lacombe express, november 28, 2013
DESCRIPTION
November 28, 2013 edition of the Lacombe ExpressTRANSCRIPT
Gift certifi cates available on-line
5029 50 Avenue, Lacombe, Alberta
403.782.5800www.headhunterssalon.ca
Mon, Wed & Fri: 9-6 • Tue & Thu: 9-9 • Sat: 9-4 • Closed Sun
Full service spa and salonFull service spa and salon
20% discount on all hot tools
15% discount on all products
We are also offering
Spa packagesp p gFREE – OPI mini cream 403 782 55880000
Open till 11 pm Nov. 28
LACOMBE RV403403.782.4544.782.4544
www.lacomberv.comwww.lacomberv.com
See it? Scan it!
DUAL ROLES: Local reservist serves community as a teacher and a soldier – PG 3
CLASSIC SOUNDS: Tenore brings traditional Christmas music to Red Deer concert - PG 15
www.lacombeexpress.com THURSDAY, NOVEMBER 28, 2013
GEARING UP - Brian Forbes hangs a Christmas tree decoration on a light post along 50 Ave. just in time for Lacombe’s Light Up the Night Festival that begins tonight. Brian Vossen/Lacombe Express
HELPING HAND: FCSS is looking for support for its Community Christmas Campaign – PG 6
Festive sights
2 Lacombe Express Thursday, November 28, 2013
COMMERCIAL BAYS FOR RENT4205 - 64 St., Ponoka, AB34’Lx16’W with 16’ high ceiling. Suitable for
Truckers, Farmers, Boaters, Contractors, or Anyone needing Secure, Heated Storage.
Yearly Lease, Rates start at $680 p/mo, plus Gas & Electricity.
Only 5 Available! Call ERNIE at 780-335-6767 for more info.
Speed Zone Changes - December 1Effective December 1, 2013, there will be multiple speed zone changes within the City
of Lacombe. These changes are in an effort to increase driver and pedestrian safety as
vehicle traffic has increased in recent years. Counil has directed City administration to
review the effectiveness of these changes on pedestrian safety after one year.
The following changes have been made:
- HWY 12 between 53rd Street and HWY 2A - Reduced from 50kph to 30kph Monday through Friday, 8 a.m. to 6 p.m. - C&E Trail - Reduced from 60 kph to 50 kph- Brownstone - Raised from 40kph to 50kph - HWY 2A - Extending the 70kph section on the south side
For more information visit www.lacombe.ca or contact:
Matthew Goudy
Infrastructure Services Director
403-782-6666
BY BRIAN VOSSENLacombe Express
During its meeting earlier this week,
Lacombe City council voted to accept La-
combe’s new Municipal Sustainability
Plan as information rather than adopt and
proceed with enacting the plan citing.
The plan, entitled ‘Imagine Lacombe’,
was explained by Planner Jen Kirchner as
a document that “Represents the goals and
visions, as identifi ed by the community, for
Lacombe as objectives to work forward to.”
Kirchner added the plan also outlines
the steps needed to be taken in order to
achieve those objectives.
However, not all councillors were in
agreement with those recommendations
or how they were defi ned in the plan.
Councillor Peter Bouwsema expressed
his concern that some items in the plan
were extremely specifi c and inquired as
to why that was. Kirchner said the plan is
specifi c by choice in order to measure the
success of the plan and clearly defi ne the
steps that need to be taken.
Bouwsema also said that he did not want
to scare developers and builders away by
making too high or too specifi c of demands
on them. He added that, some require-
ments of the plan would not be achievable
in certain areas.
Mayor Steve Christie said that should
the plan make a recommendation that is
not possible in an area, developers would
not be required to meet it. He added this
is already being done in Lacombe, saying
that the City encourages developers to
connect neighbourhoods through walking
trails but does not demand it of them.
Councillor Reuben Konnik said that he
likes the aspirations laid out in the plan
and that he thinks Lacombe should set
high goals for itself.
“Why don’t we shoot for the moon?” said
Konnik.
Councillor Wayne Armishaw, who was
part of the committee that helped make
the plan, said he agreed that the plan was
“Optimistic, utopian and idealistic.” He
added it was a good document but he said
it was in need of amendments as he saw
a disconnect between the demands of the
plan and current policies.
Chief Administrative Offi cer Norma
MacQuarrie said the plan contains high as-
pirations because that is what the adminis-
tration wants for the City of Lacombe.
“We want Lacombe to be everything it
can be. We don’t want to aspire to anything
less than this. If we do, we are failing in
terms of where we want Lacombe to go in
the future.”
Councillor Grant Harder said that,
while he agreed the plan has great goals
Lacombe should aspire to, he was not sure
those goals were achievable the way they
were laid out in the plan.
“It kind of makes me feel like we are set-
ting ourselves up for failure,” said Harder.
Councillor Bill McQuesten was the one
to move that council accept the document
only as information. He said that he too
had misgivings about the plan and more
discussion and work with the document
was needed. “There are things in here that
are just not realistic,” said McQuesten.
Council voted 5-2 in favour of Mc-
Questen’s motion with Konnik and Chris-
tie voting against.
Council puts the brakes on sustainability plan
LIGHT IT UP – From left, Judy Van Haren, Jeff Janz and Shirley Bajema, all with Agricul-ture Financial Services Corporation; Iwa Post, Adam Hamilton and Darcy Stingel with Sunny 94; Maureen MacKenzie with the City; Gord Sim and Brett Philips with Fortis Alberta; Glen Calkins from Tim Hortons; Matt Panelli with Sunny 94; and Guy Lapointe and Kelsey Van-Grinsven with the City, display their sponsorship light signs in support of Lacombe’s Light Up the Night Festival, which begins tonight. Brian Vossen/Lacombe Express
“WE WANT LACOMBE TO BE EVERYTHING IT CAN BE. WE DON’T
WANT TO ASPIRE TO ANYTHINGLESS THAN THIS.”
NORMA MACQUARRIE
Thursday, November 28, 2013 Lacombe Express 3
www.heritagechrysler.comHERITAGE CHRYSLER JEEPHERITAGE CHRYSLER JEEP 4450 - HWY 12E • Lacombe, AB 403.782.2277
ANY IN-STOCKDODGE GRANDCARAVANRECEIVES A
FREEFREETRIP FOR 2 TO
4 to choose from!
*
*Vehicles not exactly as shown. Free trip giveaway while quantities last.No cash value in lieu of trip. See dealer for full details.
4 tochoose from!
S A V E30%BLACKFRIDAY SALE! U-Connect, Climate Group!
Was $31,390
2013 Dodge Grand Caravan#LT451
SAVE$9450
Now $21,940Only
8Left!
BY BRIAN VOSSENLacombe Express
James Gascoyne is leading a double life.
Most days, Gascoyne is a math and
science teacher at Ecole Lacombe Junior
High School and answers to ‘Mr. Gas-
coyne.’
But, there are also those who know him
as Second Lt. James Gascoyne of the 41
Signal Regiment, a military reservist.
Gascoyne said that, if the two worlds
seem completely different from each other,
it’s because they are. In fact, Gascoyne
manages to keep them quite separate.
“If I never mentioned it, probably no
one would know. I don’t accidently come in
wearing a pair of combat boots.”
While Gascoyne does occasionally speak
to his class about his involvement with the
army, he said that he keeps a somewhat
low profi le of his career in the reserves.
He added that his students have trouble
understanding what it means to be soldier
while at the same time being a teacher.
Gascoyne fi rst joined the reserves in the
mid 90s while he was attending university
in Edmonton. He served with the Loyal
Edmonton Regiment for two years before
work and life took him elsewhere.
Other than being part of cadets as a
child, Gascoyne said he hadn’t had much
experience with the military up until that
point. He said that, while he was a fairly
confi dent individual, the reserves were
kind of a brand new world to him.
“Whenever you join an organization,
you are the ‘new guy’. You really feel like
you are the at the lowest rung of the ladder
and you have a ton to learn.”
As such, one needs to have a fair bit of
humility to join the armed forces, said
Gascoyne. He added that he doesn’t think
this differs much from anyone else start-
ing a new career or transferring to a new
job site.
When Gascoyne joined the military mo-
rale was quite low, he said. He added that,
to him, it seemed as though the soldiers,
who were on peacekeeping missions had
lost a sense of purpose.
When Gascoyne settled down in Central
Alberta some years later and had the op-
portunity to join the reserves again, he
signed up with the 41 Signal Regiment. He
said that at that time, the army was “Up to
its elbows in Afghanistan” and the culture.
“Mission has a way of galvanizing pur-
pose,” said Gascoyne. He added that for
soldiers who aren’t trained for peacekeep-
ing and having a new mission, the war in
Afghanistan had returned that sense of
purpose to the army.
Gascoyne said he, as well as most of the
reservists he has worked with, enjoys serv-
ing others. He said that desire to be part of
something bigger than himself is what led
him to join the reserves in the fi rst place.
Leadership is another aspect of the
armed forces that attracted Gascoyne. He
added that everyone within the reserves is
expected to take some kind of leadership
role and all reservists have to take leader-
ship courses in order to move up the ranks
as well.
Gascoyne’s desire to serve and be part
of something bigger than himself is some-
thing he has carried with him all his life. It
is what fi rst led him to join the reserves and
today has him volunteering in other facets
as well. In addition to serving through the
reserves, Gascoyne also serves his com-
munity on a number of other levels. He is
chair of the St. Stephen’s Parish Council
and vice-president for the local Alberta
Teacher’s Association (ATA) and sits on
the economic policy committee.
Even Gascoyne’s decision to pursue a
teaching career came out of that desire. He
added that when making such decisions he
has always thought about how service to
his community will fi t into it.
Gascoyne said that organization and
knowing one’s limits are important parts
of working with the reserves or volunteer-
ing with any organization. Otherwise, you
will reach a point where you are spread too
thin and not fulfi lling any obligations. He
added that even with those skills, it is dif-
fi cult to maintain a balanced workload.
“I am spread pretty thin, too thin prob-
ably, some times of the year.”
Gascoyne serves community as teacher and soldierLocal reservist’s experiences also encourages greater volunteer involvement
ON DUTY - Second Lt. James Gascoyne, front right, poses for a ‘hero’ shot with his fellow soldiers during a navigation exercise in New Brunswick several years ago. photo submitted
4 Lacombe Express Thursday, November 28, 2013
DELUXE 2 BR SUITES FOR RENT4205 - 64 St., Ponoka, AB
Includes: Fridge, Stove, Fireplace, Air Conditioning, Window Coverings, Oak Cabinetry with Corian Countertops, Balcony,
High Security Card Locks, All Utilities except Telephone.
Quiet Adult Complex, Age 40+, No Pets, Rent Starts at $1380 P/M. Call ERNIE at 780-335-6767
Win Great Prizes with the MDP Scavenger Hunt on NOW!Hey Lacombe! Are you participating in the great MDP Scavenger Hunt of 2013?
If not, why not? You have an opportunity to win an Annual Family Pool Pass or
some great City of Lacombe merchandise!
Each week we’ve posted a clue in our MDP Update advertisements in the Lacombe
Express. Our last clue will be in the December 5 paper. Compile your clues and submit
them by 1PM on December 9th at City Hall to be entered, or send us an email with your
entry to: [email protected].
Please provide your name, age, address and contact number along with your entry.
If you are late to the Scavenger Hunt, don’t despair. Our facebook page: Growing Lacombe, has all of the clues posted and so does our
website: www.lacombe.ca/planning-whats-new and click on the MDP Update page.
And if you aren’t online, drop into our offices at City Hall, or call us at 403 782 1264 and
we can help get you searching across our great city for clues!
BY ERIN FAWCETTLacombe Express
Families living in Cen-
tral Alberta will have bet-
ter access to cancer care
closer to home with the
opening of the new Central
Alberta Cancer Centre.
The new facility, which
was offi cially opened last
week, ensures fewer people
will need to travel to Ed-
monton or Calgary to ac-
cess cancer services and
treatment. It will also help
ease pressure on cancer
facilities in Edmonton and
Calgary, allowing more pa-
tients to get the care they
need more quickly.
The centre is expected
to see more than 15,000 pa-
tient visits in its fi rst year
and the new radiation
therapy facilities will treat
more than 600 cases annu-
ally. The Central Alberta
Cancer Centre is part of Al-
berta’s north south ‘radia-
tion corridor’. Once com-
pleted, the corridor will
mean 92% of patients will
be able to access radiation
treatment within 100 kms
of their homes.
The facility replaces the
existing centre in Red Deer
and is adjoined to the Red
Deer Hospital. The centre
will offer four times the
clinical space and will in-
clude all cancer services
moved from the existing
facility, two linear accel-
erators that will provide
external-beam radiation to
about 600 patients a year.
This therapy may be used
before surgery to shrink
the tumor or after surgery
to destroy any remaining
cancer cells.
In addition, a third radia-
tion vault has been built to
allow for future expansion
of services, and there will
also be additional treat-
ment and examination
rooms, outpatient clinics,
a medical day unit with
treatment areas (beds and
chairs) for chemotherapy
or other treatments and
procedures and in-house
pharmacy services, includ-
ing a satellite pharmacy
for the storage, prepara-
tion and dispensing of can-
cer medication, as well as
education, counseling and
other social support servic-
es for cancer patients and
families.
Kim Rideout, a cancer
survivor from the City,
said having a facility such
as this one close to home
will help take the stress off
families.
“I had to travel from my
home in Red Deer to Cal-
gary to receive radiation
treatments. I wasn’t used
to the traffi c of the big city,
and had to drive on snowy
highways. The commute
placed additional stress on
an already stressful situ-
ation for both me and my
family,” said Rideout, who
was diagnosed with breast
cancer in 2012. “I made a
total of 18 trips to Calgary
during my radiation treat-
ments. We traveled more
than 5,500 kilometres in
18 days. I had just fi nished
chemotherapy and I was
sicker than I ever had been
in my life. But I didn’t have
an option of going because
my life depended on it.
“This new centre in Red
Deer will mean more peo-
ple can be treated closer to
home rather than having to
travel long distances when
they’re feeling unwell from
treatments. I’m thrilled this
centre is completed and I
know fi rsthand that every-
one who has the unfortu-
nate need in the future will
benefi t more than anyone
outside the cancer commu-
nity can ever understand.”
Premier Alison Redford
was also onhand during the
grand opening event in Red
Deer. “We want to make
sure that anyone who is
diagnosed with cancer gets
the supports and treatment
they need to heal. This cen-
tre will house cutting-edge
technology and give pa-
tients earlier diagnosis and
treatment closer to home.
We’re going to keep fi ghting
cancer, together,” she said.
“The statistics are hard to
talk about but over half the
people in Alberta at some
point in their life will be
diagnosed with some form
of cancer and it is one of
the fastest growing health
issues we need to deal with
and have had to deal with
in this province.
“This facility supports
families and people across
Central Alberta.”
Fred Horne, minister
of health, added the new
facility is more than just
a building. “Every day, 42
Albertans learn they have
cancer. By 2030, we expect
that to grow to 73 new can-
cer cases a day. This new
centre is about more than
bricks and mortar, it’s
about ensuring these peo-
ple, and their families, who
are going through what
might be the most stressful
time of their lives are sup-
ported.”
Meanwhile, Rideout add-
ed she is grateful the facil-
ity is open. “For someone
who has been there, thank
you from the bottom of my
heart to everyone who had
anything to do with this
building being built. It’s 10
times bigger than anyone
can ever imagine.”
“THIS CENTRE WILL HOUSE CUTTING-EDGE TECHNOLOGY AND GIVE PATIENTS EARLIER DIAGNOSIS AND TREATMENT CLOSER TO HOME. WE’RE GOING TO
KEEP FIGHTING CANCER, TOGETHER.”
PREMIER ALISON REDFORD
New cancer centre opens in Red DeerFacility means Central Alberta patients can be treated closer to home
Thursday, November 28, 2013 Lacombe Express 5
Election Refl ections:
Grant Creasey
I feel it is important in an election to thank supporters publicly. With that in mind, I want to sincerely acknowledge the volunteers and contributors in my bid for Mayor of Lacombe. Additionally a big thank you goes to all the people who voted for me and positive change. Without strong voter support, a true democratic election cannot occur.
I ask those voters who feel disappointed not to be discouraged with their City and its politics. Citizen involvement is critical to en-sure that the council is responsive to the needs of the City while minding the wallets of the voters. I will continue to maintain my interest in the overall well-being of our City. Some critical areas include nancial responsibility of the Council and the Administra-tion and furthering an improvement in attitude towards our business community w ith corresponding actions that prove these positive changes are underway.
As a way of assisting in maintaining our City’s strength and vigor, I amapplying to volunteer with the Lacombe Police Commission. I will continue my other volunteer work as well. This includes my long standing support of the community’s youth.
The Lacombe Mayoral Election 2013 was a close one. With less than one percent separating the candidates, I believe my message was a strong one and indeed heard by many voters.
I remain steadfast in my commitment to the people of Lacombe who make our City enviable and unique. When the next election arrives, I will be here, and I will be prepared. Thank You!
Saturday, November 30, 201310:00am – 4:00 pm
Lacombe Memorial Center(50 Avenue & 52 Street)
Crafter Faire & Home BasedBusiness Faire, Numerous
Christmas Shopping Gifts available, many new as well as returning
vendors this year.
Event Admission: Food or Moneydonation to the Local Food Bank
Event Contact Number: 403-782-4323
BY BRIAN VOSSENLacombe Express
Blackfalds is one step closer to new park
and recreational amenities.
Recently, Blackfalds Town council ad-
opted three new concept plans from RC
Strategies for two new parks and an im-
provement to Blackfalds’ existing camp-
ground.
Sean Barnes, director of community
services for the Town of Blackfalds, said
it will take both time and money to imple-
ment the plans and build the parks. He
added that at this time, the Town does not
have a timeline for completion of the proj-
ects.
“We just know we have to get it done.”
Barnes said that the campground was
and is a high priority for the Town as uti-
lization continues to increase. Ball tourna-
ments, events which make for the most fre-
quent use of the campground, continue to
increase both in number and size in Black-
falds each summer.
Barnes said that about 18 ball tourna-
ments are held each summer, some with
more than 70 teams.
“It’s getting hard to accommodate these
guys.”
As such, the Town is already working
on putting some fencing around the camp-
ground and also installing a full service
dump station.
Another phase of the plan will have
camping stalls organized within the camp-
ground, which is right now just an open
fi eld, said Barnes. He added that, at this
time, the Town is not looking at expand-
ing the campground, instead hoping that
better organization of the campground
will lead to there being more room for
campers. Having said that, Barnes added
that the Town will consider expanding the
campground when and if more room is
still needed
Another higher priority in the concept
plan was putting a park in the Pine Cres-
cent neighbourhood. Barnes said this was
deemed a priority as the Town had made
a previous commitment to place a park in
that area.
“Pine Crescent has been pretty patient,”
he said. “Now we have to deliver.”
Work has already begun with installing
trails and a playground at the Pine Cres-
cent park.
Perhaps the lowest priority in the new
concept plan is the BMX park. Barnes said
that, as Blackfalds already has a skate-
board park (albeit an aging one) still has
some usability for BMX riders.
However, plans for the park have already
been shared with the Optimist Club, who
are partnering with the Town to fund the
BMX park, who are beginning their fund-
raising efforts for the facility.
When completed, the BMX park will fea-
ture a large concrete bowl as well as sev-
eral other features useable by both skate-
boarders and BMX riders. Also included in
the park will be a BMX track where Barnes
said the Town hopes to be able to host rac-
es and other such events.
“This will be quite the facility, not only
for Blackfalds but for Central Alberta,”
said Barnes.
The need for all three of these parks was
established through the 2008 facility parks
needs assessment, the same assessment
that led to the creation of the Abbey Cen-
tre.
Barnes said adopting the park concept
plan is just another step in following the
larger master plan.
Blackfalds council adopts new concept plansNeed was identifi ed through the 2008 facility parks assessment
Neighbourhood Places merging with FCSSBlackfalds Neighbourhood Place
Society is dissolving as a non-profi t
society and will be transferring their
fi nancial and human resources to Fam-
ily and Community Support Services
to continue to ensure the needs of the
community are met.
“This is a bittersweet proposal,” said
Deputy Mayor Richard Poole.
“I was the fi rst council member that
was assigned to the Blackfalds Neigh-
bourhood Place when it came to town.
The excitement and good work that
they’ve done over their existence has
been phenomenal.”
As both services currently share a
facility at 5016 Waghorn St., the merger
will not change the location of where
services can be accessed by the public.
FCSS offi ce hours are Monday through
Friday 8:30 a.m. – 4:30 p.m.
“I think this will be a very effi cient
use of our wonderful space,” said Sue
Bornn, FCSS manager. “It really falls
hand in hand with what FCSS is doing.
To see that Blackfalds Neighbourhood
Place has full confi dence in our abili-
ties and our support is very encourag-
ing.”
The current Community Building
Initiative funding contract between
Blackfalds Neighbourhood Place and
the Children and Family Services Au-
thority (CFSA) will be closed and a new
contract between the Blackfalds FCSS
and CFSA will be signed.
“The demand for social services
keeps increasing,” said Mayor Melodie
Stol.
“So this merger is about how we
can stretch the dollars to better capac-
ity and maintain a much needed pro-
gram.”
- Vossen
6 Lacombe Express Thursday, November 28, 2013
BY BRIAN VOSSENLacombe Express
‘Tis the season to sup-
port the community.
As Christmas draws
closer, it’s time for the La-
combe and District Fam-
ily and Community Sup-
port Services Community
Christmas Campaign.
The Community Christ-
mas Campaign consists
of three FCSS programs;
New Coats for Kids, San-
ta’s Anonymous and the
Christmas Food Certifi cate
Fund.
Jan Pocock, volunteer
and community services
coordinator for FCSS, said
that the campaign is only
possible through the sup-
port of the community.
“All of this is based on
the generosity of our amaz-
ing community.”
New Coats for Kids is a
program through which
eligible families can obtain
funds to purchase new win-
ter wear for their children.
Families apply based on in-
come, number of children
and ages of those children
for funding and then de-
cide which items of winter
clothing they want to spend
the money on.
Santa’s Anonymous is
a program done jointly
with the Lacombe Kins-
men. Kinsmen collect the
toys and monetary dona-
tions and then organize
toys based on the age, gen-
der and wishes of eligible
children, put together the
best matches for that list
and then have the toys de-
livered to their homes by
Santa.
The Christmas Food Cer-
tifi cates Fund allows eligi-
ble families to acquire gift
certifi cates that allow them
to buy the food of their
choice for the Christmas
season from local grocery
stores.
“We want to empower
our clients,” said Pocock.
“Everybody has the right
to choose what works for
their family in their home.”
Last year, 18 families
received new winter wear
from New Coats for Kids,
85 families received Christ-
mas gifts from Santa’s
Anonymous and 496 clients
benefi ted from the Christ-
mas Food Certifi cates
Fund.
Pocock said that the goal
is to for everyone, regard-
less of social status or fi -
nancial standing, to have a
happy holiday.
“We want everybody to
enjoy the Christmas sea-
son.” Pocock added that
Christmas is the time of
year where FCSS clients
depend more on their pro-
grams. As such, FCSS de-
pends more on the commu-
nity for support.
Thankfully, it’s also
something Pocock said
is far from lacking in La-
combe. She said the com-
munity has always sup-
ported the campaign and
truly understands its im-
portance. “We have great
hearts and we understand
that everyone has the right
to enjoy this season regard-
less of the situation and
everyone wants to help out
their neighbour, period. It
blows my mind every year,
the generosity.”
Donations for any of
these programs can be
made at the FCSS offi ce
in the Lacombe Memorial
Centre.
For Santa’s Anonymous,
there are also bins for toy
donations set up around
the City. Pocock said that
both monetary and toy
donations are accepted.
She added that donations
for teen and pre-teen gifts
are particularly needed as
these age groups are the
most diffi cult to buy for
and are often overlooked in
such Christmas gift cam-
paigns.
“All children deserve to
have a wonderful present
under the tree.”
In addition to encourag-
ing those who can to make
a donation to FCSS’s Com-
munity Christmas Cam-
paign, Pocock also encour-
aged anyone needing a
little bit of help this season
to visit the FCSS offi ce.
FCSS seeks support for Community Christmas CampaignThere are three components to annual fundraising and collecting efforts
Imagine Lacombe: A roadmap to 2040 and beyond Are you interested in helping shape the Lacombe of tomorrow? If so, you are cordially invited to attend a FREE workshop for implementing Lacombe’s Municipal Sustainability Plan, Imagine Lacombe. The MSP was developed by the citizens of Lacombe and will guide how Lacombe grows and operates for the next 40 years.
The MSP is to be used by the City of Lacombe, residents, businesses, schools and organizations within Lacombe to help shape their futures. The FREE workshop will provide an opportunity for citizens to learn about and engage in a discussion about the MSP, and provide ideas for what they can do to make more sustainable choices in their lives.
Date: Wednesday, December 4, 2013Time: 10am to 1:00 pm (lunch will be provided)Location: Lacombe Memorial Centre – County Room.RSVP: Limited space is available so please RSVP to
Jennifer Kirchner no later than Monday, December 2.
Jen Kirchner Planner City of Lacombe 403-782-1264 [email protected] 5432 56th Ave, Lacombe
CANCELLED
THE FOOT INSTITUTEis pleased to offer
the services of
Dr. Mike Motyer, DPMFoot Specialist for the
Medical & Surgical Treatmentof the Foot and Ankle.
Specializing in ConservativeTherapy, Biomechanics,
& Foot Surgery
102
40
7D
7
Dr. Mike Motyer,DPM
EXPANDED HOURS
For appointment call
(403) 342-0566www.footinstitute.com
Dr.Motyerwill see patients at:
Red Deer Associate Clinic4705 - 48 Ave. Red Deer
Dr. Motyerwill see patients at:
Medcombe Walk-in Clinic4956 Highway 2A Lacombe
For appointment call
403-342-0566www.footinstitute.com
NOW OPENOPENING SOONNOW OPENNOW OPEN
Lacombe Christmas Marketevery Friday
WARM WINTER WEAR - Jan Pocock displays some of the new winter gear ordered through this year’s New Coats for Kids campaign. Brian Vossen/Lacombe Express
Thursday, November 28, 2013 Lacombe Express 7
It would be great if the media
and health researchers would quit
trying to create panic every time a
new disease is discovered.
Earlier this year, researchers in
Taiwan discovered a new strain of
bird fl u in a 20-year-old woman.
It was determined that the wom-
an had contracted H6N1 - a strain
of bird fl u that previously was
thought to be unable to cross over
from animals to humans.
The woman was treated, recov-
ered and no further cases of H6N1
have been detected. But, research-
ers say we should be prepared for
a pandemic.
That’s right. One woman got
sick, got better and we should be
prepared for the worst.
Is anyone else sick and tired (pun
intended) of hearing this every
time a new disease is discovered?
We see something we haven’t seen
before and already we have to as-
sume it is going to infect the entire
globe?
As if that isn’t bad enough, re-
searchers elsewhere are saying
that this might not actually be
the fi rst human case of H6N1, it
might just be the fi rst case we have
caught.
Professor Wendy Barclay with
the Imperial College in London has
stated that she expects to see far
more of these cases to be reported
in the next few years as more hos-
pitals become better equipped to
identify bird fl us.
Really?
It’s not enough for us to overreact
about the discovery of a new dis-
ease, we have to be worried about
all the cases that have already hap-
pened but we didn’t know about be-
cause our technology wasn’t good
enough? It’s preposterous.
Bird fl u isn’t even a pandemic.
H5N1, the strain of the virus
most commonly identifi ed as ‘bird
fl u’ has barely made it out of Asia,
and no cases have ever been re-
corded outside of the eastern hemi-
sphere of the planet, according to
WHO.
Yet, we have been hearing about
its potential to become a pandemic
since the mid 90s.
At the young age of 24, I have al-
ready lived through at least three
pandemics as well as numerous
epidemics and potential instances
of both.
I’m too young to remember the
Russian Flu pandemic that oc-
curred when I was an infant, but
I remember SARS and swine fl u,
not to mention West Nile and Mad
Cow. All were diseases that gener-
ated a lot of hype for their deadly
potential, so much so that many
people, including some members
of my family, began thinking that
it would be enough to wipe us off
the planet or at the very least have
signifi cant impact on the world’s
population.
However, none did.
The human race suffered no
long-lasting consequences and
still goes on much as it always has.
Swine fl u, the most recent pandem-
ic to effect us, killed 18,000 people.
That pales in comparison to the 100
million who were killed in the 1918
pandemic of the Spanish fl u, and
quite obviously, humanity recov-
ered just fi ne from that one too.
I have to admit the media has a
fairly large role in spreading this
panic. The blow-by-blow reports
of these diseases create the feel-
ing that everyone and their dog is
infected with a highly contagious
and potentially deadly disease.
However, that’s not the case.
For example, not only did I not
contract any of the pandemic dis-
eases I have lived through, I don’t
know anybody that did either. I’m
not saying the numbers are lying
and the diseases weren’t wide-
spread, I’m saying widespread in-
fection doesn’t mean the majority
of the planet has the disease and
there is only a small group of peo-
ple who are uninfected.
It is also worthwhile to under-
stand the defi nition of pandemic.
Pandemic simply means a dis-
ease that has spread throughout
the globe, not something that we
should be afraid of. But, you don’t
see that defi nition pop up in a lot
media coverage on pandemics.
Oh, by the way, SARS is coming
back. It has cropped up in Saudi
Arabia where a camel was diag-
nosed with the disease and bats
carrying it have been discovered
by researchers in China. So, better
prepare for the apocalypse.
Lacombe needs more homes.
At its regular meeting on Nov.
25, Lacombe City council heard a
presentation from Anna Bubel of
Another Way Consulting regard-
ing the fi ndings of its recent hous-
ing needs assessment.
In her presentation, Bubel told
councillors that not only is La-
combe lacking availability and di-
versity in its housing market, what
exists is often unaffordable.
Most Lacombians, particularly
those who are renting or have re-
cently moved to the community,
could tell you without a study that
Lacombe’s housing market is very
competitive and the City is in need
of more housing options.
However, it is still important to
have studies like these to give the
City a clearer picture of how much
housing is needed to solve the prob-
lem, where it is needed and what
kinds of housing options should be
implemented.
Also, as Bubel said in her presen-
tation, the facts don’t always line
up with the assumptions we have
in our minds.
During (and since) the recent
municipal election, we have heard
a lot about Lacombe’s need for
commercial growth. Indeed, our
community is in dire need of more
businesses of all kinds.
That said, it is vital to remem-
ber the importance of continuing
Lacombe’s residential growth and
with that, how the two are con-
nected.
If the City is successful in stim-
ulating commercial growth and
encouraging more businesses to
come to Lacombe, the people who
work for those businesses are go-
ing to need places to live. If people
refrain from working in Lacombe’s
businesses because they can’t fi nd
anyplace to live, how exactly are
those businesses going to stay suc-
cessful?
While Lacombe is facing prob-
lems attracting people to live here,
neighbouring communities such
as Sylvan Lake and Blackfalds are
experiencing explosive growth. La-
combe’s situation is different from
these neighbouring communities
for a number of reasons; Lacombe’s
vacant services lots are expensive
to develop and nearby unserviced
land that may be suitable for devel-
opment are not owned by the City.
Regardless of the cause, this is a
key problem that Lacombe’s new
City council must fi nd a solution
to.
As many candidates alluded to
during the election, Lacombe could
get left behind by its neighbours in
terms of growth unless something
is done soon.
Council heard a few recommen-
dations on how to fi nd that solu-
tion, such as seeking further com-
munity input from stakeholders
like realtors, builders, developers
and landlords. How they will use
that information to achieve some
tangible results remains to be seen.
It is clear something needs to be
done though. Otherwise, things
will only get worse.
The word ‘pandemic’ should not mean panic
OPINION
Copyright. No material - news, photographs or
advertising - may be reproduced without the express written consent
of the Publisher. Failure to obtain such consent
may result in legal action without further notice.
5019A - 51 StLacombe, AB
T4L 2A3Main phone:
403-782-5303Fax:
403-782-5344
The Lacombe Express is a proud newspaper of
EditorBrian Vossen
PublisherTracey Scheveers
Customer ServiceTanya Kenyon
SalesKarina Folden
City needs more housing
BRIAN
V O S S E N
8 Lacombe Express Thursday, November 28, 2013
fyifyi Your weekly Community Events Calendar
These events brought to you by:LACOMBE
EVENTSThe Elnora Christmas Market at
the Elnora Community Hall runs Dec. 7 from 11 a.m. to 4 p.m. Lunch will be served all day. An item for the food bank would be appreciated. For more informa-tion call 403-773-2270. New Year’s Eve Party at the Elnora Drop In Centre, supper at 6:30 p.m. Dance at 8 p.m. to Black Velvet. Tickets: advance – $12; door – $15. Call 403-749-2161.
Festival of Wreaths - this third annual event allows you to bid for the kids! Through to Dec. 18th, bid on amazing wreaths to help local programs through Big Brothers Big Sisters. Online Bidding. The event runs Dec. 2 between 5-10 p.m. at the Lacombe Memorial Centre.
The Jim Hurley Family Skate runs Dec. 8 from 6:15 to 8:30 p.m. in the Blackfalds multiplex. No picks or sticks. We hope you enjoy the skating season!
Lacombe Christmas Farmers Markets will be held every Friday morning from 9 a.m. to 1 p.m. through to Dec. 13 at the Lacombe Memorial Cen-tre. There is also a Moonlight Madness sale on Nov. 28 from 5 to 10 p.m. Huge variety of baking, crafts, honey, perogies, woodwork, jams, veggies, meats, clothing, and more. Call 403-782-4772 for more information.
Lacombe Dance Lessons - social and choreographed ballroom dancing. Traditional Two-step or Cha Cha/Jive. For details phone Cliff at 403-782-4094.
Real Men Sing Barbershop! The Wild Rose Harmonizers Bar-bershop Chorus is a chorus for males of all ages who love to sing four-part a cappella har-mony. We are a proud member of the Barbershop Harmony society providing entertainment at seniors’ lodges, hospitals and numerous community and private functions throughout the year. No experience is required, just a love to sing. Join us on Tuesday evening, rehearsals from 7 to 9:30 p.m. at Davenport Church of Christ (#68 Donlevy Ave.) For informa-
tion, call David at 403-342-1318 or email [email protected]. Visit www.harmonizers.ca.
The Red Deer Legion Pipe Band is actively recruiting experienced and inexperienced people from the Central Alberta area, who are interested in joining the Band. Anyone with piping or drumming experience, or if you would like to learn piping or drumming, are asked to please contact us at 403-782-7183 or by email at [email protected]. Prac-tices are held at the Red Deer Legion on Tuesdays at 7 p.m.
The Lacombe Legion has bingo on Mondays at 7 p.m. in the
upstairs hall. Coffee time runs Wednesdays from 9:30-11 a.m. ($2 for coffee, tea and cook-ies). On Fridays, there are four meat draws and tickets are $2/set of three tickets. Draw starts at 6:30 p.m. On Saturdays, there are four meat draws which start at 4:30 p.m. Chase the ace starts after meat draws.
New to Lacombe? Contact La-combe Welcome Wagon at 403-348-9567 for free maps, information about the City & area, as well as free gifts from local businesses. New baby in the family? Contact Lacombe Welcome Wagon at 403-348-9567 for free information, baby product samples as well as free gifts from local businesses.
Youth Unlimited Drop-in Activites - every Tuesday and Thursday, for ages 12 and up. Movies, crafts, games, and more! It costs $2/night or $50/season (June-September). Last Thursday of the month is girls only. Hours are 6 to 9 p.m. and activities run at the YU-Turn Youth Centre.
Drop in Pool Tournament run every Saturday from 1 to 2 p.m. at the Lacombe Hotel.
Circle of Friends - free weekly supper for the community, nutritious meals for anyone interested. It runs at Bethel Christian Reformed Church.
Taoist Tai Chi - a relaxing, low im-pact exercise; continuing classes year round, for those who have completed beginners or have learned Taoist Tai Chi before. Participate in classes of your choice. Available in Red Deer, Lacombe, Rocky Mountain House, and Innisfail. Contact 403-346-6772 for more information.
Coffee Time at the Lacombe Legion runs every Wednesday morn-ing. Come join us for coffee. $2. Gatherings run from 9:30-11:30 a.m. at the Lacombe Legion.
Old-time dances run at the Red Deer Legion every Wednes-day evening. Smorg at 5 p.m. with dance at 7:30 p.m. Cover charge $6. Country music runs Friday and Saturday evenings 7 to 11 p.m. 403-342-0035.
The Lord of the Rings: Exploring the Hidden Meanings of Tolkien’s fi c-tion - Many people consider The Lord of the Rings to be the great-est work of fi ction in the 20th century. But beyond a great ad-venture story, the work explores themes of power, ethics, faith and the good life. A series exploring these themes of J.R.R. Tolkien’s fi ction will be held at St. Andrew’s United Church at 7 p.m. on Sun-day evenings. Everyone interest-ed in the intersection of theology and popular culture is welcome to participate. For more informa-tion or to register, contact Rev. Ross Smillie at 403-782-3148.
MEETINGS
The Lacombe Hospital Auxil-iary meets the fi rst Thursday of every month at 1:30 p.m. in the Education Room at the hospital. New members wel-come. For more information, call Rilla at 403-782-6165.
Imperial Daughters of the Em-pire is a non-profi t women’s volunteer program that raises money in support of numerous initiatives supporting educa-tions. Meetings are held on the fourth Tuesday of every month and begin at 7:30 p.m. at St. Andrew’s United Church. For more information, contact Mary
Lou Wilson 403-782-3923.
W.H.O.L.E. - Widows Helping Others Live Earnestly. W.H.O.L.E. can help you adjust to your loss, to channel your grief into help-ing others who are struggling with loss, and to help you gain perspective as a person who has a new role to be fulfi lled. It’s about widow to widow interaction and socialization. It’s about being able to express with like-minded women the pain and confusion that comes with loss, as well as the encouragement and friend-ship to help you once again live a life fi lled with meaning and purpose...an earnest life. There are no councillors present, only a facilitator to help keep conversations moving. W.H.O.L.E meets monthly and is open to widows of all ages. Space is limited, so please phone to book a spot. Refreshments will be served. Call 403-550-4508.
Lacombe Art Guild - the guild meets regularly on the second and third Tuesday of each month. A variety of workshops are provided for
developing artists. Member-ship is $15 per year. Contact Betty Peers at 403-782-9968 or blog lacombeartclubword-press.com. Meetings runs in LMC Credit Union Room at 5214 50 Ave. in Lacombe.
Are you having problems with someone else’s drinking? We are an anonymous group of men and women who can offer encouragement and support. Call Al-Anon Family groups at 403-346-0320 for a list of meetings in Red Deer and the surrounding area.
Writers’ Ink, The Red Deer & Dis-trict Writers Club has weekly meetings (every Tuesday) in the old farmhouse at Sunny-brook Farm (4701 30 St.) from 7 to 9 p.m. We meet, share our writing, and offer constructive criticism to one another. We also do our utmost to improve our craft by Skyping profes-sionals in the fi eld of writing, by inviting guest speakers to our Spring Workshop and to the occasional meeting. Our professional library is in-creasing as is our knowledge gained from members who are constantly seeking new challenges and sharing suc-cesses and failures with the group. Guests are welcome!
Food Addicts in Recovery Anony-mous is a 12-step support group offering a solution for all forms of food addiction. No dues, fees or weigh-in. Central Alberta groups meet in Red Deer, Lacombe and Rimbey. For locations and dates, call Joanne at 403-314-1972.
The Parkinson’s Society Edu-cation and Support Group runs the third Wednesday of each month at 1:30 p.m. in the Davenport Church of Christ. 403-346-4463.
An Amputee Support Group Meet-ing, sponsored by the Alberta Amputee Sport and Recreation Association at 7:30 in Room 2207 in the South Complex of the Red Deer Regional Hospital. Meetings the fourth Monday of each month. 403-357-3671.
Addict in the Family Support Group is a confi dential, profession-ally-facilitated support group. Meetings run every second Thursday at 4920 – 54 St. from 6 to 8 p.m. 403-342-0895.
MEETINGS
Stationery Supplies Computer RepairsTELUS Mobility AgentsNOVEMBER 29
- DECEMBER 2Ask about our “Money Back”
5 Year Extended ServicePlan on TV & Audio We are Licenced Dealers & Installers for
XPLORNET, SHAW DIRECT & Bell TV
BER
SHARPLC60847OU
60” LED SMART TVreg $3499.99
SALE $1849.99
CANON Mx452 PRINTER
Print, Scan, Copy, Fax, wireless Printer
reg $99.99
SALE $49.99
tionery Supplies Co
ACOUSTIC GUITARS
TV STANDS & WALL MOUNTS
Up to 50 % off
Up to 30 % offAC
YAMAHA YHTB4750HTIB System w/ HDMI, Air-
play, 5 channel speaker pack-age and 8” 100W powered subwoofer, A/V Receiver
reg $999.99
SALE $769.99
S
SAMSUNGPN43F4500
43” PLASMAS H.D TVreg $539.99
SALE $418.99
PANASONICDMPBDT230
BLU-RAY Playerreg $149.99
SALE $109.99
PANASONIC TCP65S60
65” PLASMA SMART TVReg $1999.99
SALE $1698SALE $1698 .99 .99
CANON MG2220 PRINTER
Print, Scan, Copy
Reg $79.99SALE $39SALE $39 .99 .99
PANASONIC DMPBD89
BLU-RAY PlayerReg $99.99
SALE $79SALE $79 .99 .99
HARMON KARDON AVR1710
7.2 Channel, 100W per Channel Network A/V Receiver
Reg $629.99 SALE $529SALE $529 .99 .99
OUTDOOR EXTENSION CORDS
15’ TO 50’
$6$6.99.99 TOTO $16 $16.99.99
GALAXY ELECTRIC FIREPLACE
1500-WATTS w/- realis c log e ect
Reg $199.99 SALE $129SALE $129 .99 .99
LACOMBELacombe Centre Mall 403-782-9440
MANY MORE IN-STORE SPECIALS
CYBER MONDAY SALE
Thursday, November 28, 2013 Lacombe Express 9
BY BRIAN VOSSENLacombe Express
Everyone should have
access to information and
it should be made as easily
accessible as possible.
To help achieve that goal,
the Parkland Regional Li-
brary recently Launched
Zinio, the world largest
electronic newsstand, free
for all cardholders in the
Regional Library System.
Meredith Bratland, com-
munications coordinator
for Parkland Regional Li-
brary, said that making
these resources available
online in this format in-
creases the availability of
those resources and there-
by increases the usage of
them.
“That’s what the library
is based off of, that every-
body should have access to
discover and learn and cre-
ate,” said Bratland.
She added that this new
service is in line with a
growing trend of libraries
to go digital.
“The library is moving
digital all the time,” said
Bratland. “Computers and
technology are a big part of
our service.”
Bratland said that there
are a number of library
patrons who want access to
periodicals but don’t want
to come to the library to
get them. She added that
not everyone can afford a
subscription to each of the
magazines they might like
to read.
In the past, the Parkland
Regional Library could pro-
vide magazines to patrons
through other patrons do-
nating old magazines or
new magazine subscrip-
tions, said Bratland.
With the Zinio online ser-
vice, patrons will eventual-
ly be able to do this digital-
ly by buying subscriptions
to add to the catalogue of
free magazines available to
library patrons, Bratland
added.
Through Zinio, library
members will have access
to over 100 ezines, maga-
zines accessible through
computer, smartphone,
tablet, or other such elec-
tronic device.
These ezines are like en-
hanced PDF versions of the
hard copy magazines, said
Bratland.
Users can fl ip through
the magazine on their de-
vice and in some cases
there are even additional
interactive features that
come with the digital ver-
sion.
Having a digital ver-
sion of the magazine on an
electronic device also al-
lows users to change font
size, zoom into photos and
where available even listen
to audio recordings of the
magazine being read.
Some of the titles avail-
able through Zinio include
National Geographic, Roll-
ing Stone, Canadian Liv-
ing, Car & Driver and Out-
door Canada.
Users also have the op-
tion of subscribing to the
magazine digitally or sim-
ply downloading a single
issue.
If desired, patrons can
even use some of their own
pocket money to purchase a
title that is not freely avail-
able through the library’s
Zinio service. Unlike eb-
ooks, magazines download-
ed to an electronic device
will remain on that device
until they are removed by
the user.
They will not become
corrupt and unreadable af-
ter a loan period like ebook
loans can.
In order to download
ezines through Zinio, li-
brary system cardholders
need to have a Zinio ac-
count. This account is free
through Parkland Regional
Library but users will still
need to set up their own
the fi rst time they go to
download a title. For more
information on setting up a
Parkland Library Zinio ac-
count, visit www.prl.ab.ca/
zinio.
Library increases accessibility with ‘Zinio ezine’ service
Share your Thoughts:What are some of your favourite recreational or cultural activities in Lacombe? Let us know!
For more details on the MDP Update, the Scavenger Hunt or the growth and development of Lacombe, visit Facebook at “City of Lacombe MDP Update,” or contact us at 403 782 1264.
Scavenger Hunt Clue #5
The City just installed eight new pieces of fitness equipment at several locations along Cranna Lake. The equipment is spread along the trail and is designed to encourage residents to go out and be active. This week go out, be active, and get a photo of you on one of the new pieces of exercise equipment at Cranna Lake and you could WIN A FREE POOL PASS!
How We Play: Recreation and Culture in Lacombe
Cities are places where we live, work and also play. Whether it is baseball at Michener Park, swimming at the Aquatic Centre, viewing art at the Lacombe Memorial Centre, or walking around Cranna Lake, the opportunity to play is an important part of our community. The City believes in the benefits of recreation and culture provision and this commitment is clear in the community vision: “The City of Lacombe is a safe, vibrant and evolving community, welcoming you to live, work and play.”
Lacombe strives to be a community where residents enjoy a high quality of life. Healthy communities provide opportunities to participate in a variety of recreational and cultural experiences and these opportunities improve quality of life in many ways including improving personal health and well being leading to balanced human development, providing a foundation for quality of life, boosting tourism, and generating economic activity.
The City also has a goal that recreational and cultural activities be available in all seasons and for all levels of ability and income. Participation in recreation and culture helps build strong families, neighbourhoods and reduces healthcare and social service costs. The preservation of open space also serves an important ecological function, providing spaces for habitat and diverse ecosystems.
In 2013 the City completed the Recreation & Culture Master Plan. The MDP Update will be supported by the Culture & Recreation Plan and will help guide decision making for future recreation facilities. Currently all new developments contribute 10% of the developed area for Municipal Reserve (land for parks, trails and schools). Land which is unsuitable for development is designated as Environmental Reserve (ER) and stays in its natural state or is used as public park. The MDP Update will review these policies, and help prioritize development of new park spaces, identify lands for preservation as environmental reserve and connect play spaces to live and work spaces.
POOL PASS!
Participate and WIN!
Ph: 403782-3333www.lacombefeed.com
All The Feed Your Animals Need!
Salts & MineralsPet FoodHorse Feeds4-H FeedPoultry FeedsCalf StartersDairy FeedsBird SeedsMilk ReplacersAlso Hog, Sheep, Goat, and Rabbits
omom
oat,
mm
,oat,,
OLD FASHIONED CHRISTMAS - This new display at the Lacombe Flatiron Museum, made up of donations from the community, depicts a typical historic Christmas scene.
Brian Vossen/Lacombe Express
‘THE LIBRARY IS MOVING DIGITAL ALL
THE TIME. COMPUTERS AND TECHNOLOGY ARE
A BIG PART OF OUR SERVICE.’
MEREDITH BRATLAND
10 Lacombe Express Thursday, November 28, 2013
*Guaranteed by the Credit Union Deposit Guarantee Corporation. Minimum deposit required. Rate subject to change.
With Servus you can get a very competitive rate
and your deposit is 100% guaranteed. Plus, you
have the fl exibility to redeem after just 12 months.
Speak to a fi nancial advisor today.
servus.ca | 1.877.378.8728
2.55% Return
100% Guaranteed
You’re Invited to a Celebration of Heritage in LacombeThe City of Lacombe has recently been recognized for its amazing heritage assests.
The charming streets and unique architecture bring beauty to life; lets celebrate! All
are welcome to come out and celebrate Lacombe’s heritage; mix, mingle and
enjoy holiday treats!
Date: Thursday, December 12Time: 6:00-9:00pmFormal Program Runs from 6:30-8:00pmLocation: St. Andrew’s United Church, 5226 – 51st Avenue, Lacombe
For more information visit:
http://www.lacombe.ca/doing-business/planning-development/what-s-new
Or contact Jennifer Kirchner at 403-782-1264 or [email protected]
hthttptp:/://w/wwwww l.lacacomombebe c.ca/a/dodoiningg-bubusisinenessss/p/plalannnniningg-dedevevelolopmpmenent/t/whwhatat s-s n-newew
OrOrOrOOrrO ccccccconononooono tatatatattatactctcttctct JJene nifeer KiKiKiKiKiKircchnere aat t 4003-33 7882-1264644446 o oooor jkj irchc neeeeeeer@r@r@r@r@@@lalalalaaacocococoocooooocccombmmbmbmbmbmmbbbbbe.eeeee.e caca
Despite the recent cold temperatures,
the ice on local water bodies is too thin
for the public at this time and the City of
Lacombe is advising residents to stay off
Cranna Lake, Royal Oak and Iron Wolf
Storm Water Ponds (SWP), as well as the
Les Walker Pond for their own safety un-
til further notice.
Heavy snowfalls have created an ex-
treme load on the ice, causing extensive
cracking and concealing unfrozen areas.
The snow accumulation may also slow
the process of ice formation.
Residents are asked to obey all posted
signs around these water bodies.
Ice thickness will be measured by
Parks Services staff on a weekly basis
until suffi cient ice thickness has been
reached for the designated ponds to be
opened for use. The ice must reach a
minimum thickness of 8” (20cm) before
people will be allowed access.
Those using the SWP ice surface are
advised to beware the ice may become
unstable at any time and that the ice
thickness may change anytime for a va-
riety of reasons, some of which are un-
predictable.
Anyone using the ice surface on a SWP
pond does so at their own risk.
Use the designated ponds only when
safe to do so and obey all posted signs.
Vehicles are not permitted on the ice.
Small, push-model snow blowers are al-
lowed. Users of Iron Wolf storm water
pond assume all risk and maintenance
responsibilities for the ice, (i.e., fl ooding,
shoveling, safety, etc).
The Storm Water Pond Policy is lim-
ited to Cranna Lake, Royal Oak and Iron
Wolf SWP, and excludes Len Thompson,
Bruns Pond, Wolf Creek Industrial SWP,
Mackenzie Ranch SWP, Henners Storm
Cell and the Airport SWP.
Other bodies of water most commonly
located on golf courses are not consid-
ered part of this program.
- Vossen
Residents advised to stay off pondsDeputy Minister of Jus-
tice and Solicitor General
Tim Grant, along with Cal
Duplessis, a team leader
with the Audits and Com-
pliance branch, presented
Chief Steve Murray and
Police Commission Chair-
person, Tammy Gagnon,
with a compliance certifi -
cate in recognition of the
high standard of policing
services provided to Alber-
tans.
Every four years, the
Ministry of Justice and So-
licitor General audits every
municipal police service in
Alberta to ensure they are
complying with Alberta’s
high policing standards.
Over 450 individual stan-
dards in 170 areas of re-
sponsibility are reviewed
and assessed.
During the audit in early
2013, the minister of justice
and solicitor general deter-
mined the Lacombe Police
Service “Fully complied
with the Alberta Policing
Standards.”
Grant said this was an
accomplishment for any
police organization but
particularly noteworthy
for a smaller police service.
“We are very proud of
the accomplishments of
LPS and we feel the resi-
dents of Lacombe can be
equally as proud that as a
commission, we have set
the standards high and the
members and staff of LPS
have worked hard to meet
our expectations,” said Ga-
gnon.
Murray agreed.
“This is a refl ection of
the dedication and hard
work of our members
and support staff, current
and former, who have em-
braced our vision of com-
munity partnership and
truly strived to be the best
police service for our com-
munity,” said Murray.
- Vossen
LPS receives recognition
HIGH STANDARD - Lacombe Police Service was awarded with a compliance certifi cate Monday in recognition of its high standard of policing services. From left is Lacombe Police Chief Steve Murray, Audits and Compliance Branch Team Leader Cal Duplessis, Police Commission Chair Tammy Gagnon and Deputy Minister of Justice and Solicitor General Tim Grant.
photo submitted
Thursday, November 28, 2013 Lacombe Express 11
When I was a child in Vic-
toria, before the routine of
school occurred for me, the
days often melted into each
other - one day of the week
very much like another.
However, while sitting in
my James Bay apartment,
I could hear the bells ring
from downtown at the in-
ner harbour and I knew
that it was Sunday.
Bells are a clarion call.
They call to people to come
- to come to God, to come
to each other, to come and
celebrate life. They ring at
weddings.
They ring out warnings.
They ring to announce the
end of war.
They are sung about in
song and entire choirs are
devoted to playing them.
They are emblems of
Christmas along with the
star which guides us, the
fi reside which warms us
and the tree that gathers us
together.
In Lacombe there is one
church bell. It rings at 10:15
a.m. on Sundays and it
rings to announce a wed-
ding.
But on Nov. 7th at 2:30
p.m. the bell rang for no
reason other than this
writer got the opportunity
to play at being Quasimodo.
The Reverend Ross Smil-
lie, showed me the bell pull.
He demonstrated how to
get the bell moving and
then he stepped aside to let
me try.
It’s such a little thing
ringing a church bell, and
yet it seemed like such
a wondrous gift. I had
not known that ringing a
church bell would be on my
bucket list until I was doing
it.
The bell rang out, pro-
claiming nothing impor-
tant that day other than
that it was a church bell,
housed in a building where
families come to praise
God, people take care of
each other, prayer shawls
are knitted, cookies are
baked, children play and a
kind reverend counsels his
parishioners.
The ringing of the church
bell on that day by a writer
who fondly remembers the
sound of the bell from her
childhood telling her it was
Sunday, had nothing spe-
cial to say other than come
- come and celebrate life.
St. Andrews United
Church was built in 1909 as
a Presbyterian church and
occupied less than a quar-
ter of the space it does now.
It’s a solid wooden struc-
ture with a brick facing.
The sanctuary that cur-
rently exists was about
half the size then and it had
a choir loft. It also had the
bell which at the time cost
the church $120.
Named after Andrew the
apostle there is a beautiful
stained glass window at the
front of the church depict-
ing Andrew at the ascen-
sion. Stained glass is plenti-
ful in the sanctuary - much
of it in memory of parishio-
ners who were instrumen-
tal to the congregation.
One window is a memo-
rial to the veterans that
served in the First World
War.
Another window depicts
a man who was a scout
master, a Sunday School
teacher and a devoted
member of the church.
There is artwork hand-
crafted by local master
wood smith Reverend Jim
Henning and throughout
the church are remind-
ers of the people who had
served the congregation in
various ways.
The Presbyterian
Church became the United
Church when it joined with
the Methodists in 1922 lo-
cally and nationally in 1925.
At the time of the union,
the Methodists had their
own church beside the Mi-
chener House which was
the Methodist manse.
Both places were still
used for awhile although
services were held at St.
Andrew’s. In 1957 the hall
at the east end of the prop-
erty was added and in 1960
a three-storey connection
between the two buildings
was built. It included meet-
ing rooms, a kitchen, class-
rooms and offi ces.
The extension to the
sanctuary was built in 2001
and at that time an elevator
was added to replace the
chair lift at the front doors.
The extension is seamless
and appears to have always
been part of the original
structure.
Smillie mentions Nancy
Locke, a parishioner who
lived to over a 100-years-
old. She told stories of life
before the warm kitchen
where they would serve
food in the basement “And
the gravy would drip onto
the fl oor which was so cold
that it would freeze the
gravy eventually creating
stalagmites.”
There is a glass case in
the corner of a meeting
room that displays memo-
rabilia of Nancy’s life.
The basement which
runs the extent of the
church is decorated with
murals depicting Noah’s
Ark and ‘Sunlight City’ to
create a welcoming envi-
ronment for the children.
“In the 50’s there were
over 300 kids in the congre-
gation,” said Smillie.
The church is a beauti-
ful historic building, but its
real beauty lies in the ways
in has been used for over a
century.
Appreciating the history of St. Andrew’s United
FRIDAY, NOV. 29 & SATURDAY, NOV. 30All Men’s and Ladies Shoes
10% to 50% Off10% to 50% OffRunning Shoes - Buy one get one at
50% Off50% Off
For Moonlight Madness, Friday Nov. 29 we willbe having hourly draws from 6p.m. to 11p.m.
Main Street, Stettler 403-742-8668
Present this ad and receive an additional $10 offPresent this ad and receive an additional $10 offyour purchase of $50 or more.your purchase of $50 or more.
LOVE: MOM, LOVE: MOM, DAD AND DAD AND NATHANNATHAN
ThHappy BirthdayTTTTTh
BBBBBBBBBBBBBBBBBBBBBBBBBTTTTTT
10BBBBBBB
Madyson
AnnaMaria
J U N U S
12 Lacombe Express Thursday, November 28, 2013
ComingEvents 52 PIONEER LODGE
ART MARKETSAT. NOV. 30, 10-4 P.M.4324 46 A Ave. Red Deer
403-391-2574
Personals 60COCAINE ANONYMOUS
403-396-8298
Dental 740F/T ASSISTANT RDA IIneeded for busy general dental offi ce in Red Deer.Must be a self-motivated team player with good communication skills.
Please send resume with cover letter to:(888) 815-9839
or email to: [email protected]
Farm Work 755F/T FEED TRUCK
OPERATOR for largeexpanding feed lot in Sundre.
Fax resume to 403-638-3908
or call 403-556-9588or email:
You can sell your guitar for a song...
or put it in CLASSIFIEDS and we’ll sell it for you!
Celebrate your lifewith a Classified
ANNOUNCEMENT
Oilfield 800
$2500 BonusEvery 100 days
IMMEDIATE OPENINGSNight Foremen,
Day & Night OperatorsMust have H2S, First Aid,
valid driver’s license. Pre-employment Drug
screening Competitive Wages.
Benefi t PackagePlease submit resume with
references to:[email protected]
or by fax to (403) 783-8004Only individuals selected forinterviews will be contacted
LOOKING FORBOILER OPERATORSwith tickets for work in
Central Alberta and Northeastern BC.Submit resumes to
[email protected] fax to: 403-886-2223
Looking for a place to live?
Take a tour through the CLASSIFIEDS
Oilfield 800
1ST RATE ENERGYSERVICES INC.,
a growing ProductionTesting company, based
out of Sylvan Lake, is currently accepting resumes for the following positions:
* ExperiencedProduction Testing* Day Supervisors* Night Operators
* ExperiencedProduction Testing
Assistants
If you are a team player interested in the oil and
gas industry, please submit your resume,
current driver’s abstract and current safety
certifi cates to the following:Fax 403-887-4750
Please specify position when replying to this ad.
We would like to thank all those candidates who apply, however only
qualifi ed personnel will be contacted.
FLUID Experts Ltd.Fluid Experts of Red Deer
is seeking experiencedClass 1 Operators
to haul clean fl uids for the Oil & Gas Industry. Home
every night, company benefi ts with exceptional
pay structure. Must be able to work on their own with
minimal supervision. Compensation based on experience. Fax resume w/all tickets and current
drivers abstract to: 403-346-3112 or email to: roger@fl uidexperts.com
Buying or Selling your home?
Check out Homes for Salein Classifieds
Oilfield 800DARK Star ProductionTesting Ltd. is currentlyseeking experienced
supervisors and assistantswith clean criminal recordand passport for immedi-ate work in South Texas.
Competitive wages.Rotation shift work
Pre-employment drugscreening
All applicants must have valid tickets including H2S fi rst aid & fi t test. Must also have valid driver’s licence. All applicants must have strong professional work
ethic.Limited positions available.Darkstar will provide work
visa. Submit Resume, passport, criminal record check and
current tickets to ken@darkstarproduction.
com Applicants missing any of the above criteria will not
be considered.
NOW HIRING Well Testing Personnel
Experienced Supervisors& Operators
Must have valid applicable tickets
Email: [email protected]
Q TESTINSPECTION LTD.
Now has immediateopenings for CGSB
Level II RT’s and CEDO’s for our winter pipeline
projects. Top wages and comprehensive benefi t
package available.Subcontractors also welcome.
Email resumes to:[email protected]
or Phone 403-887-5630.
Looking for a new pet?Check out Classifieds to
find the purrfect pet.
Professionals 810
A growing, well established ASME fabrication facility
Is hiring for the position of Mechanical Designer
/ DrafterSkilled & adept in pressure
vessel & piping design.Candidate can demonstrate profi ciency with AutoCAD/
AutoCAD Inventor,compress & has proven
record of successful projects.Strong computer skills &
technical aptitude is req’d.We offer above industry wages & comprehensive
benefi t package.Please email resumes to
[email protected] fax 403-347-7867
Restaurant/Hotel 820RAMADA INN & SUITES
REQUIRES ROOM ATTENDANTS.
Exp. preferred.Only serious inquiries apply.
Rate $13.50/hr.Drop off resume at:
6853 - 66 St. Red Deer or fax 403-342-4433
Trades 850Eagle Builders (Blackfalds)
require 2 FT ConcreteBatch Plant Operators to
maintain, operate & adjustmachinery. Min. 1 yr exp &high school dipl required.
$23/hr. Apply at: www.eaglebuilders.ca
First Choice Collision seeking
Journeyman Technician for our car & light truck
division. Successful candidate must have
Canadian Red Seal and/or Alberta Completion of
Apprenticeship Certifi cate. Starting fl at rate wage of $29.00/hr plus monthly
bonus is available. Blue Cross benefi t package
available after 3 months of successful employment with our company. Fax
resume to (403)343-2160 or drop off in person.
HVAC Service Person required. SHEET Metal
Installer required with residential and retro-fi t
experience. Attractive wages and benefi ts. Great hours.
e-mail: [email protected]
or Fax resume to: 403-309-8302
Tired of Standing?Find something to sit on
in Classifieds
Trades 850
JOURNEYMAN Electricians
andInstrument Hands req’d. for work in Central Alberta. Oilfi eld exp. an asset. Please forward your resume to [email protected] or fax 403-887-4945
PETROFIELD Industries, the Leader in manufacturingHydrovac trucks, is acceptingresumes for the following positions:* General Labourers* Industrial Painters* Sandblasters* Material Handler* Automotive Electrical Technician* Journeyman Welder / Apprentice* 2nd Yr Welder with Aluminum experience* Production Manager
Visit our website at: www.tornadotrucks.com
for more details. Our Company has an
enthusiastic fast paced working environment, with advancement possibilities for the motivated person, and offers an excellent benefi t package. fax
403-742-5544e-mail: hr@petrofi eld.com
Precast Concrete Plant in Blackfalds, AB, is looking for new team members to join an enthusiastic and
growing company. Concrete fi nisher
needed to perform detailed and quality fi nish-ing as well as other related
tasks, minimum 5 years experience. All applicants must be fl exible for hours and dedicated due to a demanding production
schedule. Own transporta-tion to work is needed. Wage will be based on
experience, attitude and willingness to commit to long term employment. Please fax resume to
403 885 5516 or email to k.kooiker@
eaglebuilders.ca Thank you to all
applicants but only those selected for an interview
will be notifi ed.
TOO MUCH STUFF?Let Classifiedshelp you sell it.
Trades 850United Tank Inspections
Inc. is currently looking for a Full-Time Heavy Duty
Mechanic for our Stettler,AB shop. You will be doing
repairs, overhauls,maintenance, service, andCVIP’s on Heavy Trucks &
Trailers. We offercompetitive wages, grouphealth benefi ts and groupRSP. Please call 403-742-
4747 or email [email protected]
Truckers/Drivers 860
Central AB based trucking company requires
Owner Operators& Company Drivers
in AB. Home the odd night. Weekends off. Late
model tractor pref. 403-586-4558
DRIVERS for furniture moving company, class 5 required (5 tons), local &
long distance. Competitive wages. Apply in person.
6630 71 St. Bay 7 Red Deer. 403-347-8841F/T TRUCK drivers req’d. Minimum Class 5 with air and clean abstract. Exp.
preferred. In person to Key Towing 4083-78 St. Cres.
Red Deer.NEED EXPERIENCEDClass 1 drivers for shortand long haul. Full Time.
Runs AB., SASK, Manitoba & BC. Please call
PROMAX TRANSPORTat 227-2712 or fax resume w/abstract 403-227-2743
Misc.Help 880
CUSTOMER SERVICE A locally owned industrial supply company is looking for an energetic person for
inside sales. E-mail resume to [email protected]
DAIRY equipment supplier looking for
GENERAL LABORERS& EQUIPMENT INSTALLERS
Competitive wages and benefi ts package. E-mail
resume: [email protected]/NIGHT
dispatcher req’d. immedi-ately. Knowledge of Red
Deer essential. Will require good verbal and written
communication skills. Fax resume to 403-346-0295
Misc.Help 880
Eagle Builders in Black-falds, AB is looking for
hard working, motivated individual to fi ll a full-time precast concrete erecting
laborer position at our company. Must be physically fi t as this labourer position requires constant heavy lifting and involves
fast paced, on the job training. Applicant must be
able to travel and must have reliable transportation
to and from work as well as a valid class 5 driver’s
license. All meals and hotel expenses are paid when out of town. Suc-cessful applicant must
provide an up to date driv-ers abstract. Construction experience an asset. Full benefi ts provided. Starting
wages based on experi-ence. Fax resumes to
403 885 5516 , must fl ag attn: Craig or e-mail to
Looking for reliable newspaper carrier for 1 day per week
delivery of theCentral Alberta Life
in the town of
INNISFAIL
Packages come ready for delivery.
No collecting.
Contact Quitcy at403-314-4316
NEWSPAPER CARRIERS REQUIRED
For afternoon delivery
once per week
In the towns of:
BlackfaldsLacombePonokaStettler
Call Rick for more info 403-314-4303
CELEBRATIONSHAPPEN EVERY DAY
IN CLASSIFIEDS
ClassifiedsYour place to SELLYour place to BUY
Obituaries
LECERFLeon Lecerf, born May 16th, 1929, died peacefully at age 84 in Cranbrook, BC on November 15th, 2013. Funeral services were held at Evergreen Roman Catholic Church on Saturday November 23rd, 2013. He was laid to rest at Evergreen Cemetery.
CLASSIFIEDSCLASSIFIEDSdeadline: Monday @ noon
To place an ad, call Toll Free: 1.877.223.3311or email: classifi [email protected]
* No cancellations, refunds or exchanges. Please read your ad the fi rst day it appears. We will accept responsibility for 1 insertion only.
Announcements .................0005-0030What’s Happening .............. 0049-0070Garage Sales ........................0100-0650Employment ........................ 0700-0920Service Directory ................. 1000-1430
Items to Buy/Sell ................. 1500-1940Agricultural .......................... 2000-2210For Rent ............................... 3000-3200Wanted to Rent....................3250-3390Real Estate ...........................4000-4190
Open House Directory ....... 4200-4310Financial ..............................4400-4430Transportation ....................5000-5240Legal/Public Notices .........6000-9000
Lacombe Express
DCR BOOKKEEPING
SERVICEOver 30 years experience with Quick Books, A/R- A/P-GST- Payroll-WCB- Bank DepositsT4’s & T4 Summary & much more
Dallas Ruggles403-783-5877403-704-0706
Bookkeeping1050
CASH INWITH THE
CLASSIFIEDS!
Turn those unwanted items into quick cash with a single phone call.
Thursday, November 28, 2013 Lacombe Express 13
Misc.Help 880
NEWSPAPER CARRIERS REQUIRED
To deliver theSYLVAN LAKE
NEWS & CENTRAL AB LIFE
1 day a week.
Please call Debbie at 403-314-4307
WAREHOUSE /DELIVERY MANAGER
Family owned andoperated since 1974,
Trail Appliances is one of the leading independent
appliance retailers inWestern Canada.
The Company currently has an immediate
opening for a Warehouse/Delivery Manager
at our Red Deer location.
Responsibilities includebut are not limited to:
• Overseeing & managing the day to day operations of the warehouse
• Interviewing, hiring, & developing employees
• Planning, assigning & directing work
• Addressing complaints & resolving problems
• Analyzing & implementing process improvements
†Requirements:
• Minimum 3 years direct experience in all aspects of warehouse operations
• Ability to plan & execute warehousing strategies
• Above average super-visory skills
• Excellent leadership, communication & time management skills
• Organized & effi cient• Ability to handle large
volumes of product†
Trail offers a comprehensivecompensation and benefi t plan, including Flex days.
If you are looking for a challenging and rewarding career as a Warehouse /Delivery Manager, please
submit your resume to:[email protected] by fax at (403) 212-7661.
Please indicate‘Warehouse / Delivery
Manager’on the subject line
of your fax/email. Security checks will be conducted on successful candidates.
Contractors 1100RMD RENOVATIONS
Bsmt’s, fl ooring, decks, etc.Call Roger 403-348-1060
MassageTherapy 1280
Executive TouchMassage (newly reno’d)
(FOR MEN)STUDIO 5003A-50 st. Downtown 9 am - 6 pm. Mon. - Fri.
403-348-5650
Misc.Services 1290
Ironman Scrap Metal Recovery picking up scrap
again! Farm machinery, vehicles & industrial. Serving Central AB. 403-318-4346
Painters/Decorators1310
PRO-PAINTING & REPAIRS 403-304-0379
Antiques& Art 1520ANTIQUE PIANO STOOL.Has swivelling/rotating seat.
In excellent condition.† $185 (fi rm).
Call (403) 342-7908.
Auctions 1530
BIG STRAPPERAUCTIONS
SALES EVERY WED. @ 6 pm.
Moose Hall 2 miles south of Ponoka on 2A
NEXT ANTIQUE SALE SUN. DEC. 1 @ 6 PM.WE BUY FOR CASH.
403-304-4791 Check website for full listing
www.bigstrapperauctions.net
Firewood 1660AFFORDABLE
Homestead FirewoodBirch, Spruce, Pine - Split 7 days/wk. 403-304-6472
LOGSSemi loads of pine, spruce,
tamarack, poplar. Price depends on location.
Lil Mule Logging 403-318-4346
Now Offering Hotter, Cleaner BC Birch. All Types. P.U. / Delivery. Lyle 403-783-2275
Health &Beauty 1700INVACARE hospital bed w/side rails, mattress, used 5 mo, new $1995 asking $1000 403-356-2941
HouseholdAppliances 1710ELECTRIC heater (Com-fort Zone) oak cabinet, portable, remote and
thermostat control, child and pet safe
$150 403-314-2026
HouseholdFurnishings1720
GREEN leather reclining love seat $500 , 2 match-ing reclining leather chairs
$250/ea. 403-341-3524
PHONE bench solid oak $175 403-314-2026
Misc. forSale 1760
CROKINOLE board 26” across metal frame
w/checkers $25; 2 wine racks, chrome plated,
holds 12 bottles, $10/ea, 2 table centers made of pine cones/candles $8/ea, med. size roaster, blue enamel
$6; 2 deer antlers on shields $60/ea; 25 legal
size fi le holders all for $10403-314-2026
WantedTo Buy 1930NOW BUYING WILD FUR -Coyotes, Foxes, Muskrat Beaver etc. Call Reuben
403-887-2439
Livestock 2100SELLING 5 BRED heifers & 25 BRED COWS at VJV Auctions Ponoka, Saturday Nov. 30. Simmental Cross, Angus & Gelbvieh. Second
calvers to mature cows, very quiet, closed herds
since 1996, bred simmen-tal and a few bred Angus.
Most bulls used from Lock-hart Valley Simmentals.
Cows have all had Express 5, 8 way Scour Guard and
Ivermectin. Call Ian or Norma Ross
403-782-2686, 391-3044
Horses 2140WANTED: all types of
horses. Processing locally in Lacombe weekly.
403-651-5912
Grain, FeedHay 2190ROUND HAY BALES 180 (mixed) Mid Aug., no rain, 1250 lbs. per bale, $45,
403-845-5670
ROUND hay bales. Cheap Free delivery. Self unload-
ing. No Sunday calls Please. 403-843-6380
SMALL SQUARE HAY and straw 403-340-3061
SMALL Square Hay Bales:1st & 2nd cut.
SMALL Square Straw Bales403-784-2276
Suites 3060ONE bdrm. ADULT only apt. close to college, $780/mo., avail. immed. no pets 403-877-3323
Offices 3110Executive Place 4900 50
Street Red Deer‘AAA’ OFFICE SPACE
FOR LEASEOnly 2,000 Sq Ft
RemainingJones Lang LaSalle
Please call +1 (403) 456-2104 Calgary +1
(780) 668-9269 Edmonton
MobileLot 3190
PADS $450/mo.Brand new park in Lacombe.
Spec Mobiles. 3 Bdrm.,2 bath. As Low as $75,000. Down payment $4000. Call at anytime. 403-588-8820
HousesFor Sale 4020
2 SPEC HOMESReady for your colours.
Can be shown at any time. 10 & 98 MacKenzie Cres. Lacombe. 403-588-8820
BRAND NEW 1340 sq. ft. bungalow, 2 bdrm., den,
dbl. att. garage. $384,900. Call Glen 403-588-2231
MASON MARTINHOMES
Custom new homesplanning service.
Kyle, 403-588-2550
MUST SELLNew Home. 1335 sq.ft.
bi-level, 24x23 att. garage.403-588-2550
Start your career!See Help Wanted
HousesFor Sale 4020
RISER HOMESBLACKFALDS4 bdrms. 3.5 baths,
front att. garage. 2 storey. Indoor/outdoor fi replace,
hardwood, tile, house-wide deck & many more upgrades.
Please phone Lloyd at 403-391-9294
for all the details. $437,900incl. legal fees, appls., GST, front sod & tree.
Condos/Townhouses4040
NEW CONDO1000 sq.ft. 2 bdrm., 2 bath. $192,000. 403-588-2550
BusinessesFor Sale 4140
ESTABLISHEDGARBAGE BIN RENTAL BUSINESS. Retiring.
403-341-5866 evenings.
Cars 5030
Cars 5030
2009 VW Golf, manual, 90,000 km. Winter pkg, $11,500. 403-391-1770
2008 BMW X5 3.0si AWD,htd. lthr., panaroof, $27,888348-8788 Sport & Import
2005 LEXUS ES 330 FWD, lthr., 41,100 kms,
$15,888. 348-8788 Sport & Import
2004 MAZDA 6 Sport, loaded, hwy. kms., new clutch, brakes, rotors, fuel pump, drive belt etc. Like new. $8900. 587-877-0122
2001 HYUNDAI Accent 2 dr. red, 403-348-2999
2000 Chrysler Neon, 2L, 4 dr.,5 spd. Clean. 403-318-3040
1999 PONTIAC Bonneyville 4 dr., saftied. 403-352-6995
SUV's 5040
2008 GMC Yukon XL Denali AWD $18,888.
348-8788 Sport & Import
2008 GMC Acadia SLE AWD, 8 passenger, 90485 kms, $19,888. 348-8788
Sport & Import
SUV's 5040
2006 CADILLAC EscaladeAWD, lthr., $15,888.
348-8788 Sport & Import
Trucks 5050
Trucks 5050
2009 RANGER XLT 4x4, 70,000 kms., $15,900. trades cons. 403-598-0682
2008 FORD F-250 XL 4X4, 6.4L, 92754 kms., $26888. 348-8788 Sport & Import
2006 GMC C4500 4X4,loaded, conversion, new
duramax installed from GM,170,000 kms., $39,888
403-348-8788 Sport & Import
VansBuses 5070
2009 DODGE Grand Caravan SXT 106,000 kms, DVD, stow n’ go
seats, pd, heated seats, remote, more, exc. cond, 1
owner senior driven, $13,500 obo 403-887-2464
Motorhomes 51002004 FLEETWOOD
Discovery Cat diesel, 4 slides, new Winegard
Dome tv’s, tires, batteries, fl oor, lifetime motorhome membership, 2011 Equi-nox Blue Ox hitch, auto
brake system, loaded and ready to go south.
403-343-2722 403-391-1796
AutoWreckers 5190RED’S AUTO. Free Scrap Vehicle & Metal Removal.
AMVIC APPROVED. We travel. May pay cash
for vehicle. 403-396-7519
VehiclesWantedTo Buy 5200 RED’S AUTO. Free scrap vehicle & metal removal. We travel. May pay cash
for vehicle. AMVIC APPROVED. 403-396-7519
Misc.Automotive 5240
FREE removal of scrap vehicles. Will pay cash for
some. 403-304-7585
Cats 1830CATS TO GIVE AWAY - 1 M., 1 F. both spayed/
neutered. M. is white with black spots, loves people, F. is white with gold spots.
Hopefully to separate homes. 403-886-4885
KITTENS (2) SIAMESE(1) BALINESE &
$50/ea. 403-887-3649
MTD 3 HORSPOWER21” SNOWBLOWER.
2 cycle. (Oil & gas mix.) $175. 403-302-0987
Misc. forSale 1760
N IQUESALE
Sunday, Dec. 1, 1 pm Sunday, Dec. 1, 1 pm Moose HallMoose Hall
• Depression Glass • Coins • Jewelery • Lamps • China
Cupboards • Cookie Jars • Furniture • Glassware & more!
Presented byBIG STRAPPER AUCTIONS
Linda Dunbrack 403-304-4791 (cell)
To view items:www.bigstrapperauctions.net
Lunch will be available
Start your career!See Help Wanted
The Classifieds Are the Cat’s Meow.
Area shoppers know the Classifieds are the purr-fect place to find a
bargain. In the Classifieds, you can track down deals on everything from
collectibles to cuddly kittens. It’s easy to place an ad or find the items you want and it’s used by hundreds
of area shoppers every day. The Classifieds Are the Cat’s Meow.
Meow! Careers
The Opportunity:
Reporting to the Chief Administrative Officer, this half-time position provides administrative support of a highly skilled and fast paced nature to the Mayor and City Council. The ideal candidate will have exceptional verbal and written communication skills; ability to deal with the public diplomatically; proficiency in working independently using initiative to prioritize and complete varied duties; and manage a complex workload efficiently in a multi-tasking team-based environment. Experience in public relations, technical writing and citizen engagement will foster success in this position.
Preferred Qualifications:
- Office Administration Diploma - Superior computer skills and familiarity with the Windows environment - Familiarity with desktop publishing software (Adobe Creative Suite 5) - Familiarity with digital photography tools and concepts - Familiarity with social media tools and concepts in an organizational setting - Ability to work independently and collaboratively - A working knowledge of the Municipal Government Act (MGA) or ability to interpret legislation.
Salary: $23.53 - $29.41 per hour (0.5 FTE) dependent on education and experience The City of Lacombe has an excellent benefits package
If you see yourself excelling in this role please forward your resume on or before December 6, 2013 to:
Human Resources 5432—56th Avenue Lacombe, AB T4L 1E9 Fax: (403) 782-5655 Email: [email protected]
All applicants are thanked for their interest, but only those candidates selected for an interview will be contacted.
14 Lacombe Express Thursday, November 28, 2013
Successful Careers Start Here
Careers
Application forms can be obtained at the Lacombe City Hall or at www.lacombe.ca Click on City Hall then Careers & Employment. All candidates are thanked for their interest, and advised that only those selected for an interview will be contacted.
THE OPPORTUNITY
The City of Lacombe has an opening for a Heavy Duty Mechanic. The Heavy Duty Mechanic ensures the City’s fleet of equipment is maintained in safe and cost effective manner.
GENERAL DUTIES
• Plan, organize, and ensure optimum fleet maintenance. • Establish work priorities; requisition supplies and equipment; and periodically inspect tools and equipment to insure that proper care and maintenance is being performed • Evaluate and make recommendations to the Manager for capital planning and expenditures. • Effectively communicate with co-workers, other departments, vendors and suppliers. • Maintain records of on-going and preventative maintenance on vehicles and equipment and provide detailed planning of future projects • Provide on-site direction and guidance to apprentice mechanics and others working the shop; inspect work to ensure compliance with standards, policies and procedures • Oversee work done by contractors on vehicles and equipment. • Obtain thorough knowledge of, and comply with, the City’s safety policies and Occupational Health and Safety (OH&S) regulations, communicating this knowledge to staff on a regular basis • Ensure proper reporting information is made available to the Manager. • Other related duties as assigned
PREFERRED QUALIFICATIONS:
• Interprovincial Heavy Duty Mechanic, Alberta Driver’s license, Class 3 with Q endorsement • 5 years as Journeyman Heavy Duty Mechanic • Licensed by Alberta Transportation to perform CVIP inspections in the City’s approved facility. • Basic welding skills • 2 years related experience, or an equivalent combination of education and experience
Salary range: $57,782 - $72,238 depending on skills and experience. The City of Lacombe has excellent benefits.
Interested candidates please submit an application form or resume on/or before December 6, 2013 to:
Attn: Human Resources City of Lacombe 5432-56 Avenue Lacombe, AB T4L 1E9 E-mail: [email protected] Website : www.lacombe.ca
www.drakeex.ca
• Skidsteer Services
• Gravel Hauling
•Excavating•
Your Quality Excavating Solution
403.304.3887
Snow Removal Now Available•Travel Vaccination's
•Ostomy Supplies•Shingles Vaccine•Compounding•Breast Pump Rentals
5049 Parkwood Road, BlackfaldsPhone: 403-600-2280 Fax: 403-600-2243
PROFESSIONAL PHARMACY
BLACKFALDS
•BOBCATS•GRADERS•LOADERS•TRUCKS•TRACK HOES
•AGRICULTURE•DEMOLITION•EXCAVATION•GENERAL CONTRACTING•SAND/GRAVEL•SUBDIVISION WORK www.dbbobcat.com
CERTIFICATE OF RECOGNITION
For All Your Excavation Needs
403.782.3437
Service Service DirectoryDirectoryAdvertise your service or business here for 3
weeks and receive the 4th week
ABSOLUTELY FREE
Call 403.782.5303
Arnett & Burgess is now acceptingapplications for the following:
CLASS 1TRUCK DRIVER
Must have experience moving heavy equipment that is related to
pipeline construction.Clean abstract.
Competitive wage.Benefi ts available.
Please fax resumesto 780-372-4238
Or email to:[email protected]
Thursday, November 28, 2013 Lacombe Express 15
403-782-5303 www.lacombeexpress.com
Your Local Community Newspaper
WeWe are here for you! are here for you!Even if all you have is a question...
WeWe are here for you! are here for you!
ARTS & LEISUREBY MARK WEBERLacombe Express
Tenore, the three-time Gospel
Music Association award-win-
ning group that exploded onto
the scene in 2011 and have soared
to acclaim are hitting the road in
support of their newly-released
Christmas disc.
They perform at CrossRoads
Church in Red Deer on Dec. 6,
starting at 7 p.m.
The story behind lead single
and title track Christmas With
You indeed melds magic and
providence.
Tenore (Mark Williams, Jason
Catron, David Wise and swing
tenor Kevin Pauls) met Heather
Headley, one of Andrea Bocelli’s
favourite singing partners during
a spontaneous meeting in London
where they had stopped on route
to Uganda. The encounter result-
ed in a recording session between
the group and Headley, who is
both a Grammy and Tony Award
winner.
Combining the power vocals
of Tenore with Headley’s voice –
Christmas With You is breathtak-
ing and delightful. But ultimate-
ly, the entire disc captures the
charming nature of the season.
“It’s always a labour of love, es-
pecially when there are multiple
minds involved,” says Catron of
selecting songs for the CD.
“We came up with our own in-
dividual lists of 10 that we each
loved. Then we had a side list of
those songs that we really felt
strongly about. So we came up
with about 20 or so, and just whit-
tled it down from there.
“We wanted to make sure this
record was timeless so we wanted
the majority of it to be classics.
We have a new one on there and
a couple that aren’t as familiar,
but for the most part you want
to conjure up that nostalgia and
those memories and moments
that have happened in people’s
lives in years past.
“We tried to give a cross-sec-
tion, but we wanted to really hold
true to the traditions of Christ-
mas.”
The CD includes such classics
as It’s the Most Wonderful Time
of the Year, O Holy Night and O
Come all ye Faithful. And in ad-
dition to Headley the project also
features the Watoto Children’s
Choir who join Tenore on Where
Are You Christmas?
As to the members, they each
have fascinating backgrounds in
their own right.
Catron travels frequently sing-
ing at Ruth Graham (daughter
of Billy Graham) conferences.
While often compared to Josh
Groban, his infl uences range
from classical artists Andrea Bo-
celli, Michael Crawford and Tony
Bennett to recording artists Steve
Green and Sandy Patty.
“I sang my fi rst song when I
was two years old at church. A
lady came up after the service
and gave me a dollar,” he recalls
with a laugh. “So I learned pretty
early that I could probably pay for
college doing this.
“It was very natural – I started
voice lessons at age seven, and
always had a pretty mature voice
for a kid. Over the years, I just
cultivated it and trained with all
kinds of people.”
After working as a soloist for
years, he got a call about the for-
mation of a new group of tenors.
“We all decided to meet up, talk
and sing together.
“It was obvious (it would work)
because of the personalities and
having the same vision to keep a
lot of these songs alive, and to en-
courage people.”
Mark David Williams is a gift-
ed singer and songwriter with a
powerful story, after surviving
multiple fractures from a head-on
collision with a drunk driver in
2001 when he was told by doctors
he would never sing again.
He studied music and theater
and graduated with a degree in
Commercial Music Performance
from Belmont University in
Nashville.
In 2004 he won the Minne-
sota Idol contest and in 2005 was
named one of Ten Outstanding
Young Minnesotans.
Wise is one of Nashville’s most
recognized session singer/ar-
rangers.
Some of his clients include
Word Music, Warner Brothers
Music, Lillenas, Disney, Brent-
wood Benson, Daywind and
Celebrity Cruise Lines. He has
recorded background vocals for
Lady Antebellum, Dolly Parton,
Sandy Patty, Steve Green and
many more.
Kevin Pauls is an industry vet-
eran with more than two decades
in the business. This longtime
gospel artist has toured with The
Gaithers, released seven indie
albums and won the Hamilton
Music Scene Award for Canadian
Recording of the Year (2005).
Meanwhile, since their incep-
tion in 2010, Tenore has received
much critical acclaim, having
been nominated for awards in
seven categories at the GMA Cov-
enant Awards.
“To be able to do this with peo-
ple I consider family and friends,
and build a team together with
the same cause and vision – there
are many days I step back and
think wow, how did we get here?
We realize that aside from all the
work we have done, that mission
and purpose of this music is big-
ger than any of us individually,”
says Catron.
“I think that’s what we all
want out of life – to be a part of
something that is bigger than
ourselves – to help humanity, our
friends and neighbours – to be
part of lifting the human spirit.
That means everything to me.”
Tickets are available at Scotts
Parable and online at www.sing-
tenore.com.
HOLIDAY SOUNDS – Tenore is setting out on a holiday tour which includes Red Deer on Dec. 6. photo submitted
Tenore brings Christmas classics to Red DeerTraditional and modern favourites to be featured in holiday show
16 Lacombe Express Thursday, November 28, 2013
BY BRIAN VOSSENLacombe Express
It has been a part of Lacombe’s Christ-
mas tradition for the better part of the
last six decades.
On Dec. 3 and 4, the Rotary Club of
Lacombe, assisted by the Lacombe Day-
break Rotary Club, will be holding the
58th annual Christmas Carol Festival at
the Lacombe Memorial Centre.
Bev Randell, one of the lead organiz-
ers of this year’s event, has been involved
with the festival for about 15 years. He
said that the long-standing tradition is
one way the Rotary Club hopes to en-
hance the community’s Christmas spirit.
“We’re adding to making Christmas a
special time of year,” said Randell. “Just
another way of building community spir-
it.”
Only four years after forming, the La-
combe Rotary Club began hosting the fes-
tival in 1955. Randell said it was and still
is done as a way to provide an opportu-
nity for local music groups and choirs to
perform for the public.
At that time all the local churches had
choirs. Now, there are fewer choirs and
fewer student concerts in the schools, he
added.
Nonetheless it is still a popular event
today.
Randell said that there is still a great
turnout for the festival every year. He
said there is always a full house and
sometimes even a little “overfl ow.”
Preparation in the earlier days was
Rotarians prepare for annual Christmas Carol Festival
BY KIRSTEN PALARDYLacombe Express
Car seats are integral in
baby safety in the car, but
if not used properly can be
just about useless or more
harmful.
“A lot of parents don’t
read their manuals or re-
ally know how to use their
car seat, they think it’s
straightforward and that
there are no tricks to us-
ing it properly, but there
are,” said registered car
seat safety technician Abby
Wah.
Wah said part of what
parents don’t understand
is a car seat’s limitations
including weight, height
and developmental level.
“Carseats each have
their own weight and
height restrictions, so par-
ents and care givers need
to make sure they follow
those closely. The restric-
tions change depending on
if you’re using an infant
bucket seat, a rear facing
seat, a front facing seat or a
booster,” said Wah.
She added that if parents
are unsure about their own
seat, to refer to their man-
ual or fi nd a registered car
seat safety technician in
their area.
With winter’s arrival,
Wah said the most impor-
tant thing for people to re-
member when putting their
child in a car seat is that
winter jackets are not ap-
propriate to be worn while
the child is strapped in.
“They create the illusion
that the straps are tight,
but coats squish. If you get
in an accident, the force of
the impact will compress
the jacket further, creating
a pocket where your child
can move around.”
This movement in the
seat on impact can cause
injuries like whiplash, con-
cussions, broken bones,
and most severely, death.
“Children’s bones and bod-
ies are brittle and fragile
until everything is fully
fused. This doesn’t happen
until they are much older,
closer to fi ve years old. Un-
til this time, we need to do
everything in our power to
protect them.”
Wah said the best way to
utilize a winter jacket in
a car seat is to buckle the
child in without the coat
fi rst, snug the straps tight,
and then put their coat on
backwards over their arms.
Some other basic things
that Wah said are impor-
tant to remember include
the pinch test, the chest-
clip and the importance of
rear-facing car seats.
“The pinch test is what it
sounds like, pinch the strap
above the chest clip. If
you can grab material, the
straps are too loose. The
chest clip also is exactly
what it sounds like, a clip
that is meant to be on your
child’s chest.”
The chest clip should line
up with your child’s arm-
pits at all ages, and Wah
said this is one of the most
important things a parent
can remember.
Without the chest clip in
the proper position, a child
can potentially be thrown
from their car seat in a col-
lision.
Wah also said that par-
ents who aren’t sure if their
child should be rear facing
or front facing should ask
themselves a few questions.
“If your child can stay
rear-facing, keep them that
way. It’s safer for them. To
move front facing each seat
has different qualifi cations
but most of them say one
year, over a certain weight
and height, and able to
walk without assistance.”
For more information,
visit www.carsafetyand-
kids.ca.
Experts offer tips on car seat safety
Book your christmas gift certificates nowBog
Book your christmas gift certificates nowg
BOX OFFICE:
403-304-6329WWW.COWPATTI.COM
A Christmas gift that will tickle
their funny bones and delight
their taste buds.
TOLL FREE 1-800-BIG-IRON
NEED A
WATER WELL??Check status of 3 GovernmentGrants/Assistance each worth
$5000 or moreCHECK BIG IRON’S SPECIAL DISCOUNT PACKAGE
Worth more than: $5000
10 YR. TIME PAYMENT PLANO.A.C NODOWNPAYMENT
View our 29 patented and patent pending inventions
online at www.1800bigiron.com
PLUS FREE “KONTINUOS SHOK” CHLORINATOR
RED DEER 403-346-7550
very different as well.
Randell said it was days of baking cook-
ies and making sandwiches for the ladies
and there were hundreds of tin stars, made
from old Esso oil cans, cut out to decorate
the hall.
Randell said he is disappointed that there
are less music programs in schools and few-
er choirs in the community than there once
were. He said he sees music as a way for peo-
ple to improve all facets of themselves and
not just in the arts sectors.
While Randell and the Rotarians may not
be able to do much in way of changing that,
he said they are glad to provide a venue to
those who still do wish to partake in musical
endeavors.
“We can at least provide a venue for those
people who are still trying to have music in
the community,” said Randell. “Music is still
fun and it’s something we should encourage
any way we can. We (the Rotarians) do this
to a small degree with (the festival).”
The Christmas Carol Festival will be held
at 7 p.m. on Dec. 3 and 4 at the Lacombe Me-
morial Centre. Admission is free but food
bank items or cash donations to the food
bank will be accepted to help meet the in-
creased demands of the Christmas season.
‘JUST ANOTHER WAY OF BUILDING COMMUNITY SPIRIT.’
BEV RANDELL
Thursday, November 28, 2013 Lacombe Express 17
Special
of the Week
403.782.87084718 Hwy 2A – Lacombe, AB
ACCESSORYLANDACCESSORYLANDA Division of L.A.N.D. Automotive Group
www.accessoryland.cawww.accessoryland.ca
The only place toPIMP Your Ride!!
Monday - Friday: 8:00 am - 6:00 pmSaturday: 9:00 am - 4:00 pm
To serveyou better
15% offoff
Cold weather is here. Make sure you don’t get
caught with a vehicle that won’t start.
SPORTSBY BRIAN VOSSENLacombe Express
It could be the biggest event in
curling ever to take place in La-
combe.
From Feb. 5 – 15, Alberta’s
greatest curlers will make their
way to Central Alberta as La-
combe hosts the Alberta Boston
Pizza Cup, the provincial cham-
pionships for the Alberta Curling
Federation (AFC).
Don Gullekson, executive
member of the Lacombe Curl-
ing Club and chair for the BP
Cup said the championship has
become more than just a curling
club initiative and that the com-
munity has bought into it as well.
“It’s become a community
thing,” said Gullekson.
Mandy Peakman, club manag-
er, agreed.
“It’s exciting. I think it’s been
really well received. I think the
support has been good and they
are just as excited for it as we
are.”
Gullekson said there are a
number of reasons why the La-
combe Curling Club wanted to
host the Boston Pizza Cup. First
of all the event can be a great
source of income for hosting
clubs if done right.
“It can be a money maker,”
said Gullekson.
However, promotion of La-
combe and Central Alberta were
also high on the list of reasons
the club wanted to host the event.
“It’s a chance for Lacombe to
promote itself,” said Gullekson.
He added it gives people a reason
to come to Lacombe.
“It sort of puts you on the
map,” said Peakman.
It’s a chance to promote the
sport of curling itself as well.
Peakman said that some of the
local schools will be coming to
the event in hopes that it will
generate some interest in curling
among the younger generation.
“We’ve got junior curlers that
have probably never seen a pro-
fessional curler or anything like
that live,” said Peakman.
Some of the best curlers in the
country, if not the world will be
coming to Lacombe to participate
in the event. Peakman added that
Alberta is well known for creat-
ing strong curling teams.
“Alberta is known for being
really strong in this fi eld,” said
Peakman.
Lacombe hosting the BP Cup
has been a process that has taken
nearly three years. Gullekson
said the club fi rst started ex-
changing emails with Alberta
Curling Federation Executive Di-
rector Jim Pringle in 2011.
Two things are necessary to
host a successful BP Cup, said
Gullekson, a dedicated group of
volunteers and the proper facil-
ity.
He added he knew going into
this that the club would support
the bid to host the BP Cup and
they could make it a successful
event. That support has spread
beyond just the curling club,
Gullekson added, as evidenced
by the committee for the BP Cup
which is made up of more than
just curling club members.
“There are some people from
the community itself that feel the
event is important.”
Peakman agreed that there is a
great amount of support behind
the club and the event. She added
that Gullekson has done a great
job of spearheading that support.
“It takes that person to get the
ball rolling.”
One of the fi rst thing that hap-
pened after Lacombe Curling
Club began talks with the AFC
was a walkthrough with Pringle
through the Barnett Arenas.
After that, the AFC actually en-
couraged Lacombe Curling Club
to host the event, said Peakman.
She added that Lacombe’s central
location made it a good place to
host the BP Cup.
For more information, visit
www.2014bostonpizzacup.com.
Lacombe gets set to host 2014 BP Cup
HURRY HARD - Ian Foster sweeps in a rock as his opponent, Sandy Phillips, looks on during a game of stick curling on Monday. Brian Vossen/Lacombe Express
18 Lacombe Express Thursday, November 28, 2013
BY BRIAN VOSSENLacombe Express
For the third year in a
row, the Lacombe Explo-
sion are the Alberta Pee
Wee provincial champions.
Last Saturday at Shouldi-
ce Athletic Park in Calgary,
the Explosion defeated the
Cochrane Lions 35–7 to win
claim the title once again.
Explosion Head Coach
Fred Knip said that the
feeling of winning a cham-
pionship, while familiar, is
always welcome.
“It does not get old. It’s
exciting. These players ac-
complished something.”
Both teams came into the
game undefeated.
Cochrane boasted a 9-0
record while the Explosion
had one more win with a
10-0 record, said Knip.
Cochrane claimed fi rst
blood by scoring within the
fi rst minute of the game af-
ter recovering a Lacombe
kick-off fumble.
After the conversion the
scoreboard read 7-0 in fa-
vour of the Lions, however,
it would be the last points
they scored.
Knip said the players
were very upset that their
opponents had capitalized
off a Lacombe mistake and
scored so early in the game.
“They thought, ‘What is
going on here?’”
Knip however, was some-
what glad the mistake was
made so early in the game,
he said.
“My fi rst reaction was,
well good, we go that out of
the way.”
While fumbling the kick-
off and enabling Cochrane
to score fi rst did not make
for a good Lacombe start,
the Explosion would more
than make up for its mis-
take and would do so quick-
ly.
On the very next kick-
off, Richard Jans ran the
ball 82 yards and scored to
put Lacombe on the board
making the score 7-6.
Jans was the player who
had fumbled the ball on the
previous play, said Knip
and as such Jans was both
angry with himself and
very eager to make up for
his mistake.
Knip added that, while
the players may have been
a bit shaken by their unfor-
tunate start, he had confi -
dence that his team could
persevere.
“These boys, they be-
lieved that they could do
it,” said Knip. “One step at
a time, one play at a time,
they did it.”
Cochrane marched the
ball to the Explosion one
yard line before fumbling
it and allowing Ryker Lunn
to recover the ball.
On the next play Jans
took the ball on an off-
tackle hand-off and ran 109
yards for another Lacombe
touchdown.
After a successful one-
point conversion, the score
was 13-7 in favour of La-
combe at the end of the
fi rst quarter.
In the next quarter, La-
combe continued to gain
momentum.
Jans added two more
runs of 32 and 26 which al-
lowed Simon Gray to sprint
in for a third Lacombe
touchdown.
A two-point conversion
then made the score 21-7 for
the Explosion.
Three minutes later Jans
ran 68 yards for his third
touchdown of the game.
The scoreboard read 29-7
for Lacombe at halftime.
Knip said that he didn’t
expect or intend for the
game to end in a blow-out,
but that the Lions showed
their fatigue as the Explo-
sion kept up the hard pace.
In the second half, the
Explosions changed their
tactics to kill the clock
and held off the Cochrane
Lions in a ‘bend, but do
not break,’ defense. Valu-
able time was eaten up and
neither team scored in the
third quarter.
Knip said conditions
played a big part in the
game, particularly in the
second half.
“Their players were fall-
ing like fl ies,” said Knip of
the Lions.
He added that the Lions
were not able to keep up
with Lacombe as the Ex-
plosion, knowing they had
a shorter bench, had put
heavy focus on condition-
ing the last few practices.
In the fourth and fi nal
quarter, Lacombe kept
the ball on the ground and
continued to kill the clock
while preventing the Lions
from moving forward at all.
With 3:23 left in the game,
Josh Green took a hand-off
and marched eight yards to
the end zone to make the fi -
nal score 35-7 for Lacombe.
Lacombe Explosion captures third straight provincial title
HARD EARNED HARDWARE - Explosion players Eric Nikolai, Ryker Lunn, Simon Gray, Brett Sletten and Richard Jans, display their provincial medals and trophy after capturing the team’s third provincial title last weekend in a 35-7 victory over the Cochrane Lions. photo submitted
Enjoy a Enjoy a luxurious luxurious night at night at Western Western Budget Budget Motel!Motel!
4205 64 St. 403-783-8382
PonokaPonoka
SPORTS
Thursday, November 28, 2013 Lacombe Express 19
Saturday, November 30, 2013 10:00am – 4:00 pmLacombe Memorial Center (50 Avenue & 52 Street)
Crafter Faire & Home Based Business Faire, Numerous Christmas Shopping Gifts available,many new as well as returning vendors this yearEvent Admission: Food or Money
donation to the Local Food BankEvent Contact Number:
403-782-4323
Horoscope
Aries, delay your plans
for the time being. A
number of unexpected
tasks that will require
your undivided
attention in the coming
day, so clear your
schedule.
Assume the role of the
strong and silent type
this week, Taurus. You
do not have to share
your opinions with
everyone, as an air of
mystery may boost
your popularity.
It can be easy to allow excitement to overtake
your logic, Gemini. But you need to be
patient and not allow exuberance to interfere with the tasks at hand.
That is a recipe for trouble.
Cancer, a hefty
workload at the offi ce
may zap your desire
to do much else.
However, don’t pass up
the opportunity when
a social engagement
beckons this week.
Leo, you will have to
continue your rather
hectic pace this week,
even when you start to
feel tired. Fortunately,
you are excited about
some of the things on
your to-do list.
Virgo, getting involved
with the right people
now opens doors that
previously may have
been closed to you.
Do not squander the
opportunity to use
these new contacts.
Libra, confl icting
emotions arise in the
week ahead. You have
the desire to fulfi ll
people’s expectations
of you, but you also
just want some time to
yourself.
Scorpio, maintaining
your focus on chores
is nearly impossible
this week, when you
are easily distracted
by anything else that
sounds interesting. Try
to get your work done.
Reestablish your
priorities, Sagittarius.
Doing so will help you
live up to your end of
the bargain on various
commitments. If
necessary, ask others
for help.
Expect to be busy for the rest of the month, Capricorn.
With potential birthday celebrations
and holiday tasks to complete, spare
moments are few and far between.
Aquarius, learning a
new skill this week
will only add to your
already vast repertoire
of abilities. This is one
more reason to have a
positive attitude.
Emphasize feeling
good about yourself
this week, Pisces.
Doing so will enable
you to help others in
the near future.
ARIESMar 21/Apr 20
TAURUSApr 21/May 21
GEMINIMay 22/Jun 21
CANCERJun 22/Jul 22
LEOJul 23/Aug 23
VIRGOAug 24/Sept 22
LIBRASept 23/Oct 23
SCORPIOOct 24/Nov 22
SAGITTARIUSNov 23/Dec 21
CAPRICORNDec 22/Jan 20
AQUARIUSJan 21/Feb 18
PISCESFeb 19/Mar 20
ANSWER
CLUES ACROSS 1. Regions 6. Abu __, UAE
capital 11. Forever 13. Lower position 14. Masterpiece
series 18. Atomic #18 19. Cuckoos 20. Goat with conical
horns 21. European money 22. Flaw the surface 23. Restaurant bill 24. Indicated
horsepower (abbr.)
25. Go in advance 28. Ancient Egyptian
King 29. Insert mark
31. Palm fruits 33. Peels a fruit’s
skin 34. Many not ands 35. Cathode-ray
oscilloscope 36. Bo __, “10” 38. Satisfi es to
excess 40. More dry 41. Of he 42. Lay a tax upon 45. Ed Murrow’s
home 46. Newsman Rather 47. Swiss mountain 49. Till 50. Potato, tossed or
green 52. Italian automaker 53. Birthplace of
Abraham 54. Scheduled visits
57. Yemen capital (alt. sp.)
59. Assisted 60. Persian kings 61. Accumulate
CLUES DOWN 1. Unkeyed 2. Recable 3. Sea eagles 4. Small social
insect 5. __ Paulo, city 6. 2 man fi ght 7. Honey (abbr.) 8. Anno Domini 9. Malibu and
Waikiki 10. To burst in 11. Mild yellow
Dutch cheese 12. Liquefi ed natural
gas 15. Douroucoulis 16. Spoiled child 17. Founder of Babism 21. Ireland 26. Love intensely 27. One who confronts
boldly 28. Atomic #52 29. Feels concern or
interest 30. Got up from 32. Sound of
disappointment 33. Out of 100 (abbr.) 36. Actress Kerr 37. Irish Gaelic 38. 10
Commandments mountain
39. Morning
40. Straight downhill ski run
41. Angel’s crown 43. Canonized
individuals 44. Old school tablets 46. Dip lightly into
water 48. Traumatic anxiety
disorder 50. Mineral spring
resorts 51. Desoxyribonucleic
acid 52. Greek cheese 54. Express pleasure 55. Don’t know when
yet 56. 13th Hebrew letter 58. Chinese tennis
star Li
HOW TO PLAY:
Fill-in the grid so that every row, every column and every 3x3 box contains the numbers 1 through 9 only once.Each 3x3 box is outlined with a dark-er line. You already have a few num-bers to get you started. Remember: You must not repeat the numbers 1 through 9 in the same line, column or 3x3 box.
ANSWER
20 Lacombe Express Thursday, November 28, 2013
Central Alberta Co-op English Estates Centre – Lacombe English Estates Centre – Lacombe 403-782-6200403-782-6200
OpenOpen Daily until 9pm Daily until 9pm www.centralab.coopwww.centralab.coop
Bartlett PearsBartlett Pears
Co-op Gold FruitFruit
Habitant Habitant SoupSoup
Unico TomatoesUnico Tomatoes
Grimm's Smoked Grimm's Smoked Pepperoni SticksPepperoni Sticks
Sun-Rype – Sun-Rype – FruitsourceFruitsource
Mitchell's Sliced Mitchell's Sliced Side BaconSide Bacon
Snack Pack PuddingSnack Pack Pudding
Co-op Gold 100% Co-op Gold 100% Juice or Five-liciousJuice or Five-licious
Powerade Ion4Powerade Ion4
Co-op Co-op PerogiesPerogies
Green Giant Simply Green Giant Simply Steam VegetablesSteam Vegetables
Schweppes, Dr. Pepper, Schweppes, Dr. Pepper, Mountain Dew, Mug Root Beer, Mountain Dew, Mug Root Beer,
Crush or Lipton Brisk Crush or Lipton Brisk
10 for$10
10 for$10
10 for$10
10 for$10
10 for$10
3 for$10
3 for$10
10 for$10
10 for$10
10 for$10
10 for$10
10 for$10
10 lbs for
$10
forsale
FRIDAY, November 29 to THURSDAY,
December 5, 2013
Green Variety - No 1 Grade - Produce of Washington
Selected Varieties - 398ml - First 10
796ml First 10
796ml or Chick Peas or Beans 540ml First 10
Original, Honey Garlic, or Hot
30-37g - First 10
500g
12 pack
1L First 10
946m First 10
Frozen, 226-250g First 10
plus deposit/enviro
plus deposit/enviro plus deposit/enviro
Selected Varieties - Frozen - 600g First 10
10%Tuesday December 3rd
November WinnersLacombe: Sean Ingram ................................................$260.58Deer Park: Bev Schultz .......................................................$77.24 Plaza: Trent Hummel ..................................................................$20.41Innisfail: Dan Rieberger..............................................$203.70Spruce View: Karen Watters .................................$26.53
Save 10% on your grocery
purchases and enter
to win your entire purchase
back!
2L First 10