vivo trials, as

well as from mechanistic, genomic and proteomic studies (Hamon et al. 2011). Proteomics

helps in understanding the biological functions by linking the genome and the transcriptome.

Comparative proteomics can be used in the protein identification and obtaining proteomic

patterns, which will one day serve as bacterial biomarkers for probiotic features (Izquierdo

et al. 2009).

2.1.1 Definition of probiotics

The word ‘probiotic’ is derived from the Greek word meaning ‘for life’ and it has had

several different meanings over the years. It was first used by (Lilly & Stillwell, 1965) to

describe substances secreted by one microorganism which stimulated the growth of

another. It was not until 1974 that Parker defined it as ‘organisms and substances which

contribute to intestinal microbial balance.’ In an attempt to improve this definition, Fuller in

1989 redefined probiotics as ‘a live microbial feed supplement which beneficially affects the

25

host animal by improving its intestinal microbial balance.’ However among the scientific

community the term ‘probiotic’ is much more complex and diverse. An expert panel

commissioned by Food and Agriculture Organization (FAO) and the World Health

Organization (WHO) defined it as: “live microorganisms”, which, when administered in

adequate amounts confers a health benefit on the host (FAO & WHO, 2001). To observe a

positive health benefit from consumption, a minimum level of microorganisms is required:

this level depends on the strain used and the required health benefit. The dose

recommended is usually between 109- 1011 CFU/ day (Mombelli & Gismondo, 2000).

2.1.2 Ideal probiotic characteristics

An effective probiotic is required to operate under a variety of different

environmental conditions and to survive in many different forms. There are many

parameters used for screening probiotics, which ones are used depend on the intended

application of a probiotic in a specific target population (Saarela et al. 2000; Mercenier et al.

2008). Common assessments reported in the literature have been employed to support the

following properties; tolerance to acid and bile salts, adhesion to mucosal and epithelial

linings, exhibition of antimicrobial activity towards pathogens, should not cause lysis of RBCs

in vivo, and production of lactic acid. Probiotic assessment may identify the potential

capability to influence local metabolic activity: for example, ability to stimulate intestinal

mucosal lactase activity which can prevent some types of diarrhoea, stimulation of the

immune system and capable of anti- carcinogenic activity (Vimala & Dileep, 2006; Gupta &

Garg, 2009; Kechagia et al. 2013). Keeping this in mind, a combined list of criteria for ideal

probiotic bacteria has been developed and this is listed in Table 2.1.

2.1.3 Probiotic bacteria in use

The first step in the selection of microbial strains for probiotic use: it must be

representative of microorganisms that are Generally Regarded as Safe (GRAS). It includes

lactic acid producers like Lactobacillus, Bifidobacterium, Streptococcus, Enterococcus,

Leuconostoc and Pediococcus species (Fellix & Dellaglio, 2007; Kleerebezem & Vaughan,

2009). Lactobacillus and Bifidobacterium are the two prominent groups which are frequently

employed in foods (Klaenhammer & Kullen, 1999; Vankerckhoven et al. 2008; Seale & Miller,

26

2013). They occupy different ecological positions in the human gastrointestinal tract.

Lactobacilli are normal inhabitants of intestine, whereas, bifidobacteria reside in the colon

(Wang et al. 2012). For the list of the most common probiotic strains in use, see Table 2.2.

Table 2.1 General screening criteria for an ideal probiotic microorganism (modified from Gupta & Garg, 2009). Those highlighted in bold have been selected as key characteristics for evaluation in this thesis.

High cell viability, they must be resistant to low pH and acids.

Ability to persist in the intestine even if the probiotic strain cannot colonize the gut.

Adhesion to the gut epithelium to cancel the flushing effects of peristalsis.

They should be able to interact or send signals to the immune cells associated with the gut.

They should be a normal inhabitant of the species targeted: for example, human

probiotics should be of human origin.

Should be non- pathogenic.

Resistance to processing.

Probiotics must be safe, for example should not cause lysis of red blood cells. This is a pre-

screening tool that helps identify isolates with haemolytic activity from further study.

They should be genetically stable.

Must have capacity to influence local metabolic activity.

Efficacy is proven in well- designed, placebo controlled clinical trials.

Ease of large scale commercial production and distribution.

27

Table 2.2 Lactobacillus, Bifidobacterium and other genera bacteria and yeast species reported as probiotics (modified from Gupta & Garg, 2009).

Lactobacillus Bifidobacterium

Other

L. acidophilus B. adolescentis Enterococcus faecalis

L. casei B. animalis E. faecium

L. crispatus B. bifidum Pediococcus. acidilactici

L. gasseri B. infantis Bacillus cereus

L. johnsonii

(L. paracasei)

B. lactis B. subtilis

L. reuteri Saccharomyces boulardii

L. rhamnosus S. cerevisiae

L. lactis

L. bulgaricus

L. helveticus

2.1.3.1 Lactobacilli species

Lactobacilli have long been the most prominent probiotic microorganisms because of

their association with popular fermented dairy products. Lactobacilli are Gram- positive rods

and part of the large group of lactic acid producing bacteria. Human strains of lactobacilli

usually are part of the normal microflora of mouth, lower small intestine, colon and vagina.

Fermentation of carbohydrates by lactobacilli produces lactic acid, so it survives well in

acidic environments like stomach. They are rarely pathogenic (Ammor et al. 2006).

L. rhamnosus GG is the most studied lactobacilli probiotic. It was first isolated in 1987

by Gorbach and Goldin (hence GG) from the faeces of a healthy human. This strain is stable

in bile and acid and adheres to intestinal cells in vitro. It survives passage through the

stomach and intestinal tract. Another useful property of this strain is the modulation of

specific enzymes, for example feeding L. rhamnosus GG to healthy volunteers for four weeks

decreased faecal β- glucuronidase specific activity (Goldin et al. 1992).

28

The strains of L. reuteri are widespread in nature and can be isolated from a variety

of food products, animals and the human gastrointestinal tract (Lionetti et al. 2006). It

appears to survive passage through the human digestive tract and persists for at least a

week after stopping ingestion.

L. acidophilus is widespread in commercially available probiotic products. It is found

in fermented dairy products and is part of normal intestinal and vaginal microflora.

However, properties of adherence and stability in the gastrointestinal tract are strain

specific. Several L. acidophilus strains have been shown to produce antimicrobial substances

in vitro, but production in vivo at levels high enough for a direct inhibition of pathogen

growth has not been demonstrated (Sanders & Klaenhammer 2001).

L. casei is a Gram- positive, rod shaped, non- sporing, non- motile, anaerobic bacteria

which lacks cytochromes. The lactic acid produced by it is used to make cheese and yoghurt,

reduce cholesterol level, enhance immune response, control diarrhoea, alleviate lactose

intolerance and inhibit intestinal pathogens (Mishra & Prasad, 2005). Similar to L.

acidophilus, the probiotic properties of L. casei are strain specific. L. casei strain Shirota has

received much commercial attention. It’s effectiveness against Escherichia coli was shown in

mouse models for treatment of urinary tract infections (Asahara et al. 2001), reduction of

influenza virus titres in aged mice (Hori et al. 2002), against Listeria monocytogenes

infections in rats (de Waard et al. 2002) and reduction of ulcer causing Helicobacter pylori in

humans (Sgouras et al. 2004).

2.1.3.2 Bifidobacteria species

Bifidobacteria are Gram- positive, strict anaerobic, lactic and acetic acid producing

bacteria, present in normal flora and are the major component in the intestinal flora of

breast- fed infants. They are used in different conditions such as diarrhoea, immune

stimulation, as anti- mutagens and anti- cholesterol agents. It also plays an active role in the

de- conjugation of bile acid, catabolism of dietary carbohydrates and vitamin synthesis. In

vivo, they are used to restore the immune defence in children (Mombelli & Gismondo,

2000).

29

2.1.3.3 Enterococcus faecium

A well- studied strain of Enterococcus is E. faecium SF68, which is marketed as

Bioflorin. This microbe is found in healthy adults, capable of producing lactic acid, survives in

an environment of low pH, resists antibiotics and inhibits pathogens (Surawicz, 2003). Other

strains of E. faecium are pathogenic and resistant to most antibiotics. Although strain SF68 is

non- toxic, there has been concern that the probiotic might pick up and share antibiotic

resistance genes in the human gut (Lund & Edlund, 2001). Cats and dogs which were fed

with E. faecium SF68, showed fewer episodes of diarrhoea when compared with controls.

This indicates that the probiotic has beneficial effects on the gastrointestinal tract (Bybee

et al. 2011).

2.1.3.4 Saccharomyces boulardii

Saccharomyces boulardii is a well- studied, commercially available yeast probiotic.

Unlike the lactobacilli, S. boulardii is not usually found in the gastrointestinal or vaginal

tracts. It grows best at 37 0C and survives passage into the faeces in both humans and

animals. It does not strongly adhere to intestinal mucosa and is eliminated within one to

three days if not re- administered. Being a yeast, it is not directly affected by antibacterial

antibiotics, so it can be given simultaneously during antibiotic therapy. However, it can be

adversely affected by antifungal therapy if taken at the same time. The clinical activity of S.

boulardii is especially relevant to antibiotic- associated diarrhoea and recurrent Clostridium

difficile intestinal infections. Experimental studies clearly demonstrate that S. boulardii has

specific probiotic properties, and recent data has opened the door for new therapeutic uses

of this yeast as an ‘immunobiotic’ (Czerucka et al. 2007).

2.1.4 Foods containing probiotics

Probiotics can be bacteria, moulds or yeast. But most probiotics are bacteria. A

probiotic may be made out of a single bacterial strain or it may be a consortium as well.

Probiotics can be in powder form, liquid form, gel, paste, granules or even as capsules,

sachets, etc. (Suvarna & Boby, 2005; Timmerman et al. 2004). Examples of foods containing

probiotics in market are yoghurt, fermented and unfermented milk, miso, tempeh, kefir,

30

aged cheese, dark chocolate, pickled vegetables, sausages, sauerkraut, some juices and soy

beverages.

31

2.2 Safety of probiotics: routine screening tests adapted

Live microorganisms are used in probiotic preparations. Although, the bacteria used

belong to the GRAS category, the possibility of infection resulting from these bacteria cannot

be ignored. The GRAS requirements are not specific for a particular microorganism. It is

dependent on the intended application and the governing authority. Requirements can

include history of safety, genetic stability of the microbe, testing for virulence genes, ability

to produce toxins, presence of transferable resistance genes etc. In New Zealand,

Agricultural compounds and Veterinary Medicine (ACVM) of Ministry for Primary Industries

(MPI) is responsible for GRAS approval. This research study is limited to only screening and

identification of potential probiotic candidates from two different sources. One of the

studies has recommended that the use of bacteria other than Lactobacillus species should

be strongly discouraged (Bjarnason et al. 1995). Another study based on different reports

suggested that the risk of infections associated with probiotic bacteria is similar to

commensals. However, the degree of risk with probiotic bacteria is lower in comparison to

other pathogenic groups of bacteria. This is said keeping in mind not only the healthy

consumers but also the immune- compromised customers (Ouwehand & Vesterlund, 2003).

Therefore, FAO/ WHO recommends probiotic food manufacturers and pharmaceuticals

producing probiotic based capsules to adopt standard screening techniques. This helps to

minimise the chances of risk and render general safety of the probiotic product. Antibiotic

resistance, haemolytic activity and antimicrobial activity are examples of commonly

employed screening tests to ensure the safety of probiotic bacteria. More information on

antibiotic resistance, the types, mechanisms and implications on probiotic bacteria can be

found in the review paper titled “Implications of antibiotic resistance in probiotics.” The

review paper has been attached at the end of this chapter (Jose et al. 2015b). In addition,

testing for pH tolerance, bile salts tolerance and ability to adhere are key selective tests

which are used for screening potential probiotic candidates.

2.3 Applications of probiotics

Antibiotics, also synonymously called antibacterials, are in use for the treatment of

bacterial infections in humans, as growth promoters in poultry and livestock, and also in

agriculture for controlling animal and plant pathogens (Ammor et al. 2007). The antibiotics

kill the invasive pathogen or inhibit their growth to control infection. According to the World

32

Health Organization, the increased and inappropriate use of antibiotics has led to

development of resistant bacteria (e.g., vancomycin resistance exhibited by Pediococcus and

Leuconostoc species). As a result, the drug discoveries that were considered as

breakthroughs of science in the last century might be lost due to profound and rapid

advancement of antibiotic resistance in bacteria. If this trend continues, in the coming years

people may have infections that are harder to treat and antibiotic therapy will no longer be

effective; thus, we might head into a postantibiotic era. This problem can be addressed to a

certain extent by supplementing food products and animal feed with probiotics instead of

antibiotics.

2.3.1 Human health benefits

Probiotic bacteria are living microbial food ingredients which have a beneficial effect

on human health. These effects are attributed to the normal restoration of increased

intestinal permeability and unbalanced gut microbiota, improvement of the intestine’s

immunological barrier functions and alleviation of the intestinal inflammatory response

(Isolauri et al. 2004). The effects of probiotics have been directly observed in some cases, in

others it has been suggested on the basis of in vitro studies and from experimental animal

models (Mombelli & Gismondo, 2000). For examples of various human health benefits of

probiotics, see Table 2.3.

33

Table 2.3 Proposed mode of action on human health and wellbeing for a limited list of probiotic bacteria.

Probiotic bacteria Proposed mode of action

Lactobacillus acidophilus LC1

Immune enhancing; vaccine adjuvant; adherence to human intestinal cells; balancing of intestinal microflora (Bernet et al. 1994).

L. acidophilus NFCO1748

Lowering of faecal enzymes; prevention of radiotherapy related diarrhoea; treatment of constipation (Lidbeck et al. 1992).

L. casei Shirota Prevention of intestinal disturbances; balancing of intestinal bacteria; lowering of faecal enzyme activities; inhibition of superficial bladder cancer (Aso & Akazan, 1992; Aso et al. 1995).

L. gasseri (ADH) Faecal enzyme reduction; survived in intestinal tract (Pedrosa et al. 1995).

L. acidophilus Significant decrease of diarrhoea in patients receiving pelvic irradiation; decreased polyps; lowered serum cholesterol levels (Marteau et al. 2001; Ouwehand et al. 2002).

L. plantarum Reduced incidence of diarrhoea in day care centres when administered to only half of the children; especially effective in reducing inflammation in inflammatory bowel; reduced pain and constipation of irritable bowel syndrome; reduced bloating, flatulence and pain in irritable bowel syndrome in controlled trial; positive effect on immunity in HIV + children (Ribeiro & Vanderhoof, 1998; Schultz & Sartor, 2000, Vanderhoof, 2001, Nobaek et al. 2000

L. reuteri Shortened the duration of acute gastroenteritis; shortened acute diarrhoea (Marteau et al. 2001; Shornikova et al. 1997).

L. rhamnosus Enhanced cellular immunity in healthy adults in controlled trial (Sheih et al. 2001).

L. salivarius Suppressed and eradicated Helicobacter pylori in tissue cultures & animal models by lactic acid secretion (Hsieh et al. 2012).

L. johnsonii Reduced candidal vaginitis (Hilton et al. 1992).

L. reuteri Reduces gingivitis and decreases gum bleeding (Krasse et al. 2006).

Bifidobacteria species Reduced incidence of neonatal necrotizing enterocolitis (Caplan & Jilling, 2000).

Enterococcus faecium Decreased duration of acute diarrhoea from gastroenteritis (Marteau et al. 2001).

Lactobacillus brevis, L. lactis, Enterococcus faecium, Weissella species

Inhibits growth and attachment of uropathogens to uroepithelial cells (Reid et al. 2001).

34

2.3.2 Farmed livestock applications

Studies have reported that in chickens, the intestinal microbiota comprises of LAB,

which includes mainly species of Lactobacillus and Enterococcus (Lan et al. 2003). In recent

years considerable interest has been shown in using some probiotic microorganisms and

organic acids as an alternative to the use of antibiotics in feeds (Guerra et al. 2007). The

selection of therapeutically efficacious probiotic cultures with marked performance benefits

like improved production, delivery and clinical efficacy is possible (Tellez et al. 2012).

Growing awareness on health, has created the need for quality food products, which are

free of drug residues and pharmaceutical metabolites (Dalloul & Lillehoj, 2006). For various

applications of probiotics in poultry, see Table 2.4. There are several mechanisms by which

probiotics improve the poultry health. Primarily, it is by maintenance of intestinal micro-

flora by competing with pathogens for binding sites and exhibiting antagonistic activity

towards pathogens infecting poultry. Neutralizing the enterotoxins secreted by pathogenic

bacteria and stimulating the immune response of the animal is another mode of action (Jin

et al. 1998).

Antibiotics have been widely used to promote growth of cattle. For newborn calves,

administration of antibiotics is useful to prevent infections caused by pathogenic bacteria.

However, its use can have serious consequences, such as the development of resistant

populations of bacteria. Subsequent use of the same antibiotics for therapy may be

ineffective. Also, residual antibiotics in dairy foods, meat, eggs and milk are unacceptable. In

such a scenario, replacement of antibiotics with probiotics for use as growth promoters in

cattle looks promising (Frizzo et al. 2011). Since 2006, the European ban on using antibiotic

growth promoters in cattle, has led to an increase in the use of probiotics in place of

antibiotics. This is gaining the attention of researchers (Abe et al. 1995). There are several

mechanisms by which probiotic bacteria improves animal health by providing protection

against various pathogens. A few of them includes competitive exclusion for mucosal binding

sites in hosts, production of antimicrobial substances such as bacteriocins, organic acids

and immune response modulation (Ng et al. 2009). Supplementing animal feed with

probiotics helps in promoting overall growth and health of animals. Few noticeable changes

include increase in body weight gain (BWG), better resistance to a number of infections

commonly infecting cattle, increase in milk yield and an increased feed conversion ratio

(FCR) (Irshad, 2006; Perez et al. 2007). For a list of use of probiotics in cattle, see Table 2.4.

35

Table 2.4 Possible probiotic bacteria for farmed livestock and proposed modes of action.

Probiotic Proposed mode of action

Bifidobacterium longum PCB 133

Showed anti- Campylobacter activity both in vitro and in vivo, is an excellent candidate for being employed as additives to feed for poultry for the reduction of food- borne campylobacteriosis in humans (Santini et al. 2010).

Enterococcus faecalis, E. durans, E. faecium, Pediococcus pentosaceus

Showed antimicrobial activity against Salmonella species, Staphylococcus aureus and Escherichia coli (Musikasang et al. 2009).

Enterococcus faecium, Bifidobacterium animalis, L. reuteri, Baacillus subtilis

Increased overall growth performance of broiler chickens infected with Eimeria tenella (Giannenas et al. 2012).

B. pseudolongum (M 602) Increase in immunity; BWG and feed conversion in calves (Namioka et al. 1991).

Lactobacillus species, Streptococcus species

Prevents pathogen access by steric interactions or specific blockage of cell receptors in cattle (McGroarty, 1993).

L. acidophilus (LAC 300) Decrease of diarrhoea by controlling the number of coliforms in intestine and faeces of calves; increase in number of leucocytes in blood of piglets; increase in BWG and FCR in piglets (Gilliland et al. 1980; Pollman et al. 1980).

L. fermentum I 5007 Enhances T- cell differentiation and induce ileum cytokine expression suggesting it could modulate immune function in piglets (Wang et al. 2009).

B. pseudolongum (M 602) Increase in immunity; BWG and feed conversion in calves & piglets (Namioka et al. 1991).

Saccharomyces cerevisiae ssp. boulardii (CNCM I-1079), Pediococcus acidilactici (CNCM MA 18/5 M)

Increase in FCR of piglets and improved LAB/ coliform ratio with dramatical decrease in E. coli counts (Le Bon et al. 2010).

L. fermentum RC-14 Inhibits Staphylococcus aureus infection and bacterial adherence to surgical implants in rats (Gan et al. 2002).

36

2.4 Future developments of probiotic research

In the past few years, proteomics approach has played a significant role in

understanding the molecular basis of probiotic functionality by providing information about

the proteins which aid in the adhesion and adaptation to the gastrointestinal tract

environment. However, till date we have got a limited understanding on how the probiotics

exert the beneficial effects and their species specific mechanisms of action is still an open

challenge to researchers. Proteomic studies carried out on epithelial and immune cells and

meta- proteomics aimed at clarifying the physiological and pathological dynamics of the gut

microbiota, provide new powerful tools to discover the bacteria- host interactions and

health effects benefitted by probiotics. Routinely, the assessment of health effects is done

through biological tests and clinical trials. In this regard, comparative proteomics will help to

develop protein patterns which will associate it with specific probiotic properties, which

could prompt the new and faster in vitro assays in assessing the health effects; thus

replacing the biological tests and clinical trials of today. In the future, this can open up paths

for the design of molecular biomarkers for the identification and selection of innovative

probiotic strains possessing predictable and improved functionality (Siciliano & Mazzeo,

2012).

2.5 Implications of antibiotic resistance in probiotics: review paper

This section has been accepted for publication (Jose et al. 2015b) and is reproduced

on the following pages as orignially published.

Pages 37-47 have been removed due to copyright compliance of published material. They are a reproduction of the following article: Jose, N., Bunt, C., & Hussain, M. (2015). Implications of Antibiotic Resistance in Probiotics. Food Reviews International, 31(1), 52-62. ISSN: 8755-9129 ; E-ISSN: 1525-6103 ; DOI: 10.1080/87559129.2014.961075

48

Chapter 3

Materials and methods

3.1 Materials

3.1.1 Bacterial isolates

The bacterial isolates used in this research study were isolated from two different

sources: fermented dairy food products (details in Table 3.1) and environment/ rumen

contents from a 10 yr old Fresian x Jersey (ID 312) located at the Johnstone Memorial

Laboratory Farm, Lincoln University.

3.1.2 Chemicals

Most of the chemicals used in this research were obtained from Sigma- Aldrich

(Missouri, USA), Invitrogen (Massachusetts, USA) and Oxoid (Hampshire, UK).

3.1.3 Reagents

Gram stain was prepared as follows. Crystal violet (0.025 g) was dissolved in 50 ml of

distilled water. Saffranin (0.025 g) was dissolved in 50 ml of distilled water. Gram’s iodine

was prepared by mixing iodine (1.5 g) and potassium iodide (2 g) in 300 ml of distilled water

and stored in a covered dark bottle.

Bromocresol purple was prepared by dissolving dye (0.6 g) in 100 ml of distilled

water and filter sterilized.

Coomassie brilliant blue stain was prepared by mixing 50% methanol (125 ml), 10%

acetic acid (25 ml), 40% water (100 ml) and 0.1% Coomassie brilliant blue dye (0.25 g).

49

Destain solution was prepared by mixing 50% methanol (125 ml), 10% acetic acid (25

ml) and 40% water (100 ml).

50

Table 3.1 Ingredient lists of fermented dairy food products as stated on the product label.

Meadow Fresh natural yoghurt

(125 g)

Mainland Epicure cheese/ Cheddar

cheese (200 g)

Mainland Camembert

cheese (125 g)

Meadow Fresh low fat milk Milk Milk

Milk Salt Salt

Salt Cultures Cultures

Cultures Enzymes (rennet) Enzyme (non-animal

rennet)

Enzymes (rennet)

Mineral salt (calcium)

Cultures (including acidophilus

and bifidus)

3.1.4 Stock solutions

All solutions and media were prepared using autoclaved water or reverse osmosis

(RO) water and sterilized by autoclaving at 121 0C for 15- 20 min or unless otherwise stated.

Glycerol stock was prepared by autoclaving glycerol (500 ml) at 121 0C for 12- 15

min. It was stored at room temperature and used when required for long term storage of

cultures by mixing with 2 X MRS broth.

5 X TBE buffer (stock solution) was prepared by suspending Tris (54 g), 0.5M (pH 8)

EDTA (20 ml) and boric acid (27.5 g) in 800 ml of distilled water and volume made upto one

litre with distilled water.

1 X TBE buffer (working stock) was prepared by mixing 5 X TBE (200 ml) and distilled

water (800 ml). Autoclaving not necessary.

51

Tween 80 (20% stock) was prepared by dissoving Tween 80 (20 ml/ g) in distilled

water (80 ml) and volume made upto 100 ml.

Sugars: Arabinose, Cellobiose, Fructose, Galactose, Glucose, Glycerol, Lactose,

Maltose, Mannitol, Mannose, Melibiose, Raffinose, Ribose, Sorbitol and Sucrose were

prepared by dissolving (20 g) each in distilled water (80 ml) and volume adjusted to 100 ml.

3.1.5 Buffers

0.3M Phosphate buffer was prepared by suspending sodium dihydrogen phosphate

(30.8 g) and disodium hydrogen phosphate (20.5 g) in one litre of distilled water. The

solution was mixed well with frequent agitation. pH was adjusted to 6.2 with 1M HCL or 1M

NaOH and sterilized in autoclave at 121 0C for 12- 15 min. The buffer was stored at room

temperature.

1 x Phosphate buffered saline (PBS) was prepared by suspending sodium chloride (8

g), potassium chloride (0.2 g), disodium hydrogen phosphate (1.44 g) and potassium

dihydrogen phosphate (0.24 g) in one litre of distilled water. The solution was mixed well

with frequent agitation. pH of the media was 7.4. It was adjusted to pH 1 and pH 5 by

addition of 1 M HCL for the BATH test.

3.1.6 Microbiological media

All media were supplied by Oxoid (Hampshire, UK) except Columbia blood agar plates

and Nutrient agar plates which were supplied by Fort Richard (Auckland, New Zealand)

unless stated otherwise. The media were sterilized by autoclaving at 121 0C for 15- 20 min.

The desired pH of each media was checked and if necessary adjusted before autoclaving.

Generally prepared agar plates were stored under refrigerated conditions and the liquid

media were stored at room temperature unless stated otherwise.

MRS broth was prepared by suspending MRS broth (52 g) in one litre of distilled

water. The solution was mixed well using a magnetic stirrer until complete dissolution. Then

52

it was dispensed into appropriate containers and sterilized in autoclave at 121 0C for 12- 15

min. The autoclaved medium was stored at room temperature. Final pH 6.2 + / - 0.2 at 25 0C.

2 X MRS broth was prepared by suspending MRS broth (104 g) in one litre of distilled

water. The solution was mixed well using a magnetic stirrer until complete dissolution. Then

it was dispensed into appropriate containers and sterilized in autoclave at 121 0C for 12- 15

min. The autoclaved medium was stored at room temperature. Final pH 6.2 + / - 0.2 at 25 0C.

3.1.7 MRS broth substituted with bile salts for bile salts tolerance assay

0.2%, 0.3%, 0.4%, 0.8%, 1.5%, 2%, and 3.5% bile salts were prepared by mixing bile

salts (1, 1.5, 2, 4, 7.5, 10 or 17.5 g respectively) with MRS broth (26 g) in 0.3M phosphate

buffer (500 ml). The solution was mixed well using a magnetic stirrer until complete

dissolution. The medium was sterilized in autoclave at 121 0C for 12- 15 min and stored at

room temperature. Final pH 6.2 + /- 0.2

MRS broth of different pH for pH tolerance assay was prepared by dissolving MRS

broth (26 g) in 0.3M phosphate buffer (pH 7) (500 ml). 1M HCL was added to bring down the

pH of the media to 2, 3, 3.5, 4 and 6.4. The solutions were mixed well using a magnetic

stirrer until complete dissolution. The media were sterilized in autoclave at 121 0C for 12- 15

min and stored at room temperature.

MRS base media for carbohydrate fermentation studies was prepared by mixing

peptone (10 g), yeast extract (5 g), Tween 80 (1 ml/ g), sodium acetate (5 g), Tri ammonium

citrate (2 g), magnesium sulphate (0.2 g), manganese sulphate (0.05 g) and di- potassium

hydrogen phosphate (2 g) to one litre of distilled water. The medium was sterilized in

autoclave at 121 0C for 12- 15 min. Final pH 6.2 + / - 0.2 at 25 0C.

MRS Agar was prepared by mixing MRS broth (52 g) and 1.5% bacteriological agar (15

g) in one litre of distilled water. The solution was mixed well using a magnetic stirrer until

complete dissolution. The medium was sterilized in autoclave at 121 0C for 12- 15 min

53

followed by placing in a water bath at 45- 50 0C to prevent solidification of media. It was

dispensed into petri- plates and stored at 2- 8 0C. Final pH 6.2 + / - 0.2 at 25 0C.

Nutrient agar was prepared by mixing nutrient broth (20 g) and 1.5% bacteriological

agar (15 g) in one litre of distilled water. The solution was mixed well using a magnetic stirrer

until complete dissolution. The medium was sterilized in autoclave at 121 0C for 12- 15 min

followed by placing in a water bath at 45- 50 0C to prevent solidification of media. It was

dispensed into petri- plates and stored at 2- 8 0C. Final pH 7.4 ± 0.2 at 25 0C.

0.1% Peptone water was prepared by dissolving peptone (1 g) in one litre of distilled

water. The solution was sterilized in autoclave at 121 0C for 12- 15 min and stored at room

temperature.

BHI Broth was prepared by dissolving BHI (18.5 g) in 500 ml of distilled water The

medium was mixed well using a magnetic stirrer until complete dissolution. It was sterilized

in autoclave at 121 0C for 12- 15 min and stored at room temperature. Final pH 7.4 + /- 0.2

3.1.8 Antibiotic discs

The antibiotic discs manufactured by Oxoid (Hampshire, UK), BD BBLTM (Becton

Dickinson and Company, New Jersey, USA) and BBLTM (New Jersey, USA) were used. The list

of the antibiotics and the concentrations used are listed in Table 3.2.

54

Table 3.2 Antibiotic, abbreviation and concentration (g) per disk as used for the antibiotic sensitivity of each lactic acid isolate.

Name of antibiotic Abbreviated form Amount in µg

Ampicillin AMP 10

Streptomycin ST 10

Ciprofloxacin CIP 5

Vancomycin VA 30

Chloramphenicol C 30

Gentamycin CN 10

Nalidixic acid NA 30

Erythromycin E 15

Tetracycline TE 30

Fusidic acid FA 10

Kanamycin K 30

3.1.9 Oxidase strips

The Oxoid MicrobactTM Identification kit (Oxoid, Hampshire, UK) was used as

supplied.

3.1.10 Pathogens

Five pathogens were used in testing the antimicrobial activity of the lactic acid

bacterial isolates. For the list of pathogens used, see Table 3.3.

55

Table 3.3 Pathogen and source as used to test sensitivity of each lactic acid isolate.

Name of pathogen Source

Escherichia coli ESR (The Institute of Environmental Science and Research, New

Zealand)

Enterobacter aerogenes NCTC1006 (ATCC 13048, DSM 30053, NCIMB 10102). Type strain

(Medium 137C)

Staphylococcus aureus ESR (The Institute of Environmental Science and Research, New

Zealand)

Salmonella menston ESR (The Institute of Environmental Science and Research, New

Zealand)

Listeria monocytogenes LM

V7

ESR (The Institute of Environmental Science and Research, New

Zealand)

3.1.11 Standards and working solutions for VFA analysis using GC- MS

Aroma standards All the seven standards used to generate standard curves for

quantitative analysis, were obtained from commercial suppliers Sigma- Aldrich New Zealand

Ltd and Merck New Zealand Ltd. The four deuterated standards used were purchased from

Sigma- Aldrich and CDN isotopes (SciVac PTY. Ltd, Hornsby NSW, Australia).

Standard and Working Solutions Primary standard solutions were prepared in 10 %

ethanol (Scharlau Chemie SA, HPLC Grade ACS ISO UV-vis) for 5 of the 7 VFA compounds and

2 of the 4 deuterated VFA compounds. Primary standards were made in 100% ethanol for

octanoic acid and d2-octanoic acid due to low aqueous solubility. All primary standard

solutions were stored in amber bottles in a freezer at -20 0C.

A concentrated composite working standard was then made by adding appropriate

amounts of the primary standards for the individual compounds to a solution of 20% ethanol

in deionised water. This composite standard was then split into small amber vials and stored

at -20 0C until it was used.

Standards for GC- MS analysis we prepared on the day by serially diluting a top

standard, which was made up in a deionised water matrix from the concentrated composite

56

working standard. Each standard vial was prepared in duplicate and made up in a 5 g L-1

tartaric acid buffered at pH 3.5.

A concentrated composite working internal standard was also made by adding

appropriate amounts of the primary standards for the individual deuterated compounds to a

solution of 10% ethanol in deionised water. This composite internal standard was then split

into small amber vials and stored at -20 0C until it was used.

3.1.12 Reagents and standards for FA analysis using GLC

Solvents Methanol- HPLC grade, Fisher Scientific, Auckland New Zealand.

Hexane- ChromasolR 95%, Sigma- Aldrich, Auckland, NZ.

Solids Sodium hydroxide- BDH Laboratory Supplies, UK.

Acids Hydrochloric acid- Fisher Scientific, Auckland, NZ.

Standards Reference standards- Tridecanoic acid 98% p/n T0502, Sigma-Aldrich,

Auckland New Zealand. GLC463 purchased from Nuchek Prep Inc., Minnesota, U.S.A. Two

Alkane standard solutions C8- C20, p/n 04070- 1ml and C21- C40, p/n 04071- 1ml both from

Sigma- Aldrich.

3.2 Methodology

3.2.1 General methods

All media and stock solutions were prepared using autoclaved water or RO water

after weighing by using laboratory analytical balance. pH was measured using a calibrated

pH meter. Solutions were stored at room temperature unless otherwise specified. Optical

densities were measured using spectrophotometer. Bacterial cultures were centrifuged

using centrifuge (for volume 2- 50 ml) or a mini eppendorf centrifuge was used for volume

upto 1.5 ml. Stock solutions and microbiological media were sterilized by autoclaving at 121

0C for 15- 20 min.

57

3.2.2 Inoculum preparation

Overnight cultures were prepared by inoculating directly from -20 0C glycerol stock

(working stock) into 10 ml of MRS media and incubated overnight/ 24 h at 37 0C under

anaerobic conditions. The overnight cultured cells were recovered by centrifugation, washed

and resuspended in 0.1% peptone water before inoculating to give a starting OD600 of 0.2,

otherwise stated.

3.2.3 Storage of isolates

Colonies were picked according to differences in their morphology on MRS agar

plates and purified by further streaking onto MRS agar. Pure cultures were characterized

according to colony and cell morphology, Gram staining reaction and catalase activity.

Isolates tentatively identified as potential probiotic bacteria were stored at -20 0C and -80 0C

in MRS broth with 40% (w/v) glycerol (modified from Ayeni et al. 2009).

3.2.4 Gram staining

The Gram stain technique was done to differentiate between the Gram- positive and

Gram- negative bacteria. A bacterial smear was prepared. It was saturated with crystal violet

for 1 min. Rinsed the slide gently with water. Saturated the smear with Gram’s iodine for 1

min. Rinsed the slide gently with water. Decolourised with 50% acetone- alcohol for 3- 5 s.

Rinsed the slide gently with water. Counterstained with saffranin for 1 min. Rinsed the slide

gently with water. Carefully blotted the slide dry with bibulous paper. Observed the slide

under the microscope. (Nikon Eclipse 50i). The Gram- positive bacteria appeared purple

coloured whereas the Gram- negative bacteria were pink in colour. The Gram stain

technique used crystal violet as primary stain, Gram’s iodine as a mordant, 95% ethyl alcohol

as a decolouriser and saffranin as a counter stain.

58

3.2.5 Carbohydrate fermentation

Carbohydrate fermentation profiles were determined according to the method

described by (Gupta et al. 1996). The list of carbohydrates used can be seen in Table 3.4.

Briefly, MRS base medium was prepared and supplemented with appropriate sugars and

dye. Bacterial cultures were added to the fermentation tubes prior to incubation at 37 0C for

24 h. A positive result was recorded after a colour change of the medium from purple to

yellow. A negative result was recorded if there was no colour change observed in the tubes

after incubation. A negative control was prepared by inoculating culture into medium devoid

of a carbohydrate substrate.

Table 3.4 Carbohydrate and type of sugar used to evaluate the carbohydrate fermentation by the lactic acid isolates.

Name of carbohydrate/ sugar Type of sugars

Arabinose monosaccharide

Cellobiose disaccharide

Fructose monosaccharide

Glucose monosaccharide

Galactose monosaccharide

Lactose disaccharide

Mannose monosaccharide

Mannitol disaccharide

Melibiose disaccharide

Maltose disaccharide

Raffinose trisaccharide

Ribose monosaccharide

Sorbitol disaccharide

Sucrose monosaccharide

59

3.2.6 Determination of growth

Bacterial growth in different media was observed visually in terms of turbidity.

However, scientifically it was determined by measuring the OD using a spectrophotometer.

The absorbance used was 600 nm for bacterial samples. The OD was compared against a

blank.

3.2.7 Determination of viable count

The viable plate count was done to determine the number of live cells under various

conditions. Overnight lactobacilli cultures were inoculated into MRS broth of required

experimental conditions. The inoculated cultures were incubated under anaerobic

conditions. 100 µl of culture was plated onto MRS agar plates after serial dilution and

incubated. The plates were later counted for number of colonies on the surface of agar.

3.2.8 Disc diffusion method

The antibiotic resistance of microbial isolates was assessed by the disc diffusion

method. Microbial cultures were evenly spread on the agar surface and antibiotic discs were

placed on the surface of the agar aseptically using sterile forceps. The antibiotic resistance

was determined by means of measurement of zones of inhibition around the antibiotic discs.

3.2.9 Well diffusion method

This technique was used in the study of antimicrobial activity. Pathogen cultures

were evenly spread on the agar surface and wells punctured into the media using sterile

disposable 1 ml pipette tips. Wells were inoculated with lactobacilli cell free supernatants

(CFS) for the antimicrobial activity determination. While wells were inoculated with treated

supernatants for characterization of antimicrobial substances determination. Antimicrobial

activity was determined in terms of inhibition zones developed around the wells.

60

3.2.10 Extraction of genomic DNA

The genomic DNA was extracted by using the Gentra Puregene Yeast/ Bacterial Kit B

(Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The list of contents

in the kit is listed in Appendix B. 500 µl of overnight cell culture (containing approx. 0.5- 1.5 x

109 cells) was transferred to 1.5 ml microcentrifuge tubes on ice. It was centrifuged for 5 s at

13, 000- 16, 000 x g to pellet cells. Longer centrifuge times may be necessary for some

species to form a tight pellet. Supernatant was carefully discarded by pipetting or pouring.

300 µl of cell suspension solution was added next and pipetted up and down. Then 1.5 µl of

lytic enzyme solution was added and mixed by inverting 25 times. This was incubated for 15-

60 min at 37 0C. Then, it was centrifuged for 1 min at 13, 000- 16, 000 x g to pellet cells.

Carefully the supernatant was discarded with a pipette. Carefully 300 µl of cell lysis solution

was added and pipetted up and down to lyse the cells. An incubation for 5 min at 80 0C may

be necessary to lyse cells of some species. Next 1.5 µl of RNase A solution was added and

mixed by inverting 25 times. This was incubated for 20 min at 37 0C. Next it was incubated

for 1 min on ice to quickly cool the sample. The 100 µl of protein precipitation solution was

added and vortexed vigorously for 20 s at high speed. Note: for species with high

polysaccharide content, sample has to be incubated on ice for 15- 60 min. Next,

centrifugation was done for 3 min at 13, 000- 16,000 x g. The precipitated proteins should

form a tight pellet. (If the protein pellet is not tight, incubate on ice for 5 min and repeat the

centrifugation.) 300 µl of isopropanol was pipetted into a clean 1.5ml micro centrifuge tube

and the supernatant from the previous step was added by pouring carefully. This was mixed

by inverting gently 50 times. Centrifuged for 1 min at 13, 000-16, 000 x g. The DNA was

visible as a small white pellet. Carefully supernatant was discarded by inverting the tube on a

clean piece of absorbent paper, taking care that the pellet remained in the tube. 300 µl of

70% ethanol was added and inverted several times to wash the DNA pellet. Centrifuged for 1

min at 13, 000- 16,000 x g. Carefully the supernatant was discarded. The tube was drained

on a clean piece of absorbent paper, taking care that the pellet remained in the tube. This

was allowed to air dry for 5 min. (The pellet might be loose and easily dislodged. Avoid over

drying the DNA pellet, as the DNA will be difficult to dissolve.) 100 µl of DNA hydration

solution was added and vortexed for 5 s at medium speed to mix. This was incubated at 65

0C for 1 h to dissolve the DNA. Later it was incubated at room temperature (15- 25 0C)

overnight with gentle shaking. (Ensure tube cap is tightly closed to avoid leakage.) Samples

were centrifuged briefly and transferred to a storage tube.

61

3.2.11 Quantification of extracted DNA

The PCR products were analysed using a nanodrop to check the purity of DNA, see

Appendix C. For nucleic acids the 260/ 280 ratio is generally taken into consideration. A

value of ~1.8 is accepted as pure for DNA. The obtained DNA was stored at -20 0C in the

freezer until further use.

3.2.12 Polymerase chain reaction (PCR)

Genomic DNA was used for the amplification. PCR was performed using three

primers, see Appendix D, for their details. PCR reactions were performed in a total volume of

25 µl of mixture in a thermocycler. PCR reaction mixture for a 25 µl volume can be found in

Appendix E. The PCR reaction cycles for the three primers used is shown in Table 3.5.

Table 3.5 PCR reaction cycle for three primers. A: Primer 1- Aci I and Aci II, B: Primer 2- Pr I and Pr II, C: Primer 3- 16-1A and 23-1B.

A

Initialization Denaturation Annealing Elongation Final elongation

Final hold

920 950 550 720 720 40

2mins 30sec 30sec 30sec 5mins 90mins

B


Final hold

950 940 550 720 720 40

5mins 1min 1min 2mins 5mins 90mins

C


Final hold

940 940 550 720 720 40

2mins 1min 1min 1mins 5mins 90mins

62

3.2.13 Agarose gel electrophoresis

0.45 g of agarose (1.5% gel) powder was measured and added into microwavable

flask along with 30 ml of 1 x TBE. This was microwaved for 1- 3 min until the agarose was

completely dissolved. Agarose solution was allowed to cool down for 5 min. 3 µl of cyber

safe dye was added to the agarose solution. Then the agarose was poured into a gel tray

with the well comb in place. The tray was allowed to sit at room temperature for 20- 30 min,

until it had completely solidified. Now the agarose gel was placed in the electrophoresis

tank. The gel tank was filled with 1 x TBE buffer until the gel was covered. Carefully 2 µl of

DNA ladder and 2 µl dye/ loading buffer and 6 µl distilled water was loaded into the first lane

of the gel. Similarly the samples were loaded into the remaining wells of the gel i.e, 8 µl

sample and 2 µl dye. The gel was run at 100 V for about 40 min/ until the dye line is

approximately 75- 80% of the way down the gel. After turning off the power, the electrodes

were disconnected from the power source. Then carefully the gel was removed from the gel

tank. DNA fragments were visualized with the gel reader, Geldoc EQ, using UV light.

3.2.14 DNA sequencing

The PCR products were sent to Bio- protection centre, Lincoln University for

sequencing. The obtained sequence data was used for BLAST search and subsequent

sequence alignment retrieved from NCBI (http://www.ncbi.nlm.nih.gov/) using BLASTN.

3.2.15 Preparation of bacterial suspension for proteomics analysis by gel electrophoresis

The bacterial cultures grown under different stress conditions along with standard

conditions were harvested by centrifuging at 4000 rpm or higher for 20 min at 4 0C. After

discarding the supernatant, cells were washed with 10 ml of 40mM Tris buffer (pH 7) twice.

Samples were again centrifuged for 20 min at 4 0C. After discarding the supernatant, cells

were finally suspended in calculated amount of 40 mM Tris buffer to achieve an OD of 20 ±

0.1 at absorbance of 600 nm. The bacterial suspensions with an OD of 20 ± 0.1 were

transferred into 1.5 ml screw capped vials and stored at -20 0C until further use (i.e., for

protein extraction). This step was done to have a similar concentration of microbial cells for

protein extraction.

63

3.2.16 Whole cell protein extraction

400 µl of collected culture sample (OD 20 ± 0.1) was added to 0.5 g of beads (0.1

mm) in a 2 ml capacity screw- top plastic tube and a Mini Bead Beater- 8 (Biospecs Products

Inc) was used to lyse the cells using three bursts of 90, 60 and 60 s. Samples were cooled on

ice for 5 min in between each burst. After bead beating, 200 µl of double strength SDS

loading buffer was added and mixed well by vortexing for 30 s. The suspension was boiled

for 10 min, cooled on ice and centrifuged (5 min at 13, 000 rpm at 4 0C) to remove cell

debris. After centrifugation, approximately 300 µl of the protein- rich supernatant was then

removed and transferred to a clean tube. Again centrifuged for 30 min at 13, 000 rpm at 4

0C. Whole cell proteins were transferred into smaller vials without disturbing the pellet at

the bottom and stored at -20 0C or loaded immediately onto the gels. 5 µl of high molecular

weight protein marker and 30 µl of protein samples were loaded directly into the lanes of

the gel.

3.2.17 Cytosolic protein extraction

400 µl of collected culture sample (OD 20 ± 0.1) was added to 0.5 g of beads (0.1

mm) in a 2 ml capacity screw- top plastic tube and a Mini Bead Beater- 8 (Biospecs Products

Inc) was used to lyse the cells using three bursts of 90, 60 and 60 s. Samples were cooled on

ice for 5 min in between each burst. The tubes were centrifuged for 10 min at 13, 000 rpm at

4 0C. The supernatant from the previous step was transferred into new labelled eppendorf

tubes, without disturbing the beads settled at the bottom. The tubes were again centrifuged

at 13, 000 rpm for 30 min at 4 0C. Without disturbing the pellet, supernatant was transferred

into new eppendorf tubes and stored at -20 0C or until further use.

Cytosolic proteins were quantified by using the BCA Protein Assay kit, following the

manufacturer’s instructions. Required volume of protein sample which gives a 30 µg

concentration was pipetted into new eppendorf tubes. 4µL dye was added into the tubes.

Proteins were denatured by heating at 96 0C for 5 min using a heating block. Finally, 5 µl of

high molecular weight protein marker and 23 µg of protein samples were added into the

lanes of the gel.

64

3.2.18 Protein quantification

The Pierce™ BCA Protein Assay Kit (Life Technologies, California, USA) was used to

quantify the cytosolic proteins. The procedure consisted of three steps. In step 1, the diluted

albumin standards were prepared according to the manufacturer’s instructions. Step 2,

consisted of preparing the BCA working reagent (WR) by mixing 50 parts of BCA reagent A

with 1 part of BCA reagent B. Step 3 consisted of the microplate procedure where 200 µl of

WR was added into the wells containing 25 µl of albumin standards and protein samples.

After mixing well, the plate was covered and then incubated at 37 0C for 30 min. Finally the

absorbance was measured at 560 nm using a plate reader. The amount of proteins in

samples were calculated from a standard curve (Appendix F).

3.2.19 1- D SDS PAGE

1-D SDS PAGE was performed using a vertical slab system. The electrophoresis tank

was filled with NuPAGE MOPS SDS Running Buffer. Then a commercial gel (NuPAGE ®

Novex® Tris-Acetate Mini Gels) was inserted into the vertical slab of the electrophoresis unit.

The high molecular weight protein marker and protein samples were loaded into the lanes of

the gel. The lid of the electrophoresis tank was closed and electrophoresis was run at 70 V

for 200 min or until the dye front reached the bottom of the gel sandwich. The gels were

then stained by coomassie brilliant blue stain for observing the protein bands.

65

Chapter 4

Isolation, identification and screening of potential probiotic lactic

acid bacteria isolates

4.1 Introduction

The human/ animal body plays host to indigenous microorganisms and there is a high

degree of interdependence between them. The gastrointestinal tract possess the second

largest surface in the body after the respiratory tract and unlike the respiratory tract

harbours a rich microbiota. The continuous state of activiation or physiological

inflammation of the gastrointestinal tract is attributed to this rich microbiota (Alvarez-

Olmos & Oberhelman, 2001). LAB are normal inhabitants of the intestinal microbiota in

healthy humans and animals (Soto et al. 2010). Several pre- disposing factors that increase

chances of infection include repetitive prescription of antibiotics for treating infections,

immuno- suppressive therapies and irradiation. All these conditions alter the composition of

the gut microbiota, leading to a state of imbalance, which is one of the primary reasons

leading to infections. LAB compete with the pathogenic bacteria for binding sites, or alter

the pH by production of organic acids, which creates an unfavourable environment for the

other microorganism. This phenomenon is known as “Bacterial Interference”, wherein

presence of one microbe limits the pathogenic potential of the other microbe. Thus, LAB

plays a significant role in balancing the gut microbiota (Mcfarlane & Cummings, 1999). This

chapter discusses about four key aspects. Initially, isolation techniques and storage of

isolates has been described. Secondly, preliminary screening of the isolates has been

discussed. Third aspect describes the genetic identification of the isolates using PCR analysis.

The last part focusses on screening of selected lactobacilli isolates for potential probiotic

properties.

Probiotic bacteria can exert beneficial effects in the body only when live. Hence, they

should survive the challenges encountered when passaging through the gastrointestinal

tract post consumption. For example, bile is stored in the gall bladder and during digestion it

flows to the duodenum, aiding in absorption of dietary fats. Presence of bile in the upper

parts of the small intestine is toxic to microoragnims which are not adapted to intestinal

conditions (Ruiz et al., 2013). Hence, the two foremost challenges probiotic bacteria

66

encounters post consumption by the host includes surviving the low pH (acidic) environment

of stomach and presence of bile salts in the intestine (Shah, 2000; Taranto et al. 2006). From

the probiotic point of view, the potential probiotic isolate must be capable of surviving the

transit through the stomach and colonize the small intestine of the host. This is a

prerequisite for the bacteria in order to impart health benefits in the host body (Strompfova

& Laukova, 2007). Therefore survival of isolates across different pH range and different bile

salt concentrations has been the focus in the preliminary screening section.

Traditional phenotypic identification of the isolates included morphological

observation, Gram- stain reactions and characterization based on carbohydrate utilization.

However, these tests lacked reproducibility to a certain extent. Thus, genomic identification

of isolates proved useful and they could produce the same results across labs, if carried out

under similar experimental conditions (Tannock, 1999). With the advancement in genomic

tools, today several molecular identification techniques are available for microbial

identification. This includes microarray hybridization, sequence analysis of 16S rRNA gene;

the latter being more prominent (Wagner et al. 2003). 16S rRNA sequences represent an

evolutionary chronometer (Woese, 1987). Some regions of 16S rRNA are conserved

throughout all bacterial species. This can be used in alignment of sequences obtained from

different isolates. Therefore, identification of the isolates has been done using the 16S- 23S

rRNA gene of lactobacilli. Ten isolates, five each from dairy food sources and bovine rumen

were selected for identification by genotypic methods. This selection was based on the

preliminary screening results.

Lactobacilli form the major group of bacteria incorporated into foods for use as

probiotics or functional foods. An effective probiotic is required to operate under a variety of

different environmental conditions and survive in many different forms. Stability and shelf-

life of the product together with viability of the organism are key factors which determine

the efficacy of the probiotic bacteria (Johnson et al. 2012). Screening factors for analysing

probiotic abilities, carried out in this study, were based on the following factors. Upon

consumption, probiotic bacteria should survive the transit in the gastrointestinal tract,

where it is open to challenges like, low pH environment of stomach and bile salts of intestine

(Kailasapathy & Chin, 2000; Shah, 2000; Musikasang et al. 2009; Kechagia et al. 2013).

Stomach pH can vary from 1- 2 upto 4- 5 (Chou & Weimer, 1999). Under conditions of fasting

or acidity, the pH can drop as low as 1- 2. And after a meal, it can rise to 4- 5 (Ranadheera et

67

al. 2012). Thus, for in vitro studies, ability of potential probiotic bacteria to survive low pH of

2- 3 is routinely carried out (Turpin et al. 2010). Probiotic bacteria must be safe in vivo. This

was determined in terms of haemolytic activity, which was used as a pre- screening tool to

help identify lactobacilli isolates with ability to lyse RBC ‘s in vitro from further evaluation.

Antibiotic resistance is necessary for survival in presence of co- administered drugs

(Mombelli & Gismondo, 2000). The genes conferring resistance should be innate in nature

and non- transferable to other bacteria. Display of antimicrobial activity against common

intestinal pathogens is also highly preferred (Kechagia et al. 2013). Common mechanism

behind this is production of organic acids by lactobacilli, which lowers the pH, thereby

creating a hostile environment for the growth of other bacteria. Simultaneously, these

organic acids can prove toxic to other bacteria, thereby inhibiting growth of most pathogens.

Competitive inhibition for mucosal binding sites between pathogen and probiotic bacteria

also limits the growth and colonization of pathogens in the body (Alvarez- Olmos &

Oberhelman, 2001). Probiotic bacteria must be capable of adhering to intestinal epithelial

lining for exerting it’s benefits in the host. Adherence property enables the probiotic bacteria

to persist for a longer time in the gut and enhances the host-bacteria cross talk (Gueimonde

& Salminen, 2006). Adherence also helps the probiotic bacteria to overcome the peristalsis

effects of stomach (Suvarna & Boby, 2005). It has also been reported that the immune

modulatory response of probiotic bacteria maybe because of its ability to bind to the gastro-

intestinal tract (Turpin et al. 2010). For this purpose, their surface properties were studied

by performing the bacterial adherence to hydrocarbons (BATH) test.

4.2 Methods

4.2.1 Isolation of isolates from dairy food products and bovine rumen contents

The bacterial isolates were isolated from commercially available fermented dairy

food products (yoghurt and cheese) and environment/ indigenous animal sources (rumen of

cow). For all solid samples, 10 g of sample was added to 40 ml of MRS broth and

homogenized by vortex mixing. For liquid samples, 10 ml of sample was added to 40 ml of

MRS broth and homogenized by vortex mixing. The inoculated broth samples were

incubated at 37 0C for 24 h under anaerobic conditions. The tubes showing turbidity were

selected and growth of potential probiotic bacteria was determined by inoculating onto MRS

68

agar plates by streak plate method and incubated at 37 0C for 24 h under anaerobic

conditions. Plates showing colony growth were selected.

4.2.2 Purification of isolates

Plates showing colony growth on MRS agar were selected. Purification 1/ subculture

1- a single colony was picked up and streaked onto fresh MRS agar plates. The plates were

incubated at 370 C for 24 h under anaerobic conditions. Plates showing colony growth were

selected. Gram staining was performed. Gram- positive rods/ cocci were selected.

Purification 2/ subculture 2 (repeat the same procedure as in purification 1). A single colony

of Gram- positive rods/ cocci were selected and inoculated into 0.6ml vials, containing MRS

broth media. This was mixed well, then the vials were incubated at 37 0C for 24 h under

anaerobic conditions. Purification 3/ subculture 3- vials showing turbidity were selected.

With the help of a micropipette the culture was poured onto fresh MRS agar plates. The

culture was spread uniformly by means of a hockey stick. The plates were incubated at 37 0C

for 24 h under anaerobic conditions. Plates showing colony growth were selected. Gram

staining was performed. Gram- positive rods/ cocci were selected. For an overview of the

flow chart, see Figure 4.1.

70

4.2.3 Storage of isolates

A 50 ml tube was filled with 50% glycerol (20 ml of 2 X MRS Broth and 20 ml of

glycerol). With the help of a 1 ml micropipette, 1 ml of the glycerol stock culture was

transferred onto the selected MRS agar plates showing colony growth. The cells were

scraped neatly by means of a hockey stick and poured into the cryovials. The cryovials were

stored at -20 0C and -80 0C in the freezer. In total fifty isolates were isolated; twenty isolates

were of dairy food origin and thirty of bovine rumen origin. Glycerol stock of the microbial

isolates were now ready for further use.

4.2.4 Oxidase test

With a tooth pick or inoculation loop a colony was picked up and spread onto the

oxidase strip. This was observed for a colour change within 2 min. Positive reaction results in

dark blue or purple colour change. Negative reaction is indicative of no change in colour. All

isolates when tested showed a negative result (data not shown). This was because

lactobacilli are oxidase negative in nature.

Basing on colony morphology and gram stain images, twenty dairy food isolates and

six bovine rumen isolates were selected for their pH tolerance studies and survival in

different bile salt concentrations.

4.2.5 pH tolerance of isolates

For the determination of the pH tolerance, 0.1 ml of glycerol stock culture was

inoculated into MRS broth medium overnight. 1% fresh overnight culture was then

inoculated into MRS broth (0.3M phosphate buffered) of four different pH- 2, 3, 4 and 6.4.

The broths were then incubated under anaerobic conditions at 37 0C for 24 h. After 24 h, the

cultures were centrifuged and washed twice in 0.1% peptone water and their OD600 was

determined against a peptone water blank.

71

4.2.6 Bile salt tolerance

For the determination of bile salts tolerance, 0.1 ml of glycerol stock culture was

inoculated into MRS broth medium overnight. 1% fresh overnight culture was inoculated

into MRS broth (0.3M phosphate buffered of pH 6.4) containing bile salt concentrations of

0.2%, 0.4%, 0.8% and 1.5%. The broths were then incubated under anaerobic conditions at

37 0C for 24 h. After 24 h, the cultures were centrifuged and washed twice in 0.1% peptone

water and their OD600 was determined against a peptone water blank.

4.2.7 Extraction of DNA from gram- positive bacteria

Based on the data obtained from the preliminary screening tests, ten isolates, five

from dairy food products and five from bovine rumen contents origin; were selected for

further analysis. They displayed potential probiotic characteristics by exhibiting good

tolerance to low pH conditions and higher bile salts concentrations. Therefore, identifying

each isolate by genetic methods was done prior to screening them for further specific

probiotic abilities testing. The detailed procedure used for extraction of genomic DNA from

gram- positive bacteria has already been explained in greater detail in section 3.2.10.

4.2.8 Polymerase chain reaction (PCR)

After the DNA was extracted in the above step, it was amplified using PCR technique.

Typically PCR consists of the following steps: initialization step- this step consisted of heating

the reaction to a temperature of 95 0C which was held for 12 min. Denaturation step- this

step was the first regular cycling event and consisted of heating the reaction to 95 0C for 30

s. It causes DNA melting of the DNA template by disrupting the hydrogen bonds between

complementary bases, yielding single- stranded DNA molecules. Annealing step- the reaction

temperature was lowered to 45 0C for 30 s allowing annealing of the primers to the single-

stranded DNA template. Elongation step- the temperature at this step depends on the DNA

polymerase used; Taq polymerase requires a temperature of 72 0C for 2 min. Final

elongation- this single step was occasionally performed at a temperature of 72 0C for 4 min

after the last PCR cycle to ensure that any remaining single- stranded DNA was fully

extended. Final hold- this step at 4 0C for 50 min may be employed for short- term storage of

the reaction. Three primers were used in this study. They were Aci I and Aci II, Pr I and Pr II,

http://en.wikipedia.org/wiki/DNA_melting

http://en.wikipedia.org/wiki/Taq_polymerase

72

16- 1A and 23- 1B. The details of the primers is shown in Appendix D. Specific reaction cycles

inside a thermocycler were required for successful DNA amplification to be carried out. The

three primers used in this study employed three different reaction cycles. The details of each

PCR reaction cycle has already been explain in greater detail in section 3.2.12.

4.2.9 Supplementary methods for paper reported in section 4.3.7

4.2.9.1 Carbohydrate fermentation profile

The test was done according to the method described by (Gupta et al. 1996). The

isolates were grown in MRS broth (pH 6.4) overnight at 37 0C. Carbohydrate utilization of the

isolates were determined for fourteen different sugars and glycerol. For a complete list of

the sugars used, see Table 3.4 in chapter 3. MRS base medium was prepared and

supplemented with appropriate sugars (1%) and dye (0.05%). The overnight culture was

centrifuged at 4000 rpm for 15 min at room temperature. The supernatant was discarded

and the pellet resuspended in 20 ml of 0.1% peptone water. About 500 µl of bacterial

inoculum was added to the tubes and mixed well. They were then incubated at 37 0C for 24

h. The experiment was performed in duplicates. A colour change from purple to yellow

indicated a positive result and no colour change indicated a negative test, see Figure 4.2.

Negative controls were prepared by inoculating cultures into the base medium devoid of a

sugar/ carbohydrate substrate.

74

4.2.9.2 Haemolytic activity

The isolates were characterized as haemolytic, partial haemolytic or non- haemolytic

in nature depending on the colour change of the agar underlying the colonies, see Figure 4.3.

β- haemolysis was indicated by a colour change to lightened yellow/ transparent, α-

haemolysis was indicated by a colour change to dark green and in case of ϒ- haemolysis no

change was observed.

Figure 4.3 Test for haemolytic activity. Negative control no culture (top), Salmonella and Listeria positive controls (middle) and Lactobacilli RC 2 (bottom) as a typical example for all isolates examined.

4.2.9.3 Antibiotic resistance

Antibiotic resistance was examined by the disc diffusion method described by

(Thirabunyanon et al. 2009). The isolates to be tested were grown overnight in fresh MRS

broth of pH 6.4 at 37 0C. About 100 µl of the suspension was spread onto the surface of the

MRS agar plates. The antibiotic disks were inserted aseptically onto the agar surface. The

plates were then incubated under anaerobic conditions for 24 h at 37 0C. The antibiotic

resistance of the isolates was determined by calculating the diameter of the zones of

inhibition around the antibiotic disks. Antibiotic resistance was determined for eleven

antibiotics. For a complete list of the antibiotics used and their concentrations, see Table 3.2

in chapter 3. The antibiotics were grouped under three categories depending on their

mechanism of action. It included (i) bacterial cell wall synthesis inhibitors such as ampicillin

and vancomycin (ii) bacterial nucleic acid synthesis inhibitors such as ciprofloxacin and

nalidixic acid (iii) bacterial protein synthesis inhibitors such as streptomycin,

chloramphenicol, gentamicin, erythromycin, tetracycline, fusidic acid and kanamycin.

75

4.2.9.4 Statistical analysis

The statistical analysis for the BATH test was done using the IBM SPSS statistics

(version 21, IBM, Armonk, NY, USA). A one way analysis of variance (ANOVA) was used to

evluate the experimental data. The significant differences were accepted at p<0.05 by

Duncan’s test. More details can be found in Appendix G.

76

4.3 Results and discussion

4.3.1 Morphological characteristics

When grown on MRS agar plates, the bacteria produced round, opaque, milky white/

creamy colonies; typical of lactobacilli, see Figure 4.4.

4.3.2 Gram nature of isolates

All isolates which produced typical lactobacilli colonies on MRS agar surface were

selected. Their Gram nature was studied by performing the Gram- staining test. The Gram

staining procedure has been described in section 3.2.4. All isolates which appeared as purple

coloured rods/ cocci when observed under the microscope were classified as Gram- positive

bacteria (lactobacilli are Gram- positive in nature) and selected for further screening. The

Gram stain images of the isolates are shown in Figure 4.5.

77

Figure 4.4 Lactobacilli isolates MI 7, MI 10, RC 13 and RC 25 as typical examples of growth of isolates on MRS agar.

RC 25

MI 7 MI 10

RC 13

78

Figure 4.5 Lactobacilli isolates MI 6, MI 10, RC 13 and RC 30 as typical examples of isolate Gram staining.

MI 6 MI 10

RC 13 RC 30

79

4.3.3 pH tolerance of isolates

The tolerance of the isolates towards four different pH is shown in Figure 4.6. All the

isolates showed maximum tolerance at pH 6.4 and pH 4. It indicated the optimum pH for

growth of lactobacilli. With a decrease in pH, the tolerance level of isolates also declined. pH

2 showed the least absorbance values for all the isolates.

80

Figure 4.6 Growth (optical density) of dairy food (MI) and bovine rumen (RC) isolates at various pH after 24 h.

0

0.2

0.4

0.6

0.8

1

1.2

MI 1 MI 2 MI 3 MI 4 MI 5 MI 6 MI 7 MI 8 MI 9 MI 10 MI 11 MI 12 MI 13 MI 14 MI 15 MI 16 MI 17 MI 18 MI 19 MI 20 RC 2 RC 5 RC 7 RC 13 RC 25 RC 30

OD

at

60

0n

m

Bacterial isolates

pH 2 pH 3 pH 4 pH 6.4

81

4.3.4 Bile salts tolerance of isolates

The tolerance of the isolates in different bile salt concentrations is described in Figure

4.7. All isolates showed maximum tolerance at 0.2%. Poor tolerance was recorded at a bile

salts concentration of 1.5%. With increase in bile salts concentration, the tolerance level of

isolates declined. Rumen isolates showed better bile salts tolerance property in comparison

to dairy isolates.

82

Figure 4.7 Growth (optical density) of dairy food (MI) and bovine rumen (RC) isolates at bile salt concentrations after 24 h.

0

0.2

0.4

0.6

0.8

1

1.2

MI 1 MI 2 MI 3 MI 4 MI 5 MI 6 MI 7 MI 8 MI 9 MI 10 MI 11 MI 12 MI 13 MI 14 MI 15 MI 16 MI 17 MI 18 MI 19 MI 20 RC 2 RC 5 RC 7 RC 13 RC 25 RC 30

OD

at

60

0n

m

Bacterial isolates

0.2% bile 0.4% bile 0.8% bile 1.5% bile

85

4.3.6 DNA sequencing

PCR samples were sent for sequencing to Bio- protection department at Lincoln

University. NCBI BLAST program was used to match the sequence similarity. The sequence

analysis of MI 6 is shown in Figure 4.11. The sequence analysis of MI 7 is shown in Figure

4.12. The sequence analysis of MI 10 is shown in Figure 4.13. The sequence analysis of MI 13

is shown in Figure 4.14. The sequence analysis of MI 17 is shown in Figure 4.15. The

sequence analysis of RC 2 is shown in Figure 4.16. The sequence analysis of RC 5 is shown in

Figure 4.17. The sequence analysis of RC 13 is shown in Figure 4.18. The sequence analysis of

RC 25 is shown in Figure 4.19. The sequence analysis of RC 30 is shown in Figure 4.20. The

genetic identities of the ten isolates has been listed in Table 4.1.

86

MI 6 >MI_6-16IA_2013-10-14_C11_0419.seq

Score = 634 bits (343), Expect = 3e-178, Identities = 429/469(91%), Gaps =

12/469(2%), Strand = Plus/Plus

Figure 4.11 Sequence obtained by amplification of the 16S- 23S rRNA gene (intergenic spacer region) of Lactobacillus isolate MI 6 using primers 16-1A (F) and 23-1B (R). A PCR product of approximately 715 bp was amplified.

Query 13 CGTT-CCGGG-CTTGTACACACCGCCCGTCACACCAT-GGAGTTTGTAACGCCCAAAGTC 69

|||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||

Sbjct 205062 CGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAAGTC 205121

Query 70 GGTGGACGAAGGCTTTATGGAGGGAGCCGCCTAAGG-GGGACAGATGACTGGGGTGAAGT 128

||||| | || |||||||||||||||||||||||| |||||||||||||||||||||||

Sbjct 205122 GGTGGCCTAA-CCTTTATGGAGGGAGCCGCCTAAGGCGGGACAGATGACTGGGGTGAAGT 205180

Query 129 CGTAACAAGGTAGCCGTAGAAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAAAA 188

||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||

Sbjct 205181 CGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAAAA 205240

Query 189 CGGAACCTACACATCGAAGAAACTTTGTTTAGTTTTGAGGGTTTCCCCCTC-GAGACTTG 247

||||||||||||||||||||||||||||||||||||||||| || ||||| ||| ||||

Sbjct 205241 CGGAACCTACACATCGAAGAAACTTTGTTTAGTTTTGAGGGGTTTACCCTCAGAG-CTTG 205299

Query 248 TACTTTGAAACCTAAATACTATCAAATTTCTT-ATTAAG-AAACAATAAACCGAGAAAAC 305

|||||||||| |||||||||||| |||||||| ||||| ||||||||||||||||| ||

Sbjct 205300 TACTTTGAAAACTAAATACTATCTAATTTCTTTATTAACAAAACAATAAACCGAGAACAC 205359

Query 306 CGGGTTATTTGAGTTTTACTTAACCAATTATAATCGCTAACTCAATAAATCAGACCATCT 365

|| ||||||||||||||| ||||| ||||||||||||||||||||| |||||||| ||||

Sbjct 205360 CGCGTTATTTGAGTTTTAATTAACGAATTATAATCGCTAACTCAATTAATCAGACAATCT 205419

Query 366 TTGATTGTTCAGTTAAAGTTAGGAAAGGGCGCATGGGGAATCCCTCGCTACTAGGAGCCG 425

||||||||| || | |||||| | |||||||||||| |||| ||| | ||||||||||||

Sbjct 205420 TTGATTGTTTAGGTTAAGTTATG-AAGGGCGCATGGTGAATGCCTTGGTACTAGGAGCCG 205478

Query 426 TATGAAGGACGGGACTAACACCGAATTGCTCTCGGGGAGCGGGAACTAC 474

||||||||||||||||||||||| |||| ||||||||||| || |||

Sbjct 205479 -ATGAAGGACGGGACTAACACCGATATGCT-TCGGGGAGCGGTAAGTAC 205525

87

MI 7

>6_7P3-161A_2013-09-24_A01_0379.seq

Score = 270 bits(146), Expect = 1e-68, Identities = 255/308(83%), Gaps =



Query 9 TACGTTCCCGGG-GTTGT-CACACCGCCCGTCACACCATGATAGTTTGTAACGCCCAAAG 66

|||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||

Sbjct 313613 TACGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAAG 313672

Query 67 TCGGTGGCCTAACCTTTATGGAGCTAGCCGCCTAAGGCCAAAGAGATGACTGTTAAGAAG 126

||||||||||||||||||||||| ||||||||||||| | ||||||||| ||||

Sbjct 313673 TCGGTGGCCTAACCTTTATGGAGGGAGCCGCCTAAGGCGGGACAGATGACTGGGGTGAAG 313732

Query 127 GCGTGCCATGATAACTGGATA-ATTAAAAG-T-CAAA-GGATGACCTGCTTTCTAAGTAA 182

||| || | || | | ||| | | || | | |||| |||| ||||||||| ||

Sbjct 313733 TCGTAACAAGGTAGCCGTATATAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAA 313792

Query 183 TAAAACGGAACCTACACATCTTAGATACTTTTTATATTTTTGAGGGGTTTACCTTCAGAG 242

|||||||||||||||||||| ||| ||||| | || |||||||||||||||| ||||||

Sbjct 313793 TAAAACGGAACCTACACATCGAAGAAACTTTGTTTAGTTTTGAGGGGTTTACCCTCAGAG 313852

Query 243 CTTGTACTTTGAAAAATACATACTTTCTACTTTCTTTAGTTACAAAATAATAAATCGAGA 302

||||||||||||||| || ||||| |||| |||||||| | |||||| |||||| |||||

Sbjct 313853 CTTGTACTTTGAAAACTAAATACTATCTAATTTCTTTATTAACAAAACAATAAACCGAGA 313912

Query 303 ACACAGCG 310

|||| |||

Sbjct 313913 ACACCGCG 313920

88

MI 10

>7_10P3-161A_2013-09-24_B01_0379.seq

Score = 883 bits(478), Expect = 0.0, Identities = 484/487(99%), Gaps =



Query 26 TTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAAGTCGGTGGCCTAACC 85

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 53 TTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAAGTCGGTGGCCTAACC 112

Query 86 TTTATGGAGGGAGCCGCCTAAGGCGGGACAGATGACTGGGGTGAAGTCGTAACAAGGTAG 145

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 113 TTTATGGAGGGAGCCGCCTAAGGCGGGACAGATGACTGGGGTGAAGTCGTAACAAGGTAG 172

Query 146 CCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAAAACGGAACCTACACA 205

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 173 CCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAAAACGGAACCTACACA 232

Query 206 TCGAAGAAACTTTGTTTAGTTTTGAGAGGTTTACCTTCAGAGCTTGTACTTTGAAAACTA 265

|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||

Sbjct 233 TCGAAGAAACTTTGTTTAGTTTTGAGGGGTTTACCCTCAGAGCTTGTACTTTGAAAACTA 292

Query 266 AATACTATCTAATTTCTTTATTAACAAAACAATAAACCGAGAACACCGCGTTATTTGAGT 325

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 293 AATACTATCTAATTTCTTTATTAACAAAACAATAAACCGAGAACACCGCGTTATTTGAGT 352

Query 326 TTTAATTAACGAATTATAATCGCTAACTCAATTAATCAGACAATCTTTGATTGTTTAGGT 385

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 353 TTTAATTAACGAATTATAATCGCTAACTCAATTAATCAGACAATCTTTGATTGTTTAGGT 412

Query 386 TAAGTTATGAAGGGCGCATGGTGAATGCCTTGGTACTAGGAGCCGATGAAGGACGGGACT 445

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 413 TAAGTTATGAAGGGCGCATGGTGAATGCCTTGGTACTAGGAGCCGATGAAGGACGGGACT 472

Query 446 AACACCGATATGCTTCGGGGAGCGGTAAGTACGCTTTGTTCCGGAGATTTCCGAATGGGG 505

|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||

Sbjct 473 AACACCGATATGCTTCGGGGAGCGGTAAGTACGCTTTGATCCGGAGATTTCCGAATGGGG 532

Query 506 GAACCCA 512

|||||||

Sbjct 533 GAACCCA 539

89

MI 13

>8_13P3-161A_2013-09-24_C01_0379.seq




Query 13 CGTT-CCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCGAAGCC 71

|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298562 CGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCGAAGCC 298621

Query 72 GGTGGCGTAACCCTTTTAGGGAGCGAGCCGTCTAAGGTGGGACAAATGATTAGGGTGAAG 131

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298622 GGTGGCGTAACCCTTTTAGGGAGCGAGCCGTCTAAGGTGGGACAAATGATTAGGGTGAAG 298681

Query 132 TCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAAACAG 191

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298682 TCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAAACAG 298741

Query 192 ACTGAAAGTCTGACGGAAACCTGCACACACGAAACTTTGTTTAGTTTTGAGGGGATTACC 251

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298742 ACTGAAAGTCTGACGGAAACCTGCACACACGAAACTTTGTTTAGTTTTGAGGGGATTACC 298801

Query 252 CTCAAGCACCCTAGCGGGTGCGACTTTGTTCTTTGAAAACTGGATATCATTGTTGTAAAT 311

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298802 CTCAAGCACCCTAGCGGGTGCGACTTTGTTCTTTGAAAACTGGATATCATTGTTGTAAAT 298861

Query 312 GTTTTAAATTGCCGAGAACACAGCGTATTTGTATGAGTTTCTAATAATAGAAATTCGCAT 371

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298862 GTTTTAAATTGCCGAGAACACAGCGTATTTGTATGAGTTTCTAATAATAGAAATTCGCAT 298921

Query 372 CGCATAACCGCTGACGCAAGTCAGTACAGGTTAAGTTACAAAGGGCGCACGGTGGATGCC 431

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298922 CGCATAACCGCTGACGCAAGTCAGTACAGGTTAAGTTACAAAGGGCGCACGGTGGATGCC 298981

Query 432 TTGGCACTAGGAGCCGATGAAGGACGGAACTAATACCGATATGCTTCGGGGAGCTATAAG 491

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 298982 TTGGCACTAGGAGCCGATGAAGGACGGAACTAATACCGATATGCTTCGGGGAGCTATAAG 299041

Query 492 TAAGCTTTGATCCGGAGATTTCCGAATGGGGGAACCCA 529

||||||||||||||||||||||||||||||||||||||

Sbjct 299042 TAAGCTTTGATCCGGAGATTTCCGAATGGGGGAACCCA 299079

90

MI 17

>9_17P3-161A_2013-09-24_D01_0379.seq

Score = 475 bits(257), Expect = 2e-130, Identities = 427/508(84%), Gaps =



Query 12 ATA-GTTCCCGGG-CTTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAA 69

||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 38 ATACGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGGGAGTTTGTAACGCCCAAA 97

Query 70 GTCGGTGGCCTAACCTTTATGGAGGGAGCCGCCTAA---GGGACAGATGACTGGGGGGAA 126

|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||

Sbjct 98 GTCGGTGGCCTAACCTTTATGGAGGGAGCCGCCTAAGGCGGGACAGATGACTGGGGTGAA 157

Query 127 GGCGTAACCAGGTAGCCGGAGGA-AACCTGGGGGTGGATCACCTCCTTTCTTAGGGATTA 185

| |||||| ||||||||| |||| |||||| || ||||||||||||||||| ||| || |

Sbjct 158 GTCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAA 217

Query 186 AAAGGAACCTACCCCTCGGAGGAACTTTGGTTAGTTTTGAGGGGTTTACCCTTAGAAGTT 245

|| ||||||||| | ||| || ||||||| |||||||||||||||||||||| ||| ||

Sbjct 218 AACGGAACCTACACATCGAAGAAACTTTGTTTAGTTTTGAGGGGTTTACCCTCAGAGCTT 277

Query 246 TTTCATTGAAAACTAAATTCTTTCTTAtttttttttttACGAAACAATTAACCGGGGACC 305

| | ||||||||||||| || ||| |||| ||| || || ||||||| ||||| | ||

Sbjct 278 GTACTTTGAAAACTAAATACTATCTAATTTCTTTATTAACAAAACAATAAACCGAGAACA 337

Query 306 CCGGGTTTATTGGGTTTTAATTTACCAATTATTATTCCTAACTCAATTTATCAGACAATC 365

||| ||| ||| ||||||||| || |||||| || ||||||||||| |||||||||||

Sbjct 338 CCGCGTTATTTGAGTTTTAATTAACGAATTATAATCGCTAACTCAATTAATCAGACAATC 397

Query 366 TTTGGATGGTTT-GGTTAAGGTATGGAGGGCCCATGGGGAATACCTTTGTACTTGGAGCC 424

|||| || |||| ||||||| |||| ||||| ||||| |||| |||| ||||| ||||||

Sbjct 398 TTTG-ATTGTTTAGGTTAAGTTATGAAGGGCGCATGGTGAATGCCTTGGTACTAGGAGCC 456

Query 425 GGTTAAAGGA-GGGACTTAAAACGAATTTGCCTTggggggggggTTACGTAACCTTTGGA 483

| | || ||| |||||| | | ||| | || ||| |||| | ||| | ||| ||||| |

Sbjct 457 GATGAA-GGACGGGACTAACACCGA-TATG-CTTCGGGGAGCGGTAA-GTACGCTTTG-A 511

Query 484 TCCCAAAAAATTCCGAATGGGGGAACCC 511

||| | | ||||||||||||||||||

Sbjct 512 TCCGGAGAT-TTCCGAATGGGGGAACCC 538

91

RC 2

>RC_2-16IA_2013-10-14_E11_0419.seq


1/488(0%), Strand = Plus/Minus

Query 17 CCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAAGTCGGTGG 76

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884796 CCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAAGTCGGTGG

1884737

Query 77 GGTAACCTTTTAGGAACCAGCCGCCTAAGGTGGGACAGATGATTAGGGTGAAGTCGTAAC 136

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884736 GGTAACCTTTTAGGAACCAGCCGCCTAAGGTGGGACAGATGATTAGGGTGAAGTCGTAAC

1884677

Query 137 AAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATATTACGGAAA 196

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884676 AAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATATTACGGAAA

1884617

Query 197 CCTACACACGCGTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTTGTTCT 256

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884616 CCTACACACGCGTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTTGTTCT

1884557

Query 257 TTGTAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACACCGCGtttt 316

||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884556 TTGAAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACACCGCGTTTT

1884497

Query 317 ttgagttttttATTGAAGTTTAATTATCGCTAAACTCATTAATCGCATTTACCGTTAGGT 376

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884496 TTGAGTTTTTTATTGAAGTTTAATTATCGCTAAACTCATTAATCGCATTTACCGTTAGGT

1884437

Query 377 AAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGCGGATGAAG 436

|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||

Sbjct 1884436 AAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGCCGATGAAG

1884377

Query 437 AACGGGACTAACACCAATATGCTTGGGGGAGCTGTACGTAAGCTATGATCAAAAGATTTC 496

|||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||

Sbjct 1884376 GACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGGAGATTTC

1884317

Query 497 -GAATGGG 503

|||||||

Sbjct 1884316 CGAATGGG 1884309

Figure 4.16 Sequence obtained by amplification of the 16S- 23S rRNA gene (intergenic spacer region) of Lactobacillus isolate RC 2 using primers 16-1A (F) and 23-1B (R). A PCR product of approximately 726 bp was amplified.

92

RC 5 >RC_5-16IA_2013-10-14_F11_0419.seq Score = 881 bits(477), Expect = 0.0, Identities = 492/499(99%), Gaps =


Query 12 CGTT-CCGGG-CTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAAGTC 69

|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884801 CGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAAGTC

1884742

Query 70 GGTGGGGTAACCTTTTAGGAACCAGCCGCCTAAGGTGGGACAGATGATTAGGGTGAAGTC 129

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884741 GGTGGGGTAACCTTTTAGGAACCAGCCGCCTAAGGTGGGACAGATGATTAGGGTGAAGTC

1884682

Query 130 GTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATATTAC 189

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884681 GTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATATTAC

1884622

Query 190 GGAAACCTACACACGCGTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTT 249

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884621 GGAAACCTACACACGCGTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTT

1884562

Query 250 GTTCTTTGTAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACACCGC 309

|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884561 GTTCTTTGAAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACACCGC

1884502

Query 310 GttttttgagttttttATTGAAGTTTAATTATCGCTAAACTCATTAATCGCATTTACCGT 369

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884501 GTTTTTTGAGTTTTTTATTGAAGTTTAATTATCGCTAAACTCATTAATCGCATTTACCGT

1884442

Query 370 TAGGTAAATGAGGTTAAGTTAACAAGGGCACATGGTGAATGCCTTGGCACTAGGAGCGGA 429

||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||

Sbjct 1884441 TAGGTAAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGCCGA

1884382

Query 430 TGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGAAG 489

||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||

Sbjct 1884381 TGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGGAG

1884322

Query 490 ATTTCCGAATGGGGAAACC 508

|||||||||||||| ||||

Sbjct 1884321 ATTTCCGAATGGGGCAACC 1884303


93

RC 13 >RC_13-16IA_2013-10-14_G11_0419.seq Score = 885 bits(479), Expect = 0.0, Identities = 492/498(99%), Gaps =



|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||


1988823


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1988763


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1988703

Query 188 GGAAACCTACACATTCTTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTT 247

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988702 GGAAACCTACACATTCTTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTT

1988643

Query 248 GTTCTTTGATAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACACCGC 307

||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||


1988583


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1988523

Query 368 TAGGTAAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGCCGA 427

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988522 TAGGTAAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGCCGA

1988463

Query 428 TGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGAAA 487

||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |

Sbjct 1988462 TGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGGAG

1988403

Query 488 ATTTCCGAATGGGGAAAC 505

|||||||||||||| |||

Sbjct 1988402 ATTTCCGAATGGGGCAAC 1988385


94

RC 25 >RC_25-16IA_2013-10-14_H11_0419.seq Score = 880 bits(476), Expect = 0.0, Identities = 494/502(98%), Gaps =



|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||


1884742


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1884682


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1884622

Query 188 GGAAACCTACACACGCGTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTT 247

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1884621 GGAAACCTACACACGCGTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAACTT

1884562

Query 248 GTTCTTTGAAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACACCGC 307

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1884502


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


1884442

Query 368 TAGGTAAATGAGGGTTAAGTTAACAAGG-CGCATGGTGAATGCCTTGGCACTAGGAGCGG 426

||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |

Sbjct 1884441 TAGGTAAATGAGG-TTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGCCG

1884383

Query 427 ATGAAGGACGCGACTAACACCAATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGGA 486

|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||

Sbjct 1884382 ATGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCGGA

1884323

Query 487 GATTTCCGAATGGGGAAACCCA 508

||||||||||||||| ||||||

Sbjct 1884322 GATTTCCGAATGGGGCAACCCA 1884301


95

RC 30

>RC_30-16IA_2013-10-14_A12_0419.seq



Query 9 ATA-GTT-CCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAA 66

||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988885 ATACGTTCCCGGGCCTTGTACACACCGCCCGTCACACCATGAGAGTTTGTAACACCCAAA

1988826

Query 67 GTCGGTGGGGTAACCTTTTAGGAACCAGCCGCCTAAGGTGGGACAGATGATTAGGGTGAA 126

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988825 GTCGGTGGGGTAACCTTTTAGGAACCAGCCGCCTAAGGTGGGACAGATGATTAGGGTGAA

1988766

Query 127 GTCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAT 186

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988765 GTCGTAACAAGGTAGCCGTAGGAGAACCTGCGGCTGGATCACCTCCTTTCTAAGGAATAT

1988706

Query 187 TACGGAAACCTACACATTCTTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAA 246

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988705 TACGGAAACCTACACATTCTTCGAAACTTTGTTTAGTTTTGAGAGATTTAACTCTCAAAA

1988646

Query 247 CTTGTTCTTTGAAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACAC 306

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988645 CTTGTTCTTTGAAAACTAGATAATATCAAATATATTTTTTCATAATGAAACCGAGAACAC

1988586

Query 307 CGCGttttttgagttttttATTGAAGTTTAATTATCGCTAAACTCATTAATCGCATTTAC 366

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988585 CGCGTTTTTTGAGTTTTTTATTGAAGTTTAATTATCGCTAAACTCATTAATCGCATTTAC

1988526

Query 367 CGTTAGGTAAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGC 426

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988525 CGTTAGGTAAATGAGGTTAAGTTAACAAGGGCGCATGGTGAATGCCTTGGCACTAGGAGC

1988466

Query 427 CGATGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCG 486

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 1988465 CGATGAAGGACGGGACTAACACCGATATGCTTCGGGGAGCTGTACGTAAGCTATGATCCG

1988406

Query 487 AAGATTACCGAATGGGGAAACCCA 510

||||| |||||||||| ||||||

Sbjct 1988405 GAGATTTCCGAATGGGGCAACCCA 1988382


96

Table 4.1 Genetic identity of each isolate as established by NCBI BLAST.

Isolate Source Genetic identification

MI 6 Dairy food Lactobacillus reuteri TD1, complete genome

MI 7 Dairy food Lactobacillus reuteri JCM 1112 DNA, complete genome

MI 10 Dairy food Lactobacillus reuteri strain C16

MI 13 Dairy food Lactobacillus rhamnosus LOCK908, complete genome

MI 17 Dairy food Lactobacillus rhamnosus LOCK908, complete genome

RC 2 Bovine rumen Lactobacillus plantarum 16, complete genome


RC 13 Bovine rumen Lactobacillus plantarum subsp. plantarum ST-III, complete genome


RC 30 Bovine rumen Lactobacillus plantarum subsp. plantarum ST-III, complete genome

http://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_526120653

97

4.3.7 Comparison of microbiological and probiotic characteristics of probiotic lactobacilli isolates from dairy food products and animal rumen contents

The above (Table 4.1) listed ten lactobacilli isolates were screened for potential

probiotic abilities. This study was undertaken to characterise and draw a comparison of

potential probiotic characteristics of dairy versus rumen isolates. The FAO/ WHO screening

guidelines 2006 were adopted for screening the lactobacilli isolates with potential probiotic

features. This criteria included testing for haemolytic activity, antibiotic resistance, anti-

microbial activity, survival at low pH of 2 and 3, survival in presence of 0.3% and 2% bile salts

and determination of adherence properties in vitro.

Basing on in vitro studies and cellular models, the probiotic bacteria are routinely

screened for certain parameters. After obtaining the preliminary screening data, ten

lactobacilli isolates, five each from dairy and rumen sources were screened next for potential

probiotic abilities. The screening tests employed are detailed as follows. Most common

method is to check the ability of isolates to survive in the presence of low pH and presence

of bile salts (Pfeiler & Klaenhammer, 2009). Lactobacilli and bifidobacteria have a known

history of safe use. Therefore characterization of these two groups of bacteria based on

antimicrobial and antibiotic resistance is often ignored in routine screening. This can pose a

threat considering the vast demand for probiotic foods and development of multi- drug

resistant bacteria (D’Aimmo et al. 2007). Thus, pathogen inhibition, antibiotic resistance and

haemolytic activity testing were few characteristics that were also closely observed in this

research study. Competing with other gut bacteria for binding/ adhesion sites explains how

the probiotic bacteria is able to adhere to the gut lining to exert beneficial effects in host.

This feature is one of the key characteristics which distinguishes a probiotic bacteria (Ryan et

al. 2008; Todorov et al. 2008). Hence, determination of the adherence abilities of the

isolates were carried out by the bacterial adherence to hydrocarbons (BATH) method.

This section has been accepted for publication (Jose et al. 2015a) and is reproduced

on the following pages as orignially published.

113

4.4 Conclusions

Initially twenty dairy food isolates and thirty bovine rumen isolates were collected.

Phenotype characterisation (gram staining and colony morphology) of these isolates

identified twenty- six isolates for further evaluation. All dairy food isolates were found to be

Gram- positive and colony morphologies indicating they were likley to be lactic acid

bacteria. Only six of the thirty bovine rumen isolates meet these criteria, this is not surpising

considering the vast range of microbial species present in the bovine rumen.

The twenty- six isolates (twenty from dairy food and six from the bovine rumen) were

investigated for their survival at low pH and in the presence of bile salts. These conditions

were selected as they are major challenges probiotic bacteria encounter during gastro-

intestinal tract transit following injestion by farmed livestock or humans. Ten isolates (five

each from dairy food and the bovine rumen) were identified as having good adhesion and

survival at low pH and in the presence of bile salts. The high proportion of bovine rumen

isolates (five of six) found to have good potential probiotic characteristics reflects perhaps

their being isolated from an environment where such characteristics would be condusive to

survival.

Species identification of the ten isolates confirmed all were Lactobacillus sps.

Extensive testing to further characterise the probiotic potential of the ten isolates included;

inhibition of pathogens, resistance to antibiotics, biosafety (absence of haemolytic activity),

adhesion (BATH test), carbohydrate fermentation, survival at low pH, and high bile salt

concentration. This testing identified two isolates (isolate MI 13 from dairy food and isolate

RC 2 from the bovine rumen) for further evaluation.

114

Chapter 5

Characterization of selected probiotic isolates for specific properties

5.1 Introduction

This chapter focusses on the characterization of two selected lactobacilli isolates, one

each from dairy food and bovine rumen source. MI 13 (L. rhamnosus LOCK 908) was the

dairy food isolate and RC 2 (L. plantarum 16) was the rumen isolate selected for further

characterization of specific properties. This selection was based on the selective screening of

isolates done in section 4.3.7. Seven different aspects of these two isolates were studied

intensively in this chapter, which included adhesion onto Caco- 2 cells, monolayer integrity

studies, 1 D SDS PAGE proteomic profiles, production of volatile compounds, alterations in

fatty acid profiles, characterization of antimicrobial compounds produced and effects of

glyphosate. In the last study, which includes effects of glyphosate, dairy isolate was not used

as they had no prior exposure to this herbicide. Only the rumen isolates were included were

a part of this study.

It is believed that the probiotic bacteria should adhere to the intestinal epithelial

lining to exert beneficial effects in the host. Any bacteria that is not adhered to the intestinal

epithelial lining physically would be washed away along with the flow rate of the digesta

through the small intestine. Therefore, the physical adsorption of probiotic bacteria to

gastric epithelial cells determines it’s colonization in the gut (Robins- Browne & Levine, 1981;

Savage, 1978). The adhesion mechanism is influenced by several physical and bio- chemical

factors. Hydrophobic nature, electrostatic and interactions, steric and passive forces and

presence of cell surface components are few of these factors (Servin & Coconnier, 2003).

Beneficial properties resulting due to adhesion include initiating an immune response

(Kimura et al. 1997) and competing with pathogens for binding sites and nutrients in the

host (Hirano et al. 2003). Understanding the mechanisms responsible for probiotic bacterial

adhesion in vivo is quite challenging. This has led to the development of Caco- 2 cell line, one

of the human adenocarcinoma cell lines used extensively in the study of bacterial adherence

in vitro (Duary et al. 2011). Caco- 2 cells resemble physiologically and functionally the

enterocytes lining the intestine. They are excellent models which help in understanding how

the probiotic bacteria interacts with the intestinal epithelial lining (Wang et al. 2008;

115

Moussavi & Adams, 2010). They also help in investigating how the probiotic bacteria

competes with human commensals for attachment sites in the gut. Another remarkable

feature of Caco- 2 cells is that they are useful in studying the bacteria which target only

humans; as animal model studies lack efficacy in such cases (Chauviere et al. 1992).

Proteomics involves the study of proteomes, which represents a moving target.

Proteomic studies investigate the functional molecules and not the source code, unlike

genomics. Previously, in probiotics field, many studies revolved around studying their

adaptation to environmental growth parameters, their metabolism and genomics. However,

more recently, understanding the probiotic properties and mechanisms underlying the

probiotic characteristics became more prominent. Proteomics techniques were widely used

for this purpose. Genomics includes bacterial characterization and identification by DNA

sequencing in vitro. Proteomic approaches comprises of the in silico analysis of predicted

protein sequences (van de Guchte et al. 2012). Proteins are produced in abundance by an

organism and they are highly diverse in their properties. The protein expression profile of an

organism under standard growth conditions and stressful environmental conditions varies

widely. It is not possible to study and analyse the entire proteome in one single step.

Therefore, entire proteome is characterized into different protein subsets comprising of

intracellular proteins, membrane proteins or extracellular proteins (Garrigues et al. 2005). In

the field of probiotics, proteomic tools have been used primarily for focussing on bacterial

stress response encountered during food production and processing conditions. Variations in

temperature, presence of bile salts, acidic environment, oxidative stress, presence of NaCl,

nutrient limitation are examples of stress conditions which are commonly used. The stress

response of an organism is highly complex and unique to that particular organism. It is

influenced by the environmental conditions and experimental setup. A proper

understanding of the stress response followed by identification of the stress response

proteins, makes it easier to design methods to grow the bacteria.

The stress response can affect the synthesis of several proteins, which are called as

stress proteins. There are three different groups of stress proteins. (i) general stress

proteins- they are the most commonly expressed proteins under nearly all different kinds of

stresses and probably noticed in all bacteria. They are induced non- specifically and are

involved in DNA or protein repair. Examples include DnaK, GroEL, GroES or proteases like Clp

proteases. (ii) specific stress proteins- they are proteins which are expressed under specific/

116

particular stress condition. (iii) proteins of general metabolism, that can be affected by some

specific stresses (Champomier-Vergès et al. 2002). The procedure for protein analysis by gel

electrophoresis method has already been described in section 3.5.

Microorganisms produce VFA compounds as a result of anaerobic fermentation of

complex carbohydrates. The nature of the substrate plays a key role in determining the type

of VFA commpounds produced. Ruminants are known to depend on VFA compounds to

meet majority of their maintenance energy requirements. Acetic acid, propionic acid and

butyric acid are known for their role in stimulation of sodium and fluid absorption in colon

(Tagang et al. 2010). With regard to role of VFA compounds in probiotics, the ability to

impart flavours to food products is of interest. However, very little is known about it’s

production mechanism in LAB (Nakae & Elliott, 1965). The fatty acid profiles of bacteria are

species specific. However, conditions of stress/ environmental factors can induce a change in

the fatty acid profiles. In this case, low pH and increased bile salts concentration have been

used to create stress conditions for growth of lactobacilli. There is limited literature

reporting whether the stress induced changes are essential for survival and also whether the

ability to alter the fatty acids composition is predetermined nature (Suutari et al. 1990).

Depending on the degree of saturation/ unsaturation in the carbon chain fatty acids can be

divided into three classes: saturated fatty acids (SFA), monounsaturated fatty acids (MUFA)

and polyunsaturated fatty acids (PUFA). SFA do not have a double bond. MUFA contain only

one double bond and PUFA contain two or more double bonds.

With an increase in antibiotic resistance amongst bacteria, interest in the use of

probiotics and their antimicrobial compounds as an alternative to treat and prevent

infections are on the rise (Shokryazdan et al. 2014). The common antimicrobial compounds

produced by lactobacilli species includes organic acids, hydrogen peroxide or bacteriocins.

Only few bacteria are capable of bacteriocin production (Moraes et al. 2010). The most

common mechanism of inhibition of pathogens by lactobacilli includes the production of

organic acids, which lowers the pH in the environment thereby inhibiting growth of the

pathogen. Hence exhibition of antimicrobial activity against pathogens is a selective property

of potential probiotic candidates.

Roundup® is a commercial herbicide that is manufactured by Monsanto. It is applied

in agricultural fields to control the growth of weeds. Glyphosate (N- phosphonomethyl

glycine) is the active ingredient present in Roundup®, a broad spectrum herbicide which

117

interferes with the synthesis of aromatic amino acids in plants and microorganisms by

inhibiting the activity of enzyme, 5- enolpyruvyl shikimate 3- phosphate synthase (EPSPS)

(Cerdeira & Duke, 2006). It is claimed that Roundup® influences soil and gut microbial

diversity, however very little research has been presented to support this. In the present

work, the effects of Roundup® and glyphosate along with a widely reported organic spray

was studied on five lactobacilli isolates of rumen origin.

5.2 Methods

5.2.1 1 D SDS PAGE profiles of whole cell proteins and cytosolic proteins

5.2.1.1 Bacterial culturing conditions to study low pH and and bile salts stressed cells

Glycerol stock cultures of RC 2 and MI 13 were inoculated into MRS broth media of

pH 6.4 (phosphate buffered). It was mixed well and incubated at 37 0C overnight. The

following day, the overnight culture OD was measured. This can be done using a

spectrophotometer. The absorbance was set at 600 nm. Now the overnight culture was

inoculated into MRS broth containing two conditions of stress: pH 3.5 and 3.5% bile salts at

an initial OD of 0.3. The inoculated broths were incubated at 37 0C for 16 h. Overnight

culture was also added to standard MRS broth at an initial OD of 0.15. The cells were

harvested after OD reached 1.5- 2.0. approximately 8- 10 h or until pH stays above 5.

Because further incubation can lead to a drop in the pH, which can induce a stress level.

5.2.1.2 Visualization of protein bands

In order to visualize the protein bands, the gel after electrophoresis step was placed

in a staining ray containing Coomassie brilliant blue stain overnight. After staining, the gel

was washed a couple of times with RO water and then placed in a tray containing destaining

solution. The destaining solution was replaced every two to three hours until the protein

bands could be clearly visualized with the naked eye.

5.2.2 Identification of VFA compounds

5.2.2.1 Bacterial culturing conditions for volatile fatty acid (VFA) analysis in bacterial broth of low pH and bile salts stressed cells by HS- SPME GC- MS

The analysis of VFA compounds in bacterial broth was determined using an

automated Headspace Solid-Phase Micro-Extraction (HS- SPME) based on the method

118

published by (Tomasino et al. 2015). The bacterial cultures were grown under similar

conditions as previously described in section 5.2.1. After 16 h incubation time, the bacterial

cultures were centrifuged at 10, 000 rpm for 10 min at room temperature. The CFS was

transferred into smaller 1.5 ml eppendorf tubes and stored at -20 0C in the freezer until gas

chromatography- mass spectrophotometry (GC- MS) was carried out for detecting the VFA

compounds.

5.2.2.2 Sample preparation for VFA analysis

Sample preparation involved pipetting 0.45 ml of broth sample, 0.45 ml of deionised

water and 8.06 ml of 5 g L-1 tartaric acid buffer (pH 3.5) into 20 mL SPME sample vials (a 20

fold dilution of the broth), followed by 40 µl of the internal standard solution (4 internal

standard mix see Appendix J). 4.5 g of crystalline sodium chloride was then added to the

SPME vial just prior to capping. Samples were incubated initially for 10 min at 50 0C during

which time the vial was agitated at 500 rpm. After 10 min the SPME fiber (2 cm long

Stableflex DVB/CAR/PDMS, p/n 57348-U, Sigma- Aldrich Australia) was exposed to the

headspace of the vial for a period of 30 min at 50 0C. During this exposure period the

headspace volatiles were adsorbed onto the fiber. Desorption of these volatiles occurred

when the fiber was inserted into the GC injection port for 5 min at 250 0C. Prior to use the

SPME fiber was conditioned at 270 0C in the injection port for 1 h. Before each sample was

run the SPME fiber was conditioned for 10 min at 270 0C in a fiber conditioning station

attached to the Combi- Pal auto sampler used with the Shimadzu GC- MS instrument. Helium

was used in the fiber conditioning station to create an oxygen free atmosphere.

5.2.2.3 GC- MS analysis conditions

GC- MS analysis was carried out on a Shimadzu GC- MS- QP2010 gas chromatograph–

mass spectrometer equipped with a Combi- Pal autosampler ready for automated SPME. GC-

MS solution version 2.72 was used as the data acquisition software. The chromatography

was performed using two GC columns in series namely a Rtx- Wax 30.0 m x 0.25 mm ID x 0.5

μm film thickness (Polyethylene Glycol- Restek, Bellefonte, PA, USA) and a Rxi- 1MS 15 m x

0.25 mm ID x 0.5 μm (100% dimethyl polysiloxane- Restek, Bellefonte, PA, USA). Helium was

used as the carrier gas with the GCMS set to a constant linear velocity of 46.8 cm sec- 1. The

injector was operated in splitless mode for 3 min then switched to a 20:1 split ratio. The

119

column oven was held at 50 0C for 3 min (during desorption of the SPME fiber), then heated

to 240 0C at 10 0C min- 1 then further increased to 250 0C at 30 0C min- 1 and held at this

temperature for 5 min. Total run time was 27.33 min. The interface and MS source

temperatures were set at 250 0C and 200 0C respectively. The MS was operated in electron

impact (EI) mode at an ionization energy of 70 eV. All analytes were analysed in full scan

mode. Selected ions were used for the quantification of these analytes, see Appendix J.

5.2.3 Identification of FA methyl esters

5.2.3.1 Bacterial culturing conditions for fatty acid (FA) analysis of low pH and bile salts stressed cells using GLC

The bacterial cultures were grown under similar conditions as previously described in

section 5.2.1. After 16 h incubation time, the bacterial cultures were centrifuged at 10, 000

rpm for 10 min at room temperature. The pellet was washed in 0.1% in peptone water and

again centrifuged at 10, 000 rpm for 10 min. This step was repeated three times and the final

pellet was transferred into 0.5 ml eppendorf tubes and stored at -20 0C until sample

preparation for GLC analysis.

5.2.3.2 Sample preparation for FA analysis

Bacterial cells, 50- 70 mg, were added to a 1.7 ml eppendorf tube followed by the

addition of 0.1 ml of C13:0 Tridecanoic acid 167 µgmL-1 (Internal standard). These cells were

then transferred to a glass tube (13 mm x 100 mm) with the aid of 1 ml of 3.75 N sodium

hydroxide added to the eppendorf tube.

The reaction conditions for both saponification and methylation reactions used were

described by (Whittaker et al. 2005). However the isolation of the fatty acid methyl esters

(FAMES) used differed from that described by these authors. In detail 3 mL of hexane was

added before vortexing the tubes (5 min) with the lower phase then removed and 3 ml of

0.3 N sodium hydroxide added. Further vortexing of the tubes (5 min) was carried out before

0.5 ml of saturated sodium chloride was added (Sherlock MIS operating manual). To enhance

separation of the organic and aqueous layers the tubes were centrifuged at 1384 g for 5 min

at room temperature. After this approximately 2.9 ml of the organic layer was transferred to

clean glass tube (13 mm x 100 mm) and evaporated to dryness with oxygen free nitrogen.

The residue was then reconstituted in 50 µl of hexane, vortexed mixed, and transferred to a

120

vial insert where it was further diluted with an additional 50 µl hexane used to rinse out the

glass tube (Moss et al. 1974).

The internal standard was prepared by diluting 0.1001 g of Tridecanoic acid in 20 ml

of methanol (HPLC grade) to make a primary standard. An aliquot of 0.334 ml of the primary

standard was then added to a 10 ml volumetric flask and made up to the mark with

methanol to make a final concentration of 167 µg ml-1.

5.2.3.3 GLC analaysis conditions

A fatty acid methyl ester profile was then obtained using capillary GC column CP7420

100 m x 0.25 mm i.d. x 0.25 µm film thickness (Varian Column from Agilent Technologies s/n

6005241). This column was installed in a Shimadzu GC2010 gas chromatograph equipped

with a flame ionisation detector (FID). The GC conditions were as follows; the injector was

operated in split mode at a ratio of 15:1 with helium used as the carrier gas at a constant

linear velocity of 16.7 cm sec- 1, a sample volume of 1 µl was injected, the GC oven ramp

(modified from that published by (Rugoho et al. 2014) was initially held at 45 0C for 4 min

and then ramped to 175 0C at 13 0C min- 1 held for 27 min and then further ramped to 215

0C at 4 0C min- 1 and held for 35 min before a final ramp to 245 0C at 25 0C min- 1 which was

held for 10 min. The total run time was 97.2 min with both the injector and detector

temperatures set at 250 0C. Fatty acid method esters were identified using retention time

designations accompanying the Nuchek standard GLC 463.A. Linear Retention Indices (LRI)

were also calculated for each fatty acid methyl esters. This involved injecting two Alkane

standard mixes C8- C20 and C21- C40 under the same GC conditions as the samples with the

LRI value for each fatty acid methyl ester calculated based on the equation derived by (van

Den Dool & Kratz, 1963) and reviewed by (Zellner et al. 2008). A typical example (RC 2 under

bile salts stress) of a GLC chromatogram has been shown in Appendix K.

5.2.4 Statistical analysis for VFA compounds and FA methyl esters production

A general linear model was employed for the statistical analysis using the program

Minitab 17 (Minitab Incorporation, USA) to evaluate the experimental data for VFA

componds production and FA methyl esters production. The significant differences were

accepted at p<0.05 by Tukey’s post hoc analysis for differences between treatments.

121

5.2.5 Characterization of antimicrobial compounds produced by lactobacilli

The well diffusion method described by (Toure et al. 2003) with modifications was

followed to characterize the antimicrobial substances produced by lactobacilli. Lactobacilli

isolates were grown in MRS broth and the five pathogens were grown in BHI broth at 37 0C

overnight. Cultures centrifuged at 4000 rpm for 10 min at 4 0C. The supernatant obtained

after centrifugation was divided into three different portions for different assays.

1. 5ml of supernatant was treated with 1mg/ ml trypsin for determining bacteriocin

activity.

2. 5ml of supernatant was treated with 0.5mg/ ml catalase for determining hydrogen

peroxide production.

3. 5ml of supernatant, pH was adjusted to 6.5 ± 0.1 using 1N NaOH.

The treated supernatants were filter sterilized. Wells are punctured into the nutrient

agar plates which were spread with 200 µl of L. monocytogenes/ S. menston (indicator

strain). Now 100 µl of the treated supernatant was added into the wells. The plates were left

in the refrigerator for 3 h/ until diffusion of the supernatant into the agar. Then incubated at

37 0C for 48 h. The plates were observed for development of zones of inhibition. The type of

antimicrobial substance responsible for pathogen inhibition was determined based on the

presence/ absence of inhibition zones, see Table 5.1.

122

Table 5.1 Inhibition halo presence or absence and its corresponding indication depending on the treatment applied to the supernatant.

Supernatant

treatment

Inhibition halo presence or

absence

Antagonistic substance present

non-treated present organic acids, hydrogen peroxide or

bacteriocins.

treated with trypsin absent bacteriocin

present hydrogen peroxide or organic acids

treated with catalase absent hydrogen peroxide

present bacteriocin or organic acids

treated with NaOH absent organic acids

present bacteriocin or hydrogen peroxide

123

5.3 Results and discussion

5.3.1 1 D SDS PAGE whole cell protein and cytosolic protein profiles of dairy food isolate, MI 13 and rumen isolate, RC 2

The comparison of the protein profile banding patterns with pH stress and bile salts

stress revealed a number of protein bands which were differentially expressed. With the

whole cell proteomic profile, the most noticeable difference was the presence of dominant

bands of MW ~40 kDa and ~78 kDa, which was seen after 16 h incubation with pH 3.5. It was

visually difficult to detect any changes in protein expression banding patterns in case of bile

salts stress with the whole cell profiles, see Figure 5.1. The cytosolic protein banding

patterns were much more clear and distinct. Presence of dominant bands of MW ~32 kDa

was observed after 16 h incubation with pH 3.5. Presence of dominant bands of MW ~32

kDa and ~30 kDa was observed after 16 h incubation with 3.5% bile salts, see Figure 5.2.

Unlike the dairy food isolate, clear distinguishable changes at pH 3.5 and 3.5% bile

salts after 16 h incubation could be noticed in case of rumen isolate with whole cell protein

profile. The comparison of the protein profile banding patterns with pH stress and bile salts

stress revealed a number of protein bands which were differentially expressed. With the

whole cell proteomic profile, the most noticeable difference was the presence of dominant

bands of MW ~78 kDa and ~110 kDa, which was seen after 16 h incubation with pH 3.5. With

3.5% bile salts, the presence of dominant bands of MW ~78 kDa was observed after 16 h

incubation, see Figure 5.3. In case of cytosolic profiles, protein bands of MW ~110 kDa was

observed after 16 h incubation with pH 3.5. Presence of dominant bands of MW ~80 kDa,

~100 kDa and ~160 kDa was observed after 16 h incubation with 3.5% bile salts, see Figure

5.4.

128

5.3.2 Identification of VFA compounds produced under low pH and bile salts stressed conditions using HS- SPME GC- MS

The GC- MS technique detected seven different VFA compounds in bacterial broth of

low pH and bile salts stressed cells. The names of each VFA compounds identified has been

listed in Table 5.2. The different VFA compounds produced under standard and low pH and

bile salts stress conditions is shown in Figure 5.5. Statistical analysis showed that the amount

of acetic acid produced under standard and stress conditions were significantly different

from each other. There was no significant difference between MI 13 and RC 2 under

standard and stress conditions in the production of isobutyric acid. Butanoic acid, isovaleric

acid and 2- methylbutanoic acid produced under standard and low pH stress were

significantly different from those produced under bile salts stress. Hexanoic acid and

octanoic acid production was observed only in the case of bile salts stress conditions in MI

13 nad RC 2.

Table 5.2 Volatile fatty acids detected in bacterial broth using HS- SPME and Shimadzu QP- 2010 GC- MS.

Volatile fatty acid

compounds

MI 13

standard

MI 13 pH

stress

MI 13 bile

salts stress

RC 2

standard

RC 2 pH

stress

RC 2 bile

salts stress

Acetic Acid (mg/l) 4225 2192 3375 4411 2371 3091

Isobutyric Acid (µg/l) 8852 8905 9917 8853 9476 9745

Butanoic Acid (µg/l) 5810 5505 7832 5747 5889 7695

Isovaleric Acid (µg/l) 3424 3138 4881 3423 3412 4801

2-methylbutanoic

acid (µg/l)

1235 1099 1719 1221 1178 1696

Hexanoic Acid (µg/l) 0 0 13770 0 0 13441

Octanoic Acid (µg/l) 0 0 777 0 0 724

129

Figure 5.5 Different volatile fatty acid compounds produced by MI 13 and RC 2 under standard and pH and bile salts stress conditions. Columns with different letters differ significantly (p<0.05).

0

2000

4000

6000

8000

10000

12000

14000

16000V

olu

me

of

vola

atile

fat

ty a

cid

s p

rod

uce

d

Types of volatile fatty acids

MI 13 std MI 13 pH stress MI 13 bile stress RC 2 std RC 2 pH stress RC 2 bile stress

A A

A A

A A

A A

A A

A A

D D

D

D D

D

B B

B B B B

B B B B

C C

130

5.3.3 Identification of fatty acid methyl esters produced under low pH and bile salts stressed conditions using GLC

GLC technique helped in detection and identification of twenty four fatty acid methyl

esters under standard and low pH and bile salts stress conditions. The names of each

identified fatty acid along with their systematic name and structure has been listed in Table

5.3. The different types of fatty acids produced by MI 13 and RC 2 under standard and low

pH and bile stress conditions is shown in Figure 5.6. In MI 13, the SFA and MUFA levels were

significantly different for all treatments. The PUFA levels for standard and low pH stress

were same but increased for bile salts stress. In RC 2, SFA and MUFA levels were significantly

different from each other for all treatments. The PUFA levels for standard and low pH stress

were same but increased for bile salts stress. In general an increased level of PUFA

production in both the isolates under bile salts stress was observed.

131

Table 5.3 List of fatty acid methyl esters detected by GLC.

Fatty acid Systematic name Structure CAS Noa RTb

GC-FID

(mins)

LRIc

Tridecylic d Tridecanoic C13:0 1731-88-0 27.42 2024

Tetradecanoic Myristic C14:0 124-10-7 29.70 2129

Petadecylic Pentadecanoic C15:0 7132-64-1 32.65 2227

Palmitic Hexadecanoic C16:0 112-39-0 36.53 2336

Margaric Heptadecanoic C17:0 1731-92-6 41.65 2431

Stearic Octadecanoic C18:0 112-61-8 46.91 2539

Nonadecylic Nonadecanoic C19:0 1731-94-8 51.00 2646

Myristoleic c9-Tetradecenoic C14:1c9 1120-25-8 31.4 2189

trans-Palmitoleic t9-Hexadecenoic C16:1t9 1937-62-8 37.94 2357

cis-Palmitoleic c9-Hexadecenoic C16:1c9 1120-25-8 38.85 2376

no namee Heptadecenoic C17:1 75190-82-8 44.39 2483

Elaidic t9-Octadecenoic C18:1t9 1937-62-8 48.04 2566

trans -Vaccenoic t11-Octadecenoic C18:1t11 52380-33-3 48.26 2572

Petroselinic c6-Octadecenoic C18:1c6 2777-58-4 48.51 2578

Oleic c9-Octadecenoic C18:1c9 112-62-9 48.70 2582

cis -Vaccenoic c11-Octadecenoic C18:1c11 1937-63-9 49.03 2590

no namee c7-nonadecenoic C19:1 146407-37-6 52.22 2682

no namee c5-Eicosenoic C20:1c5 20839-34-3 55.39 2777

Gondoic c11-Eicosenoic C20:1c11 2462-85-3 55.98 2795

Nervoic c15-Tetracosenoic C24:1c15 2733-88-2 74.41 3210

Linoleic c9,12-Octadecadienoic C18:2c9,12 2462-85-3 51.32 2656

gamma -Linolenic c6,9,12-Octadecatrienoic C18:3c6,9,12 16326-32-3 52.99 2705

Linolenic c9,12,15-Octadecatrienoic C18:3c9,12,15 301-00-8 54.20 2741

homo ϒ linolenic c8,11,14-Eicosatrienoic C20:3c8,11,14 17364-32-8 60.49 2918

a CAS numbers are for the methyl esters of the fatty acid listed. b GC Retention Time in minutes.

c LRI values calculated from alkane mixes C8-C20 and C21-C40 (H.van Den Dool and P.Dec. Kratz (1963)). d Internal standard added - 0.1 mL of 167 µg mL-1 Tridecanoic acid. e No commercial name available for these fatty acids, systematic name used uniformally.

132

Figure 5.6 Types of fatty acid methyl esters produced by MI 13 and RC 2 under standard and pH and bile salts stress conditions. Columns with different letters differ significantly (p<0.05).

0

5

10

15

20

25

30

35

40

45

50

MI 13 std MI 13 pH stress MI 13 bile stress RC 2 std RC 2 pH stress RC 2 bile stress

% o

f fa

tty

acid

s

Bacterial growth conditions

SFA MUFA PUFA

E

B

H

F

A

H

C D

G

E

B

H H

F

A

C D

G

133

5.3.4 Determination of antimicrobial compounds produced by lactobacilli

Inhibition zones were observed around the supernatant samples treated with trypsin,

catalase and untreated sample. Around the neutralized supernatant, no inhibition zones

were seen. This indicated that the inhibition ability of the lactobacilli towards pathogens was

due to organic acids production. The inhibitory activity of lactobacilli isolates against E. coli

is shown in Table 5.4. The inhibitory activity of lactobacilli isolates against E. aerogenes is

shown in Table 5.5. The inhibitory activity of lactobacilli isolates against S. menston is shown

in Table 5.6. The inhibitory activity of lactobacilli isolates against S. aureus is shown in Table

5.7 and the inhibitory activity of lactobacilli isolates against L. monocytogenes is shown in

Table 5.8.

134

Table 5.4 Inhibition zone of Lactobacillus isolates against E. coli for each supernatant treatment.

Lactobacillus isolate Supernatant + trypsin

Inhibition zone (mm)

Supernatant + catalase


Neutralized supernatant


Untreated supernatant


MI 6 12.7 ± 1.5 11.2 ± 1.6 10.8 ± 0.3 -

MI 7 16.3 ± 1.2 15.3 ± 0.6 13.0 ± 0 -

MI 10 15.0 ± 0 15.7 ± 0.6 15.3 ± 0.6 -

MI 13 16.0 ± 0 15.0 ± 0 14.3 ± 0.6 -

MI 17 17.0 ± 2 14.2 ± 0.7 14.5 ± 0.8 -

RC 2 14.3 ± 1.2 16.0 ± 1.7 18.7 ± 2.3 -

RC 5 16.3 ± 0.6 13.7 ± 2.1 17.0 ± 0 -

RC 13 12.1 ± 1.8 14.7 ± 1.5 10.9 ± 1.1 -

RC 25 13.0 ± 0 14.7 ± 0.6 16.7 ± 1.5 -

RC 30 12.8 ± 0.3 16.0 ± 2 10.5 ± 1.3 -

Values are means ± SD done in triplicate. - No inhibition

135

Table 5.5 Inhibition zone of Lactobacillus isolates against E. aerogenes for each supernatant treatment.

Lactobacillus isolate Supernatant + trypsin Supernatant + catalase Neutralized supernatant Untreated supernatant

MI 6 12.7 ± 0.6 12.8 ± 1.0 - 13.7 ± 1.5

MI 7 12.0 ± 1.0 10.3 ± 0.6 - 13.2 ± 1.6

MI 10 12.3 ± 2.1 11.7 ± 0.6 - 13.3 ± 2.1

MI 13 15.0 ± 0 12.7 ± 1.5 - 9.8 ± 0.8

MI 17 16.1 ± 1.0 13.4 ± 1.2 - 16.3 ± 1.5

RC 2 15.3 ± 0.6 13.0 ± 1.0 - 16.3 ± 0.6

RC 5 16.8 ± 0.8 12.7 ± 1.5 - 12.3 ± 1.5

RC 13 15.1 ± 1.8 13.6 ± 1.2 - 13.6 ± 0.5

RC 25 16.0 ± 0 13.3 ± 1.5 - 15.3 ± 0.6

RC 30 16.0 ± 2 16.0 ± 0 - 15.4 ± 1.2


136

Table 5.6 Inhibition zone of Lactobacillus isolates against S. menston for each supernatant treatment.


MI 6 15.3 ± 1.2 14.0 ± 1.0 - 11.0 ± 0

MI 7 16.7 ± 1.2 16.0 ± 0 - 16.3 ± 0.6

MI 10 16.0 ± 0 17.3 ± 1.2 - 14.3 ± 1.2

MI 13 16.7 ± 2.9 17.0 ± 0 - 16.0 ± 0

MI 17 16.5 ± 1.5 15.3 ± 1.5 - 14.0 ± 2.0

RC 2 17.7 ± 0.6 17.0 ± 0 - 14.7 ± 1.2

RC 5 15.7 ± 0.6 16.3 ± 1.5 - 15.0 ± 0

RC 13 13.7 ± 1.5 15.0 ± 0 - 13.7 ± 0.6

RC 25 13.7 ± 0.6 15.3 ± 1.2 - 14.3 ± 1.2

RC 30 10.7 ± 0.6 12.3 ± 0.6 - 12.7 ± 1.5


137

Table 5.7 Inhibition zone of Lactobacillus isolates against S. aureus for each supernatant treatment.


MI 6 11.9 ± 1.4 10.3 ± 0.6 - 12.7 ± 0.6

MI 7 13.7 ± 0.6 12.7 ± 1.2 - 12.5 ± 1.5

MI 10 13.0 ± 1.0 10.7 ± 1.2 - 10.9 ± 1.0

MI 13 15.3 ± 0.6 15.0 ± 0 - 12.8 ± 1.1

MI 17 13.2 ± 1.3 12.2 ± 0.3 - 13.7 ± 0.6

RC 2 16.0 ± 1.0 15.7 ± 2.1 - 12.7 ± 1.5

RC 5 10.7 ± 2.1 11.3 ± 0.6 - 10.0 ± 0

RC 13 17.3 ± 0.3 14.3 ± 1.2 - 11.8 ± 0.3

RC 25 14.3 ± 2.1 10.8 ± 0.3 - 15.0 ± 1.7

RC 30 13.2 ± 1.0 13.5 ± 0.6 - 16.3 ± 0.6


138

Table 5.8 Inhibition zone of Lactobacillus isolates against L. monocytogenes for each supernatant treatment.


MI 6 11.7 ± 0.6 12.3 ± 1.5 10.3 ± 0.6 -

MI 7 17.7 ± 1.5 10.7 ± 0.6 10.8 ± 1.0 -

MI 10 11.7 ± 0.6 13.0 ± 0 - 10.7 ± 0.6

MI 13 13.3 ± 1.2 12.7 ± 2.1 - 14.7 ± 1.5

MI 17 14.7 ± 1.5 13.7 ± 1.5 - 14.7 ± 2.3

RC 2 10.7 ± 0.6 10.0 ± 1.0 - 11.0 ± 1.0

RC 5 11.0 ± 0 12.0 ± 2.0 - 12.0 ± 1.0

RC 13 11.0 ± 1.0 12.0 ± 1.0 - 16.3 ± 1.5

RC 25 15.3 ± 1.5 16.8 ± 1.0 - 15.7 ± 1.5

RC 30 12.0 ± 1.7 15.0 ± 2.6 - 18.8 ± 1.0


139

5.3.5 Analysis of the adherence and permeability properties of potentially probiotic dairy vs rumen lactobacilli isolates to human Caco- 2 cells

This section has been drafted for submisison to a suitable journal and is reproduced

on the following pages.

140

Journal Name

Research Paper

Analysis of the adherence and permeability properties of

potentially probiotic dairy vs rumen lactobacilli isolates to human Caco- 2 cells

Neethu Maria Jose1, Craig R. Bunt2 and Malik A. Hussain1

1Department of Wine, Food and Molecular Biosciences, Lincoln University, Lincoln 7647, New Zealand

2Department of Agriculture, Lincoln University, Lincoln 7647, New Zealand

Correspondence:

Malik A. Hussain

WFMB, RFH Building Room 047

P O Box 85084, Lincoln University

Lincoln 7647, Christchurch, New Zealand

Tel.: +64 3 4230638

E-mail: [email protected]

mailto:[email protected]

141

Abstract

The selection criteria of an ideal probiotic bacteria is complex and involves a range of factors.

One of the key criterion for this selection is based on the adhesion abilities of the probiotic

bacteria onto the gastrointestinal epithelial lining. The objective of this study was to evaluate

and compare the adherence and permeability potential of two selected lactobacilli isolates,

one from dairy food products and one from bovine rumen contents. The adhesion and

permeability abilities of the two lactobacilli isolates were compared against an Escherichia

coli, which is a human commensal. Genetically the lactobacilli isolates were identified as

Lactobacillus rhamnosus LOCK 908 (dairy food origin) and L. plantarum 16 (bovine rumen

origin). From the adhesion studies, it was concluded that the rumen isolate exhibited better

adherence to Caco- 2 cells in comparison with the dairy isolate. On the contrary, presence of

the dairy food isolate showed a high TEER value for the membrane integrity studies.

Keywords: Lactobacilli; Escherichia coli; Caco- 2 cells; adherence; permeability

142

1. Introduction

An effective probiotic bacteria is required to operate under a variety of different

environmental conditions and survive in many different forms. It should therefore possess

ideal probiotic characteristics such as, high viability, resistance to acidic and bile salt

conditions, ability to interact and trigger immune cells of the gut, should be non- pathogenic,

genetically stable and exhibit resistance to processing conditions (Gupta and Garg, 2009).

However, the key criterion for selection is believed to be the adherence to the intestinal

epithelial lining and ability to colonize the gut (Alander et al., 1999; Mattila- Sandholm et al.,

1999). This characteristic feature best describes a bacteria as a potential probiotic. It is

because, after consumption and gastro-intestinal tract transit, the survival and prolongation of

the probiotic bacteria in the gut is determined by the host- bacterial interaction. This

phenomenon is dependent on the adhesion abilities of the probiotic bacteria (Gueimonde and

Salminen, 2006). Therefore, adhesion to human adenocarcinoma cell lines, which mimics the

human intestinal cells is considered to be a prominent feature of potentially probiotic bacteria

(Kleeman and Klaenhammer, 1982; Conway et al., 1987).

Understanding the mechanisms responsible for probiotic bacterial adhesion in vivo is quite

challenging. This has led to the development of Caco- 2 cell line, one of the human

adenocarcinoma cell lines used extensively in the study of bacterial adherence in vitro (Duary

et al., 2011). Caco- 2 cells resemble physiologically and functionally the enterocytes lining

the intestine. They are excellent models which help in understanding how the probiotic

bacteria interacts with the intestinal epithelial lining (Wang et al., 2008; Moussavi and

Adams, 2010). They also help in investigating how the probiotic bacteria competes with

human commensals for attachment sites in the gut.

Integrity of the intestinal barrier plays a significant role in maintenance of good health.

This is attributed to the formation of tight junctions between adjacent intestinal epithelial

cells, thereby sealing any gaps (Schneeberger and Lynch, 2004). Any compromise of the

intestinal barrier makes it “leaky”, resulting in infections (Anderson et al., 2010).

Determination of the ability of probiotic bacteria in maintenance of intestinal lining integrity

is measured in vitro in terms of transepithelial electrical resistance (TEER) (Klingberg et al.

2005).

In our initial study, ten lactobacilli isolates, five each from dairy food products and bovine

rumen contents were assessed for their hydrophobicity by the bacterial adherence to

hydrocarbons (BATH) method. From the study it was evident that the rumen isolates

exhibited better adherence to hydrocarbons in comparison to dairy isolates (Jose et al., 2015).

143

In the present study, only two of the ten isolates, one from dairy and one from rumen were

further investigated for their adhesion and permeability properties in vitro. For determining

the adhesion and permeability properties, the two lactobacilli isolates which possessed

potential probiotic properties were made to grow on a Caco- 2 cell monolayer.

2. Materials and methods

2.1 Bacterial strains and growth conditions

L. rhamnosus LOCK 908 was isolated from dairy food product and L. plantarum 16 was

isolated from bovine rumen. The two lactobacilli isolates were inoculated in de Man, Rogosa,

Sharpe (MRS) broth (Oxoid, Basingstoke, UK) of pH 6.4 ± 0.2, whereas E. coli was

inoculated into Brain Heart Infusion (BHI) broth (Oxoid, Basingstoke, UK) of pH 7.4 ± 0.2.

The cultures were incubated at 370 C overnight. After incubation the cultures were centrifuged

at 4,000 rpm for 10 min. The cells were washed and suspended in phosphate buffered saline

(PBS) of pH 7.4 after adjusting the Optical Density (O.D.) to 2.0.

2.2 Culturing Caco- 2 cells

The Caco- 2 cell line used for the adhesion studies were propagated and maintained at the

University of Otago, Dunedin, New Zealand. Caco-2 cells were cultured in BD FalconTM Cell

culture flasks of surface area of 75 cm2 (BD Biosciences, Bedford, MA, USA) following

standard protocols (Gao et al., 2000). Cells were fed on alternate days with 15 ml Dulbecco’s

Modified Eagle Medium (DMEM) supplemented with 10% Foetal Bovine Serum (FBS)

(Moregate® Australia and New Zealand, Queensland, Australia) 1% non-essential amino acid

and 1% penicillin-streptomycin. Upon 70% cell confluency, cells were detached from the

flask with 2 ml trypLETM Express Enzyme (1X) (Gibco® Life Technologies Corporation, NY,

USA) for seeding.

2.3 Seeding Caco- 2 cells

Caco- 2 cells were seeded on the permeable supports (Corning® Incorporated, NY, USA) at

50,000 cells/ well (0.5 ml of 100,000 cells/ ml) for 21 to 28 days (to obtain fully differentiated

monolayer) for uptake studies. The cells grown on the permeable support were fed on

alternate days with fresh medium (0.5 ml in the donor compartment and 1.5 ml in the receiver

compartment).

144

2.3 Adhesion studies

Caco- 2 cells were seeded with culture medium in transwell membrane tissue culture plates.

The two lactobacilli isolates, L. rhamnosus LOCK 908 and L. plantarum 16 and E. coli were

added individually and also each lactobacilli isolate was added in combination with E. coli

into the wells of the tissue culture plates. They were then incubated at 370 C in 10% carbon

dioxide- 90% air. After incubation, the Caco- 2 monolayers were washed with sterile PBS

several times to remove the unattached bacteria. It was later fixed with methanol, gram

stained. The gram stained slides were observed under the oil- immersion objective (100x) for

counting the number of bacteria that had adhered to the Caco- 2 cells, see Figure 1. The

bacteria in 25 random microscopic fields were counted for each test (Thirabunyanon et al.,

2009 and Liu et al., 2013).

2.4 Monolayer integrity studies

The matured Caco-2 cell monolayers were washed with diluted DMEM (1:1 ratio of

completed DMEM to PBS) twice. Then the cells were incubated with 0.5 ml and 1.5 ml of

diluted DMEM in the donor compartment and the receiver compartment, respectively, at 370

C for 30 min prior to the permeability study. The diluted DMEM in the donor compartment

then was replaced with diluted DMEM containing either 1% ethanol (to challenge the

integrity of the monolayer), E. coli (0.4 ml), dairy isolate (0.4 ml), or rumen isolate (0.4 ml),

(see Table 1) and the co- incubation with the Caco-2 cell monolayers was carried out at 370 C

over 90 min. Transepithelial electrical resistance (TEER) measurements were taken at 90 min

using Millicell®-ERS (EMD Millipore® Corporation, Billerica, MA, USA).

Table 1. Samples co-incubated with the Caco- 2 cells monolayers over 90 min.

Sample 1% Ethanol E. Coli Dairy isolate Rumen isolate A

(positive control) + - - -

B + - + - C + - - + D + + - - E + + + - F + + - + G

(negative control) - - - -

148

how the lactobacilli isolates compete with a human commensal for binding sites. From our

study, it was evident that the rumen isolate, L. plantarum 16 remained unaffected by the

presence of E. coli. It adhered in significantly large numbers onto the Caco- 2 cells. However,

the dairy isolate, L. rhamnosus LOCK 908, adhesion numbers were greatly lowered in the

presence of E. coli. The trend observed was similar in both the two week and three week old

Caco- 2 cells. Although the adhesion numbers overall were higher in case of two week old

Caco- 2 cells. It was previously reported that L. plantarum of faecal origin recorded a higher

adherence rate to Caco- 2 cells, whereas, a dairy isolate, L. delbrueckii subsp. bulgaricus

showed a lower adherence rate (Duary et al., 2011). This suggests that the adherence property

of Lactobacillus species is strain specific (Chauviere et al., 1992). With membrane integrity

studies, it can be concluded that the presence of the rumen isolate did not affect the intestinal

lining permeability. On the other hand, the dairy food isolate was capable of strengthening the

intestinal barrier function, which was demonstrated by an increase in TEER values over the

90 min incubation period. Previous studies have reported a noticeable increase in TEER

values with L. plantarum species (Anderson et al. 2010; Klinberg et al. 2005). This is not

surprising as different strains of L. plantarum can have different effects on membrane

integrity studies in vitro. It can either show no increase in TEER value as seen in our study or

it can show an increase in TEER value, as evident from studies carried by Anderson et al. in

2010 and Klinberg et al. in 2005. From the results obtained from this study it has been

understood that the ability to adhere and enhance the expression of tight junction- related

genes are two different mechanisms, which are strain specific.

Acknowledgement

The authors are grateful to the University of Otago, Dunedin, New Zealand, for their

contribution in this research. The authors would also like to thank the Faculty of Agriculture

and Life Sciences, Lincoln University for their financial support. The funding body was not

directly involved in the research.

149

References

Alander, M., Satokari, R., Korpela, R., Saxelin, M., Vilpponen- Salmela, T., Mattila-

Sandholm, T., von Wright, A. 1999. Persistence of colonization of human colonic mucosa by

a probiotic strain, Lactobacillus rhamnosus GG, after oral consumption. Applied and

Environmental Microbiology 65 (1), 351- 354.

Anderson, R.C., Cookson, A.L., McNabb, W.C., Park, Z., McCann, M.J., Kelly, W.J., Roy,

N.C. 2010. Lactobacillus plantarum MB452 enhances the function of the intestinal barrier by

increasing the expression levels of genes involved in tight junction formation. BMC

Microbiology 10, 1- 11.

Chauviere, G., Coconnier, M.H., Kerneis, S., Fourniat, J., Servin, A.L. 1992. Adhesion of

Lactobacillus acidophilus strain LB to human enterocyte- like Caco2 cells. Journal of General


Conway, P.L., Gorbach, S.L., Goldin, B.R. 1987. Survival of lactic acid bacteria in the human

stomach and adhesion to intestinal cells. Journal of Dairy Science 70, 1- 12.

Duary, R.K., Rajput, Y.S., Batish, V.K., Grover, S. 2011. Assessing the adhesion of putative

indigenous probiotic lactobacilli to human colonic epithelial cells. Indian Journal of Medical

Research 134, 664- 671.

Gao, J.N., Hugger, E.H., Beck-Westermeyer, M.S., Borchardt, R.T. 2000. Estimating

intestinal mucosal permeation of compouds using Caco- 2 cell monolayers. Current Protocols

in Pharmacology 8, 7.2.1-7.2.23.

Greene, J.D., Klaenhammer, T.R. 1994. Factors involved in adherence of lactobacilli to

human Caco-2 cells. Applied and Environmental Microbiology 60 (12), 4487-4494.

Gueimonde, M., Salminen, S., 2006. New methods for selecting and evaluating probiotics.

Digestive and Liver Disease 38, S242-S247.

Gupta, V., Garg, R. 2009. Probiotics. Indian Journal of Medical Microbiology 27 (3), 202-

209.

150

Jose, N.M., Bunt, C.R., Hussain, M.A. 2015. Comparison of microbiological and probiotic

characteristics of lactobacilli isolates from dairy food products and bovine rumen contents.

Microorganisms 3, 198-212.

Kleeman, E.G., Klaenhammer, T.R. 1982. Adherence of Lactobacillus species to human fetal

intestinal cells. Journal of Dairy Science 65, 2063- 2069.

Klingberg, T.D., Pedersen, M.H., Cencic, A., Budde, B.B. 2005. Application of

measurements of transepithelial electrical resistance of intestinal epithelial cell monolayers to

evaluate probiotic activity. Applied and Environmental Microbiology 71, 7528- 7530.

Liu, X., Liu, W., Zhang, Q., Tian, F., Wang, G., Zhang, H., Chen, W. 2013. Screening of

lactobacilli with antagonistic activity against enteroinvasive Escherichia coli. Food Control

30, 563- 568.

Mattila- Sandholm, T., Matto, J., Saarela, M. 1999. Lactic acid bacteria with health claims:

interactions and interference with gastrointestinal flora. International Dairy Journal 9, 25- 35.

Moussavi, M., Adams, M.C. 2010. An in vitro study on bacterial growth interactions and

intestinal epithelial cell adhesion characteristics of probiotic combinations. Current


Schneeberger, E.E., Lynch, R.D. 2004. The tight junction: a multifunctional complex.

American Journal of Physiology- Cell Physiology 286, C1213- C1228.

Thirabunyanon, M., Boonprasom, P., Niamsup, P. 2009. Probiotic potential of lactic acid

bacteria isolated from fermented dairy milks on antiproliferation of colon cancer cells.

Biotechnology Letters 31, 571- 576.

Wang, B., Wei, H., Yuan, J., Li, Q., Li, Y., Li, N., Li, J. 2008. Identification of a surface

protein from Lactobacillus reuteri JCM1081 that adheres to porcine gastric mucin and human

enterocyte- like HT- 29 cells. Current Microbiology 57, 33- 38.

151

5.3.6 Effect of glyphosate on rumen isolates in vitro

This section has been drafted for publication to a suitable journal and is reproduced on the

following pages.

152

Effect of glyphosate on rumen isolates in vitro

Neethu Maria Jose1, Craig R. Bunt1* and Malik A. Hussain2

1, 2Department of Wine, Food and Molecular Biosciences, Lincoln University, Lincoln 7647,

New Zealand

1*Department of Agriculture, Lincoln University, Lincoln 7647, New Zealand

Correspondence:

Craig R. Bunt

Department of Agricultural Sciences

P O Box 85084, Lincoln University

Lincoln 7647, Christchurch, New Zealand

Tel.: +64 3 423057

E-mail: [email protected]

mailto:[email protected]

153

Glyphosate (N-(phosphonomethyl) glycine) is widely used in agricultural fields for control of

weeds. Genetically modified soy, corn, canola, alfalfa, cotton, and sorghum have been

developed to be resistant to glyphosate allowing farmers to control weeds without damage to

crops. The use of glyphosate for weed control is controversial (James 2009; Johal and Huber

2009). Glyphosate is a broad spectrum herbicide which interferes with the synthesis of

aromatic amino acids in plants and microorganisms by inhibiting the activity of the 5-

enolpyruvyl shikimate 3-phosphate synthase (EPSPS) enzyme (Cerdeira and Duke 2006). It is

assumed that glyphosate does not directly affect vertebrates as they lack this enzyme (Schrodl

et al. 2014; Solomon et al. 2007). It has been claimed that it may be possible for glyphosate to

influence microorganism for example Lactobacillus spp., which form part of the normal

microbiota of humans and animals (Mercola 2015). Lactobacillus spp. are beneficial bacteria,

which promote general wellbeing in the host by balancing the gut. The response of lactobacilli

to different stress conditions like low pH, bile salt stress, high or low temperature stress,

nutrient stress etc. has been widely studied, due to their applications in health food and

complementary medicines (Hyronimus et al. 2000; Hamon et al. 2011; Koponen et al. 2012;

Jose et al. 2015). It has been suggested that impacts on beneficial microbes by glyphosate

may interference with human and animal health (Claire et al. 2012; Johal and Huber 2009;

Mercola 2015), although this is not a widely held opinion. A number of recipes for so called

“organic roundup” or “organic herbicide” have become widely distributed on the internet

(Kniss 2014) as a way to address the perceived problems with glyphosate. It is claimed that

unlike glyphosate containing products these organic herbicides do not impact microbes, be

they be in the soil or gut of animals.

To our knowledge there are no reports investigating possible glyphosate effects on bacteria

from the bovine rumen. We have compared a commercial glyphosate herbicide (Zero

Weedkiller – Super Concentrate; Yates Ltd, Auckland, New Zealand) containing glyphosate

(3.92 mg/ml once diluted 8 ml/l for application) against a recipe widely distributed on the

internet (Kniss 2014) described as an organic herbicide on the growth of five lactobacilli

isolated from the bovine rumen. Variations in the amounts of each component of the organic

herbicide are common; for this study we used the following recipe; 1.89 l white vinegar

(Pams Products Ltd; Auckland, New Zealand), 120 g salt (Cerebos Ltd; Dunedin, New

Zealand) and 30 ml dish soap (Ecostore Ltd; Auckland, New Zealand). The isolates used were

genetically identified as, RC 2 (Lactobacillus plantarum 16), RC 5 (L. plantarum 16), RC 13

(L. plantarum subsp. plantarum ST- III), RC 25 (L. plantarum 16) and RC 30 (L. plantarum

subsp. plantarum ST- III). The microbiological and probiotic characteristics of these

Lactobacillus have been previously reported (Jose et al. 2015).

154

The disc diffusion method was used to assess the antimicrobial activity of commercial

glyphosate, glyphosate (N-phosphonomethyl glycine, Sigma-Aldrich New Zealand;

Auckland, New Zealand), organic herbicide and the organic herbicide individual ingredients.

One hundred microliter of overnight lactobacilli cultures were evenly spread onto the surface

of MRS agar plates (Oxoid, Basingstoke, UK) and 7 mm diameter blank sterile paper discs

(Oxoid, Basingstoke, UK), antibiotic (ampicillin) discs or papers discs dipped in commercial

glyphosate, organic herbicide, white vinegar, glyphosate (3.92 mg/ml), salt (62.5 mg/ml) or

detergent (15.6 l/ml) were transferred aseptically onto the surface of the agar. Replicate

plates (n=3) were prepared for this study. All test solutions were sterilised by filtration

through a 0.10 m filter. The plates were then incubated for 24 h at 37oC under anaerobic

conditions. Following incubation the plates were then inspected for zones of inhibition around

the paper discs, see Figure 1 for typical examples. The sizes of zones were measured from the

outer edge of the disc to the outer edge of the zone.

Small inhibition zones of up to approximately 1 mm were observed around commercial

herbicide, organic herbicide, glyphosate and the individual components of the organic

herbicide (Figure 2). The inhibition zones for ampicillin ranged from about 5 to 10 mm

depending on the isolate. The inhibition zone produced by ampicillin was significantly greater

(p<0.01) compared to the commercial, organic herbicide and blank discs. Differences between

the commercial, organic herbicide and glyphosate and the individual components of the

organic herbicide were not significant (P>0.10).

In a similar study that compared the effects of glyphosate potential pathogens and beneficial

members from poultry it was reported that most pathogenic bacteria were highly resistant

towards the glyphosate, although Campylobacter spp. were susceptible. However, the

beneficial bacteria had a moderate to high degree of susceptibility to glyphosate (Shehata et

al. 2013). It has also been reported that commercial glyphosate products, such as Roundup®

are more toxic towards food microorganisms than glyphosate alone at similar concentrations

(Clair et al. 2012). Many substances have either positive or negative influence on the growth

of microbes. Some studies of glyphosate and bacteria growth have drawn conclusions about

the toxicity of glyphosate towards microbes without suitable controls or specifically isolating

a component such as glyphosate from a mixture as having an influence without examining it

alone or in comparison with positive and negative control. Kurenbach et al. 2014 have

reported that glyphosate can reduce antibiotic susceptibility in Escherichia coli and

Salmonella enterica serovar Typhimurium. While these researchers did not investigate

glyphosate alone (they evaluated a commercial glyphosate containing product) the claim

155

glyphosate reduced antibiotic sensitivity is not supported by the data, furthermore many of the

test combinations they evaluated actually increased antibiotic sensitivity.

We have shown that for 5 isolates from the bovine rumen glyphosate, a commercial

glyphosate herbicide, and an organic herbicide and its components appear to have a similar

influence on microbial growth. This very small influence by glyphosate (be it alone or in the

form of a commercial product) and organic alternatives when compared to that of an

antibiotic that the isolates are known to be sensitive to suggest that this influence is minor and

likely to be of no consequence in vivo.

156

Figure 1. Inhibition of rumen isolates RC 2 (a) and RC 25 (b) by the agar disc diffusion

assay. RC 2 (a) plate shows zone of inhibition around discs containing clockwise from top

left; antibiotic, blank (control), organic herbicide or commercial glyphosate. The RC 25 (b)

plate shows zone of inhibition around discs containing clockwise from top left; vinegar, salt,

detergent or glyphosate.

158

Hamon E, Horvatovich P, Izquierdo E, Bringel F, Marchioni E, Werner DA, Ennahar S.

Comparative proteomic analysis of Lactobacillus plantarum for the identification of

key proteins in bile tolerance. BMC Microbiology 11, 1-11, 2011

Hyronimus B, Le Marecc C, Sassi AH, Deschamps A. Acid and bile tolerance of spore-

forming lactic acid bacteria. International Journal of Food Microbiology 61, 193-

197, 2000

Johal GS, Huber DM. Glyphosate effects on diseases of plants. European Journal of

Agronomy 33, 144-152, 2009

Jose N, Bunt CR, and Hussain MA. Comparison of Microbiological and Probiotic

Characteristics of Lactobacilli Isolates from Dairy Food Products and Bovine rumen

Contents. Microorganisms 3.2, 198-212, 2012

Kniss A. http://weedcontrolfreaks.com/2014/06/salt-vinegar-and-glyphosate/ 5 June, 2014

Kurenbach B, Marjoshi D, Amábile-Cuevas CF, Ferguson GC, Godsoe W, Gibson P,

Heinemann JA. Sublethal Exposure to Commercial Formulations of the Herbicides

Dicamba, 2, 4-Dichlorophenoxyacetic Acid, and Glyphosate Cause Changes in

Antibiotic Susceptibility in Escherichia coli and Salmonella enterica serovar

Typhimurium. mBio, 6, 9-15, 2015

Koponen J, Laakso K, Koskenniemi K, Kankainen M, Savijoki K, Nyman TA, de Vos

WM, Tynkkynen S, Kalkkinen N, Varmanen P. Effect of acid stress on protein

expression and phosphorylation in Lactobacillus rhamnosus GG. Journal of

Proteomics 75, 1357-1374, 2012

Mercola J. http://articles.mercola.com/sites/articles/archive/2013/10/06/dr-huber-gmo-

foods.aspx 16 September, 2015

Schrodl W, Kruger S, Konstantinova- Muller T, Shehata AA, Rulff R, Kruger M.

Possible effects of glyphosate on Mucorales abundance in the rumen of dairy cows in

Germany. Current Microbiology 69, 817-823, 2014

Shehata AA, Schrodl W, Aldin AA, Hafez HM, Kruger M. The effect of glyphosate on

potential pathogens and beneficial members of poultry microbiota in vitro. Current

Microbiology 66, 350-358, 2013

Solomon KR, Anadon A, Carrasquilla G, Cerdeira AL, Marshall EJP, Sanin LH. Coca

and poppy eradication in Columbia: environmental and human health assessment of

http://weedcontrolfreaks.com/2014/06/salt-vinegar-and-glyphosate/

http://articles.mercola.com/sites/articles/archive/2013/10/06/dr-huber-gmo-foods.aspx

http://articles.mercola.com/sites/articles/archive/2013/10/06/dr-huber-gmo-foods.aspx

159

aerially applied glyphosate. Reviews of Environmental Contamination and

Toxicology 190, 43-125, 2007

161

Figure 5.8 Average number of adhered bacteria to two week old Caco- 2 cells. Standard error of the mean bars (n=4).

5.4 Conclusions

The two isolates were characterised in terms of their adhesion to and permeability

across gut Caco- 2 cells. These isolates were also characterised under standard and stressed

(low pH and high bile) conditions by proteomic assessment of protein expression, production

of volatile fatty acids and fatty acid methyl esters. Overall isolate RC 2 from the bovine

rumen appears the be a superior candidate for further evaluation as a novel probiotic.

0.00

5.00

10.00

15.00

20.00

25.00

30.00

35.00

40.00

Rumen wk 2 Food wk 2 E.Coli wk 2 Rumen (withE.coli) wk 2

E.Coli (withRumen) wk 2

Food (withE.coli) wk 2

E.coli (withFood) wk 2

Ave

rage

bac

teri

a p

er C

aco

- 2

cel

l

Bacterial isolates

162

Chapter 6

General discussion and conclusion

6.1 General discussion

Objective 1: Isolation of potential probiotic bacteria from two sources

As part of this research study, fifty isolates were isolated from dairy food products

and bovine rumen contents in New Zealand. Out of which twenty isolates were of dairy food

origin and thirty isolates were of bovine rumen origin.

Objective 2: Preliminary screening of isolates

Basing on the morphology and gram- nature, twenty- six isolates in total were

selected for preliminary screening, which has been previously described in sections 4.3.3 and

4.3.4. Ten isolates which portrayed better performance characteristics in vitro for the

preliminary screening tests were identified by genetic methods as Lactobacillus sps.

Objective 3: Identification and selective screening of the ten most promising isolates

MI 6, MI 7, MI 10, MI 13, MI 17 were the five dairy food isolates and RC 2, RC 5, RC

13, RC 25, RC 30 were the five bovine rumen isolates that were genetically identified, see

section 4.3.6.

After genetic identification the ten selected lactobacilli isolates were subjected to

screening for potential probiotic abilities, see section 4.3.7. From the screening results, it

was evident that all the isolates proved capable of tolerating low pH conditions (pH 2 and pH

3). However, viability decreased with a decrease in pH. In similar studies, it was found that

the strains could tolerate and survive in MRS broth of pH 3, whereas low viability was

observed at pH 2 (Mishra & Prasad, 2005; Liu et al. 2013). Bile salt at a concentration of 0.3%

is the maximum that can be found in an average healthy person. Thus, in this study 0.3 %

was selected as the starting range for screening the isolates. The result showed that all

isolates could tolerate the 0.3% and 2% bile salt condition. However, higher growth was

163

monitored at 0.3% concentration of bile salt. Our findings are similar with other study were

lactobacilli was found to grow well and multiply in 0.3% of bile salt (Hoque et al. 2010).

As per safety concerns, a potential probiotic bacteria should not cause lysis of RBC’s

in the body. In vitro investigation of this was done by testing the isolates for haemolytic

activity. Lactobacilli are usually non- haemolytic in nature. In our study, all the ten isolates

were incapable of exhibiting haemolysis on the agar media containing 5% sheep blood.

Previous studies done on lactic acid bacteria and bifidobacteria species demonstrated that

they were non-haemolytic in nature (Santini et al. 2010).

The antibiotic resistance profiles of lactobacilli species showed that all the ten

isolates were resistant to vancomycin. This is because they possess D-Ala-D-Lactate in their

peptidoglycan instead of D-Ala-D-Ala dipeptide. The resistance is of intrinsic type because

the target site for antibiotics is absent (Klein et al. 2000). There has been no reported cases

of transferable resistance genes with vancomycin so far. However, resistance to this

antibiotic is of major concern as it is the last remaining choice for treating infections caused

by the multi-drug resistant Staphylococcus aureus (Pfeltz & Wilkinson, 2004).

Chloramphenicol, erythromycin and tetracycline are examples of antibiotics which inhibit

the protein synthesis mechanism. Lactobacilli are usually susceptible to such antibiotics.

However, aminoglycosides, which are also protein synthesis inhibitors are not effective

against gram- positive bacteria and gram- negative anaerobes. They exhibit bactericidal

activity against gram- negative aerobes and facultative anaerobic bacilli. Lactobacilli are

usually resistant towards these aminoglycosides which includes kanamycin, streptomycin

and gentamycin (Charteris et al. 1998b; Coppola et al. 2005; Zhou et al. 2005). According to

the experimental data obtained, three dairy isolates: MI 6 (L. reuteri TD1), MI 7 (L. reuteri

JCM 1112) and MI 10 (L. reuteri strain C16) showed resistance against chloramphenicol.

Previous studies have also reported chloramphenicol resistance in L. reuteri species because

they possess a plasmid- borne (pTC82) cat gene which confers resistance against

chloramphenicol (Lin et al., 1996). All five dairy isolates and five rumen isolates showed

resistance against nalidixic acid. There are previous studies that reported resistance of

lactobacilli against antibiotics targeting nucleic acid synthesis. An example of such an

antibiotic is nalidixic acid. According to the studies, the resistance in this case was found to

be intrinsic in nature (Charteris et al. 1998b; Coppola et al. 2005). LAB and bifidobacteria

have been used in the food and dairy industry over a long span of time and there were no

164

issues concerning it’s safety. It has been generally concluded that the chances of acquiring

infection from ingested food containing probiotic bacteria is not very high (Gasser, 1994;

Ouwehand et al. 2002).

One of the beneficial effects of probiotic consumption is attributed to the ability of

the probiotic bacteria to inhibit the growth of pathogens such as bacteria, viruses or fungi.

At the time of infection, the host initiates the immune system functioning. Probiotic bacteria

work synergistically with the host immune system and helps maintain the intestinal barrier

integrity, or breaks down the toxins produced by the pathogens, or creates a low pH

environment which is unfavourable for the growth of pathogens, or it produces metabolites.

Some of the metabolites synthesized by LAB includes hydrogen peroxide (H2O2), bacteriocin,

lactic acid, acetic acid and nitric oxide to name a few. Bacteriocins produced by the probiotic

bacteria show antimicrobial activity against bacteria of the same species or different species.

All the above mechanisms inhibit the adherence/ establishment and/ or replication of the

pathogens in the gastro-intestinal tract, thereby protecting the host from infections. The

antimicrobial activity profile shows that all the isolates were incapable of inhibiting the

growth of E. coli. Maximum inhibition was observed against L. monocytogenes. Inhibition of

Gram- positive bacteria such as L. monocytogenes and S. aureus by lactobacillus species

were already described (Bao et al. 2010). A mixed response was seen with E. aerogenes, S.

aureus and S. menston inhibition.

Determining the hydrophobicity of the bacterial strains plays a crucial role in their

selection as potential probiotics. Strains with a good adherence property indicates that they

are better capable of binding to the intestinal epithelial lining and improving the cell barrier

functions (Resta- Lenert & Barrett, 2003). This mechanism is one of the major factors by

which a probiotic bacteria exerts beneficial effects in the host. With a decrease in pH, the

adsorbence to dichloromethane increased. In general, rumen isolates portrayed better

adherence properties in comparison with dairy isolates. RC 2 and RC 25 rumen isolates

showed maximum adherence percentage.

Objective 4: Final characterisation of one isolate from the dairy food and the bovine rumen

for specific properties

The further characterization of selected two isolates, MI 13 and RC 2 for specific

properties has been described in chapter 5. The adhesion and permeability studies using

165

Caco- 2 cells can be found in section 5.3.7. From the results on adhesion studies, it was

evident that the rumen isolates showed higher adherence numbers than the dairy food

isolates to Caco- 2 cells independently and also in presence of E. coli. For the paper

publication only the three week adhesion studies were reported as there was no significant

changes observed within the two and three week Caco- 2 cells. The adhesion numbers of the

isolates across the two kinds of Caco- 2 cells followed a similar trend. With the monolayer

integrity studies, in the presence of dairy isolates, an increased TEER values was recorded

over a 90 min incubation. It was previously reported that L. plantarum of faecal origin

recorded a higher adherence rate to Caco- 2 cells, whereas, a dairy isolate, L. delbrueckii

subsp. bulgaricus showed a lower adherence rate (Duary et al. 2011). This suggests that the

adherence property of Lactobacillus species is strain specific (Chauviere et al. 1992).

From the 1D SDS PAGE protein profiles, dominant protein bands was observed with

isolates MI 13 and RC 2 under pH 3.5 and 3.5% bile salts stress after 16 h incubation. In MI

13, bands were over- expressed for pH stress with whole cell protein profiles and bands

were over- expressed with pH and bile salts stress for cytosolic profiles. In RC 2, dominant

and clear bands were seen for pH and bile salts stress with both whole cell and cytosolic

protein profiles. These results support the screening test results carried out for probiotic

abilities screening where, rumen isolate, RC 2, displayed better tolerance to presence of bile

salts and dairy isolate, MI 13 displayed better tolerance to acidic environment.

Seven different VFA compounds were produced by MI 13 and RC 2 under standard

and stress conditions. However, their levels of production were different with each

treatment. One key finding was the detection of hexanoic and octanoic acids which were

produced only under the bile salts stress conditions. They production was not observed

under standard conditions of growth and low pH stress. In case of fatty acid analysis, twenty

four different fatty acids were identified by GLC technique. Although SFA, MUFA and PUFA

were produced both under standard and stress conditions, their percentage levels varied

with each treatment. Myristoleic, trans- palmitoleic, cis- palmitoleic, elaidic, trans-

vaccenoic, petroselinic, oleic, cis- vaccenoic, gondoic and nervoic fatty acids (MUFA) showed

the highest levels in all the three treatments, followed by tridecylic, teradecanoic,

petadecylic, palmitic, margaric, nonadecyclic and stearic fatty acids (SFA). Linoleic, gamma-

linolenic, linolenic and homo ϒ linolenic fatty acids (PUFA) showed an increase in case of

stress conditions, particularly bile salts stress.

166

In characterization of antimicrobial substances produced by lactobacilli isolates, it

was found that the culture supernatants treated with catalase and trypsin did not affect the

inhibitory activity. However, with neutralized supernatants, inhibitory activity was affected.

This was attributed to the production of organic acids by the lactobacilli isolates. A similar

result was previously reported by (Shokryazdan et al. 2014). Testing the rumen isolates for

effects of glyphosate and organic herbicide showed that there was no significant effect on

them.

6.2 Conclusion

Demand for probiotic food market is on the rise and people are becoming more

conscious of their health and nutrition. In such a scenario, it is necessary that the probiotic

foods which are designed and developed for either improving general health and wellbeing

or targeting specific health conditions, are by all means safe to the consumer.

Traditionally lactobacilli have been isolated from fermented foods, gut of animals,

faecal content etc. for applications as probiotics. It was always assumed that lactobacilli

from natural/ indigenous origin possessed better potential probiotic properties. However,

there is no available literature which substantiates this belief. Our research study provides

experimental data which proves, that the best candidates for use as probiotics can be

isolated from indigenous sources instead of commercial or food origin. After subjecting the

dairy food isolates and bovine rumen isolates to similar screening tests and analysing the

results, a conclusion can be made that the bovine rumen isolates possess better potential

probiotic properties. However, probiotic properties and related mechanisms are linked to

the strain used, and hence arriving to a general conclusion, is a difficult task in probiotic

study. With the availability of large genomic and proteomic data on LAB, it is expected that

greater insights into understanding the probiotic mechanisms will soon take place. This

might open up new avenues where specific genes conferring probiotic characteristics will be

identified.

A key conclusion from this research is that potential probiotic candidates can be

isolated from commercial dairy food products and the bovine rumen. The data obtained

from the screening tests indicates that overall the rumen isolates displayed better in vitro

167

probiotic characteristics and isolates MI 13 and RC 2 shows promising potential for further

development as a novel probiotic.

168

6.3 Future directions

This research study started with fifty isolates and ends with selected two lactobacilli

isolates which can serve as potential probiotic candidates in future. A few suggestions in

order to take this work further includes:

Proteomics to select a single candidate for further evaluation.

Following up the 1 D SDS PAGE with advanced proteomic tools such as 2 D DIGE, can

help identify the different proteins expressed by the isolates under standard and stress

conditions. In the field of probiotic studies, characteristic proteomic profiles can be

identified for individual properties that may serve as bacterial biomarkers for the selection

of strains with the best probiotic potential.

Translating research from the lab to the consumer market comes with consideable

added cost. Clearly a key mechanims to reduce cost is to reduce the number of candidates to

assess in vivo.

Feeding rats/ other animal models with the probiotic supplement and trying to

recover the probiotic bacteria from the faeces of the animal to confirm if it survives

the gastrointestinal transit.

The lactobacilli isolates exhibited good performance characteristics in vitro, this could

be followed up with in vivo studies.

Before introducing a potential probiotic organims to human subjects safety much be

established. In vivo small animal safety studes are essential and accepted as an impotrant

requirment prior to human consumption.

A sensory evaluation of the probiotic bacteria for smell, appearance, taste and

texture and incorporating the potential lactobacilli candidates into food products and

testing for shelf- life.

Probiotic food products should be appealing with a good safety profile. Therefore, a

sensory evaluation could help identify this. Any unpleasant sensory properties could be

corrected through formulations.

169

Ultimatley human consumers and to a certain estend animal consumers must be

convinced to consume a priorbiotic organism. A key requirment will be acceptable sensory

characteristics.

170

References

Abe, F.; Ishibashi, N.; Shimamura, S. Effect of administration of bifidobacteria and lactic acid

bacteria to newborn calves and piglets. J. Dairy Sci. 1995, 78, 2838-2846.

Alvarez-Olmos, M.I.; Oberhelman, R.A. Probiotic agents and infectious diseases: a modern

perspective on a traditional therapy. Clin. Infect. Dis. 2001, 32, 1567-1576.

Ammor, M.S.; Belén Flórez, A.; Mayo, B. Antibiotic resistance in non- enterococcal lactic acid

bacteria and bifidobacteria. Food Microbiol. 2007, 24, 559-570.

Asahara, T.; Nomoto, K.; Watanuki, M.; Yokokura, T. Antimicrobial activity of intraurethrally

administered probiotic Lactobacillus casei in a murine model of Escherichia coli urinary tract

infection. Antimicrob. Agents Chemother. 2001, 45, 1751-1760.

Aso, Y.; Akaza, H.; Kotake, T.; Tsukamoto, T.; Imai, K.; Naito, S. Preventive effect of a

Lactobacillus casei preparation on the recurrence of superficial bladder cancer in a double-

blind trial. Eur. Urol. 1995, 27, 104-109.

Aso, Y.; Akazan, H. Prophylactic effect of a Lactobacillus casei preparation on the recurrence

of superficial bladder cancer. Urol. Int. 1992, 49, 125-129.

Ayeni, F.; Adeniyi, B.; Ogunbanwo, S.; Tabasco, R.; Paarup, T.; Peláez, C.; Requena, T.

Inhibition of uropathogens by lactic acid bacteria isolated from dairy foods and cow’s

intestine in western Nigeria. Arch. Microbiol. 2009, 191, 639-648.

Bao, Y.; Zhang, Y.; Zhang, Y.; Liu, Y.; Wang, S.; Dong, X.; Zhang, H. Screening of potential

probiotic properties of Lactobacillus fermentum isolated from traditional dairy products.

Food Control, 2010, 21, 695-701.

171

Bernet, M.F.; Brassart, D.; Neeser, J.R.; Servin, A.L. Lactobacillus acidophilus LA-1 binds to

cultured human intestinal cell lines and inhibits cell attachment and cell invasion by

enterovirulent bacteria. Gut, 1994, 35, 483-489.

Bjarnason, I.; Macpherson, A.; Hollander, D. Intestinal permeability: an overview.

Gastroenterol. 1995, 108, 1566-1581.

Bybee, S.N.; Scorza, A.V.; Lappin, M.R. Effect of the probiotic Enterococcus faecium SF68 on

presence of diarrhea in cats and dogs housed in an animal shelter. J. Vet. Intern. Med. 2011,

25, 856-860.

Caplan, M. S.; Jilling, T. Neonatal necrotizing enterocolitis: possible role of probiotic

supplementation. J. Pediatr. Gastr. Nutr. 2000, 30, S18-S22.

Cerdeira, A. L.; Duke, S. O. The current status and environmental impacts of glyphosate-

resistant crops: a review. J. Environ. Qual. 2006, 35, 1633-1658.

Champomier-Vergès, M.C.; Maguin, E.; Mistou, M.Y.; Anglade, P.; Chich, J.F. Lactic acid

bacteria and proteomics: current knowledge and perspectives. J. Chromatogr. B, 2002, 771,

329-342.

Charteris, W.P.; Kelly, P.M.; Morelli, L.; Collins, J.K. Antibiotic susceptibility of potentially

probiotic lactobacillus species. J. Food Prot. 1998b, 61, 1636-1643.

Chauviere, G.; Coconnier, M.H.; Kerneis, S.; Fourniat, J.; Servin, A.L. Adhesion of human

Lactobacillus acidophilus strain LB to human enterocyte-like Caco-2 cells. J. Gen. Microbiol.

1992, 138, 1689-1696.

172

Chou, L.S.; Weimer, B. Isolation and characterization of acid and bile tolerant isolates from

strains of Lactobacillus acidophilus. J. Dairy Sci. 1999, 82, 23-31.

Coppola, R.; Succi, M.; Tremonte, P.; Reale, A.; Salzano, G.; Sorrentino, E. Antibiotic

susceptibility of Lactobacillus rhamnosus strains isolated from Parmigiano Reggiano cheese.

Lait, 2005, 85, 193-204.

Czerucka, D.; Piche, T.; Rampal, P. Yeast as probiotics - Saccharomyces boulardii. Aliment.

Pharm. Ther. 2007, 26, 767-778.

D'Aimmo, M.R.; Modesto, M.; Biavati, B. Antibiotic resistance of lactic acid bacteria and

Bifidobacterium spp. isolated from dairy and pharmaceutical products. Int. J. Food Microbiol.

2007, 115, 35-42.

Dalloul, R.A.; Lillehoj, H.S. Poultry coccidiosis: recent advancements in control measures and

vaccine development. Expert Rev. Vaccines. 2006, 5, 143-163.

de Waard, R.; Garssen, J.; Bokken, G.C.A.M.; Vos, J.G. Antagonistic activity of Lactobacillus

casei strain shirota against gastrointestinal Listeria monocytogenes infection in rats. Int. J.

Food Microbiol. 2002, 73, 93-100.

Duary, R.K.; Rajput, Y.S.; Batish, V.K.; Grover, S. Assessing the adhesion of putative

indigenous probiotic lactobacilli to human colonic epithelial cells. Indian J. Med. Res. 2011,

134, 664-671.

FAO & WHO. Evaluation of health and nutritional properties of powder milk and live lactic

acid bacteria. Food and Agriculture Organization of the United Nations and World Health

Organization expert consultation report. FAO, Rome, Italy, 2001.

173

Felix, G.E.; Dellaglio, F. Taxonomy of lactobacilli and bifidobacteria. Curr. Issues Intest.

Microbiol. 2007, 8, 44-61.

Frizzo, L.S.; Zbrun, M.V.; Soto, L.P.; Signorini, M.L. Effects of probiotics on growth

performance in young calves: a meta-analysis of randomized controlled trials. Anim. Feed

Sci. Technol. 2011, 169, 147-156.

Gan, B.S.; Kim, J.; Reid, G.; Cadieux, P.; Howard, J.C. Lactobacillus fermentum RC-14 inhibits

Staphylococcus aureus infection of surgical implants in rats. J. Infect. Dis. 2002, 185, 1369-

1372.

Garrigues, C.; Stuer-Lauridsen, B.; Johansen, E. Characterisation of Bifidobacterium animalis

subsp. lactis BB-12 and other probiotic bacteria using genomics, transcriptomics and

proteomics. Aust. J. Dairy Technol. 2005, 60, 84-92.

Gasser, F. Safety of lactic acid bacteria and their occurence in human clinical infections. Bull.

Inst. Pasteur. 1994, 92, 45-67.

Giannenas, I.; Papadopoulos, E.; Tsalie, E.; Triantafillou, E.; Henikl, S.; Teichmann, K.; Tontis,

D. Assessment of dietary supplementation with probiotics on performance, intestinal

morphology and microflora of chickens infected with Eimeria tenella. Vet. Parasitol. 2012,

188, 31-40.

Gilliland, S.E.; Bruce, B.B.; Bush, L.J.; Staley, T.E. Comparisons of two strains of Lactobacillus

acidophilus as dietary adjuncts for young calves. J. Dairy Sci. 1980, 63, 964-972.

Goldin, B.R.; Gorbach, S.L.; Saxelin, M. Survival of Lactobacillus species (strain GG) in human

gastrointestinal tract. Dig. Dis. Sci. 1992, 37, 121-128.

174

Gueimonde, M.; Salminen, S. New methods for selecting and evaluating probiotics. Digest.

Liver Dis. 2006, 38, S242-S247.

Guerra, N.P.; Bernárdez, P.F.; Méndez, J.; Cachaldora, P.; Castro, P.L. Production of four

potentially probiotic lactic acid bacteria and their evaluation as feed additives for weaned

piglets. Anim. Feed Sci. Technol. 2007, 134, 89-107.

Guo, X.H.; Kim, J.M.; Nam, H.M.; Park, S.Y.; Kim, J.M. Screening lactic acid bacteria from

swine origins for multistrain probiotics based on in vitro functional properties. Anaerobe,

2010, 16, 321-326.

Gupta, P.K.; Mital, B.K.; Garg, S.K. Characterization of Lactobacillus acidophilus strains for use

as dietary adjunct. Int. J. Food Microbiol. 1996, 29, 105-109.

Gupta, V.; Garg, R. Probiotics. Indian J. Med. Microbiol. 2009, 27, 202-209.

Hamon, E.; Horvatovich, P.; Izquierdo1, E.; Bringel, F.; Marchioni, E.; Werner, A.D.; Ennahar,

S. Comparative proteomic analysis of Lactobacillus plantarum for the identification of key

proteins in bile tolerance. BMC Microbiol. 2011, 11, 1-11.

Hilton, E.; Isenberg, H.D.; Aplerstein, P.; France, K.; Borenstein, M.T. Ingestion of yoghurt

containing Lactobacillus acidophilus as prophylaxis for candida vaginitis. Ann. Intern. Med.

1992, 116, 353-357.

Hirano, J.; Yoshida, T.; Sugiyama, T.; Koide, N.; Mori, I.; Yokochi, T. The effect of Lactobacillus

rhamnosus on enterohemorrhagic Escherichia coli infection of human intestinal cells in vitro.

Microbiol. Immun. 2003, 47, 405-409.

175

Hoque, M.Z.; Akter, F.; Hossain, K.M.; Rahman, M.S.M.; Billah, M.M.; Islam, K.M.D. Isolation,

identification and analysis of probiotic properties of Lactobacillus spp. from selective

regional yoghurts. World J. Dairy Food Sci. 2010, 5, 39-46.

Hori, T.; Kiyoshima, J.; Shida, K.; Yasui, H. Augmentation of cellular immunity and reduction

of influenza virus titer in aged mice fed Lactobacillus casei strain shirota. Clin. Diagn. Lab.

Immunol. 2002, 9, 105-108.

Hsieh, P.S.; Tsai, Y.C.; Chen, Y.C.; Teh, S.F.; Ou, C.M.; King, V.A.E. Eradication of Helicobacter

pylori infection by the probiotic strains Lactobacillus johnsonii MH-68 and L. salivarius ssp.

salicinius AP-32. Helicobacter, 2012, 17, 466-477.

Irshad, A. Effect of probiotics on broilers performance. Int. J. Poultry Sci. 2006, 5, 593-597.

Isolauri, E.; Salminen, S.; Ouwehand, A.C. Probiotics. Best Pract. Res. Cl. Ga. 2004, 18, 299-

313.

Izquierdo, E.; Horvatovich, P.; Marchioni, E.; Aoude- Werner, D.; Sanz, Y.; Ennahar, S. 2- DE

and MS analysis of key proteins in the adhesion of Lactobacillus plantarum, a first step

toward early selection of probiotics based on bacterial biomarkers. Electrophoresis 2009, 30,

949-956.

Jin, L.Z.; Ho, Y.W.; Abdullah, N.; Jalaludin, S. Growth performance, intestinal microbial

populations and serum cholesterol of broilers fed diets containing Lactobacillus cultures.

Poultry Sci. 1998, 77, 1259-1265.

Johnson, S.; Maziade, P.J.; McFarland, L.V.; Trick, W.; Donskey, C.; Currie, B.; Goldstein, E.J. C.

Is primary prevention of Clostridium difficile infection possible with specific probiotics? Int. J.

Infect. Dis. 2012, 16, e786-e792.

176

Jose, N. M.; Bunt, C. R.; Hussain, M. A. Comparison of microbiological and probiotic

characteristics of lactobacilli isolates from dairy food products and animal rumen contents.

Microorganisms. 2015a, 3, 198-212.

Jose, N.M.; Bunt, C.R.; Hussain, M.A. Implications of antibiotic resistance in probiotics. Food

Rev. Int. 2015b, 31, 52-62.

Kailasapathy, K.; Chin, J. Survival and therapeutic potential of probiotic organisms with

reference to Lactobacillus acidophilus and Bifidobacterium spp. Immunol. Cell Biol. 2000, 78,

80-88.

Kechagia, M.; Basoulis, D.; Konstantopoulou, S.; Dimitriadi, D.; Gyftopoulou, K.; Nikoletta, S.;

Fakiri, M.E. Health benefits of probiotics: a review. ISRN Nutr. 2013, 1-7.

Kimura, K.; McCartney, A.L.; McConnell, M.A.; Tannock, G.W. Analysis of faecal populations

of bifidobacteria and lactobacilli and investigation of the immunological responses of their

human hosts to the predominant strains. Appl. Environ. Microbiol. 1997, 63, 3394-3398.

Kirtzalidou, E.; Pramateftaki, P.; Kotsou, M.; Kyriacou, A. Screening for lactobacilli with

probiotic properties in the infant gut microbiota. Anaerobe, 2011, 17, 440-443.

Klaenhammer, T.R.; Kullen, M.J. Selection and design of probiotics. Int. J. Food Microbiol.

1999, 50, 45-57.

Kleerebezem, M.; Vaughan, E.E. Probiotic and gut lactobacilli and bifidobacteria: molecular

approaches to study diversity and activity. Annu. Rev. Microbiol. 2009, 63, 269-290.

177

Klein, G.; Hallman, C.; Cacas, I.; Abad, J.; Lowers, J.; Reuter, G. Exclusion of vanA, vanB and

vanC type glycopeptide resistance in strains of Lactobacillus reuteri and Lactobacillus

rhamnosus used as probiotics by polymerase chain reaction and hybridization methods. J.

Appl. Microbiol. 2000, 89, 815-824.

Krasse, P.; Carlsson, B.; Dahl, C.; Paulsson, A.; Nilsson, A.; Sinkiewicz, G. Decreased gum

bleeding and reduced gingivitis by the probiotic Lactobacilllus reuteri. Swed. Dent.J. 2006,

30, 55-60.

Lan, P.T.N.; Binh, L.T.; Benno, Y. Impact of two probiotic Lactobacillus strains feeding on

faecal lactobacilli and weight gains in chicken. J. Gen. Appl. Microbiol. 2003, 49, 29-36.

Le Bon, M.; Davies, H.E.; Glynn, C.; Thompson, C.; Madden, M.; Wiseman, J.; Mellits, K.H.

Influence of probiotics on gut health in the weaned pig. Livest. Sci. 2010, 133, 179-181.

Lidbeck, A.; Overvik, E.; Rafter, J.; Nord, C.E.; Gustafsson, J.A. Effect of Lactobacillus

acidophilus supplements on mutagen excretion in faeces and urine in humans. Microb. Ecol.

Health Dis. 1992, 5, 59-67.

Lilly, D.M.; Stillwell, R.H. Growth promoting factors produced by probiotics. Science, 1965,

147, 747-748.

Lionetti, E.; Miniello, V.L.; Castellaneta, S.P.; Magista, A.M.; De Canio, A.; Maurogiovanni, G.;

Ierardis, E.; Cavallo, L.; Francavilla, R. Lactobacillus reuteri therapy to reduce side effects

during anti- Helicobacter pylori treatment in children: a randomnized placebo controlled

trial. Aliment. Pharmacol. Ther. 2006, 24, 1461-1468.

178

Liu, X.; Liu, W.; Zhang, Q.; Tian, F.; Wang, G.; Zhang, H.; Chen, W. Screening of lactobacilli

with antagonistic activity against enteroinvasive Escherichia coli. Food Control, 2013, 30,

563-568.

Lund, B.; Edlund, C. Probiotic Enterococcus faecium strain is a possible recipient of the vanA

gene cluster. Clin. Infect. Dis. 2001, 32, 1384-1385.

Marteau, P.R.; de Vrese, M.; Cellier, C.J.; Schrezenmeir, J. Protection from gastrointestinal

diseases with the use of probiotics. Am. J. Clin.Nutr. 2001, 73, 430s-436s.

Mcfarlane, G.; Cummings, J.H. Probiotics and prebiotics: can regulating the activities of

intestinal bacteria benefit health? BMJ. 1999, 318, 999-1003.

McGroarty, J.A. Probiotic use of lactobacilli in the human female urogenital tract. FEMS

Immunol. Med. Microbiol. 1993, 6, 251-264.

Mercenier, A.; Lenoir-Wijnkoop, I.; Sanders, M.E. Physiological and functional properties of

probiotics. Int. Dairy Fed. 2008, 429, 2-6.

Mishra, V.; Prasad, D.N. Application of in vitro methods for selection of Lactobacillus casei

strains as potential probiotics. Int. J. Food Microbiol. 2005, 103, 109-115.

Mombelli, B.; Gismondo, M.R. The use of probiotics in medical practice. Int. J. Antimicrob.

Agents, 2000, 16, 531-536.

Moraes, P.M.; Perin, L.M.; Tassinari Ortolani, M.B.; Yamazi, A.K.; Viçosa, G.N.; Nero, L.A.

Protocols for the isolation and detection of lactic acid bacteria with bacteriocinogenic

potential. LWT - Food Sci. Technol. 2010, 43, 1320-1324.

179

Moss, C.W.; Lambert, M.A.; Merwin, W.H. Comparison of rapid methods for analysis of

bacterial fatty acids. Appl. Microbiol. 1974, 28, 80-85.

Moussavi, M.; Adams, M.C. An in vitro study on bacterial growth interactions and intestinal

epithelial cell adhesion characteristics of probiotic combinations. Curr. Microbiol. 2010, 60,

327-335.

Musikasang, H.; Tani, A.; H-kittikun, A.; Maneerat, S. Probiotic potential of lactic acid

bacteria isolated from chicken gastrointestinal digestive tract. World J. Microbiol. Biotechnol.

2009, 25, 1337-1345.

Nakae, T.; Elliott, J.A. Volatile Fatty Acids Produced by Some Lactic Acid Bacteria. I. Factors

Influencing Production of Volatile Fatty Acids from Casein Hydrolysate. J. Dairy Sci. 1965, 48,

287-292.

Namioka, S.; Sasaki, T.; Maede, Y. Immunopotentiation of the small intestine of weaning

piglets by peptidoglycan derived from Bifidobacterium thermophilum. Biosci. Microflora.

1991, 10, 1-9.

Ng, S.C.; Hart, A.L.; Kamm, M.A.; Stagg, A.J.; Knight, S.C. Mechanisms of action of probiotics:

recent advances. Inflamm. Bowel Dis. 2009, 15, 300-310.

Nobaek, S.; Johansson, M.L.; Molin, G.; Ahrné, S.; Jeppsson, B. Alteration of intestinal

microflora is associated with reduction in abdominal bloating and pain in patients with

irritable bowel syndrome. Am. J. Gastroenterol. 2000, 95, 1231-1238.

Oelschlaeger, T.A. Mechanisms of probiotic actions- a review. Int. J. Med. Microbiol. 2010,

300, 57-62.

180

Ouwehand, A.; Vesterlund, S. Health aspects of probiotics. IDrugs, 2003, 6, 573-580.

Ouwehand, A.C., Salminen, S., & Isolauri, E. Probiotics: an overview of beneficial effects.

Antonie van Leeuwenhoek, 2002, 82, 279-289.

Pedrosa, M.C.; Golner, B.B.; Goldin, B.R.; Barakat, S.; Dallal, G.E.; Russell, R.M. Survival of

yoghurt containing organisms and Lactobacillus gasseri (ADH) and their effect on bacterial

enzyme activity in the gastrointestinal tract of healthy and hypochlorhydric elderly subjects.

Am. J. Clin. Nutr. 1995, 61, 353-359.

Perez Guerra, N.; Fajardo Bernardez, P.; Mendez, J.; Cachaldora, P.; Pastrana Castro, L.

Production of four potentially probiotic lactic acid bacteria and their evaluation as feed

additives for weaned piglets. Anim. Feed Sci. Technol. 2007, 134, 89-107.

Pfeiler, E.A.; Klaenhammer, T.R. Role of transporter proteins in bile tolerance of Lactobacillus

acidophilus. Appl. Environ.Microbiol. 2009, 75, 6013-6016.

Pfeltz, R.F.; Wilkinson, B.J. The escalating challenge of vancomycin resistance in

Staphylococcus aureus. Curr. Drug Targets Infect. Disord. 2004, 4, 273-294.

Pollmann, D.S.; Danielson, D.M.; Peo, E.R. Effects of microbial feed additives on performance

of starter and growing finishing pigs. J. Anim. Sci. 1980, 51, 577-581.

Ranadheera, C.S.; Evans, C.A.; Adams, M.C.; Baines, S.K. In vitro analysis of gastrointestinal

tolerance and intestinal cell adhesion of probiotics in goat's milk ice cream and yogurt. Food

Res. Int. 2012, 49, 619-625.

Reid, G.; Bruce, A.W.; Frase, N.; Heinemann, C.; Owen, J.; Henning, B. Oral probiotics can

resolve urogenital infectious. FEMS Immunol. Med. Microbiol. 2001, 30, 49-52.

181

Resta-Lenert, S.; Barrett, K.E. Live probiotics protect intestinal epithelial cells from the

effects of infection with enteroinvasive Escherichia coli (EIEC). Gut, 2003, 52, 988-997.

Ribeiro, H.; Vanderhoof, J.A. Reduction of diarrheal illness following administration of

Lactobacillus plantarum 299v in a daycare facility. J. Pediatr. Gastroenterol. Nutr. 1998, 26,

561.

Robins-Browne, R.M.; Levine, M.M. The fate of ingested lactobacilli in the proximal small

intestine. Am. J. Clin. Nutr. 1981, 34, 514-519.

Rugoho, I.; Liu, Y.; Dewhurst, R.J. Analysis of major fatty acids in milk produced from high-

quality grazed pasture. New Zeal. J. Agr. Res. 2014, 57, 165-179.

Ruiz, L.; Margolles, A.; Sanchez, B. Bile resistance mechanisms in Lactobacillus and

Bifidobacterium. Front. Microbiol. 2013, 4, 1-8.

Ryan, K.A.; Jayaraman, T.; Daly, P.; Canchaya, C.; Curran, S.; Fang, F.; O'Toole, P.W. Isolation

of lactobacilli with probiotic properties from the human stomach. Lett. Appl. Microbiol. 2008,

47, 269-274.

Saarela, M.; Mogensen, G.; Fondén, R.; Mättö, J.; Maatila- Sandholm, T. Probiotic bacteria:

safety, functional and technological properties. J. Biotechnol. 2000, 84, 197-215.

Sanders, M.E.; Klaenhammer, T.R. The scientific basis of Lactobacillus acidophilus NCFM

functionality as a probiotic. J. Dairy Sci. 2001, 84, 319-331.

Santini, C.; Baffoni, L.; Gaggia, F.; Granata, M.; Gasbarri, R.; Di Gioia, D.; Biavati, B.

Characterization of probiotic strains: An application as feed additives in poultry against

Campylobacter jejuni. Int. J. Food Microbiol. 2010, 141, S98-S108.

182

Savage, D.C. Factors involved in colonization of the gut epithelial surface. Am. J. Clin. Nutr.

1978, 31, S131-S135.

Schultz, M.; Sartor, R.B. Probiotics and inflammatory bowel diseases. Am. J. Gastroenterol.

2000, 95, S19–S21.

Seale, J.V.; Millar, M. Probiotics: a new frontier for infection control. J. Hosp. Infect. 2013, 84,

1-4.

Senok, A.C.; Ismaeel, A.Y.; Botta, G.A. Probiotics: facts and myths. Clin. Microbiol. Infect.

2005, 11, 958-966.

Servin, A.L.; Coconnier, M.H. Adhesion of probiotic strains to the intestinal mucosa and

interaction with pathogens. Best Pract. Res. Clin. Gastroenterol. 2003, 17, 741-754.

Sgouras, D.; Maragkoudakis, P.; Petraki, K.; Gonzalez, B.M.; Eriotou, E.; Michopoulos, S.;

Mentis, A. In Vitro and in Vivo inhibition of Helicobacter pylori by Lactobacillus casei strain

shirota. Appl. Environ. Microbiol. 2004, 70, 518–526.

Shah, N.P. Probiotic bacteria: Selective enumeration and survival in dairy foods. J. Dairy Sci.

2000, 83, 894-907.

Sheih, Y.H.; Chiang, B.L.; Wang, L.H.; Liao, C.K.; Gill, H.S. Systemic immunity- enhancing

effects in healthy subjects following dietary consumption of the lactic acid bacterium

Lactobacillus rhamnosus HN001. J. Am. Coll. Nutr. 2001, 20, 149-156.

183

Shokryazdan, P.; Sieo, C. C.; Kalavathy, R.; Liang, J. B.; Alitheen, N. B.; Jahromi, M. F.; Ho, Y.

W. Probiotic potential of Lactobacillus strains with antimicrobial activity against some

human pathogenic strains. BioMed Res. Int. 2014, 2014, 1-16.

Shornikova, A.V.; Isolauri, E.; Burkanova, L.; Lukovnikova, S.; Vesikari, T. A trial in the Karelian

Republic of oral rehydration and Lactobacillus GG for treatment of acute diarrhoea. Acta

Paediatr. 1997, 86, 460-465.

Siciliano, R.A.; Mazzeo, M.F. Molecular mechanisms of probiotic action: a proteomic

perspective. Curr. Opin. Microbiol. 2012, 15, 390-396.

Soto, L.P.; Frizzo, L.S.; Bertozzi, E.; Avataneo, E.; Sequeira, G.J.; Rosmini, M.R. Molecular

microbial analysis of lactobacillus strains isolated from the gut of calves for potential

probiotic use. Vet. Med. Int. 2010, 274987-274987.

Strompfova, V.; Laukova, A. In vitro study on bacteriocin production of enterococci

associated with chickens. Anaerobe, 2007, 13, 228-237.

Surawicz, C.M. Probiotics, antibiotic-associated diarrhoea and Clostridium difficile diarrhoea

in humans. Best Pract. Res. Clin. Gastroenterol. 2003, 17, 775-783.

Suutari, M.; Liukonnen, K.; Laakso, S. (1990). Temperature adaptation in yeasts: the role of

fatty acids. J. Gen. Microbiol. 1990, 136, 1469-1474.

Suvarna, V.C.; Boby, V.U. Probiotics in human health: A current assessment. Curr. Sci. 2005,

88, 1744-1748.

Tagang, A.; Ishaku, K.P.; Abdullahi, A. Volatile fatty acids production in ruminants and the

role of monocarboxylate transporters: a review. Afr. J. Biotechnol. 2010, 9, 6229-6232.

184

Tannock, G.W. Identification of lactobacilli and bifidobacteria. Curr. Issues Mol. Biol. 1999, 1,

53-64.

Taranto, M.P.; Perez-Martinez, G.; de Valdez, G.F. Effect of bile acid on the cell membrane

functionality of lactic acid bacteria for oral administration. Res. Microbiol. 2006, 157, 720-

725.

Tellez, G.; Pixley, C.; Wolfenden, R.E.; Layton, S.L.; Hargis, B.M. Probiotics/direct fed

microbials for salmonella control in poultry. Food Res. Int., 2012, 45, 628-633.

Thirabunyanon, M.; Boonprasom, P.; Niamsup, P. (2009). Probiotic potential of lactic acid

bacteria isolated from fermented dairy milks on antiproliferation of colon cancer cells.

Biotechnol. Lett. 2009, 31, 571-576.

Timmerman, H.M.; Koning, C.J.M.; Mulder, L.; Rombouts, F.M.; Beynen, A.C. Monostrain,

multistrain and multispecies probiotics - A comparison of functionality and efficacy. Int. J.

Food Microbiol. 2004, 96, 219-233.

Todorov, S.D.; Botes, M.; Guigas, C.; Schillinger, U.; Wiid, I.; Wachsman, M.B.; Dicks, L.M.T.

Boza, a natural source of probiotic lactic acid bacteria. J. Appl. Microbiol. 2008, 104, 465-477.

Tomasino, E.; Harrison, R.; Breitmeyer, J.; Sedcole, R.; Sherlock, R.; Frost, A. Aroma

composition of 2-year-old New Zealand Pinot Noir wine and its relationship to sensory

characteristics using canonical correlation analysis and addition/omission tests. Aust. J.

Grape Wine Res. 2015, 21, 376-388.

185

Toure, R.; Kheadr, E.; Lacroix, C.; Moroni, O.; Fliss, I. Production of antibacterial substances

by bifidobacterial isolates from infant stool active against Listeria monocytogenes. J. Appl.

Microbiol, 2003, 95, 1058-1069.

Turpin, W.; Humblot, C.; Thomas, M.; Guyot, J.P. Lactobacilli as multifaceted probiotics with

poorly disclosed molecular mechanisms. Int. J. Food Microbiol. 2010, 143, 87-102.

van de Guchte, M.; Chaze, T.; Jan, G.; Mistou, M.Y. Properties of probiotic bacteria explored

by proteomic approaches. Curr. Opin. Microbiol. 2012, 15, 381-389.

van Den Dool, H.; Kratz, P. A generalization of the retention index system including linear

temperature programmed gas- liquid partition chromatography. J. Chromatogr. A. 1963, 11,

463-471.

Vanderhoof, J.A. Probiotics: future directions. Am. J. Clin. Nutr. 2001, 73, 1152S-1155S.

Vankerckhoven, V.; Huys, G.; Vancanneyt, M.; Vael, C.; Klare, I.; Romond, M.B., Goossens, H.

Biosafety assessment of probiotics used for human consumption: recommendations from

the EU-PROSAFE project. Trends Food Sci. Technol. 2008, 19, 102-114.

Vimala, Y.; Dileep, P. Some aspects of probiotics. Ind. J. Microbiol. 2006, 46, 1-7.

Wagner, R.D.; Paine, D.D.; Cerniglia, C.E. Phenotypic and genotypic characterization of

competitive exclusion products for use in poultry. J. Appl. Microbiol. 2003, 94, 1098-1107.

Wang, A.; Yu, H.; Gao, X.; Li, X.; Qiao, S. Influence of Lactobacillus fermentum I5007 on the

intestinal and systemic immune responses of healthy and E. coli challenged piglets. Antonie

van Leeuwenhoek, 2009, 96, 89-98.

186

Wang, B.; Wei, H.; Yuan, J.; Li, Q.; Li, Y.; Li, N.; Li, J. Identification of a surface protein from

Lactobacillus reuteri JCM1081 that adheres to porcine gastric mucin and human enterocyte-

like HT-29 cells. Curr. Microbiol. 2008, 57, 33-38.

Wang, S.; Zhu, H.; Lu, C.; Kang, Z.; Luo, Y.; Feng, L.; Lu, X. Fermented milk supplemented with

probiotics and prebiotics can effectively alter the intestinal microbiota and immunity of host

animals. J. Dairy Sci. 2012, 95, 4813-4822.

Whittaker, P.; Fry, F.S.; Curtis, S.K.; Al-Khaldi, S.F.; Mossoba, M.M.; Yurawecz, M.P.; Dunkel,

V.C. Use of fatty acid profiles to identify food-borne bacterial pathogens and aerobic

endospore- forming bacilli. J. Agr. Food chem. 2005, 53, 3735-3742.

Woese, C. R. Bacterial evolution. Microbiol. Rev. 1987, 51, 221-271.

Zago, M.; Fornasari, M.E.; Carminati, D.; Burns, P.; Suàrez, V.; Vinderola, G.; Giraffa, G.

Characterization and probiotic potential of Lactobacillus plantarum strains isolated from

cheeses. Food Microbiol. 2011, 28, 1033-1040.

Zellner, B.D.A.; Bicchi, C.; Dugo, P.; Rubiolo, P.; Dugo, G.; Mondello, L. Linear retention

indices in gas chromatographic analysis: a review. Flavour Frag. J. 2008, 23, 297–314.

Zhou, J.S.; Pillidge, C.J.; Gopal, P.K.; Gill, H.S. Antibiotic susceptibility profiles of new probiotic

latobacillus and bifidobacterium strains. Int. J. Food Microbiol. 2005, 98, 211-217.

187

Appendix A

Sources of laboratory instrumentation, equipment and chemicals

Instrumentation and equipment

AccuBlock™ Digital Dry Baths

Supplied by Labnet International Inc. USA

Anaerobic jars and anaerobic sachets

Supplied by AnaeroGen™, Thermo Scientific, USA

Analytical Balance,

Mettler AE 200, supplied by Marshall Scientific, USA

Autoclave

Supplied by Astell Scientific Limited, UK

Centrifuge

Heraeus Multifuge X3R centrifuge, supplied by Thermo Scientific, USA

Contherm Digital series Incubators

Supplied by Contherm Scientific Limited, NZ

Electrophoresis qeuipment (vertical slab system)

Supplied by Bio- Rad, NZ

188

Eppendorf minispin

Supplied by Eppendorf, Germany

GelDoc transilluminator

Supplied by Bio- Rad, NZ

Magnetic stirrer

Stuart heat- stir CB162, supplied by Stuart Equipments, NZ

Micro- plate reader

FLUOstar Omega, supplied by BMG Labtech, NZ

Mini bead beater

Supplied by BioSpec Products, USA

Nikon Eclipse 50i Microscope

Supplied by Nikon Instruments Inc., USA

pH meter

Orion 3 star pH benchtop, supplied by Thermo Scientific, USA

Spectrophotometer

Biorad smartspec 3000, supplied by Bio- Rad, NZ

Stuart see- saw rocker SSL4

Supplied by Stuart Equipments, NZ

189

Thermocycler

BIOER Gene Pro thermocycler, supplied by Alpha Laboratories, NZ

Water baths

Supplied by Grant Instruments, UK

Chemicals

Agar Bacteriological

Supplied by Oxoid, UK

Ampicillin


Amoxicillin

Supplied by BBLTM, USA

BHI Broth


Bile salts


Chloramphenicol


190

Ciprofloxacin


Columbia blood agar plates

Supplied by Fort Richard, NZ

Crystal violet

Supplied by Sigma- Aldrich, USA

D- Glucose anhydrous

Supplied by Thermo Fisher Scientific, USA

Disodium hydrogen phosphate anhydrous


Erythromycin


Fusidic acid

Supplied by BD BBLTM, USA

Gentamycin,


Kanamycin


191

MRS Agar


MRS Broth


Nalidixic acid


Nutrient Agar


Peptone Bacteriological


Safranin

Supplied by Sigma- Aldrich, USA

Sodium dihydrogen orthophosphate


Sodium hydroxide

Supplied by BDH Laboratories, UK

192

Streptomycin


Sucrose


Tetracycline


Vancomycin


193

Appendix B

Gentra Puregene Yeast/ Bacterial kit contents

Sl. No Reagents and buffers Volume

1 Cell lysis solution 125 ml

2 Protein precipitation solution 50 ml

3 DNA hydration solution 25 ml

4 Cell suspension solution 125 ml

5 Lytic enzyme solution 650 µl

6 RNase A solution 650 µl

Gentra Puregene Kit buffers and reagents must be stored dry at the temperature

indicated on the kit label. RNase A solution, and Lytic enzyme solution must be refrigerated

at the temperatures marked on the labels. All other reagents can be stored at room

temperature (15– 25°C). When stored at the indicated temperatures, Gentra Puregene Kits

are stable until the expiration date printed on the label and on the kit box.

194

Appendix C

Assessment of DNA purity using nanodrop

Isolate DNA

ng/µl

Ration of absorbance at 260nm/280nm

MI 6 16.97 2.07

MI 7 7.06 1.76

MI 10 8.40 1.81

MI 13 12.44 1.89

MI 17 6.49 1.82

MI 18 7.32 1.78

RC 2 5.00 1.86

RC 5 2.48 1.97

RC 13 9.53 1.74

RC 25 5.97 1.92

RC 30 7.83 1.74

195

Appendix D

PCR primers

Primer Name Primer sequence

Forward primer: Aci I TCTAAGGAAGCGAAGGAT Primer length : 18

Tm (1 M Na+) : 62

Tm (50 Mm Na+): 41

% GC : 44

Reverse primer: Aci II CTCTTCTCGGTCGCTCTA Primer length : 18

Tm (1 M Na+) : 67

Tm (50 Mm Na+): 45

% GC : 55


Forward primer: Pr I CAGACTGAAAGTCTGACGC Primer length : 19

Tm (1 M Na+) : 68

Tm (50 Mm Na+): 46

% GC : 52

Reverse primer: Pr II GTACTGACTTGCGTCAGCGG Primer length : 20

Tm (1 M Na+) : 72

Tm (50 Mm Na+): 51

% GC : 60


Forward primer: 16-1A GAATCGCTAGTAATCG Primer length : 16

Tm (1 M Na+) : 57

Tm (50 Mm Na+): 36

% GC : 43

Reverse primer: 23-1B GGGTTCCCCCATTCGGA Primer length : 17

Tm (1 M Na+) : 68

Tm (50 Mm Na+): 47

% GC : 64

196

Appendix E

PCR reaction mix

PCR buffer 2.5µl

dNTPs 0.5µl

Taq polymerase 0.5µl

MgCl2 1.5µl

Nuclease free water 17.25µl

Template DNA 1.25µl

Forward primer 0.75µl

Reverse primer 0.75µl

197

Appendix F

Protein standard curve constructed by using BCA kit

Diluted albumin standards

Vial Volume of diluent, cold

40 mM Tris (µl)

Volume of BSA (µl) Final BSA

concentration (µg/ ml)

A 0 300 of stock 2000

B 125 375 of stock 1500

C 325 325 of stock 1000

D 175 175 of vial B solution 750

E 325 325 of vial C solution 500

F 325 325 of vial E solution 250

G 325 325 of vial F solution 125

H 400 100 of vial G solution 25

I 400 0 0

198

y = 0.0016x + 0.3567 R² = 0.9799

0

0.5

1

1.5

2

2.5

3

3.5

4

0 500 1000 1500 2000 2500

OD

at

56

0 n

m

Protein concentration µg/ ml

BCA standard curve of RC 2

y = 0.0012x + 0.3301 R² = 0.9804

0

0.5

1

1.5

2

2.5

3

0 500 1000 1500 2000 2500

OD

at

56

0 n

m

Protein concentration (µg/ ml)

BCA standard curve of MI 13

199

Appendix G

Statistical analysis for BATH test

pH 1

Post Hoc Tests

Homogeneous Subsets

Percent Strains N Subset for alpha = 0.05

a b c d e f

Duncana

RC 2 3 68.3727

RC 25 3 83.6335

RC 13 3 92.2956

RC 5 3 93.8802

MI 10 3 94.3128

MI 6 3 98.0218

MI 17 3 99.6212

MI 13 3 100.3157

RC 30 3

MI 7 3

Sig. 1.000 1.000 1.000 .469 1.000 .250

Percent Strains Subset for alpha = 0.05

g h

Duncana

RC 2

RC 25

RC 13

RC 5

MI 10

MI 6

MI 17

MI 13 100.3157

RC 30 101.3346

MI 7 104.7889

Sig. .097 1.000

Means for groups in homogeneous subsets are displayed.

a. Uses Harmonic Mean Sample Size = 3.000.

200

pH 5

Post Hoc Tests

Homogeneous Subsets

Percent Strains N Subset for alpha = 0.05

a b c d e f

Duncana

RC 2 3 59.8143

RC 25 3 76.6268

RC 5 3 80.3711

RC 13 3 82.8535

RC 30 3 83.3976

MI 7 3 92.1459

MI 6 3 92.8868 92.8868

MI 17 3 93.2888

MI 10 3 93.4755

MI 13 3

Sig. 1.000 1.000 1.000 .229 .106 .218

Percent Strains Subset for alpha = 0.05

g

Duncana

RC 2

RC 25

RC 5

RC 13

RC 30

MI 7

MI 6

MI 17 93.2888

MI 10 93.4755

MI 13 93.8850

Sig. .212



201

pH 7.4

Post Hoc Tests

Homogeneous Subsets

Percent Strain N Subset for alpha = 0.05

a b c d e f

Duncana

RC 25 3 74.0847

RC 2 3 77.9221

RC 5 3 78.1013

RC 13 3 79.3308

RC 30 3 81.3613

MI 13 3 86.6068

MI 7 3 87.9258

MI 17 3 89.8961

MI 6 3 90.9566

MI 10 3 93.9726

Sig. 1.000 .098 1.000 .102 .184 1.000



202

Appendix H

Statistical analysis for adhesion studies

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

Test N Mean Grouping

E. coli 4 24.37 A

E.coli (with rumen) 4 10.027 B

Rumen (with E.coli) 4 7.562 B C

E.coli (with Food) 4 7.322 B C

Rumen 4 6.450 C

Food 4 3.571 D

Food (with E.coli) 4 0.2205 E

Means that do not share a letter are significantly different.

203

Appendix I

Statistical analysis for permeability studies

Tukey Pairwise Comparisons

Grouping Information Using the Tukey Method and 95% Confidence

Treatment N Mean Grouping

EtOH 1% + E. Coli 3 493.5 A

EtOH 1% + dairy 3 484.23 A B

EtOH 1% + dairy + E. Coli 3 471.43 A B C

No treatment (Control) 4 459.2 A B C

EtOH 1% + rumen 3 449.4 A B C

EtOH 1% (Negative control) 3 439.0 B C

EtOH 1% + rumen + E. Coli 3 429.17 C

Means that do not share a letter are significantly different.

204

Appendix J

Quantification parameters for the seven analytes and four deuterated standards

Analyte ISTDa Retention Target Confirming Ions m/z Calibration Range Standard Purity CAS No.

Time (min) Ion m/z (% to Target Ion) (1/20 dilution) (µg/l) Curve (R2)

b (%)

d4-acetic acid (1) 12.02 46 63 (72.3) 99.5 141-78-6 d7-butanoic acid (2) 14.41 63 46 (27.3), 58 (7.1) 98 73607-83-7 d11-hexanoic acid (3) 16.99 63 77 (42.9), 93 (12.4) 99 97-62-1 d2-octanoic acid (4) 19.44 62 74(32.9), 102 (12.0) 99 105-54-4 acetic acid 1 12.08 43 60 (82.1), 45 (84.4) 0 – 205479

c 0.9994 98 66-25-1

isobutyric acid 2 13.77 88 42 (25.6) 0 – 3201c 0.9960 99 79-31-2

butanoic acid 2 14.53 60 73 (26.6) 0 – 780.6c 0.9999 98 539-82-2

isovaleric acid 2 15.08 60 87 (18.0) 0 – 298.3 0.9996 98 123-66-0 2-methylbutanoic acid 2 15.10 74 57 (65.7) 0 – 199.1

c 0.9995 98 116-53-0

hexanoic acid 3 17.15 60 73 (41.2), 87 (11.7) 0 – 1279.6c 0.9999 99 111-27-3

octanoic acid 4 19.47 60 73 (56.0), 101 (20.4) 0 – 800.1d 0.9999 98 928-97-2

a ISTD = internal standard

b A quadratic function was fitted to each aroma compound standard curve. Up to seven standards were used to generate each curve. c Six standards were used for these calibration curves. d five standards were used for these calibration curves.

205

Appendix K

Example of a GLC chromatogram

206

Appendix L

Conference abstracts

New Zealand Microbiological Society Conference, 2013- Oral abstract

low pH tolerance and antibiotic resistance in lactobacilli isolates

Authors:

Neethu Maria Jose [1], Craig Bunt [2], and Malik Altaf Hussain [1]

[1] Department of Wine, Food and Molecular Biosciences, Lincoln University, Lincoln,

New Zealand

[2] Department of Agricultural Sciences, Lincoln University, Lincoln, New Zealand

Lactobacilli are the major group of health promoting microorganisms, generally

known as probiotics. When probiotics are consumed by humans, they must survive transit

through the stomach, where the pH can be as low as 1.5 to 2, in order to reach the intestinal

tract. Lactobacilli normally grow at a pH range of 4 to 6. Moreover, to prevent intestinal

disorders, probiotics must be resistant to antibiotics in order to survive in the presence of

co-administered antibiotics. The objective of this study was to investigate the low pH

tolerance and antibiotics resistance in twenty lactobacilli isolated from New Zealand dairy

products. The isolates were tested for low pH tolerance by growing them in MRS broths (pH

2 and 3). The resistance against twelve different antibiotics was determined by the disc

diffusion method. The results indicate that all isolates were tolerant to pH 3; however only a

few isolates were able to survive at pH 2. The antibiotic sensitivity test provided the

resistance profile of the isolates. All isolates exhibited resistance to ciprofloxacin, nalidixic

acid and vancomycin. Majority were sensitive to ampicillin. Isolates, that can survive low pH

conditions, may have better potential to be successfully incorporated in foods as probiotics.

Antibiotic resistance of isolates suggests that their use in patients treated with antibiotic

therapy might prove beneficial and aid recovery of the patients by helping to re-establish

desirable microflora. This study of lactobacilli isolates screening has identified candidates for

further investigation and development as potential probiotics in foods and complementary

and alternative medicines.

207

Asia Pacific Probiotic Workshop, 2014- Poster abstract

Comparison of adherence properties and antibiotic resistance in potential probiotic

lactic acid bacteria isolated from dairy products and bovine rumen contents

Authors:



New Zealand


Lactobacilli are one of the major groups belong to health promoting microorganisms

generally known as probiotics. The objective of this study was to investigate the adherence

properties and antibiotics resistance in ten potential probiotic bacteria isolated from

commercial dairy products and bovine rumen contents. Adherence ability enables the

probiotic bacteria to persist for a longer time in the gut and enhances the host-bacteria cross

talk. It also helps the probiotic bacteria to overcome the peristalsis effects of stomach. For

these reasons, their surface properties were studied by performing the BATH test i.e. testing

bacterial adherence to hydrocarbons. According to the results of our study, bacterial

adherence properties increased with an increase in pH. Results showed a clear strain and pH

effect involved in demonstration of adherence. Moreover, to prevent intestinal disorders,

probiotics must be resistant to antibiotics in order to survive in the presence of co-

administered antibiotics. Antibiotic resistance profiles of isolates indicated that all of them

exhibited resistance to ciprofloxacin, nalidixic acid and vancomycin antibiotics. Majority

were sensitive to ampicillin drug. Antibiotic resistance of isolates suggests that their use in

patients treated with antibiotic therapy might prove beneficial and aid recovery of the

patients through re-establishment of desirable microbiota in the gut. This screening study of

lactobacilli isolates has provided a comparison of probiotic properties of dairy vs rumen

bacterial isolates and generated useful information to identify candidate which could serve

as potential probiotics.

209

New Zealand Microbiological Society conference, 2014- Oral abstract

Screening of lactobacilli isolates from dairy food products and bovine rumen

contents for application as probiotics

Authors:



New Zealand


“Let food be thy medicine and medicine be thy food,” the age-old quote by

Hippocrates, is certainly the tenet of today. Lactobacilli are employed in probiotic food

preparations and as feed additives in poultry and livestock, due to health benefits associated

with their consumption. The objective of this study was to evaluate and compare the

probiotic potential of ten lactobacilli isolates from commercial dairy food products and

bovine rumen contents in New Zealand. These isolates were genetically identified by

amplification and sequencing of 16S-23S rRNA gene (intergenic spacer region) using primers

16-1A (F) and 23-1B (R). Phenotypic confirmation was achieved through morphological

characterisation, growth-kinetics and carbohydrate utilisation profiles. FAO/ WHO screening

guidelines (2006) were followed to assess probiotic potentials of the isolates through in vitro

testing for haemolytic activity, low pH tolerance, bile salt tolerance, antibiotic resistance

against eleven commonly prescribed antibiotics, antimicrobial activity against selected five

pathogens and adherence to hydrocarbons. The results showed that all isolates were non-

haemolytic in nature. Isolates of dairy origin showed better tolerance to low pH stress. On

the other hand, rumen isolates exhibited a higher tolerance to the presence of bile salts. All

isolates exhibited resistance to ciprofloxacin, nalidixic acid and vancomycin antibiotics.

Majority were sensitive to ampicillin drug. Isolates of rumen origin demonstrated a higher

inhibitory effect on Listeria monocytogenes, Enterobacter aerogenes and Salmonella

menston species. In case of adherence test, bacteria became more adsorbent with an

increase in pH. These screening studies on lactobacilli isolates have helped in assessing and

identifying candidates for further investigation and development as potential probiotics.

210

International Journal of Food Science and Technology Conference, 2015- Poster

abstract

Comparative proteomic analysis of L. plantarum and L. rhamnosus cells exposed to

acid and bile stresses

Authors:



New Zealand


Increased consumer awareness regarding importance of gut health has led to the

demand of probiotic food products. Probiotic bacteria should be in a live form in order to

exert beneficial effects in the host. Probiotic abilities of lactobacilli are strain specific.

Proteomic tools were employed to analyse the changes in protein expression of lactobacilli

exposed to specific stress conditions. The objective of this study was to investigate

proteomic changes in two different species of lactobacilli, namely L. plantarum and L.

rhamnosus in response to acid and bile stress conditions. These two conditions were

selected on a rationale that upon consumption probiotic bacteria should survive during the

transit in the gastro-intestinal tract where it is open to challenges such as low pH

environment of stomach and bile salts of the upper intestinal tract. Cells were exposed to

acid stress (pH 3.5) and bile salts stress (3.5%) using MRS broth. Cells grown in standard

MRS broth were used as control. This poster presents the changes observed in protein

expression of these two strains in response to acid and bile stress factors.

212

Lincoln University Thr3sis competition, 2014- Oral abstract

Developing a NOVEL PROBIOTIC bacteria: The answer to many underlying health

questions

Authors:



New Zealand


“Let food be thy medicine and medicine be thy food,” the age-old quote by

Hippocrates, is certainly the tenet of today. This research study envisioned the necessity for

developing a novel probiotic bacterial strain with intended specific applications such as

promoting health benefits in humans, enhancing growth promotion in livestock or increasing

health improvements in poultry. As part of this research programme, bacterial strains were

isolated from commercial and indigenous sources in New Zealand, identified and screened

for probiotic abilities, and ultimately selected strains are to be analysed using proteomics

tools to compare the proteome profiles of probiotic vs non- probiotic bacteria.

213

Lincoln University Thr3sis competition, 2015- Oral abstract

Universal or application specific probiotics

Authors:



New Zealand


This research study focusses on the development of bacterial isolates which possess

potential probiotic properties. The selected bacterial isolate can be used to generate an

overall health benefit in the host, by altering the gut micro flora upon consumption.

Probiotics applications could also be specific targeting poultry and livestock. This includes

increase in body weight gain (BWG), better resistance to a number of infections commonly

infecting cattle, increase in milk yield and an increased feed conversion ratio (FCR).

lincoln university digital - connecting repositories · neethu maria jose lincoln university 2015 ....

Documents