large dna deletions drive premature aging in mitochondrial ... · large dna deletions drive...

Large DNA deletions drive premature aging in mitochondrial mutator mice Marc Vermulst1, Jonathan Wanagat2, Gregory C. Kujoth3, Jason H. Bielas1, Peter S. Rabinovitch1, Tomas A. Prolla3, Lawrence A. Loeb1 1Department of Pathology, University of Washington, Seattle, 91895 Washington, USA. 2Department of Gerontology and Geriatric Medicine, University of Washington, Seattle, WA 91895, USA 3Departments of Genetics and Medical Genetics, University of Wisconsin, Madison, WI 53706, USA. Supplementary Material Materials and Methods

MtDNA deletion detection. Deletions were PCR-amplified and quantified using

our recently described RMC-methodology1 with minor alterations (Fig. S1).

Deleted mtDNA molecules were quantified by single molecule amplification

according to previously published protocols2, or in triplicate using standard

comparative qPCR-methodology. Primer sequences are listed in table S1.

PCR conditions PCR reactions were performed using a DNA Engine Opticon®

Monitor 2, a continuous fluorescence detection system from BioRad, and

amplicons were quantified with Stratagene’s Brilliant® SYBR® Green qPCR

Mastermix. QPCR reactions were performed in 25 � l reactions containing

1xBrilliant® SYBR® Green qPCR Mastermix from Stratagene, 20 pM forward and

reverse primers, and 2 u uracil DNA glycosylase (UDG). The samples were

amplified as follows: UDG incubation at 37 °C for 10 min, 95 °C for 10 min, and

then 45 cycles of 95 °C for 30 sec, 60 °C for 1 min and 72 °C for 1.5 min.

Samples were held at 72 °C for 5 min and stored at -20 °C.

Histochemistry. Cytochrome oxidase staining solutions were prepared in 10ml

aliquots containing 750mg sucrose, 5mg DAB, 10mg cytochrome c. 1 ml

10xcatalase, and 9ml 50mM sodium phosphate buffer pH 7.4. Succinate

dehydrogenase staining solutions were prepared in 10 ml aliquots containing

100mg sodium succinate, 10mg NBT, 0.2mg phenazine methosulphate, and

10ml Tris-HCl, pH7.4. Frozen tissue sections were incubated with cytochrome

oxidase staining solution at room temperature for either 15 (heart), 35

(duodenum), or 60 minutes (brain), washed with 1xPBS, and incubated with

succinate dehydrogenase staining solution for 3 (heart), 10 (duodenum) or 30

minutes (brain) at 37°C. Samples where then washed with 1xPBS and either

coverslipped or washed in 70% ethanol.

Microdissection. Microdissection was performed on a PALM MicroBeam

System from P.A.L.M. Microlaser Technologies AG and Zeiss. Laser dissected

samples were caught in opaque adhesive caps from P.A.L.M. Microlaser

Technologies, inspected under a microscope, and lysed in a 3 � l reaction

containing 0.4mg/ml ProK, 0.5% SDS and 10mM EDTA at 46°C.

Tissue homogenization and organelle separation. Animals were sacrificed

and all tissues were harvested within 5 minutes of death. All animals were

cared for according to approved guidelines by the University of Washington and

the University of Wisconsin. Tissues were sliced in pieces with a scalpel and

rinsed in 1xPBS before homogenization in a Dounce-type glass homogenizer

with 25 firm strokes of a hand driven glass pestle. Homogenization buffer

contained 0.075M sucrose, 0.225M sorbitol, 1mM EGTA, 0.1% fatty acid free

bovine serum albumin (BSA), and 10mM Tris HCl, pH 7.8). Differential

centrifugation was performed as described previously3 to obtain a crudely

purified mitochondrial pellet.

Supplementary Data Detection of deletions in mitochondrial DNA. The RMC-assay uses restriction

enzymes and qPCR to detect random mutations at restriction sites1. Briefly, DNA

is digested with TaqI and PCR amplification is then attempted across a TaqI

restriction site. Thus, only molecules that contained a mutation in the restriction

site, which rendered it resistant to cleavage, provide a viable amplicon for PCR-

amplification. These mutant molecules are quantified, and compared to the total

number of mtDNA molecules, providing a measure of the mutation frequency.

Previously, we determined that the frequency of point mutations and small

deletions at TaqI sites in the mitochondrial genome is as low as 1x10-6/bp.

Based on this result, we reasoned that multiple TaqI restriction sites are unlikely

to be mutated in a single mitochondrial DNA (mtDNA) molecule. Thus, by

flanking multiple TaqI sites with a single primer set, a PCR product is unlikely to

occur as a result of multiple mutations at individual TaqI sites. Instead, PCR

amplification requires loss of all restriction sites in a single mutational event that

renders the DNA molecule resistant to TaqI cleavage.

Figure S1. The RMC assay for detection of mtDNA point mutations and large

deletions. To detect point mutations and small deletions (top), a single TaqI

restriction site (TCGA) is flanked by a pair of primers, shown in red. Single base

mutations and small deletions within the restriction site are detected with

frequencies of � 10-6 and � 4 x 10-8, respectively. To detect large mtDNA deletions

(bottom), primers are spaced several kb apart, flank multiple TaqI restriction

sites, and can be placed throughout the mitochondrial genome, depending on

the region to be analyzed. The probability of attaining a PCR product as a result

of multiple point mutations decreases exponentially with the number of TaqI

sites that are flanked, providing a genetic selection that uncovers mutation

events that remove all TaqI sites simultaneously. A second primer set, shown in

green, is used for determination of total copy number. The ratio of deleted

mtDNA molecules versus total mtDNA molecules corresponds to the deletion

frequency.

Validation of assay for deletion detection. We validated our assay using a

plasmid that encodes a commonly observed mtDNA deletion, and yields a

430bp PCR-product when amplified. This deletion is the result of a

rearrangement between two 15bp direct repeats, and accounts for 50-80% of all

deletions recovered from WT and PolgA+/mut mice. We added the plasmid in

decreasing proportion to a large number (106) of mtDNA molecules. Using this

end-point dilution method, we were able to accurately detect the plasmid

harboring the mtDNA deletion over 5 log scales. Dilution of the plasmid in 20-

fold increments resulted in a concomitant linear decrease in the number of

molecules detected (Fig S2).

Figure S2. Assay validation. A TOPO4 plasmid containing a mtDNA deletion

was added in 20-fold dilutions to a pool of 106 WT mtDNA molecules The

logarithm of the number of plasmid molecules added is shown on the y-axis,

and the cycle, C(t), at which these molecules were detected with qPCR is

shown on the x-axis.

Detection of mtDNA deletions produced by oxidative damage and single

molecule amplification. In order to demonstrate the robustness of our assay,

we treated primary normal human dermal fibroblasts with 1mM H2O2. which

allowed for >95% cell survival. Cells were harvested 24-72 hrs post treatment to

permit mutation induction and mtDNA was isolated and analyzed. We

Plasmid detection C(t)

Pla

smid

ad

ded

(lo

g)

recovered multiple mtDNA deletions from the treated cells, but none from the

untreated control cells, constituting a >45-fold induction of deletions. In order to

demonstrate that our assay can detect single deleted mtDNA molecules, we

analyzed multiple tissue samples from mouse brain and heart. Samples were

diluted to single mutant molecule level, amplified, and sequenced in order to

map the breakpoints of the deletion (Fig S3). 98% of the recovered molecules

constituted mtDNA deletions that had lost all TaqI sites, in 2% of the cases

mispriming had occurred on residual nDNA.

Figure S3. Single molecule amplification of deleted mtDNA molecules.

MtDNA, extracted from a 15 month old mouse, was digested with TaqI and

displayed in a 96 well PCR plate, so that only 1 in 10 wells contained an

amplifiable, deleted mtDNA molecule. Single molecules were amplified,

analyzed on a gel, and sequenced. The gel displays six single, PCR-amplified

molecules.

200bp

600bp

400bp

800bp

Figure S4. mtDNA deletions in heart tissue as a function of age in WT,

PolgA+/mut and PolgAmut/mut mice. The average frequency of deletions in young

(1-3 months) WT mice is set to 1. Fold increases over that baseline are

depicted. * signifies a statistical difference (P<0.01, two sided t-test) between

PolgAmut/mut and WT animals at 1-3 or 15-17 months of age.

0

10

20

30

40

50

0 10 20 30 40

age (months)

fold

incre

ase

WT

+/mut

mut/mut

*

*

Figure S5. MtDNA deletion load at two additional loci. Deletion load was

assessed using two additional primer sets that exclude detection of

recombination events between a 15bp direct repeat. The level of deletions in 15

month old PolgAmut/mut mice (n=3) is compared to age matched WT mice (n=3).

The deletion load of WT mice was normalized to 1. PolgAmut/mut mice displayed

91 and 99-fold increases over WT levels (P<0.01, two sided t-test, n=3).

deletion load site 1 and 2

0

20

40

60

80

100

120

1 2

fold

incre

ase

WT

mut/mut

Figure S6. Sequencing and identification of point mutations from COX-

negative villi. 10 � M sections from PolgA+/mut duodenum were stained

sequentially for COX (brown) and SDH-activity (purple). Using laser

microdissection, we isolated 7 COX-negative villi. These are generated by

mtDNA mutations that originate in single stem cells4, and sequenced the

mitochondrial COX-genes. Point mutations with high degrees of heteroplasmy

were found in all instances and resulted either in lost start codons (CN-3),

premature stop codons (CN-6, 7a-b), or changes in conserved amino acid

residues (CN-1a, 2, 4, and 5a-c).

Figure S7. Quantitative PCR can detect mtDNA deletions from small amounts of

starting material. In order to demonstrate that we could detect near

homoplasmic deletions in cells using qPCR, we isolated normal, and COX-

negative SDH-hyperreactive, muscle fibers from WT mice using laser

microdissection. Fibers were selected (Fig. S5A, E), freed from the surrounding

tissue with a UV-laser (Fig. S5B, F), and catapulted into a cap (Fig. S5C, G).

COX-negative, SDH hyperreactive fibers invariably contain a single large

mtDNA deletion5. We lysed the fibers, and performed competitive qPCR with ten

200bp long amplicons, scattered throughout the genome, to detect copynumber

differences between them. The location of the amplicon relative to the mtDNA is

listed on the x-axis. A similar approach to detect deletions, using a limited

number of amplicons has been employed successfully by others6. PCR

products from WT fibers amplified in a very similar fashion, indicating the

absence of near homoplasmic deletions (fig. S5D), whereas COX-negative

fibers displayed amplification patterns indicative of two distinct sets of mtDNA

molecules (fig. S5H). One mtDNA molecule was present in high copynumber

(blue), and could only be amplified with a subset of neighbouring amplicons,

demonstrating it is a deleted mtDNA molecule. A second mtDNA molecule was

rare, but could be amplified equally with all primer pairs, demonstrating it is a

full length molecule. This approach thus provides qualitative data on the size

and the location of near homoplasmic mtDNA deletions, and quantifies the

relative ratio of WT vs. deleted mtDNA molecules as well. This allows one to

directly estimate if the threshold at which mtDNA mutations result in COX-

deficiency (approximately >80% mutant vs normal mtDNA) is breached (red

line). Amplicons function as internal controls for their neighbours. In the

example presented in figure 5H, one deleted mtDNA molecule was present

containing only bp4000-6000, which includes the origin of light strand

replication and is in 10-fold excess to WT mtDNA.

Table S1 Primers for mouse mtDNA bp Control forward: TCGGCGTAAAACGTGTCAAC 350-369

Control reverse: CCGCCAAGTCCTTTGAGTTT 579-598 Deletion site 1 forward: AGGCCACCACACTCCTATTG 8810-8829 Deletion site 1 reverse: AATGCTAGGCGTTTGATTGG 13098-13117 Deletion site 2 forward: CCTCCAACAGGAATTTCACC 8955-8974 Deletion site 2 reverse: GGTGAGGATAAGCATGGTAATC 12116-12137 Deletion site 3 forward: ACGAAATCAACAACCCCGTA 7275-7294 Deletion site 3 reverse: AATGCTAGGCGTTTGATTGG 13098-13117 0kb forward: ACTCAAAGGACTTGGCGGTA 581-600 0kb reverse: AGCCCATTTCTTCCCATTTC 768-787 2.5kb forward: GTTGGGGTGACCTCGGAGAA 2249-2268 2.5kb reverse: AACCGACCTGGATTGCTCCG 2520-2539 4kb forward: CCTATCACCCTTGCCATCAT 3920-3939 4kb reverse: GAGGCTGTTGCTTGTGTGAC 4094-4113 5kb forward: CTGAGCGGGAATAGTGGGTA 5399-5418 5kb reverse: TGGGGCTCCGATTATTAGTG 5578-5597 6kb forward: GCCTTTCAGGAATACCACGA 6622-6641 6kb reverse: AGGTTGGTTCCTCGAATGTG 6836-6855 7kb forward: ACGAAATCAACAACCCCGTA 7275-7294 7kb reverse: GGCAGAACGACTCGGTTATC 7427-7446 8kb forward: GCATTAGCAGTCCGGCTTAC 8399-8408 8kb reverse: GGCTGAAAAGGCTCCAGTTA 8659-8678 9kb forward: CCTCCAACAGGAATTTCACC 8955-8974 9kb reverse: AGGATGGTGAAGTAAAGTCC 9114-9133 10kb forward: TAACAGCCTGATTACTGCCA 10369-10388 10kb reverse: TAGGCGTTCAGTTTGGTTCC 10576-10595 12kb forward: AATTACAACCTGGCACTGAGTC 11927-11948 12kb reverse: GGTGAGGATAAGCATGGTAATC 12116-12137

CCGCAGCA | CGGAAGCC 9323 | 12866 0 CTTCGGATTT | TTCTTCAAA 9311 | 12741 0 TTTGTAGACG | GGCCTGATA 9345 | 12681 0 CTTACTCCC | CATCCGAAA 9396 | 12806 0 Table S2 Sequences, locations and homology surrounding the breakpoints of

isolated mtDNA deletions in WT, PolgA+/mut and PolgAmut/mut mice. Breakpoints

are depicted by vertical red lines. Some deletions were associated with

mutations around the breakpoint. If present, these are listed on the far right.

1. Bielas, J.H. & Loeb, L.A. Quantification of random genomic mutations. Nat

Methods 2, 285-90 (2005). 2. Vermulst, M. et al. Mitochondrial point mutations do not limit the natural lifespan

of mice. Nat Genet 39, 540-3 (2007). 3. Copeland. Mitochondrial DNA, methods and protocols. Methods in Molecular

Biology 197(2002). 4. Greaves, L.C. et al. Mitochondrial DNA mutations are established in human

colonic stem cells, and mutated clones expand by crypt fission. Proc Natl Acad Sci U S A 103, 714-9 (2006).

5. Wanagat, J., Cao, Z., Pathare, P. & Aiken, J.M. Mitochondrial DNA deletion mutations colocalize with segmental electron transport system abnormalities, muscle fiber atrophy, fiber splitting, and oxidative damage in sarcopenia. Faseb J 15, 322-32 (2001).

6. Taylor, R.W. et al. Mitochondrial DNA mutations in human colonic crypt stem cells. J Clin Invest 112, 1351-60 (2003).

large dna deletions drive premature aging in mitochondrial ... · large dna deletions drive...

Documents