large-scale phenotypic analysis—the pilot project on yeast chromosome iii

. 13: 1547–1562 (1997)

*Correspondence to: K.-J. Rieger.†Present address: GATC-Gesellschaft fur Analyse Technikund Consulting, Fritz-Arnold-Strasse 23, D-78467 Konstanz,Germany.‡Present address: Institute of Microbiology, University ofWroclaw, 51-148 Wroclaw, Poland.§Present address: Institute of Biochemistry and Biophysics,Polish Academy of Sciences, 5 Pawinskiego, Warsaw, Poland.Note added in proof: Our wild-type strains have been depositedat ATCC with the following ATCC accession numbers: W303

Large-Scale Phenotypic Analysis—the Pilot Project onYeast Chromosome III

KLAUS-JO}RG RIEGER*, ANETA KANIAK, JEAN-YVES COPPEuE, GORDANA ALJINOVIC†,AGNES BAUDIN-BAILLIEU, GABRIELA ORLOWSKA‡, ROBERT GROMADKA§,OLGA GROUDINSKY, JEAN-PAUL DI RAGO AND PIOTR P. SLONIMSKI

Centre de Genetique Moleculaire du Centre National de la Recherche Scientifique, Laboratoire Propre Associe al’Universite Pierre et Marie Curie, F-91198 Gif-sur-Yvette, France

Received 3 June 1997; accepted 13 September 1997

In 1993, a pilot project for the functional analysis of newly discovered open reading frames, presumably coding forproteins, from yeast chromosome III was launched by the European Community. In the frame of this programme,we have developed a large-scale screening for the identification of gene/protein functions via systematic phenotypicanalysis. To this end, some 80 haploid mutant yeast strains were constructed, each carrying a targeted deletion of asingle gene obtained by HIS3 or TRP1 transplacement in the W303 background and a panel of some 100 growthconditions was established, ranging from growth substrates, stress to, predominantly, specific inhibitors and drugsacting on various cellular processes. Furthermore, co-segregation of the targeted deletion and the observedphenotype(s) in meiotic products has been verified. The experimental procedure, using microtiter plates forphenotypic analysis of yeast mutants, can be applied on a large scale, either on solid or in liquid media. Since theminimal working unit of one 96-well microtiter plate allows the simultaneous analysis of at least 60 mutant strains,hundreds of strains can be handled in parallel. The high number of monotropic and pleiotropic phenotypes (62%)obtained, together with the acquired practical experience, have shown this approach to be simple, inexpensive andreproducible. It provides a useful tool for the yeast community for the systematic search of biochemical andphysiological functions of unknown genes accounting for about a half of the 6000 genes of the complete yeastgenome. ? 1997 John Wiley & Sons, Ltd.

Yeast 13: 1547–1562, 1997.

— chromosome III; drug-sensitivity/resistance; functional analysis; genome; Saccharomyces cerevisiae

INTRODUCTION

Five years ago, a consortium of 35 Europeanlaboratories established the first complete sequence

(201239), W303-1B (201238), W303-1B/A (201214).

CCC 0749–503X/97/161547–16 $17.50? 1997 John Wiley & Sons, Ltd.

of a eukaryotic chromosome, that of chromosomeIII from the yeast Saccharomyces cerevisiae.30

Recently, the yeast genome has been completelysequenced and the 6000 open reading frames(ORFs), potentially coding for proteins, have beenidentified.15 The case for choosing yeast as themost appropriate organism to move into this newdimension of biological research is overwhelming(well-known eukaryote, compact genome, power-ful classical and reverse genetics, targeted genedisruption, numerous homologies to human genes,potential industrial applications). Indeed, thesystematic sequencing of the genome of this model

1548 .-. .

? 1997 John Wiley & Sons, Ltd.

MATERIALS AND METHODS

Yeast strainsTargeted gene deletions were carried out in

either the diploid strain W303 (by HIS3 trans-placement; MATa/MATá; ura3-1, trp1-1, ade2-1,leu2-3, 112, his3-11, 15, can1-100), the correspond-ing haploid strain W303-1B (MATá; ura3-1, trp1-1,ade2-1, leu2-3, 112, his3-11, 15, can1-100)46 orBMA64 (by TRP1 transplacement;MATa/MATá;ura3-1, ade2-1, leu2-3, 112, his3-11, 15, trp1Ä).5

Strain FY1679-18B (MATá, ura3-52, trp1-Ä63,leu2-Ä1, his3-Ä200) was obtained from B. Dujon.W303-1B/his3-Ä200 (MATá; ura3-1, trp1-1, ade2-1, leu2-3, 112, his3-Ä200, can1-100) was derivedfrom W303-1B and has been constructed as fol-lows. The strain W303-1B was first transformedwith a BamHI fragment containing the HIS3 genecoming from pFL38/HIS3.7 The normal chromo-somal structure of the resulting His+ strain wasverified by Southern blot. A 726 bp fragment in-cluding the his3-Ä200 allele was PCR amplified

organism opens the door to the identification ofbasic biological mechanisms common to all eu-karyotes, including man, which are not accessiblethrough classical approaches. The central findingcoming out of the sequencing project is the abun-dance of novel genes and gene families, which wasunexpected from the previous genetic and bio-chemical approaches. Indeed, some 50% of thenew genes discovered had no clear homologuesamongst the previously described genes of knownfunction, whether from yeast or other organisms.31

Therefore, the main challenge during the nextstage of the yeast genome project is to elucidate thephysiological role and the biochemical function ofall these genes.Substantial effort, being spent to unravel the

functions of these novel genes (sometimes referredto as ‘orphans’), involves various biological ap-proaches, among others: (i) the systematic inacti-vation of yeast genes by random introduction of aâ-galactosidase (lacZ) reporter gene, generatingmutant phenotypes and providing information onthe level of gene expression and protein localiz-ation;10 (ii) the use of genetic footprinting to assessthe phenotypic effects of Ty 1 transposon inser-tions;43 (iii) characterization of the yeast transcrip-tome, providing insight into global patterns ofgene expression;48 (iv) proteome analysis throughcombined action of two-dimensional gel electro-phoresis and mass spectrometry;8,23,25 (v) con-struction of new high-copy-number yeast vectors,designed for the conditional expression of epitope-tagged proteins in vivo13 or (vi) in-silicoapproaches.28,42

A joint effort of several European laboratories isunder way to elucidate the functions of newlydiscovered ORFs from yeast chromosome III as apilot project for future studies, applicable to thewhole yeast genome.23 As a part of this project, wehave developed a large-scale screening for theidentification of physiological and biochemicalfunctions of unknown genes by the means ofsystematic phenotypic analysis of individually de-leted ORFs. For this purpose, some 80 ORFs ofchromosome III have been deleted and a panel ofabout 150 different growth conditions has beendeveloped, of which 100 are presented herein. Inaddition to the widely used standard media (e.g.discriminating between the fermentative vs. respir-atory growth, sugar and nitrogen source utiliz-ation, temperature sensitivity), we have introduceda systematic inhibitor sensitivity approach. Therationale of this approach is simple. If a protein

involved in a specific biological process is absent,the mutant cell may become more sensitive orsometimes more resistant than the wild-type to theaction of the inhibitor affecting this process itselfor processes linked to it by a network of inter-actions. The finding of such a difference(s) under agiven growth condition constitutes the first indi-cation about the function of the mutated gene. Itmay be informative about the biochemical func-tion of the ORF (e.g. if a hypersensitivity to aspecific inhibitor is found) or it may be onlyindicative of the physiological role of the deletedgene (e.g. if a growth deficiency is found under ageneral stress like high temperature). Nevertheless,even in the latter case the result is of use for futurestudies, since it points out that the ORF in ques-tion does correspond to a real gene and not to aspurious sequence of nucleotides.The urgent need for speeding-up and scaling-up

of the phenotypic testing, applicable to the con-tinuously increasing number of available mutantsto be analysed, provided by the EUROFANproject (European Functional Analysis Network),has led us to use a microtiter plate-based search ofmutant phenotypes. The objective of this articleis to describe this methodology in detail, to illus-trate it by a few examples and to discuss itsadvantages, drawbacks and other potential fieldsof application.

. 13: 1547–1562 (1997)

1549-

using Taq polymerase and then cloned in the SmaIsite of pFL34,7 an integrative vector bearingURA3 as a selectable marker. This plasmid waslinearized using the unique restriction site EagIlocated at the 3* end of the PCR product topromote integration at the HIS3 locus and thenwas used to transform the His+ strain. Ura+

transformants were selected and plated onto amedium containing histidine and uracil to allowrecombination, which leads to the excision of theintegrated plasmid. After 2 days, they were replica-plated onto a 5-fluoro-orotic acid medium to selectUra" clones. Recombinational excision of theplasmid results either in the reconstitution of theHIS3 allele or in its substitution by the his3-Ä200allele. His" clones were selected and the deletionwas verified by Southern blot using the strainsW303-1B and FY1679-18B as controls and theBamHI fragment described above as a probe.

Construction of the ORF deletion cassettesThe ORF deletion cassettes were made by PCR

as described by Baudin et al.4

Selection and PCR-screening of His+

transformantsThe diploid W303 and the corresponding hap-

loid W303-1B strains were transformed with theORF deletion cassette, according to Chen et al.11

The His+ transformants were selected on minimalmedium lacking histidine (2% glucose, 0·67% yeastnitrogen base w/o amino acids, 20 mg/l adenine,20 mg/l tryptophan, 60 mg/l leucine and 20 mg/luracil). In the next step, His+ transformants weregrouped by 12 in 96-well microtiter plates. Cellwalls were digested for 1 h at 37)C in 150 ìl of50 m-Tris/HCl, pH 7·5, 10 m-EDTA, 0·3%â-mercaptoethanol containing 0·5 mg/ml zymol-yase 100 000. Cell lysis was completed by adding10 ìl 20% sodium dodecyl sulfate and proteinswere precipitated by the addition of 100 ìl 8 -ammonium acetate followed by incubation at"70)C for 15 min. The plates were centrifuged for15 min at 2000 g and the supernatants mixed with0·6 volumes of isopropyl alcohol. Nucleic acidswere pelleted for 20 min at 2000 g, washed with70% ethanol, vacuum dried, and resuspended in30 ìl 10 m-Tris/HCl, pH 7·5, 1 m-EDTA. TheDNAs (2 ìl) were analysed by PCR in 25 ìl con-taining 0·25 U of Taq polymerase (Bioprobe),10 m-Tris/HCl pH 8·8, 50 m-KCl, 1·5 m-MgCl , 0·1% Triton X100, 200 ì of each dNTP,
2

25 picomoles of a primer internal to HIS3 (5*-GGAGAAAGTAGGAGATCTCTCTTG, primerP1 in Figure 2) and 25 picomoles of primer P2(primer external to the target ORF); the reactionswere run as follows: [95)C, 2 min; 55)C, 30 s; 72)C,1·5 min]#1; [95)C, 30 s; 55)C, 45 s; 72)C, 1·5min]#28; [95)C, 30 s; 55)C, 30 s; 72)C, 15 min]#1.

Southern blot and standard genetic analysisGenomic DNAs from the disruptants were pre-

pared according to Hoffman and Winston20 andSouthern blot analysis was performed as describedby Sambrook et al.35 We used as probes a 1·7BamHI fragment containing the HIS3 gene andPCR-made DNA fragments specific to the targetloci. The probes were labelled with [á32P]dCTPwith the random priming kit from Gibco BRL.Yeast mating, sporulation and tetrad analysis wereperformed as described by Rose et al.34

ChemicalsIf not stated otherwise, salts, heavy metal inhibi-

tors and other chemicals were added directly to thethree standard media (YPGFA, WOFA, N3FA,where FA denotes functional analysis) listed belowunder headings of 001–003. Stock solutions of thedifferent compounds were made in acetone, etha-nol, dimethylsulfoxide (DMSO), dimethylforma-mide (DMF), methanol, acetic acid and, if notfurther specified below, water. Stock solutionswere filter sterilized and stored following the in-structions of the suppliers. Various concentrationsof solvents were assayed on wild-type strains, toexclude that solvents themselves cause growthinhibition. In some of the conditions listed below,DMSO was added to a final concentration of3% to facilitate penetration of the inhibitor. Con-trols (solvent alone) vs. experimental (solvent+inhibitor) were compared. All chemicals wereobtained from the Sigma Chemical Company(St. Quentin, Fallavier, F), except for benomyl,which was a gift from E. I. DuPont (Wilmington,Del., lot: B-19501). hydroxyurea and sodiumorthovanadate (Aldrich, St. Quentin), maltose(Merck, Darmstadt), ferrous (II) sulfate (Serva,Heidelberg) and thiolutin (Pfizer, Groton, Conn.).All of them were of the highest available puritygrade.

Standard media(001) YPGFA, standard complete glucose

medium: 1% yeast extract (Difco Laboratories,

. 13: 1547–1562 (1997)

1550 .-. .

Detroit, U.S.A.), 1% bactopeptone (Difco), 2%glucose and 80 mg/l adenine (adenine is added inlarge excess in order to prevent the formation ofthe red pigment in ade2 strains); (002) WOFA,standard synthetic glucose medium: 0·67% yeastnitrogen base without amino acids (Difco), 2%glucose, supplemented with: 80 mg/l adenine,20 mg/l uracil, 10 mg/l histidine, 60 mg/l leucine,20 mg/l tryptophan; (003) N3FA, standard gly-cerol medium: 1% yeast extract, 1% bactopeptone,2% glycerol, 0·05 -sodium phosphate (pH 6·2,100 ml/l) and 80 mg/l adenine. Media were solidi-fied by adding 2% (petri-dishes) or 0·7% Bacto-Agar (Difco) to 96-well microtiter plates (NuncIntermed, Polylabo, Paris).

Salts and heavy metalsThe following compounds were added to

YPGFA before autoclaving (KCl, NaCl, MgCl2,MgSO4, NH4Cl, SrCl2). Growth conditions are asfollows (concentrations of stock solutions and finalconcentrations of compounds in the test media aregiven in brackets): (004) 001+BaCl2 [1 ; 50 m];(005) 001+FeCl2 [0·3 ; 23 m]; (006) 001+FeCl3[0·2 ; 8·5 m]; (007) 001+FeSO4 [0·2 ; 23 m];(008) 001+CaCl2 [5 ; 0·5 ]; (009) 001+CdCl2[1 m; 40–50 ì]; (010) 001+CsCl [3 ; 0·1 ];(011) 001+CoCl2 [0·3 ; 750 ì]; (012)001+CuSO4 [0·5 ; 5–6 m]; (013) 001+NiCl2[0·3 ; 850 ì]; (014) 001+HgCl2 [0·2 ; 230–250 ì]; (015) 001+KCl [1·3 ]; (016) 001+NaCl[1·3 ]; (017) 001+MgCl2 [0·5/0·7 ]; (018)001+MgSO4 [0·4/0·6 ]; (019) 001+NH4Cl [0·7/1 ]; (020) 001+RbCl [4 ; 0·2 ]; (021)001+SrCl2 [0·5 ]; (022) 001+LiCl [5 ; 0·15–0·175 ]; (023) 001+MnCl2 [0·1 ; 4 m]; (024)001+ZnCl [0·1 ; 4–5 m].
2
Inhibitors(025) 002+hydroxyurea (100 mg/ml; 6 mg/ml];

(026) 002+phenylethanol [100 mg/ml in ethanol;2 mg/ml]; (027) 003+nalidixic acid [10 mg/ml in 1NNaOH; 200 ìg/ml]+3% DMSO; (028) 002+actino-mycin D [0·8 mg/ml in ethanol; 45 ìg/ml]+3%DMSO; (029) 002+8-hydroxyquinoline (1 mg/mlin ethanol; 26 ìg/ml]; (30) 002+cycloheximide(0·1 mg/ml; 0.2/0.3 ìg/ml]; (031) 002+anisomycin[2 mg/ml in ethanol; 50 ìg/ml]; (032) 002 (supple-mented with 5 ìg/ml uracil)+6-azauracil [3·5 mg/ml; 350 ìg/ml]; (033) 001+protamine sulfate[10 mg/ml; 750 ìg/ml]; (034) 001+chlorambucil[0·3 in cold acetone; 2/3 m]; (035) 003+anti-


mycin A (1 ìg/ml in cold acetone; 0·0025 ìg/ml];(036) 003+chloramphenicol [100 mg/ml in ethanol;2 mg/ml]; (037) 003+erythromycin [100 mg/ml inacetone; 200 ìg/ml]; (038) 001+benomyl [5 mg/mlin DMSO; 25/40 ìg/ml]]; (039) 001+caffeine [5%;0·15/0·2%]; (040) 003+sodium orthovanadate[0·05 in 50 m-KOH; 3 m]; (041) 002+sodiumfluoride [1 ; 5 m]; (042) 002+1·10 phenanthro-line [10 mg/ml in ethanol; 30/35 ìg/ml]; (043) 001/002+cerulenin [1 mg/ml in ethanol; 0·5 ìg/ml];(044) 002+2,2 dipyridyl [10 mg/ml; 50 ìg/ml];(045) 002+aurintricarboxylic acid [2 m in etha-nol; 100 ì]; (046) 001+staurosporine [0·5 mg/mlin DMSO; 3·5 ìg/ml]; (047) 002+colchicine[100 mg/ml in ethanol; 2 mg/ml]; (048) 002+triflu-operazine [0·01 ; 500 ì]; (049) 002+verapamilhydrochloride [2 mg/ml in ethanol; 100 ìg/ml];(050) 002+cinnarizine [1 mg/ml in ethanol; 100 ìg/ml]; (051) 002+tunicamycin [1·1 mg/ml in 1 m-NaOH; 2·5 ìg/ml]; (052) 002+griseofulvin[10 mg/ml in DMF; 100 ìg/ml]; (053) 002+phenyl-methylsulfonyl fluoride [0·1 in methanol;4–5 m]; (054) 002+-ethionine [1 mg/ml; 1 ìg/ml];(055) 002+paromomycin sulfate [100 mg/ml; 2 mg/ml]; (056) 002+5-azacytidine [2·5 mg/ml; 100 ìg/ml]; (057) 001+brefeldin A [5 mg/ml in methanol;100 ìg/ml]; (058) 001+nocodazole [2·5 mg/ml; 60–100 ìg/ml]; (059) 002+thiolutin [0·2 mg/ml inDMSO; 2–9 ìg/ml]; (060) 003+carbonyl-cyanidem-chlorophenylhydrazone [10 m in ethanol;2/3 ì]; (061) 003+oligomycin [2 mg/ml in etha-nol, 0·2/0·3 ìg/ml]; (062) 003+neomycin sulfate[5 mg/ml; 0·5/1 mg/ml]; (063) 002+emetine [20 mg/ml in ethanol; 2 mg/ml]; (064) 002+acetylsalicylicacid [100 mg/ml in ethanol; 0·4–0·5 mg/ml]; (065)001+fluorescent brightener 28 [20 mg/ml; 1·5–2·5 mg/ml]; (066) 001+p-chloromercuribenzoicacid [10 m in DMSO; 0·3 m]; (067) 001+nysta-tin [1 mg/ml; 4–9 ìg/ml]; (068) 003+2,4-dinitro-phenol [20 m in acetone; 0·4 m]; (069) 001+tetraethylammonium chloride [2 ; 100/150 m];(070) 002+3-amino-1,2,4-triazole [100 mg/ml;2·5 mg/ml]; (071) 002+diltiazem hydrochloride[50 mg/ml; 2 mg/ml]; (072) 001+ethylenediamine-tetraacetic acid [10 mg/ml; 1 mg/ml]; (073)001+ethanol [100%; 10/15%]; (074) 001+forma-mide [100%; 2·5/3%]; (075) 001+dimethylforma-mide [100%; 2·5/3%]; (076) 001/002+diamide[50 m; 1·6 m]; (077) 001+H2O2 [30%; 1–2·5 m]; (078) 002+-canavanine [2 mg/ml; 30 ìg/ml]; (079) YPFA+2-deoxy--glucose [0·2 mg/ml inYPFA medium containing 2% sucrose or 2%galactose]; (080) 001+1·8 -sorbitol.

. 13: 1547–1562 (1997)

1551-

Carbon sourcesStandard complete medium without glucose

(YPFA) or standard synthetic medium withoutglucose (WOFA) were supplemented with the cor-responding carbon source: (081) 3% potassium-acetate; (082) 3% ethanol; (083) 2% maltose; (084)2% galactose; (085) 2% sucrose; (086) 2% raffinose;(087) 2% melibiose; (088) 2% fructose; (089) 2%lactate; (090) oleic acid: 0·67% yeast nitrogen base(Difco), 2·5% Bacto-Agar (Difco), 0·05% yeastextract (Difco), 0·25% oleic acid [10% oleic acid,10% Tween 80 were mixed with 70 ml of waterprior to addition of 0·7 g NaOH in 10 ml water],growth factors as in 002; (091) lauric acid: 0·67%yeast nitrogen base (Difco), 2·5% Bacto-Agar(Difco), 0·05% yeast extract (Difco), 0·05% lauricacid from a stock containing 1% lauric acid and8·3% Tween 40; growth factors as in 002; the pH ofthe medium was adjusted to pH 6.

Nitrogen sourcesUnder the conditions listed below the standard

medium is YCBFA (1·17% yeast carbon base(Difco), 20 mg/l adenine, 20 mg/l uracil, 10 mg/lhistidine, 60 mg/l leucine, 20 mg/l tryptophan)supplemented with the following compounds assole nitrogen source: (092) proline [1 mg/ml]; (093)allantoin [1 mg/ml]; (094) glutamic acid [1 mg/ml];(095) -glutamine [1 mg/ml]; (096) NH4Cl [1 mg/ml]; (097) -ornithine [1 mg/ml]; (098) -serine[1 mg/ml]; (099) -threonine [1 mg/ml]; (100) urea[1 mg/ml].

General culture conditions(i) Three growth temperatures (16, 28, 36)C); (ii)

plate assay for heat-shock sensitivity: fresh cellsgrown overnight in liquid YPGFA medium at28)C were serially diluted and 20 ìl of the corre-sponding mutant or wild-type cell suspensionswere spotted on plates containing media 001–003.The plates were sealed with Parafilm, floated in awater bath and incubated for 60 min at 55)C.Then, plates were cooled to room temperature andincubated at 28)C for 3 or 4 days until growth wasscored; (iii) osmotic lability: about 5#107 cellsfrom an overnight culture at 28)C were arranged ina cluster tube 8-strip rack (Costar, Polylabo,Paris), washed twice in sterilized water and shakenat 28)C for up to 10 days. Viability was checked byspotting serially diluted aliquots of all cultures onYPGFA- and WOFA-containing microtiter plates;(iv) pH sensitivity: concentrated YPGFA (90% of


final volume) was mixed at 60)C with filter-sterilized 10#acetate-buffer (1 ) of pH in therange 2·41–5·51. For certain mutants (see Table 1),YPGFA media with 0·1 -citrate (pH 3·0 and 6·0)or 0·1 -phtalate buffers (pH 3·8 and 4·5) wereused.

Establishing the range of inhibitor concentrationsfor the reference strainThe first step consisted of establishing the

threshold concentration (or a range of concen-trations) for the reference strain. The thresholdconcentration should be not too high in order toallow the growth of the reference strain and easydiscrimination of hypersensitive mutants and nottoo low in order to detect a significant increase inresistance in other mutants. To this end, media(5 ml) were supplemented at about 65)C withcompounds to be tested and poured in petri-dishes. Reference strains [W303-1B (MATá) andW303-1B/A (MATa, isogenic to the previous andobtained by mating type switch)] were pregrownovernight in liquid YPGFA at 28)C. Dilutionsmade in Ringer’s solution were spotted on platesand cells were grown for up to 7 days at 28)C and36)C in the presence or absence of the desireddrug.

Phenotypic tests in microtiter platesSolid media were liquified by heating (85)C) in

a covered water bath (Salvig, Reussbuhl,Switzerland). After cooling to about 65)C, inhibi-tors were added. Solutions were then transferred toa multipipette adapted disposer, out of which,using automatic multichannel pipettes, they werefilled in flat-bottomed 96-well microtiter plates atabout 230 ìl/well. Control and mutant strains werepregrown overnight in liquid YPGFA at 28)C toearly stationary phase (ca. 2–4#108 cells/ml). Ali-quots (0·5 ml) of cultures were gridded in clustertube 8-strip racks, serving as a master plate, andsubsequently serially diluted in Ringer. Twentymicroliters of 1:100 and 1:10 000 diluted cell sus-pensions, corresponding to about 2–4#104 and2–4#102 cells respectively, were inoculated intothe wells and the microtiter plates placed on ashaker for 10 s in order to cover uniformly the agarsurface. Plates were then incubated at 16)C, 28)Cand 36)C for up to 12 days. From the first day ofincubation, growth of the mutant strains wasscored visually, either directly on the plate or later

. 13: 1547–1562 (1997)

1552 .-. .


on photographs, by comparison with the growthof the corresponding control strains.

Table 1. The deletants analysed in the examples shownin Figure 3.

Strain Deletion

FA 8/2 Äycr008w aFA 8/3 Äycr008w á

FA 9/5 Äycr011c aFA 9/6 Äycr011c á

FA 17/1 Äycr015c áFA 17/B Äycr015c á

FA 19/6-2C Äycr083w aFA 19/6-3A Äycr083w á

FA 20/1-1C Äycr073c áFA 20/1-3B Äycr073c a

FA 25/1 Äycr010c áFA 25/2 Äycr010c a

FA 26/1 Äycr006c aFA 26/2 Äycr006c á

FA 30/11 Äycl060c áFA 30/12 Äycl060c a

FA 31/11 Äycl062w áFA 31/12 Äycl062w a

FA 32/2 Äycr030c á

FA 33/13 Äycr063w aFA 33/14 Äycr063w á


FA 35/1 Äycr034w á





FA 41-2C Äycr090c áFA 41-2D Äycr090c a

FA 42-3C Äycr091w áFA 42-3D Äycr091w a

FA 43/1-1A Äycl034w aFA 43/1-1B Äycl034w á

FA 49/1-1A Äycl051w áFA 49/1-1D Äycl051w a

FA 50/1-3A Äycr026c á

FA 51/5-1A Äycr086w áFA 51/1-1D Äycr086w a

FA 52/1-1C Äycl045c áFA 52/1-1D Äycl045c a

RESULTS AND DISCUSSION

The aim of the present study was to describe anefficient methodology applicable to a large-scalephenotypic analysis of the yeast S. cerevisiaegenome. As a first step in the functional analysis,we constructed individual deletion alleles in some80 different ORFs located on chromosome III.Targeted deletion of a single gene was performedby either HIS3 or TRP1 transplacement in theW303 background using PCR products.4,5 In con-trast to Baudin et al.,4 we opted for using the strainW303 (carrying point mutations his3-11,15) as arecipient strain for HIS3 transplacement and not astrain with the his3-Ä200 allele (FY1679-18B,W303-1B/his3-Ä200).The his3-Ä200 mutation, initially constructed by

Struhl,45 has become a common auxotrophicmarker present in many yeast laboratory strains.52

A previously unrecognized and rather unexpectedconsequence of this mutation is a severe disfunc-tioning of mitochondrial respiration. In accord-ance with a report by Sirum-Connolly andMason,40 we observed that strains carrying thismutation exhibit strong defects on non-fermentable substrates, with a total absence ofgrowth at 16)C and a slow growth at 28)C and/or34)C (Figure 1). In addition, we observed that evenon rich glucose medium the FY1679-18B straingrows very poorly at 16)C. Consistent with thesedefects, diploid strains homozygous for the his3-Ä200 deletion sporulate poorly, hampering tetradanalyses.The HIS3 gene is adjacent to and divergently

transcribed from PET56,45 a gene required formitochondrial function.40 The his3-Ä200 mutationis a 1036-base pair deletion that removes the entireHIS3 coding sequence and a part of an AT-richpromoter region that is important for transcriptionof both HIS3 and PET56. Besides causing histi-dine auxotrophy, this deletion decreases the tran-scription of PET56 by about 80%.45 Thus, theobserved respiratory growth deficiency is presum-ably due to a reduced expression of PET56 inhis3-Ä200 mutants.In consequence, strains carrying the his3-Ä200

mutation seemed to us not appropriate forfunctional analysis of newly discovered ORFs,since search of respiratory-deficient, sporulation-

. 13: 1547–1562 (1997)

1553-

Figure 1. Effects of the his3-Ä200 mutation on growth on non-fermentablesubstrates. The strains were grown for 2 days at 28)C in 10% glucose, 1% yeastextract, and 1% bactopeptone; the cultures were diluted serially and 20 ìl of eachdilution were deposited on glucose (2% glucose, 1% yeast extract, 1% bactopep-tone, and 30 mg/l adenine) and glycerol (2% glycerol, 1% yeast extract, and 1%bactopeptone) plates.

deficient and cryosensitive phenotypes would beconfusing in a nuclear background which alreadydisplays these lesions and, therefore, interferes ormasks the effects of gene inactivations. Thus, wedecided to disrupt genes in strains without this


deletion. The strain W303 and its isogenic deriva-tives were chosen because they display goodrespiratory-competence, excellent sporulation andspore viability, high transformability, and arewidely used in yeast genetics.

. 13: 1547–1562 (1997)

1554 .-. .

We used PCR-made disrupting fragments con-taining at the extremities 50 bp of homology to thetarget loci (usually, the first and last 50 bp of theORF). The HIS+ transformants were screened byPCR with a primer internal to HIS3 and a primerexternal to the target ORF (thus, amplificationoccurs only if the marker gene is integrated at theORF locus, see Figure 2). This was first done onpools of 12 transformants and then repeated onindividual transformants from ‘positive pools’(Figure 2). We applied this procedure to 42 ORFslocated on chromosome III, the sizes of whichrange from 0·3 to 4 kb. ‘Positive’ clones wereobtained for 39 ORFs with a frequency rangingfrom 0·25 to 5%. Since this method turned out tobe rather time-consuming, we adopted morestraightforward methods like gene deletion byTRP1 or kanr marker transplacement and con-struction of deletion cassettes by fusion PCR.1,5,50

The list of 73 individual gene deletions constructedin our laboratory is given in Coppee et al.12a

The search for phenotypic consequences result-ing from the inactivation of individual genes is thefirst step which follows logically the determinationof the complete sequence of the yeast genome,crucial for the understanding of the biology of thisorganism. This search should fulfil simultaneouslytwo criteria: (i) it should be as broad and unbiasedas possible; (ii) it should be practical, i.e. easilyreproducible and applicable as a routine. Appar-ently, these two conditions are contradictory, sincethe number of imaginable growth conditions isenormous and therefore screening for all of them isimpossible. However, several hundred growth con-ditions should be sufficient to cover in an initialscreening a large fraction of biochemical, develop-mental, regulatory and signalling pathways of theyeast cell. Once a clear mutant phenotype has beenfound, a discrete inhibited step in a pathway maybe further characterized, for example, by the use ofanalogues or unrelated compounds acting in thesame general process. On the basis of these find-ings, the first 100 growth conditions, covering animportant part of the yeast biology, were selected(see Materials and Methods). A number of pre-viously defined yeast phenotypes (in relationto various inhibitors) can be found in a recentcompilation by Hampsey.18

Given the growing number of mutants to beanalysed and the potential applications in screen-ing of chemical compounds (hunt for interestingnew drug candidates), we adopted microtiter platetechnology to search for phenotypes. The advan-


tages and drawbacks of this system can be sum-marized as follows: (i) easy to manipulate largenumbers of strains and conditions; smaller volumefor storage incubation; (ii) straightforward to scorephenotypic differences (Figure 3); (iii) less expen-sive, especially for costly chemicals, a 96-wellmicrotiter plate allows analysis of five times morestrains (in our tests at least 60) than a standardpetri-dish, while both require about the same vol-ume of medium; (iv) absence of cross-feeding andcross-diffusion between individual drop-out cul-tures (e.g. diffusion of secreted metabolites orenzymes); (v) analysis on solid or in liquid media;(vi) simple and provides reproducible results; (vii)possibility of automation.Some of the critical points of this experimental

approach are: (i) in the well, the agar surface isconcave and smaller than the surface of a drop-outdeposit on a flat surface of a petri-dish. Therefore,colonies grown from individual cells (theirnumber, shape and morphological heterogeneity)are more easily analysed on petri-dishes than inwells; (ii) optimal growth conditions are availablein all wells of the plate, except for the outer ring ofwells, where growth differences may result from anincreased evaporation (corner wells should neverbe used because of this phenomenon).For all phenotypic tests, ‘calibration’ of growth

conditions in respect to a reference strain is re-quired. The analysed mutants were derived fromdifferent ‘wild-type’ genetic backgrounds (W303,FY1679, CEN.PK2). Depending on the geneticbackground, important differences in sensitivity toa given drug were observed. This was especiallytrue for the CEN.PK2 strain. For this strain, some30% of the tested growth conditions turned out tobe unsuitable for phenotypic testing, since inhibi-tor concentrations were either below or over thethreshold determined for W303. Otherwise, inmost cases growth differences between W303 andFY1679 were less pronounced, except for respirat-ory media where FY1679 is partly deficient, since itcarries the his3-Ä200 deletion (see above).All these points have been taken into consider-

ation in order to obtain reliable and informativeresults. Some representative examples from thislarge-scale screening are shown in Figure 3. Asillustrated for the screening in the presence ofbenomyl and hydroxyurea (Figure 3A, B), somemutants display complete inhibition of growthwhich can be easily detected (e.g. deletantsÄycr086 and Äycr077). Furthermore, examinationof growth as a function of time can even detect

. 13: 1547–1562 (1997)

1555-

Figure 2. Schematic representation of the method used for targeted gene deletion by HIS3 transplacement in strain W303. Thefigure shows an example of agarose gel electrophoresis after PCR screening of transformants. In this experiment, the primers5*-ATGAAGATAACGTGTACAGACTTGGTGTACGTCTTCATTTTACTCTTCCTCTCTTGGCCTCCTCTAG (oligopro)and 5*-CTATTTAATTAGCCATTGGGATTTCAACTTCTTGTTTGAAACAGAAGGACTCGTTCAGAATGACACG (oligo-term) were used to generate a 1108-bp DNA fragment for disrupting YCL45c, a 2279-bp ORF from S. cerevisiae chromosome III.The primers 5*-GGGAGAAAGTAGGAGATCTCTCTTG (P1, internal to HIS3) and 5*-CTGAGATGGCAATCGCCTCTCGCC (P2, external to YCL45c) were used to screen the transformants. As can be seen, amongst the 16 pools of 12transformants tested, one gave the expected PCR signal, a 1139-bp DNA fragment. The PCR screen is then repeated individuallyon the 12 transformants from the ‘positive pool’ to identify the clone which carries the expected deletion in YCL45c.

1556 .-. .

Figure 3A,B (for legend see Figure 3C).

subtle variations in growth rates (Figure 3A).These mutants, with either a reduced growth forboth inocula or no growth of the low inoculum(but growth with high inoculum) are only indica-tive and classified as ‘suggestive’ phenotypes.It is beyond the scope of this article, which is

essentially a methodological one, to describe all theresults obtained, in particular, those concerningthe ‘suggestive’ phenotypes. We have not listedsuch phenotypes in the summary Table 1 (likethose of weak sensitivity to benomyl of Äycr017c,Äycl060c, Äycr073c, see Figure 3) for the followingreason. In our experience, a ‘suggestive’ phenotypeshould be considered only as a hint for furtherresearch. It should be tested with several inocula,with a more detailed range of inhibitor concen-tration and cosegregation in tetrads. A possibleheterogeneity of clones should be verified, sinceaccumulation of more resistant suppressors canoccur and mask the sensitivity of the originalmutant, especially when a heavy inoculum is usedper well. An example of such an analysis concern-ing Äycr086w mutants is described in Rieger et al.(in preparation) and results of further studieson various ‘suggestive’ phenotypes will be givenelsewhere.


In general, the notion of the ‘function’ of a geneis of necessity ambiguous. It should be definedaccording to different levels of analysis: physio-logical role, participation in cellular processesand biochemical pathways, underlying molecularmechanisms, etc. These various ‘functions’ can bededuced either from experiments (in vivo or in vitroapproaches) or from similarity/homology compari-sons at the sequence level (complete proteins orfragments, Expressed Sequence Tags, in silico ap-proach). The latter approach is the most frequentlyused. According to the MIPS database (updatefrom April 1997), 56% of the ORFs from chromo-some III belong to class 1 and 2 of either knownproteins or display strong similarity to proteins ofknown function (higher than one-third of FASTAself-scores), whereas the remaining 44% are func-tionally still uncharacterized, belonging to ORFclasses 3–6 (3, weak similarity to known protein; 4,similar to unknown protein; 5, no similarity; 6,questionable ORF). Of 73 genes12a on yeast chro-mosome III, belonging mostly to ORF classes 3–6,tested in about 60 different growth conditions,62% showed some phenotype. Of these, 37%were clear phenotypes (Table 1; e.g. no growth inthe presence of an inhibitor or a non-fermentable

. 13: 1547–1562 (1997)

1 8 9 10 11 12

A Em 3 FA 43/1-1A FA 43/1-1A FA 52/1-1D FA 52/1-1D EmptyB Em 4 FA 43/1-1B FA 43/1-1B FA 34/1 FA 34/1 Empty

C FA ) FA 49/1-1A FA 49/1-1A FA 35/1 FA 35/1 FA 17/B

D FA ) FA 49/1-1D FA 49/1-1D FA 36/2 FA 36/2 FA 25/1E FA C FA 50/1-3A FA 50/1-3A FA 37/1 FA 37/1 FA 25/2F FA D FA 51/1-1A FA 51/1-1A FA 38/11 FA 38/11 FA 26/1G FA C FA 51/1-1D FA 51/1-1D FA 39/1 FA 39/1 FA 26/2H Em D FA 52/1-1C FA 52/1-1C FA 17/1 FA 17/1 Empty

Figure 3 from the screening of deleted ORFs of unknown function, from yeastchromos Methods. Microtiter plates with control (in triplicate) and deleted strains(42 strain ndependent isolates of the same deletions or the two mating types,MATáandMA )C. Strains were arranged in the plates as follows: each strain is inoculatedtwice, wi 6, 8, 10 and 1 and with corresponding low cell inoculum (ca. 2#102 cellsper well) letant and control strains in the microtiter trays. Strains ssm5-1 (MATa)and ssm were taken as a phenotypic control: haploid strains bearing alleles ssm5(suppres droxyurea, especially at 37)C.2 In the conditions of hydroxyurea test inmicrotite tion. (A) Microtiter plates with control and deleted strains were incubatedfor vario Photographs were taken after 4 (left) and 6 days (right) of incubation at28)C. On ains (e.g. B11, E5, H3, F5) display a moderate increase in sensitivity, easilydetectab sitivity to hydroxyurea (6 mg/ml; growth medium: 025). The photographwas take nd D6–7) and the strain in wells D10–11 show strong sensitivity to thecompoun w inoculum-deposit that is inhibited.

1557

-

?1997

JohnWiley

&Sons,

Ltd.

.13:

1547–1562(1997)

2 3 4 5 6 7

pty FA 8/2 FA 8/2 FA 20/1-3B FA 20/1-3B FA 33/13 FA 33/1pty FA 8/3 FA 8/3 FA 32/2 FA 32/2 FA 33/14 FA 33/1

17/B FA 9/5 FA 9/5 FA 19/6-2C FA 19/6-2Cssm5-1(MATa)

ssm5-1(MATa

25/1 W.T. W.T. FA 19/6-3A FA 19/6-3Assm5-1(MATá)

ssm5-1(MATá

25/2 W.T. W.T. FA 30/11 FA 30/11 FA 41-2C FA 41-226/1 W.T. W.T. FA 30/12 FA 30/12 FA 41-2D FA 41-226/2 FA 9/6 FA 9/6 FA 31/11 FA 31/11 FA 42-3C FA 42-3pty FA 20/1-1C FA 20/1-1C FA 31/12 FA 31/12 FA 42-3D FA 42-3

Figure 3c.

. (A, B) Large-scale phenotypic tests in microtiter plates. Representative examplesome III. Preparation of media and cell suspensions was done as outlined in Materials ands corresponding to deletions in 26 different ORFs, see Table 1, and representing either iTa, carrying the same deletion) were incubated for various periods of time at 28)C and 36th high cell inoculum (ca. 2#104 cells per well) in wells in columns with numbers 2, 4,in wells in columns with numbers 3, 5, 7, 9, 11 and 12, respectively. (C) Lay-out of de5-1 (MATá) were inoculated in wells C6–7 and D6–7, respectively. These two strainssor mutations of rna15-2 in the essential gene STS1) were found to be sensitive to hyr plates, growth of the strains is also inhibited at 28)C when scored after 4 days of incubaus periods of time at 28)C in the presence of benomyl (40 ìg/ml; growth medium: 038).ly two strains (F8, F9; D10, D11) show a strong hypersensitivity to benomyl while 11 strle with low inocula, but barely or no longer seen with high inocula. (B) Screening for senn after 4 days of incubation at 28)C. The control hypersensitive strains ssm5 (C6–7 ad at both inocula, while, for two other strains (G9 and G11), it is mostly growth of lo

Tab red after the completion of its sequence.

OR Further studies (in vitro/in vivo)

YC

YC romadka et al.16

YC aik and Jones (1996, unpublished)YC RNA processing and 40S ribosome subunit synthesis (this

-Baillieu et al.)6

YC tRNA splicing mutants24

YC somal protein (this laboratory)YC p and Hal5p protein kinases, increased sensitivity to salts,

nfers increased salt tolerance32,41

YC

YC ia22

YCYC glucan synthase subunit (this study14,33,39)YC aintenance of the mitochondrial genome, probably codes for

bosomal protein (this laboratory12)YCYCYC n protein with 8 beta-transducin (WD-40) repeats, defective

n and cytokinesis37

YCYC d Sanz et al.36

1558.-.

.

?1997

JohnWiley

&Sons,

Ltd.

.13:

1547–1562(1997)

le 2. Non-exhaustive list of phenotypes of genes from yeast chromosome III uncove

F GenePhenotype(s)(this study)

L063w* Caffeine (S), CsCl (S),tetraethylammonium-chloride (R),pH (R)

L059c* KKR1 Lethal This laboratory, GL052c* PBN1 Lethal This laboratory; NL031c* RRP7 Lethal Required for pre-r

laboratory, BaudinL017c* NFS1 Lethal Suppressor of pre-R003w* MRP-L32 Respiratory deficient Mitochondrial riboR008w* SAT4 CsCl (S) Similarity to Npr1

overproduction coR017c* Vanadate (R), osmotically remedied

heat-shock sensitivity, nystatin (S),caffeine (S)

R032w* BPH1 pH (S) This laboratory, JR033w* 8-Hydroxyquinoline (S)R034w* GNS1/FEN1 LiCl (R), pH (S) Probable beta-1,3-R046c* PETCR46 Respiratory deficient Essential for the m

a mitochondrial riR047c* Calcium chloride (S)R054w* CTR86 LethalR057c* PWP2 Lethal Periodic tryptopha

in bud-site selectioR071c* PETCR71 Respiratory deficient This laboratoryR072c* Lethal This laboratory an

Table overed after the completion of its sequence.

ORF Further studies (in vitro/in vivo)

YCR0 inase kinase, expression of constitutively-activated N-terminals tyrosine phosphorylation of Hog1p in Pbs2p-dependentlethal to yeast cells26

YCR0 II-associated, required for faithful chromosome transmissionand meiosis51

YCR0 RNA polymerase II holoenzyme3,19,44

YCR0 fect, strongly decreased spore viability, impaired nuclearetic interaction with TUB1 (this laboratory)

YCR0 h repair protein17,27,29,38,47

YCR0

(S) gro n marker and phenotype were verified by Southern blot and/or tetradanalysi herent on two independent haploid mutants. ***The gene deletion wasconfirm one of the mutants was tested in all of the 100 growth conditions listedin MatIt shou erials and Methods); consequently, increased sensitivity may correspondeither t acetic acid present at low pH. It has been verified that the latter is truefor bot on only in media with the acetate buffers and not in media adjusted withcitrate

1559

-

?1997

JohnWiley

&Sons,

Ltd.

.13:

1547–1562(1997)

2. Non-exhaustive list of phenotypes of genes from yeast chromosome III unc

GenePhenotype(s)(this study)

73c* SSK22 Tunicamycin (S) MAP kinase kdeletion inducemanner and is

77c* PAT1 Hydroxyurea (S), caffeine (S),cycloheximide (S), NaF (S),benomyl (S), thermosensitive (S)

Topoisomeraseduring mitosis

81w** SRB8 8-Hydroxyquinoline (S), RbCl (S),CsCl (S), manganese chloride (S),LiCl (S), cycloheximide (S)

DNA-directed

86w* SPO86 Benomyl (S) Sporulation demigration, gen

92c*** MSH3 Hydroxyurea (S) DNA mismatc94w** Cold sensitive, trifluoperazine (S),

zinc chloride (S), cobalt chloride (S),manganese chloride (S)

wth sensitivity; (R) growth resistance; *gene deletion and co-segregation of disruptios. **The gene deletion was confirmed by Southern blot, phenotypic analysis was coed by PCR, phenotypic analysis was coherent on two independent haploid mutants. Nerials and Methods.ld be noted that sensitivity to low pH has been tested with acetate buffers (see Mato growth inhibition by low pH per se or growth inhibition mediated by undissociatedh low pH-sensitive strains, Äycr32w and Äycr34w; the mutants showed growth inhibitior phtalate buffers in the same range of pH.

1560 .-. .

substrate, lethals), 25% were suggestive, whereasno phenotype was found for the remaining 38% ofthe analysed mutants. These figures should beconsidered as minimal, since we have not tested allthe mutants in all the conditions listed in Materialsand Methods. We found that several conditionsused are apparently of no immediate interest, sincewe have never observed a single mutant displayinga difference in comparison to the reference strain(e.g. condition 028). On the contrary, other con-ditions (e.g. salts and heavy metals, conditions025, 038, 039, 040, 069) turned out to be morerevealing since a relatively larger number ofmutants displayed at least ‘suggestive’ phenotypes.In conclusion, the experimental approach appliedhere allowed the detection of phenotypes for thoseORFs for which no indication about theirbiological/physiological role is available.It should be stressed that many single gene

mutations are largely pleiotropic, i.e. display sev-eral phenotypes. A few examples are given in Table2. The deletion of YCR034w leads to an increasedsensitivity to low pH, as well as to resistance tolithium chloride. Such multiple effects are under-standable since the primary defect can lead by acascade of successive interactions to a variety ofend effects. The panoply of end effects can beconsidered as ‘symptoms’ of the mutation andthey can be grouped in ‘syndromes’ diagnostic ofthe biochemical/physiological process which isaffected. Our results indicate that some 30% ofthe mutants belong to this category.Nevertheless, one has to keep in mind that a

phenotype is only the starting point of a functionalanalysis of a given gene. Its interpretation depends,on the one hand, on potentially significant se-quence similarities with known genes and, on theother hand, on our knowledge about the cellulartarget(s) and mode(s) of action of inhibitors. Forinstance, complete growth inhibition in the pres-ence of sodium fluoride, a phosphatase inhibitor,implies a relatively discrete function in the cell,whereas no growth on caffeine leaves us with apanoply of possibly affected cellular processes,including intracellular calcium homeostasis, DNArepair and recombination and cell cycle progres-sion. At the level of phenotypic tests, we cannotdifferentiate between the primary lesion caused bythe deletion and a secondary effect or a general‘unhealthy’ state of the cell. This must be deter-mined by further more detailed studies.But, to this end, a crucial step towards under-

standing of function has been made—the gene is


now accessible for genetic/biochemical analysis. Aclear and stringent phenotype could be used tohunt for genetic interactions via isolation of mul-ticopy and extragenic suppressors, testing of inter-action between mutations with similar phenotypes,which would provide further information aboutthe function of the studied ORF. In concert withdifferent but complementary approaches, such as2-hybrid analysis, two-dimensional gel electro-phoresis of proteins and transcript analysis, acoherent picture of the role of various novel genesin integrated cellular processes should emerge.Finally, a supplementary, potential use of this in

vivo screening system is to identify new targets forchemical compounds, coming either from yeast orother organisms. The system, although being basi-cally a classical approach, can be adapted tohigh-throughput screening (HTS) and thus pro-vides a tool for the discovery of new ‘small’-molecule drugs. Therefore, the utility of yeast as amodel organism could be twofold—combining thehunt for gene function and drug research. For thispurpose, three elements are required: (i) auto-mation of the microtiter plate-based in vivo screen-ing system (robotics workstation, computerizedsystem for data acquisition, collection and man-agement); (ii) standardized mutant collection; (iii)suitable arrayed libraries of chemical compounds.This approach would complement other strate-

gies, including in vitroHTS9 against defined targets(e.g. cloned receptors, enzymes), combinatorialchemistry,21,49 bioinformatics, and the develop-ment of macromolecular, mechanism-based thera-peutic agents (e.g. oligonucleotides, genes/genefragments, recombinant proteins).

ACKNOWLEDGEMENTS

This work was supported by grants BIO2.CT93.0022 (experimental pilot study for aEuropean cooperation on gene function search inS. cerevisiae) from the European Commission and92H00882 from the Ministere de la Recherche.K.-J.R. and J.-Y.C. received a fellowship fromthe EC (ERBCHBGGCT920087) and G.O.and A.K. had fellowships from the JumelageFranco-Polonais du CNRS and the Reseaux deFormation-Recherche from the Ministere de laRecherche. We thank Drs F. M. Klis and J. Rytkafor suggestions concerning growth conditions, D.Menay for the synthesis of oligonucleotides andM.-L. Bourbon, F. Casalinho, P. Kerboriou andM. C. Lucinus for their help in preparation of

. 13: 1547–1562 (1997)

1561-

various standard media. The anonymous daughterof the Editor-in-Chief is thanked for improvingthe presentation of the data in Figure 3C andTable 1.

REFERENCES

1. Amberg, D. C., Botstein, D. and Beasley, E. M.(1995). Precise gene disruption in Saccharomycescerevisiae by double fusion polymerase chainreaction. Yeast 11, 1275–1280.

2. Amrani, N., Dufour, M.-E., Bonneaud, N. andLacroute, F. (1996). Mutations in STS1 suppressthe defect in 3* mRNA processing caused by therna15-2 mutation in Saccharomyces cerevisiae.Mol. Gen. Genet. 252, 552–562.

3. Balciunas, D. and Ronne, H. (1995). Three sub-units of the RNA polymerase II mediator complexare involved in glucose repression. Nucl. Acids Res.23, 4421–4425.

4. Baudin, A., Ozier-Kalogeropoulos, O., Denouel,A., Lacroute, F. and Cullin, C. (1993). A simpleand efficient method for direct gene deletion inSaccharomyces cerevisiae. Nucl. Acids Res. 21,3329–3330.

5. Baudin-Baillieu, A., Guillemet, E., Cullin, C. andLacroute, F. (1997a). Construction of a yeast straindeleted for the TRP1 promoter and coding regionthat enhances the efficiency of the polymerasechain reaction-disruption method. Yeast 13, 353–356.

6. Baudin-Baillieu, A., Tollervey, D., Cullin, C. andLacroute, F. (1997b). Functional analysis ofRrp7p, an essential yeast protein involved in pre-rRNA processing and ribosome assembly. Mol.Cell. Biol. 17, 5023–5032.

7. Bonneaud, N., Ozier-Kalogeropoulos, O., Guoya,L., Labouesse, M., Minvielle-Sebastia, L. andLacroute, F. (1991). A family of low and high copyreplicative, integrative and single-stranded S.cerevisiae/E. coli shuttle vectors. Yeast 7, 609–615.

8. Boucherie, H., Dujardin, G., Kermorgant, M.,Monribot, C., Slonimski, P. and Perrot, M. (1995).Two-dimensional protein map of Saccharomycescerevisiae: Construction of a gene–protein index.Yeast 11, 601–613.

9. Broach, J. R. and Thorner, J. (1996). High-throughput screening for drug discovery. Nature384 (Suppl.), 14–16.

10. Burns, N., Grimwade, B., Ross-Macdonald, P. B.,et al. (1994). Large-scale analysis of gene expres-sion, protein localization, and gene disruption inSaccharomyces cerevisiae. Genes & Dev. 8, 1087–1105.

11. Chen, D.-C., Yang, B.-C. and Kuo, T.-T. (1992).One-step transformation of yeast in stationaryphase. Curr. Genet. 21, 83–84.


12a. Coppee, J.-Y., Baudin, A., Cullin, C., et al. (1995).Construction of a library of 73 individual genedeletions in view of the functional analysis of thenew genes discovered by systematic sequencing ofSaccharomyces cerevisiae chromosome III. Yeast11, Special Issue, S655.

12. Coppee, J.-Y., Rieger, K.-J., Kaniak, A., di Rago,J.-P., Groudinsky, O. and Slonimski, P. P. (1996).PetCR46, a gene which is essential for respirationand integrity of the mitochondrial genome. Yeast12, 577–582.

13. Cullin, C. and Minvielle-Sebastia, L. (1994). Multi-purpose vectors designed for the fast generation ofN- or C-terminal epitope-tagged proteins. Yeast10, 105–112.

14. El-Sherbeini, M. and Clemas, J. A. (1995). Cloningand characterization of GSN1: a Saccharomycescerevisiae gene involved in synthesis of 1,3-â-glucanin vitro. J. Bacteriol. 177, 3227–3234.

15. Goffeau, A., et al. (1996). Life with 6000 genes.Science 274, 562–567.

16. Gromadka, R., Kaniak, A., Slonimski, P. P. andRytka, J. (1996). A novel cross-phylum family ofproteins comprises a KRR1 (YCL059c) gene whichis essential for viability of Saccharomyces cerevisiaecells. Gene 171, 27–32.

17. Habraken, Y., Sung, P., Prakash, L. and Prakash,S. (1996). Binding of insertion/deletion DNA mis-matches by the heterodimer of yeast mismatchrepair proteins MSH2 and MSH3. Curr. Biol. 6,1185–1187.

18. Hampsey, M. (1997). A review of phenotypes inSaccharomyces cerevisiae. Yeast 13, 1099–1133.

19. Hengartner, C. J., Thompson, C. M., Zhang, J., etal. (1995). Association of an activator with anRNA polymerase II holoenzyme. Genes Dev. 9,897–910.

20. Hoffman, C. S. and Winston, F. (1987). A ten-minute DNA preparation from yeast efficientlyreleases autonomous plasmids for transformationof Escherichia coli. Gene 57, 267–272.

21. Hogan, J. C. (1996). Directed combinatorial chem-istry. Nature 384 (Suppl.), 17–19.

22. Jia, Y. (1993). Identification et analyse fonctionellede deux nouveaux genes, YCR032 et YCR033,situes sur le chromosome III de la levure S. cerevi-siae. PhD Dissertation, L’Universite Pierre etMarie Curie.

23. Kahn, P. (1995). From genome to proteome: look-ing at a cell’s proteins. Science 270, 369–370.

24. Kolman, C. and Soll, D. (1993). SPL1-1, a Sacch-aromyces cerevisiae mutation affecting tRNAsplicing. J. Bacteriol. 175, 1433–1442.

25. Lamond, A. I. and Mann, M. (1997). Cell biologyand the genome projects—a concerted strategy forcharacterizing multiprotein complexes by usingmass spectrometry. Trends Cell Biol. 7, 139–142.

. 13: 1547–1562 (1997)

1562 .-. .

26. Maeda, T., Takekawa, M. and Saito, H. (1995).Activation of yeast PBS2MAPKK by MAPKKKsor by binding of an SH3-containing osmosensor.Science 269, 554–558.

27. Marsischky, G. T., Filosi, N., Kane, M. F. andKolodner, R. (1996). Redundancy of Saccharo-myces cerevisiae MSH3 and MSH6 inMSH2-dependent mismatch repair. Genes Dev. 10,407–420.

28. Nakai, K. and Kanehisa, M. (1992). A knowledgebase for predicting protein localization sites ineukaryotic cells. Genomics 14, 897–911.

29. New, L., Liu, K. and Crouse, G. F. (1993). A yeastgeneMSH3 defines a new class of eukaryotic MutShomologues. Mol. Gen. Genet. 239, 97–108.

30. Oliver, S. G., et al. (1992). The complete DNAsequence of yeast chromosome III. Nature 357,38–46.

31. Oliver, S. G. (1996). From DNA sequence tobiological function. Nature 379, 597–600.

32. Posas, F., Camps, M. and Arino, J. (1995). ThePPZ protein phosphatases are important determi-nants of salt tolerance in yeast cells. J. Biol. Chem.270, 13036–13041.

33. Revardel, E., Bonneau, M., Durrens, P. and Aigle,M. (1995). Characterization of a new gene familydeveloping pleiotropic phenotypes upon mutationin Saccharomyces cerevisiae. Biochim. Biophys.Acta 1263, 261–265.

34. Rose, M. D., Winston, F. and Hieter, P. (1990).Methods in Yeast Genetics—A Laboratory CourseManual. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY.

35. Sambrook, J., Fritsch, E. F. and Maniatis, T.(1989). Molecular Cloning—A Laboratory Manual.Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

36. Sanz, E., Ballesta, J. P. G. and Remacha, M.(1995). YCR072C, an essential â-transducin pro-tein involved in yeast morphogenesis. Yeast 11,Special Issue, S338.

37. Shafaatian, R., Payton, M. A. and Reid, J. D.(1996). PWP2, a member of the WD-repeat familyof proteins, is an essential Saccharomyces cerevisiaegene involved in cell separation. Mol. Gen. Genet.252, 101–114.

38. Sia, E. A., Kokoska, R. J., Dominska, M.,Greenwell, P. and Petes, T. D. (1997). Microsatel-lite instability in yeast: dependence on repeat unitsize and DNA mismatch repair genes. Mol. Cell.Biol. 17, 2851–2858.

39. Silve, S., Leplatois, P., Josse, A., et al. (1996). Theimmunosuppressant SR 31747 blocks cell prolifer-ation by inhibiting a steroid isomerase in Saccha-romyces cerevisiae. Mol. Cell. Biol. 16, 2719–2727.


40. Sirum-Connolly, K. and Mason, T. L. (1993).Functional requirement of a site-specific ribosemethylation in ribosomal DNA. Science 262, 1886–1889.

41. Skala, J., Purnelle, B., Crouzet, M., Aigle, M. andGoffeau, A. (1991). The open reading frameYCR101 located on chromosome III from Saccha-romyces cerevisiae is a putative protein kinase.Yeast 7, 651–655.

42. Slonimski, P. P. and Brouillet, S. (1993). A data-base of chromosome III of Saccharomyces cere-visiae. Yeast 9, 941–1029.

43. Smith, V., Chou, K. N., Lashkari, D., Botstein, D.and Brown, P. O. (1996). Functional analysis of thegenes of yeast chromosome V by genetic footprint-ing. Science 274, 2069–2074.

44. Song, W., Treich, I., Qian, N., Kuchin, S. andCarlson, M. (1996). SSN genes that affect tran-scriptional repression in Saccharomyces cerevisiaeencode SIN4, ROX3, and SRB proteins associatedwith RNA polymerase II. Mol. Cell. Biol. 16,115–120.

45. Struhl, K. (1985). Naturally occurring poly(dA-dT)sequences are upstream promoter elements for con-stitutive transcription in yeast. Proc. Natl. Acad.Sci. USA 82, 8419–8423.

46. Thomas, B. J. and Rothstein, R. (1989). Elevatedrecombination rates in transcriptionally activeDNA. Cell 56, 619–630.

47. Tran, H. T., Gordenin, D. A. and Resnick, M. A.(1996). The prevention of repeat-associated dele-tions in Saccharomyces cerevisiae by mismatchrepair depends on size and origin of deletions.Genetics 143, 1579–1587.

48. Velculescu, V. E., Zhang, L., Zhou, W., et al.(1997). Characterization of the yeast transcrip-tome. Cell 88, 243–251.

49. Verdine, G. L. (1996). The combinatorial chemistryof nature. Nature 384 (Suppl.), 11–13.

50. Wach, A., Brachat, A., Pohlmann, R andPhilippsen, P. (1994). New heterologous modulesfor classical or PCR-based gene disruptions inSaccharomyces cerevisiae. Yeast 10, 1793–1808.

51. Wang, X., Louis, E. J., Borts, R. H. and Hickson,I. D. (1996). Pat1: a topoisomerase II-associatedprotein required for faithful chromosome trans-mission in Saccharomyces cerevisiae. Nucl. AcidsRes. 24, 4791–4797.

52. Winston, F., Dollard, C. and Ricupero-Hovasse,S. L. (1995). Construction of a set of convenientSaccharomyces cerevisiae strains that are isogenicto S288C. Yeast 11, 53–55.

. 13: 1547–1562 (1997)

large-scale phenotypic analysis—the pilot project on yeast chromosome iii

Documents