kidney hyaluronan172039/fulltext01.pdf · the entire plasma volume is filtered and processed about...

ACTA

UNIVERSITATIS

UPSALIENSIS

UPPSALA

2008

Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 351

Kidney Hyaluronan

Regulatory Aspects During Different States of BodyHydration, Nephrogenesis & Diabetes

LOUISE RÜGHEIMER

ISSN 1651-6206ISBN 978-91-554-7199-6urn:nbn:se:uu:diva-8724

�� ! �� "�#"$ %� �&� �� % ��% '&��&� (�� % ��)* +&� �� ,�� -,��&*

��

./�&�� 0* � !* 1�� * .�� 2�� %%�� -�� %�� 3��&�� 4 ��* 2�� * �� $"* 5��* ��* 6-�3 78!97"9$$�98"7795*

+&� :�� &� �� % ,�� ,&��& �� &�� % �� * �� &�� &�� ,��&� �&� :�� %�� &� ��*�� &�� &�� &� �� % �� &��

� �� %�� &��& �� ,�� *+&� �� % �&�� &�� ,�� , ��&� �� &� �� % ��

&�� %%�� % �� &�� % :�� *��&�� &�� ,��& �� &��

��&�� &�� * 2�� &�� &�� &�� ;�� * �� &�� &��* +&� �� %&�� %� �� ,�� % �&� �� *�* %��*�&�� &�� &�� &,�� &��

:�� &��* +&� �� &�� 66 �� &�� & �� %��* 6% ��66 �� :�� ,��& � 2�< �&�� &�� ,&��& �� %�� &� :��*.�� &�� ,&��& �� ,��&

�� % &�� &�� .32� &�� * +&� �� % &�� %��&�� ,�� &��* +&� &��&�� % &�� &� �� % �� &��&�*+&�� &�� &�� , ��&�� &�� &� �� % ��

&�� % %�� &��*

� �� &�� :�� &�� &�� &�� &�� &�� &�� 66� �� & ��

�� !�� " � �� #��" #$ %&'" �� "�()&%'*+ ��" ��

= 0�� ./�&�� !

6--3 "5$"95� 56-�3 78!97"9$$�98"7795��#�#��#��#��9!8�� (&��#>>��*:�*��>��?��@��#�#��#��#��9!8��)

3

List of Papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals:

I. Hormonal Regulation of Renomedullary Hyaluronan. Rügheimer L, Johnsson C, Maric C, and Hansell P Acta Physiol (Oxf.) 2008, In press.

II. Hyaluronan Synthases and Hyaluronidases in the Kidney During Changes in Hydration Status. Rügheimer L, Olerud J, Takahashi T, Shimizu K and Hansell P In manuscript 2008.

III. ACE Inhibition During Completion of Nephrogenesis Obstructs Neonatal Dissipation of Interstitial Hyaluronan, not Correlated to Lymph Vessel Expression. Hansell P, Rügheimer L, Åstrand ABM, Johnsson C, Friberg P and Kerjaschki D In manuscript 2008.

IV. Renal Hyaluronan Content During Experimental Uncontrolled Diabetes in Rats. Rügheimer L, Carlsson C, Johnsson C and Hansell P J Physiol Pharmacol 2008; 59(1): 115-128.

Reprints of papers and figures are with permission from the

publishers, Paper I from Blackwell Publishing and Paper IV from

Polish Physiological Society.

4

Vita non est vivere sed valere vita est

5

Contents

Abbreviations .................................................................................................. 7�

Introduction ..................................................................................................... 9�The Kidney ................................................................................................. 9�

Vasopressin/ADH/AVP ......................................................................... 9�The renin-angiotensin system (RAS) ..................................................... 9�Nitric oxide (NO) ................................................................................. 10�Prostaglandins ...................................................................................... 10�

Hyaluronan ............................................................................................... 11�Hyaluronan receptors ............................................................................... 12�Turnover of hyaluronan - Synthesis ......................................................... 12�Turnover of hyaluronan - Catabolism ...................................................... 13�The role of hyaluronan in the kidney ....................................................... 14�

Renomedullary interstitial cells (RMIC) ............................................. 16�Nephrogenesis – postnatal development .................................................. 16�Diabetes mellitus ...................................................................................... 17�Animal model of diabetes ........................................................................ 18�

Aims .............................................................................................................. 19�

Materials and Methods .................................................................................. 20�Animals .................................................................................................... 20�Treatment with ACE-inhibitor enalapril (Paper III) ................................. 20�Induction of diabetes (Paper IV) .............................................................. 20�Anesthesia ................................................................................................ 21�Surgical procedures .................................................................................. 21�Experimental protocols in vivo ................................................................. 21�

Experimental protocols in vivo (Paper I) ............................................. 22�Experimental protocols in vivo (Paper II) ............................................ 22�Experimental protocols in vivo (Paper IV) .......................................... 22�

Hyaluronan analysis and determination of water content ........................ 23�Histochemistry ......................................................................................... 23�

Staining for hyaluronan ....................................................................... 23�Staining for CD44 ................................................................................ 24�Staining for podoplanin ....................................................................... 24�Staining for LYVE-1 ........................................................................... 25�

6

Morphology .............................................................................................. 25�Urine analysis ........................................................................................... 25�

Hyaluronidase activity measurements ................................................. 25�HAS 2 mRNA isolation and preparation of cDNA .................................. 26�Gene expression analyses ......................................................................... 26�

Analysis of HAS 1-3 mRNA expression (Paper II) ............................. 26�Analysis of HAS 2 mRNA expression (Paper IV) .............................. 27�

RMICs in culture (Paper I) ....................................................................... 28�Experimental protocol in vitro (Paper I) .................................................. 28�Statistical analysis .................................................................................... 29�

Results ........................................................................................................... 30�Hormonal regulation of renomedullary hyaluronan (Paper I) .................. 30�Hyaluronan synthases and hyaluronidases in the kidney during changes in hydration status (Paper II) ........................................................................ 32�ACE inhibition during completion of nephrogenesis obstructs neonatal dissipation of interstitial hyaluronan, not correlated to lymph vessel expression (Paper III) ............................................................................... 35�Renal hyaluronan content during experimental uncontrolled diabetes in rats (Paper IV) .......................................................................................... 38�

Discussion ..................................................................................................... 41�The role of hyaluronan in homeostasis ..................................................... 41�Hyaluronan and different states of body hydration .................................. 44�

Heterogeneous distribution of hyaluronan in nephrogenesis ............... 47�Water handling in the diabetic kidney ................................................. 50�

What regulates renal hyaluronan? ............................................................ 52�

Conclusions ................................................................................................... 53�

Svensk sammanfattning / Summary in Swedish ........................................... 54�

Acknowledgement / Tack! ............................................................................ 56�

References ..................................................................................................... 59�

7

Abbreviations

ABC Avidin biotin complex ACE Angiotensin converting enzyme Ang II Angiotensin II ANOVA Analysis of variance AQP Aquaporines AT1-receptor Angiotensin II receptor type 1 AT2-receptor Angiotensin II receptor type 2 AVP, ADH Vasopressin, Antidiuretic hormone BG Blood glucose bw Body weight CD44 A cell surface receptor for hyaluronan cDNA complementary deoxyribonucleic acid cGMP Cyclic guanosine monophosphate COX Cyclooxygenase Da Dalton dw Dry weight ELISA Enzyme-Linked Immunosorbent Assay eNOS endothelial eNOS FITC Fluorescein isothiocyanate. a derivative of

fluorescein GlcNAC N-acetyl-D-glucosamine GlcUA D-glucuronic acid GLUT-2 Insulin-independent glucose transporter HA Hyaluronan (hyaluronic acid) HABP Hyaluronan binding protein HAS Hyaluronan synthase HYAL Hyaluronidase IL-1� Interleukin 1 beta INDO Indomethacin iNOS Inducible nitric oxide synthase L-NAME N-nitro-L-arginine methyle ester LYVE-1 A receptor for hyaluronan in the lymphatic

vessel endothelium MAPK Mitogen activated protein kinase MP Methylprednisolone mRNA Messenger ribonucleic acid nNOS neuronal nNOS

8

NO Nitric oxide NOS Nitric oxide synthase PBS Phosphate buffered saline PDGF Platelet derived growth factor PGE2 Prostaglandin E2 PKC Protein kinase C RAS Renin-angiotensin system RIA Radiometric assay RMIC Renomedullary interstitial cells SEM Standard error of the mean SDS Sodium dodecyl sulfate STZ Streptozotocin TBP A transcription factor that binds specifically to

the DNA sequence called TATA box TGF-� Transforming growth factor beta TNF Tumor necrosis factor UT-A1 Urea transporter A1 V1-receptor Vasopressin receptor type 1 V2-receptor Vasopressin receptor type 2 ww Wet weight

9

Introduction

The Kidney One of the most important functions of the kidneys is the maintenance of constant volume and composition of body fluids, which is essential for ho-meostasis. The kidney regulates the excretion of water and electrolytes so that it precisely matches a persons eating and drinking habits, thereby allow-ing the control of arterial blood pressure, which is achieved by several mechanisms involving hormones, nerves, intrarenal mechanisms and struc-tural components.

The entire plasma volume is filtered and processed about 60 times each day. The filtration of plasma and formation of urine takes place in the nephron, which is the functional unit of the kidney. The nephron contains a tuft of capillaries called the glomerulus, where fluid is filtered from the blood, and a tubule system, where the filtered fluid is converted into urine through reabsorption and secretion (Guyton and Hall, 2000).

Vasopressin/ADH/AVP The permeability of water changes along the tubule. The fine-tuning of water permeability takes place in the distal tubules and in the collecting duct in the medulla, where permeability can change from low to high depending on the level of antidiuretic hormone/vasopressin (ADH/AVP). AVP is one of the major hormones involved in the regulation of renal fluid balance. The hor-mone causes structural changes providing temporary water channels to be inserted in the apical membrane called aquaporines (Nielsen et al., 1993). During maximal variation in plasma AVP, urine output can change between 0.5 l/day (high AVP-levels) to more than 20 l/day (low AVP-levels) (Guyton and Hall, 2000).

The renin-angiotensin system (RAS) RAS was first described in 1898 by Tigerstedt and Bergman (Tigerstedt, 1898). Angiotensinogen is converted through renin to angiotensin I, which is further converted into angiotensin II (Ang II) with angiotensin converting

10

enzyme (ACE). Renin is released from the juxtaglomerular cells in the kid-ney and ACE is predominantly found in the lung, and in kidney and heart.

Ang II is the part of the RAS responsible for physiological functions, and is a potent vasoconstrictor and contributing to the maintenance of both short-term and long-term blood pressure regulation. Ang II also increases sodium reabsorption in the kidney, resulting in decreased excretion of salt and water, either via an effect on the tubular epithelial cells or through increased aldos-terone secretion (Guyton and Hall, 2000).

The RAS is up-regulated during renal development and in the perinatal period (Guron and Friberg, 2000, Wolf, 2002)

ACE inhibition is commonly used as treatment for patients with hyperten-sion and diabetes. ACE inhibitors prohibit the conversion of angiotensin I to Ang II and thereby exclude the effects of Ang II and aldosterone i.e. lower-ing blood pressure. ACE inhibitors are not recommended for pregnant wom-en due to fetopathy (Shotan et al., 1994, LIF, 2006).

Nitric oxide (NO) NO is formed, along with L-citrulline, in an enzymatic reaction between molecular oxygen and L-arginine. NO has a wide range of effects in the body ranging from the cardiovascular system (vasodilator) to host defence system. The half life of NO is short.

There are three known isoforms of nitric oxide synthase (NOS): neuronal nNOS, inducible iNOS, and endothelial eNOS. iNOS is constitutively ex-pressed in the kidney, and nNOS is expressed in the macula densa cells, in the medullary thick ascending limb, inner medullary collecting duct and in the principal cells of the cortical collecting duct (Thorup et al., 1993, Ahn et al., 1994, McKee et al., 1997, Wang et al., 1998).

N�-nitro-L-arginine methyle ester (L-NAME) is an unselective NOS inhi-bitor and a structural analogue of L-arginine. Inhibiton of NOS results in increased blood pressure due to increased vascular resistance. In the kidney, this leads to decreased glomerular filtration rate and decreased renal blood flow (Charlton and Baylis, 1990).

Prostaglandins Prostaglandins belong to the eicosanoids and are formed from arachidonic acid, which can be blocked with cyclooxygenase (COX) inhibitors. COX is the enzyme needed for the synthesis of prostaglandins from arachidonic acid. Prostaglandins are local mediators that attain biologically effective concen-trations only at their site of formation, as they rapidly degrade in the lung when circulating with plasma. The biological effects differ widely and range from vasoconstriction to uterine contractions during labour.

11

Prostaglandins stimulate hyaluronan synthase and when blocked with a COX inhibitor result in an absence of an otherwise occurring increase in hyaluronan during hydration (Rügheimer et al., 2008b).

Hyaluronan

Hyaluronan (HA) is a major structural component of the extracellular matrix and belongs to the family of glycosaminoglycans. HA is a linear, high mole-cular weight polysaccharide composed of repeating disaccharide units of D-glucuronic acid (GlcUA) and N-acetyl-D-glucosamine (GlcNAc) (Figure 1).

Figure 1. The repeating disaccharide units of hyaluronan.

If stretched end-to-end, one molecule would be 20 mm long, but individual segments of a HA molecule fold into a rod-like conformation because of the � linkages and extensive intrachain hydrogen bonding between adjacent sugar residues (Lodish, 2002). HA is negatively charged due to ionization of the carboxylgroups of the glucuronic acid constituents at physiological pH (Laurent and Fraser, 1992). The repulsion between the negatively charged carboxylate groups that protrude outward at regular intervals also contributes to the structure of the molecule (Lodish, 2002). Unlike other glycosaminog-lycans, HA is neither sulfated nor does the primary structure contain peptide (Laurent and Fraser, 1992).

The negatively charged network attracts cations, for example Na+, that give HA high osmotic activity and attract large amounts of water through osmosis. When HA in solution reaches a concentration of approximately 0.1 mg/ml, the molecule can form an entangled network: one gram of HA binds up to one liter of water. Given no constraints, an HA molecule will occupy a volume about 1000 times the space of the molecule itself. When placed in a confining space, such as in the extracellular matrix, the HA molecule will push outward, creating a turgor pressure that increases with the amount of water in the gel (Lodish, 2002).

12

HA is implicated in basic biological processes such as cell proliferation, differentiation, and migration. In pathological processes with enhanced extracellular matrix metabolism, such as rheumatoid arthritis and cancer, HA is recognized as one of key participants (Toole et al., 2001).

Hyaluronan receptors HA interacts with cell surface receptors (Toole, 2000). Several HA receptors have been identified: CD44, RHAMM (receptor for HA mediated motility), LEC (liver endothelial cell clearance receptor), HARE (HA receptor for endocytosis), layilin and LYVE-1 (HA receptor in the lymphatic vessel en-dothelium) (Zhuo, 2000, Bono et al., 2001, Jackson, 2003).

CD44 is the best studied and most common HA receptor found in a varie-ty of cells (Toole, 1990, Underhill, 1992, Lesavre et al., 1997). The CD44 receptor is a transmembrane glycoprotein and consists of four functional domains. The receptor is known to participate in matrix-cell signaling, cell migration, cell-cell aggregation and receptor mediated internaliza-tion/degradation of HA (Culty et al., 1992, Hua et al., 1993).

HA binds not only to these surface receptors but also to aggrecans, which are peptide cores associated with glycosaminoglycans, and other proteins in the extracellular matrix. The binding is reinforced by small link proteins that aggregate onto the HA chain. Binding to these proteins is considered impor-tant, for the arrangement and modulation of the extracellular matrix.

Turnover of hyaluronan - Synthesis There are three homologous mammalian HA synthases known as HAS 1-3 (Spicer et al., 1996, Weigel et al., 1997, DeAngelis, 1999). They have im-pressive catalytic activity and can polymerize about 100 monosaccharide/sec in vitro (Varki, 1999). HAS 1 and HAS 2 polymerize HA chains of similar lengths between 2x105 – 2x106 Da, whereas HAS 3 polymerize shorter HA chains, in the range of <2x105 Da to 3x105 Da (Figure 2).

HA chains of different lengths have different effects on cell behavior. Short HA chains stimulate cell proliferation and initiate signaling cascades; they may be involved in angiogenesis and inflammatory responses. High-molecular-weight HA chains are antiangiogenetic and have the opposite effect of inhibiting cell proliferation (Comper and Laurent, 1978, West et al., 1985, Laurent and Fraser, 1992, Deed et al., 1997, Slevin et al., 1998, Lo-keshwar and Selzer, 2000).

HA synthases are found in the inner part of the plasma membrane and newly synthesized HA is extruded into the extracellular space (Prehm, 1984, Philipson and Schwartz, 1984). Renomedullary interstitial cells (RMICs) are

13

major producers of HA and the level of HA in the supernatant of RMICs in culture changes according to the osmotic power of the culture media (Han-sell et al., 1999, Göransson et al., 2001).

Figure 2. A schematic picture of a cell synthesizing hyaluronan. HAS 1 produces small amounts of high-molecular-weight hyaluronan. HAS 2 produces more high-molecular-weight hyaluronan. HAS 3 is the most active of the hyaluronan synthases, yet produces low molecular weight hyaluronan chains.

Turnover of hyaluronan - Catabolism Hyaluronidases (HYAL) are a family of enzymes involved in the degrada-tion of HA (Fraser et al., 1997). They have a wide range of properties, in-cluding differences in size, inhibitor sensitivities, catalytic mechanisms, substrate specificities and pH optima (Kreil, 1995, Frost, 1996, Csoka et al., 2001). There are six known human isoforms of HYAL (Bollet et al., 1963, Kreil, 1995, Sun et al., 1998, Csoka et al., 2001).

Normal turnover of plasma HA is about 15-35% a minute (Knepper et al., 2003) and tissue half-life of HA ranges from 0.5 to 3 days. When reaching the blood stream, 85-90% of HA is eliminated in the liver by receptor-facilitated uptake. The kidney extracts about 10% but excretes only 1-2% in the urine. The lymph nodes have a capacity for extraction and catabolism of HA. The lymphatic system is only present in the renal cortex (not in the me-dulla), where it can drain the interstitium of larger molecules, such as HA.

The levels and/or expression of HYALs are changed in the tissues, sera, or urine in cases of disease, such as cancer and diabetes (Lokeshwar et al., 1996, Bertrand et al., 1997, Tamakoshi et al., 1997, Lokeshwar et al., 1999, Laudat et al., 2000, Ikegami-Kawai et al., 2004). The role of these changes in the pathogenesis of these diseases are not clear.

The CD44 receptor is involved in the turnover of HA through uptake and intracellular breakdown by acid hydrolysis in lysosomes, as has been shown for macrophages, cultured fibroblasts and chondrocytes (Culty et al., 1992,

14

Hua et al., 1993). The process involves HA being tethered to the cell surface by CD44 in caveolin-enriched invaginations. It is cleaved to 20 kDa frag-ments by HYAL 2 on the plasma membrane, endocytosed, and ultimately delivered to low pH intracellular organelles/lysosomes, where it is further digested by HYAL 1 (Formby and Stern, 2003).

Many biological systems are under negative control. Stimulation of syn-thesis does not usually occur when quick responses are required; instead, there is a release from negative control. Inhibition of catabolism by HYAL inhibitors may be responsible for the release from negative control and quick rate of HA increase. Little is known about HYAL inhibitors, but levels of HYAL inhibitors are elevated in the serum of cancer patients and in liver disease (Mio and Stern, 2002, Stern, 2004).

The role of hyaluronan in the kidney HA is found predominantly in the renal inner medulla (papilla), whereas, in the renal cortex, HA content is low and only about 1-3% of that in the renal medulla (Wells et al., 1990, Johnsson et al., 1996, Hansell et al., 2000, Göransson et al., 2002) (Figure 3). This heterogeneous distribution is impor-tant for the ability to produce concentrated or dilute urine during normal physiological conditions. HA plays an important role in water homeostasis through the distribution and movement of water (Fraser et al., 1997), and together with AVP regulated aquaporins to determine water reabsorption in the medullary structures.

HA and water form gel-like structures at low HA concentrations (about 0.1 mg/ml), which in turn create a swelling of the extracellular matrix. The gels formed have different pore sizes and charge density: they are selective and can regulate the traffic of molecules and cells according to their size and/or charge (steric exclusion) (Alberts, 2002). The renomedullary content of HA in the rat during baseline conditions has been calculated to about 0.6 mg/ml (Hansell et al., 2000) i.e. the medullary interstitium behaves as a gel. The antagonism of water reabsorption by interstitial HA may involve changes in the interstitial hydrostatic pressure. Elevations in HA decreases water transport and an intraperitoneal injection of HA decreases peritoneal fluid absorption (Wang et al., 1998, Wang et al., 1999). In the interstitium, HA diminishes the water permeability of the membrane (Lai-Fook and Brown, 1991, Zawieja et al., 1992).

15

Figure 3. Histochemi-cal staining for inters-titial hyaluronan (HA) in sections of renal cortex and medulla from control animals. The renal cortex (upper panel) is vir-tually devoid of HA and contains only a few percent of that in the medulla (lower panel). The interstitial HA is seen as dark-brown staining Bar represents 50 μm.

When urine is formed, the pelvic wall contracts in order to force the urine out of the kidney and down along the ureter. This force compresses the HA gel structure in the medullary interstitium and can theoretically give rise to two types of effects for inner medullary concentration. One is the lowering of osmolality in the surrounding interstitial fluid and the other is to use the stored mechanical energy to drive water absorption from the tubule. HA may in this respect function as a mechano-osmotic transducer (Knepper et al., 2003). The contractions are shown in hamster papillas which are very long and thin (Pruitt et al., 2006). The effects are if any smaller in the rat or hu-man papilla that is wider and thicker.

HA is involved in water homeostasis, during acute hydration medullary HA increases (Hansell et al., 2000, Göransson et al., 2002), which can re-duce water reabsorption across the interstitium. In contrast, medullary HA

16

content decreases during water deprivation/dehydration leading to increased water reabsorption across the interstitium. This implies that the mechanisms by which HA regulates renal water handling are different to that of AVP, as the latter increases during water deprivations leading to increased insertion of aquaporins and water permeability. A tubular system with large amounts of AVP-regulated aquaporins situated in an interstitial environment with a reduced HA content should allow excessive water reabsorption. In 1958, Ginetzinsky found that the amount of hyaluronidase excreted in the urine increases during dehydration and drops to zero after hydration (Ginetzinsky, 1958). This suggests that elevated HYAL activity during dehydration reduc-es interstitial HA, and vice versa.

Under pathological conditions, HA is inappropriately regulated. During renal ischemia-reperfusion injury, tubulointerstitial inflammation and renal transplant rejection renal cortical levels of HA increase heavily, whereas, renal papillary levels are largely unaltered, which may contribute to the pa-thophysiology of the disease process (Johnsson et al., 1996, Nilsson et al., 2001, Göransson et al., 2004, Melin et al., 2006).

Renomedullary interstitial cells (RMIC) RMIC are major contributors of HA in the renal medulla. RMICs in culture produce less HA during hyperosmotic conditions than during iso- and hy-poosmotic conditions, supporting the in vivo observations that HA content decreases during dehydration and increases during hydration (Hansell et al., 1999, Göransson et al., 2001). Furthermore, CD44 expression on RMICs increases during hyperosmotic conditions and decreases during hypo-osmotic conditions (Göransson et al., 2001) and can provide a mechanism to increase/decrease the intracellular breakdown of HA, leading to changes in interstitial HA during dehydration and hydration. The AVP receptor V1 is present on RMICs (Zhuo, 2000). AVP increases PGE2 production in RMICs, and PGE2 increases HA production (Beck et al., 1980, Mahadevan et al., 1995). AT1 and AT2 receptors are found on RMIC (Maric et al., 1998).

Nephrogenesis – postnatal development Kidney development proceeds through a serious of three embryonic phases: pronephros, mesonephros and metanephros. The pronephros and mesoneph-ros appear early in gestation and mostly degenerate. In humans, the devel-opment of nephrons in the permanent kidney starts with the outgrowth of the uteric bud in metanephros at about 5 weeks of gestation. HA accumulates during the early and intermediate stages of metanephros. Pohl et al. (Pohl et al., 2000) propose that HA and CD44, together, constitute a morphoregulato-

17

ry pathway that plays a key role in sequential cycles of branching morpho-genesis in the uteric bud. When differentiation of the epithelium to mature tubules and renal corpus-cles occurs, an increase in hyaluronidase activity and a decrease in HA con-centration follows (Belsky and Toole, 1983). Nephron formation is complete between the 28th and 36th gestational weeks (Guron and Friberg, 2000).

Depending on size and concentration, HA can modulate branching mor-phogenesis and promote differentiation of both the collecting duct and neph-rons (Rosines et al., 2007).

The rate of fluid intake and excretion in the newborn infant is seven times greater in relation to weight than in the adult. In the infant, the rate of meta-bolism in relation to body mass is twice that in the adult (Guyton and Hall, 2000).

The osmotic gradient in the renal medulla is primarily composed of urea and sodium chloride. The concentration of urea is low in the neonate due to low dietary protein intake. The capacity of the thick ascending limb to reab-sorb sodium is low. The neonatal collecting duct does not respond to vaso-pressin due to fewer V2 receptors. Together, this has a role in the inability to concentrate urine to the same extent as an adult (Alpern, 2008).

ACE inhibition or AT1 receptor antagonist given during the perinatal pe-riod produces profound structural and functional abnormalities (Guron and Friberg, 2000, Matsusaka et al., 2002). This suggests Ang II involvement in nephrogenesis is different from the traditional effect of the hormone in fluid-electrolyte homeostasis and arterial blood pressure regulation.

Kidney development in the rat differs from humans in that nephrogenesis begins at embryonic day 12 and is complete 7-10 days after birth. In humans, nephrogenesis starts at day 22 of gestation and nephron development is complete week 28th to 36th, but functionally, the human kidney is not com-plete until 1 to 2 years after birth.

Diabetes mellitus Diabetes mellitus is a syndrome characterized by metabolic aberrations due to an absolute or relative lack of insulin. Type 1 diabetes mellitus is charac-terized by a loss of the insulin producing beta cells. Type 2 is due to a com-bination of an impaired beta cell function and peripheral insulin resistance. In Sweden, the prevalence for diabetes mellitus type 1 is 3% and type 2 is 0.5%. The incidence of type 1 diabetes in Sweden is 14/100 000 citizens per year (Apoteket, 2007). Over 50% of diabetic patients that survive for more than 20 years after diagnosis suffer late complications, such as retinopathy, neuropathy and nephropathy (Sutherland et al., 1993).

The development of diabetic nephropathy depends on the degree to which glycaemia is controlled (Sutherland et al., 1993). Diabetic nephropathy is the

18

most common cause of end stage renal disease, with about 265 new cases a year in Sweden (Apoteket, 2007). The changes in kidney function during diabetic nephropathy are partly due to structural changes of the glomeruli i.e. glomerulopathy as more extracellular substances are produced, which create a swelling of the matrix (Aurell, 1997). The expansion of the extracellular matrix is considered to be linked to enrichment with HA (Fraser et al., 1997).

Animal model of diabetes Streptozotocin (STZ) [2-deoxy-2-(3-methyl-nitrosourea)-1-D-glucopyranose] is a broad spectrum antibiotic produced by Streptomyces achromogenes and is widely used to induce diabetes type 1 in rats. STZ consists of a nitrosamine group linked to a glucose molecule. Because of the glucose molecule, STZ can enter the �-cell of the islets of Langerhans through the insulin-independent glucose transporter GLUT-2 (Schnedl et al., 1994). Once inside the cell, STZ acts an alkylating agent inducing DNA strand break (Gandy et al., 1982, Uchigata et al., 1982). STZ can alkylate proteins and important components necessary for ATP generation and is cytotoxic and nephrotoxic. However, Palm and co-workers (Palm et al., 2004) established that albumi-nuria, disturbed metabolic parameters, kidney function and kidney growth in this STZ-diabetic model are due to the response to hyperglycemia and not STZ-nephrotoxicity, although part of the proteinuria is due to STZ per se.

19

Aims

The overall aim was to provide new insight into the regulation of intra-renal hyaluronan during various conditions of hydration, completion of nephrogenesis and diabetes mellitus.

Paper I The aim of this study was to examine the involvement of hormones known to be regulators of renal fluid-electrolyte homeostasis on renomedullary hya-luronan content in vivo during normohydration and hydration and in vitro.

Paper II The aim was to elucidate possible mechanisms underlying the changes oc-curring in renal interstitial hyaluronan content during different states of body hydration. The changes in levels of hyaluronan, hyaluronan synthase (HAS) 1-3 mRNA, hyaluronidases (HYAL) 1-4 mRNA expression, and urinary hyaluronidase activity were examined.

Paper III The aim was to elucidate the normal turnover of hyaluronan during comple-tion of nephrogenesis in the rat in order to explain the normal heterogeneous distribution in the adult kidney, and, to gain a better understanding of the mechanisms underlying the accumulation of hyaluronan in the adult kidney after neonatal treatment with a blocker to the renin angiotensin system.

Paper IV This study was designed to investigate if hyaluronan is distributed different-ly within the kidney in uncontrolled streptozotocin-induced diabetic rats than in normal rats. Changes in mRNA level of the hyaluronan synthase (HAS 2) were investigated and the ability to respond with diuresis upon hydration during diabetic conditions was tested.

20

Materials and Methods

Animals All experimental procedures were conducted in accordance with the guide-lines of the Swedish National Board for Laboratory Animals and were pre-viously granted from the regional ethics committee for animal experiments.

The experiments were performed on 111 adult male Sprague Dawley rats, 55 adult male Wistar Furth rats (B&K Universal, Sollentuna, Sweden) and 42 pups from pregnant Wistar females, puchased at gestation day 15-16 (Møllegaard Breeding Centre, Copenhagen, Denmark). The animals were allowed free access to standardized chow (R3, Ewos, Södertälje, Sweden) and tap water. The pellet food contained 3 g/kg Na+, 8 g/kg K+ and 21% protein. The group of dehydrated animals in Paper II was without water 24 h prior to surgery. Three animals were housed in each Macrolone type IV cage (Papers I, II, IV). The rats were kept in standard animal rooms under stan-dard animal house conditions regarding lighting regime (12 h light: 12 h darkness), temperature (21±1ºC) and relative humidity (30-60%). The litters in Paper IV were kept together in cages in a room with controlled tempera-ture of 24°C, lighting and humidity as standard conditions.

Treatment with ACE-inhibitor enalapril (Paper III) The pups were given daily intra peritoneal injections of enalapril maleate (10 mg kg-1, Merck, Sharp & Dome, Sollentuna, Sweden) or the corresponding vehicle, isotonic saline (10 ml kg-1) from day 3–13 after birth. The rats were weaned until day 21 after birth.

Induction of diabetes (Paper IV) The animals were rendered diabetic by a single injection in the tail vein of STZ (45 mg/kg body weight (bw), Sigma-Aldrich, St. Louis, Missouri, USA) dissolved in an isotonic Ringer® solution (Fresenius Kabi, Halden, Norway). Seven days after the injection, and on the day of the surgery, the

21

tip of the tail was cut off and blood glucose level was determined with test reagent strips (Medisense® Blood glucose sensor electrode, Abbott Laborato-ries, Bedford, UK). The animals were considered diabetic if blood glucose level were �20 mmol/l. The time between the induction of diabetes and the experiments was four weeks. The control animals received a sham injection of isotonic Ringer® solution.

Anesthesia The animals in Papers I, II, IV were anesthetized with an intra peritoneal injection of Inactin® [5-ethyl-5-(1-methyl-propyl)-2-thio-barbiturate so-dium], 120 mg/kg bw for non-diabetic animals and 80 mg/kg bw for diabetic animals (Sigma-Aldrich, St Louis, MO, USA). Animals in Paper III were anesthetized by an intra peritoneal injection of pentobarbital sodium (Me-bumal®, 60 mg kg-1, Apoteksbolaget, Umeå, Sweden).

Surgical procedures The anesthetized animal was placed on a servo-controlled heating pad in order to maintain temperature at 37.5ºC throughout the surgery. Tracheot-omy maintained free breathing. Polyethylene catheters were inserted into the left femoral vein and artery. The vein catheter was used for substance ad-ministration and continuous infusion of saline or hypotonic glucose-saline. An arterial catheter was used for continuous mean arterial blood pressure measurements (Statham P23Dc, Statham Laboratories, Los Angeles, CA, USA) and for blood sampling. For urine sampling, the urinary bladder was catheterized through a suprapubic incision. In a group of animals in Paper I, vasopressin was infused through a needle (0.30 mm outer diameter) into the renal artery.

Experimental protocols in vivo After surgery, animals in Papers I, II and IV were allowed to recover for 45 min. After the experimental procedures, the kidneys were excised, weighed, and sectioned into cortex and papilla. Specimens used for HA analysis were put onto filter paper for 1½ min on each cutting edge and subsequently weighed (wet weight, ww) and then frozen at –70ºC until analysis for HA content.

The specimens used for gene expression were put into RNA-later® (Am-bion, TX, USA) after which they were frozen and stored at –20°C until analysis for hyaluronan synthase- and hyaluronidase- mRNA.

22

Directly after anesthesia, the kidneys from animals in Paper III were ex-cised, decapsulated and weighed. The left kidneys were treated as above for HA analysis and the right kidneys were fixed in formalin (4% PBS) and embedded in paraffin for determination of receptor expression.

All animals were euthanized with an intravenous injection of saturated KCl.

Experimental protocols in vivo (Paper I) Urine was collected during six consecutive 30 min urine collection periods, two control and four experimental periods. During the recovery and control periods, the animals received saline at 5 ml·h-1·kg-1 bw (euvolemia). The experimental periods were either euvolemic or hydrated/water loaded (hypo-tonic saline at 15 ml·h-1·kg-1 bw). In addition, animals were treated with the NOS inhibitor L-NAME (10 mg kg-1 bw bolus dose, 3 mg·h-1·kg-1 bw conti-nuously), (Sigma-Aldrich, St Louis, MO, USA) or, the unspecific COX inhi-bitor indomethacin, Confortid® (INDO) (5 mg·kg-1 bw: A/S Dumex, Copen-hagen, Denmark) or, AVP (10 ng bolus, 5 ng·min-1 continuously: Sigma-Aldrich, St Louis, MO, USA). In two final groups, glucocorticoid methyl-prednisolone (MP) (Depo-Medrol®, Pharmacia, Stockholm, Sweden) was injected subcutaneously (slow depot release) (1.5 ml·kg-1 bw). Seven days after injection, the animals underwent the same surgical and experimental protocol as described above for “euvolemia” or “hydration”.

Experimental protocols in vivo (Paper II) Urine was collected during six consecutive 30 min periods, two control (C1-C2) and four experimental (E1-E4) periods for the control- and the hydrated- animals. Urine was collected during 30 min (C1) for the dehydrated animals. During the recovery and control periods, the control- and hydrated- animals received saline at 5 ml·h-1·kg-1 bw (euvolemia). The experimental periods could be either euvolemic or hydrated (hypotonic saline at 15 ml·h-1·kg-1 bw). The dehydrated animals were not given an infusion and were deprived of water 24 h before the experiments. At the end of experiments, a blood sample was taken from all animals to measure hematocrite.

Experimental protocols in vivo (Paper IV) To compensate for fluid loss during and after surgery, the animals were giv-en a continuous infusion of an isotonic Ringer® solution at a rate of 5 ml·h-

1·kg-1 bw for non-diabetic animals, and at a rate of 10 ml·h-1·kg-1 bw for di-abetic animals. During the control period, all animals received the same in-fusion as under stabilization.

23

During four consecutive 30-minute experimental sampling periods, the rats received either:

1) Isotonic Ringer® solution, as during the control period 2) Hypotonic glucose saline solution-hydration (15 ml h-1·kg-1 bw, 100 mOsm·kg-1 H2O) (same rate to both non-diabetic and diabetic animals).

Blood samples were taken to measure systemic hematocrite, and urine was collected during all periods.

Hyaluronan analysis and determination of water content HA content in kidney specimens of cortex and papilla and in supernatants from RMICs in culture were measured by a commercial radiometric assay (RIA) (Pharmacia Diagnostics, Uppsala, Sweden). As, RIA was withdrawn from the market during the experiments, the samples from animals given MP and AVP and the appropriate control animals in Paper I and all animals in Papers II, IV were analyzed with an enzyme linked immunosorbent assay (ELISA) (Echelon Biosciences Inc., Salt Lake City, UT, USA).

Frozen specimens were lyophilized overnight and then reweighed (dry weight, dw). After grinding, HA was extracted from the tissue for 16 h with 0.5 mol/l NaCl following centrifugation for 15 min at 2700g at 4°C. Super-natants were stored at -70°C before measurement of HA by RIA or ELISA. The HA content in supernatants of RMICs in culture was correlated to the number of cells on each plate. The water content of the tissue in percent was calculated with the formula: (100 x (ww � dw)/ww).

Histochemistry

Staining for hyaluronan The kidney was fixed in 4% buffered formalin, at pH 7.3 and with 1% cetyl-pyridinium chloride (CPC), and stored at room temperature until dehydrated. Then, it was embedded in paraffin and sectioned into 4μm thick slices. Sec-tions of paraffin-embedded material were stained histochemically with an avidin-biotin-technique. The sections were rehydrated and incubated with 0.1% trypsin in 0.05 M Tris-HCl for 90 min. Subsequently, the sections were incubated with 3% H2O2 in PBS to block endogenous peroxidase, and with bovine serum albumin (10 mg/ml, Fraction V, Sigma-Aldrich, St. Louis, MO, USA) to block non-specific binding sites. One-hour incubation with biotin-labeled HA binding-proteins (HABP; Seikagaku Corporation, Tokyo, Japan) was followed by one-hour incubation with ABC Vectastain Reagent (Vector Laboratories, Burlingame, CA, USA). Finally, H2O2 (substrate) and

24

3-amino-9-ethyl-carbazole (AEC; electron donor) were added, and the sec-tions counterstained with Mayer’s hematoxylin. Control sections were incu-bated for two hours with Streptomyces hyaluronidase and then with either HABP or PBS.

Staining for CD44 Tissue was fixed in formalin (4% in PBS) and embedded in paraffin. Em-bedded tissue blocks were cut into 4μm thick sections. A purified mouse anti-rat CD44H (Pgp-1, H-CAM) monoclonal antibody (BD Pharmingen, San Diego, CA, USA) was used for localization of CD44. After deparaffini-zation and rehydration, the sections were boiled in citric acid buffer for 2 × 6 min in a microwave oven at a setting of 98°C at 750 W. When cooled, the slides were washed in distilled water, incubated with a solution of 0.06% H2O2 for 5 min and washed again. Then, 4 drops of avidin (Vector Laborato-ries, Burlingame, CA, USA) was mixed with normal rabbit serum 1:20 (DAKO, Denmark) and the slides were incubated for 15 min, followed by a wash in PBS. Biotin (Vector Laboratories, Burlingame, CA, USA) was used for blocking (15 min). Casein was mixed with PBS for 15 min, and then, experimental slides were incubated with the mouse anti-rat CD44 antibody at dilution of 1:100: the control slides were incubated with normal serum for 60 min. All slides were then rinsed for 2 × 10 min in PBS and incubated for 30 min with a 1:300 dilution of biotinylated rabbit anti-mouse antibody (DAKO, Denmark). After being washed for 2 × 10 min in PBS and incu-bated with a Avidin-Biotin complex reagent (Dako Cytomation, Glostrup, Denmark) for 5 min, the sections were washed for 5 min in tap water and incubated for 5 min in a solution of 3,3'-diaminobenzidine (Sigma-Aldrich, St. Louis, Missouri, USA). After a wash in tap water for 5 min, the sections were counterstained with Mayer’s hematoxylin, washed again in tap water, and finally dehydrated and cover-slipped. For photo documentation, a Leica DMR photomicroscope (Leica, Wetzlar, Germany) was used.

Staining for podoplanin Kidney sections (4μm thick) were stained by indirect immunoperoxidase, as described (Regele et al., 2000). Briefly, sections were deparaffinized in xy-lene, rehydrated, and microwave treated in citrate buffer at 600 W for 10 min. After washing in PBS, endogenous peroxidase was blocked by 3% hy-drogen peroxide for 15 min, followed by incubation with PBS containing 10% normal goat serum for 30 min. For immunostaining, specimens were incubated for 1 h with polyclonal rabbit anti-podoplanin sera diluted 1:500. Detection was with biotinylated goat anti-rabbit IgG for 30 min at 20°C, followed by streptavidin-peroxidase complex, according to manufacturer’s instructions (Vector Laboratories, Burlingame, CA, USA). Peroxidase reac-

25

tion product was visualized by diaminobenzidine (Serva, Heidelberg, Ger-many). Slides were counterstained with hematoxylin. Sections were incu-bated with FITC-conjugated rabbit anti-podoplanin IgG, biotinylated anti-rabbit IgG, alkaline-alkaline phosphatase conjugate, and Vector blue alkaline phosphatase kit III. All reagents were from Vector Laboratories (Burlin-game, CA, USA). The number of positive cells was counted in randomly selected medium power fields, 0.5 mm2 in diameter, with a microscope equipped for epifluorescence and a 10x objective.

Staining for LYVE-1 The same procedure as described above was used for podoplanin but immu-nostaining was with polyclonal rabbit anti-LYVE-1 sera, which was detected with FITC-conjugated rabbit anti-LYVE-1 IgG (Vector Laboratories, Bur-lingame, CA, USA).

Morphology Paraffin-embedded 4-�m-thick kidney sections were stained with eosin, Mayer’s hematoxylin (Paper III), periodic acid-Shiff and Picrosirius (Paper IV) for morphological evaluation. All slides were evaluated blind.

Urine analysis Urine volumes were measured gravimetrically and the flow (Vurine, μl/min) was calculated. Urinary osmolality (Uosm) was estimated from the depression of the freezing point (The Fiske® Micro-Osmometer, Model 210, Fiske® Associates, Norwood, Massachusetts, USA). Urinary sodium (UNa) and po-tassium (UK) concentrations were determined by flame photometry (Flame Photometer IL 543 (Metric), Instrumentation Laboratory, Milano, Italy).

Urinary glucose and protein concentrations were determined colorimetri-cally with an enzymatic assay for glucose (Roche Diagnostics GmbH, Mannheim, Germany) and a DC protein assay for protein (Bio-Rad Labora-tories, Hercules, CA, USA).

Hyaluronidase activity measurements Materials: HA from rooster comb and all reagents for polymerizing electro-phoretic gels was obtained from Wako Pure Chemical Industries (Tokyo); Alcian blue 8GX from Fluka Chemical (Buchs, Switzerland), pronase E (protease type xxv) from Sigma Chemical (St. Louis, MO, USA).

26

Urinary HYAL activity was determined by quantitative zymography with a slight modification (Ikegami-Kawai et al., 2004). Briefly, rat urine and rat serum, as a standard, were diluted 1-10 fold (rat urine) and 20 fold (rat se-rum) with 0.15 M NaCl and mixed with an equivalent volume of Laemmli’s sample buffer (Laemmli, 1970) containing 4% SDS and no reducing reagent. After incubation for 1 h at 37°C without heating, 2-15 μl of the mixture (urine: 0.2-7.5 μl, serum: 0.05-1 μl) were applied to 7% SDS-polyacrylamide gels containing 0.17 mg·ml-1 HA. After electrophoretic run at 25 mA for approximately 70 min at 4°C, gels were rinsed with 2.5% Tri-ton X-100 for 80 min at room temperature and then incubated on an orbital shaker (18 h at 37°C) with 0.1 M formate buffer (pH 3.5) containing 0.03 M NaCl. Gels were then treated with 0.1 mg/ml pronase E in 20 mM Tris-HCl buffer (pH 8.0) for 2 h at 37°C.

To visualize digestion of HA, gels were stained with 0.5% Alcian blue in 25% ethanol/10% acetic acid. After destaining, gels were counterstained with Coomassie brilliant blue R-250. For the determination of HYAL activ-ity, the stained gel was scanned on a VersaDoc 5000 imaging system with Quantity One software version 4.5 (Bio-Rad Laboratories, Hercules, CA, USA). The relative band intensities of rat urinary HYAL were calculated from the ratios to the band intensity of HYAL from 0.05 μl of a control rat serum, as a standard on the same gel.

HAS 2 mRNA isolation and preparation of cDNA Before preparation, the excised specimens were stored in RNA-later (QIAGEN, Merck Eurolab, Stockholm, Sweden). Tissues in Paper II were cut into pieces and homogenized with Lysing Matrix A system (Mp Bio-medicals, Solon, OH, USA). Total RNA isolation was performed with RNAquous-4 PCR Kit together with DNaseI treatment (Ambion, Austin, TX, USA) and cDNA was made with Superscript III (Invitrogen, Carlsbad, CA, USA). In Paper IV, RNA was isolated with an RNeasy mini kit (QIAGEN, Merck Eurolab, Stockholm, Sweden), according to the manufac-turer’s instructions. Synthesis of cDNA was by Reversed Transcription Sys-tem (Promega, Madison, WI, USA).

Gene expression analyses

Analysis of HAS 1-3 mRNA expression (Paper II) Amplification was obtained by a LightCycler system (Roche-Diagnostic, Lewes, UK) with DyNAmoTM Capillary SYBR green qPCR Kit (Finnzymes,

27

Espoo, Finland). The cycling program was at 95°C for 10 s, 55°C for 15 s and 72°C for 12 s. All genes analyzed were normalized against TATA box binding protein (TBP) at the threshold cycle values, CT values. The se-quences used are presented in Table 1. PCR products were verified on a 1.8 % agarose gel. Results were analyzed for each sample by relative quantifica-tion and the difference between sample and control crossing point (cp) val-ues was compared. To render a true value for each mRNA level, the calcu-lated difference was transformed according to 2(cpTBP-cpX).

Table 1. Primers used in the present study. All primers were purchased from MWG Biotech, Ebersberg, Germany. Gene Sense primer (5´-3´) Anti-sense primer (5´-3´) HAS-1 ATTGGGTAGGTGTAAGGAGAC CTCCAGGGCTACCTCATAAG

HAS-2 CACACATACACACACATACACC GTCTTTGTTCAAGTCCCAGC

HAS-3 CAGCACCTTCTCATGCATC TCTCCTCCAACACCTCCTAC Hyal 1 TCGGACCCTTTATCCTGAAC TTCTTACACCACTCTCCACTC

Hyal 2 CGTTACGTCAAGGCAGTCAG AGGTACACGGAGGGAAAGAG

Hyal 3 TGCACTGATGGAACACACAC ATATTATGCCAGCCATTGCCAC

Hyal 4 TCATGCCCAGAAGAGGAAG GTAGACAAATACGGGCAGAG

TBP ACCCTTCACCAATGACTCCTATG ATGATGACTGCAGCAAATCGC

Analysis of HAS 2 mRNA expression (Paper IV) cDNA synthesized was amplified with a LightCycler (Roche Diagnostics GmbH, Mannheim, Germany). Specific primers were designed by TIB Mol-Biol, Syntheselabor (Berlin, Germany). According to the LightCycler proto-col, 0.5 μl of the cDNA was amplified in a final volume of 10 μl, containing 5 μl Fast Start DNA Master SYBR Green (Roche Molecular Biochemicals, Mannheim, Germany) and 0.5 mM of the sense and anti-sense primers (HAS 2 - sense GCTCTATGGGGCGTTCCTC, antisense CCAGATGTAAGT-GACTGATTTGTCCC). The stability of expression of various housekeeping genes, such as TBP (Cybergene AB, Stockholm, Sweden) and G6PDH (TIB Molbiol Syntheselabor, Berlin, Germany) were assessed. As the TBP gene was the most constant for relative quantifications, it was used as reference in the real-time PCR protocol (TBP - sense ACCCTTCACCAAT-GACTCCTATG, antisense ATGATGACTGCAGCAAATCGC). LightCyc-ler Run version 5.32 was used with the following parameters: denaturation at 95°C for 3 min; amplification with a total of 45 cycles, each cycle with a

28

denaturation temperature at 95°C for 15 s; annealing temperature at 60°C for 10 s; and elongation temperature at 72°C for 15 s.

Controls were included in each run of the real-time PCR assay. For each primer pair, one sample with no cDNA (containing only RNase-free water) was included. Results were analyzed for each sample with relative quantifi-cation, the difference between sample and control crossing point (cp) values were compared. To render a true value for each mRNA level, the calculated difference was transformed according to 2-�(cpHas2-cpTBP) to yield the ratio Has 2/TBP.

RMICs in culture (Paper I) RMICs were isolated from kidneys of Sprague Dawley rats (80-90 g bw) with a method described by Fontoura et al. (1990) and modified by Maric et al. (Fontoura et al., 1990, Maric et al., 1996). The animals were anesthetized with pentobarbitone sodium (Nembutal® 40 mg.kg-1 intra peritoneal). After midline incision, a needle was inserted into the abdominal aorta and the kid-neys were perfused retrogradely at 150 mmHg with sterile Hanks‘balanced salt solution, until they were cleared of blood. The kidneys were then re-moved and the medulla was dissected. The tissue was finely cut and digested with 0.1% collagenase type I for 30 min at 37ºC. Digested fragments were sieved and dispersed cells were resuspended in a 1:1 mixture of culture me-dium RPMI 1640 and Dulbecco’s modified Eagle’s medium (DMEM), con-ditioned by 3T3 Swiss albino mouse fibroblasts. Cells were kept at 37°C in a 95% air/5% CO2 incubator. Before experimentation, the cells were characte-rized by morphological (electron microscopy) and immunocytochemical methods (�-actin), as previously described (Maric et al., 1996). Cells (pas-sages 12-17) were used in the experiments and were derived from two different animals.

Experimental protocol in vitro (Paper I) RMICs plated at 5x104 cells/cm2 (either in 25 cm2 flasks or on glass slides)

were grown for 48 h in RPMI 1640 culture medium containing 10% fetal bovine serum to reach sub-confluence. The cells were then serum-starved for 24 h, then exposed to different fluid-sodium retaining hormones for 24 h, after which the supernatant was retrieved, frozen and stored at –70°C until analysis for HA content. The number of cells on each plate was determined by a routine hemocytometer method.

The following substances were tested in the cultures: 1) Angiotensin II, 10-6 M (Phoenix Pharmaceutical, Belmont, CA, USA) 2) Vasopressin, 10-6 M (Sigma-Aldrich, St. Louis, MO, USA)

29

3) Angiotensin II, 10-6 M + Vasopressin, 10-6 M

Statistical analysis All values are presented as means ± 1 standard error of the mean (SEM).

Multiple data sets were analyzed with one-way analysis of variance (ANOVA) followed by Dunnett’s test for unpaired or Student’s paired t-test with Bonferroni correction for paired data sets. Two data sets were analyzed with unpaired Student’s t-test.

Data presented as percentage (%) were statistically analyzed on raw val-ues before graphical transformation. Due to the variation between assays for the values of HA, values were logarithmically transformed before analysis. For all comparisons, p<0.05 was considered statistically significant.

30

Results

Hormonal regulation of renomedullary hyaluronan (Paper I) Hyaluronan was heterogeneously distributed within the kidney with more than sixty times the amount in the renal papilla, where urine con-centration or dilution occurred, than in the cortex.

Antidiuretic hormone reduced the hyaluronan content in vivo and in vitro. During hydration, hyaluronan increased in the papilla. This eleva-tion was nitric oxide and prostaglandin dependent.

Hyaluronan was heterogeneously distributed in all kidneys, irrespective of treatment, i.e. the cortical levels were only a few percent of that in the papil-la.

Baseline papillary hyaluronan levels were not affected by L-NAME (NOS-inhibitor) or indomethacin (INDO, COX-inhibitor) treatment. Vaso-pressin (AVP) reduced baseline levels of hyaluronan in vivo by 33% and in vitro (renomedullary interstitial cells; RMIC) by 63%, compared to untreated animals or cells. Treatment of RMICs with Ang II showed a non-significant tendency to reduce hyaluronan. When Ang II was combined with vasopres-sin, the reduction of hyaluronan was 95% (Figure 4). In animals treated for 7 days with methylprednisolone (MP), the papillary hyaluronan content de-creased by 40% (Figure 5). In all in vivo experiments, cortical hyaluronan levels were unaffected.

31

Figure 4. Hyaluronan (HA) con-tent in the supernatant of cultured RMICs under control conditions and after 24 h exposure to angi-otensin II (Ang II, 10-6M), vaso-pressin (AVP, 10-6M) and a com-bination of Ang II and AVP. * p<0.05 vs. corresponding value of control cells. Reprint with per-mission from Blackwell Publish-ing.

In hydrated control animals (2 h hydration), diuresis was accompanied by a 45% increase in papillary hyaluronan content. However, hydrated animals given either L-NAME or indomethacin, did not respond with an increase in papillary hyaluronan levels. Methylprednisolone treated animals responded to hydration with an increase of 66%, a relative increase similar to that in control animals subjected to hydration; however, the absolute value was still below that in the hydrated control animals.

Figure 5. Hyaluronan (HA) in the renal papilla of: control animals; control animals subjected to 2 h of hydration (H2O); animals given a nitric oxide synthase inhibitor (L-NAME) or a cyclooxygenase inhibitor (INDO) for 2 h; animals treated with L-NAME (L-NAME+H2O) or indomethacin (INDO+H2O) prior to 2 h of hydration; animals treated with vasopressin (AVP) for 2 h; animals treated with methylpredni-solone (MP, 7 days); and animals treated with MP for 7 days followed by 2 h of hydration (MP+H2O). * p<0.05 vs. control animals.

32

Hyaluronan synthases and hyaluronidases in the kidney during changes in hydration status (Paper II)

Papillary hyaluronan changes according to body hydration. Compared to control conditions, hyaluronan decreased after 24 h dehydration and increased after 2 h of hydration. No changes in hyaluronan were seen in the cortex during different states of body hydration.

mRNA for hyaluronan synthase 2 and hyaluronidase 1-3 were all heavily expressed in the papilla where the levels of hyaluronan were high during normal physiological conditions. After dehydration, hyalu-ronan synthase 2 decreased, compared to hydration levels. No changes in expression were seen in hyaluronan synthase 1, 3 and hyaluronidase 1-4 after 24 h of dehydration. Urinary hyaluronidase activity was ele-vated after dehydration and reduced during hydration.

After dehydration, papillary hyaluronan content decreased by 22%, com-pared to the control animals. The papillary hyaluronan content was 58% higher after hydration than in control animals (Figure 6). No changes oc-curred in cortical hyaluronan during manipulations with hydration status.

Figure 6. Change in hyaluronan (HA) content in the renal papilla during variation in hydration status. * denotes p<0.05 vs. control group.

33

HAS 1 and 3 mRNA were weakly expressed in the papilla, whereas, HAS 2 mRNA was heavily expressed (Figure 7). HYAL 1-3 were heavily ex-pressed and HYAL 4 mRNA was weakly expressed (Figure 8). During de-hydration, HAS 2 mRNA decreased compared to the level of expression during increased water intake. No changes in expression were seen in HAS 1, 3 mRNA and HYAL 1-4 mRNA during 24 h of dehydration. After hydra-tion, HYAL 2 mRNA increased.

Figure 7. Gene expression of hyaluronan synthase (HAS) 1-3 in the renal papilla during variation in hydration status. # denotes p<0.05 vs. water-loaded (hydrated) animals.

34

Figure 8. Gene expression of hyaluronidase (HYAL) 1-4 in the renal papilla during variation in hydration status. * denotes p<0.05 vs. control animals.

The excreted hyaluronidase activity was increased by 62% during dehyd and reduced by 45% during hydration (Figure 9).

Figure 9. Urinary hyaluronidase activity in rats during different forms of body hy-dration. Left panel: expressed as per unit volume urine. Right panel: expressed as excreted activity. RI: relative intensity, see Materials & Methods section * p<0.05 vs control animals (normohydration).

35

ACE inhibition during completion of nephrogenesis obstructs neonatal dissipation of interstitial hyaluronan, not correlated to lymph vessel expression (Paper III) In the newborn rat, the hyaluronan content was high in the cortex until day 6-8 after birth, whereafter it gradually and rapidly decreased dur-ing day 10-21, reaching the low levels found during adulthood. The me-dullary hyaluronan content was high days 6-8 and then gradually re-duced to a level 12-fold above the cortical level at day 21.

In rats treated neonatally (day 3-13) with an ACE-inhibitor, the nor-mal reduction in cortical and medullary hyaluronan content was inhi-bited. The number of cells expressing podoplanin included in lymph vessels was 18-fold higher than in control animals at 17-21 days after birth, suggesting compensatory upregulation.

In control animals, hyaluronan content of the renal cortex was high day 6-8 after birth. During days 10-21, cortical hyaluronan content gradually and rapidly decreased and at day 21, it was similar to the adult renal cortex (Fig-ure 10). The rate of hyaluronan dissipation was largest between days 8 and 13, when about 80% of the cortical hyaluronan content disappeared. In ACE-treated animals, the normal disappearance of cortical hyaluronan was inhi-bited and during days 6-8, it was similar to that in control animals. However, during days 10-21, no reduction appeared and at day 21, cortical hyaluronan content was more than 12-fold above that of vehicle-treated animals.

Figure 10. Renal cortical hyaluronan (HA) content in 6-21 days old rats treated neonatally with vehicle or the ACE-inhibitor, enalapril. Values are means ± SEM. * denotes p<0.05 vs. corresponding control value.

36

Figure 11. Renal medul-lary hyaluronan (HA) content in 6-21 days old rats treated neonatally with vehicle or the ACE-inhibitor, enalapril. Val-ues are means ± SEM. * denotes p<0.05 vs. cor-responding control value. Due to the small medul-lary specimens, the large variation implies low accuracy in measure-ments during the first 10 days.

In vehicle-treated control animals, hyaluronan content of the renal papilla during days 6-8 was about 6-fold higher than that of the cortex. During days 10-21, it gradually decreased and at day 21 was about 12-fold higher than that of the cortex (Figure 11).

In ACE-treated animals, the high hyaluronan values at 6-8 days after birth also gradually decreased after day 10, but did not decrease as much as the controls. The values leveled during 17-21 days after birth and had at day 21, 3-fold more hyaluronan than the control animals.

The number of podoplanin positive cells (excluding those on glomeru-

li/podocytes) in the kidneys of vehicle-treated animals decreased from day 6 to days 17-21. In ACE-treated animals, the number of podoplanin positive cells increased from day 6 to days 17-21. At days 17-21 after birth, animals treated with ACE had 18-fold more podoplanin positive cells than vehicle treated animals had. The podoplanin positive staining of glomeruli, evident in control kidneys, was very weak in the neonatally ACE-treated animals (Figure 12). There was no apparent up-regulation of CD44 in ACE-treated animals this early in the process. No labeling of the lymphatic endothelial HA receptor LYVE-1 was detected in any part of the kidney during any situ-ation.

37

Figure 12. Histological staining for podoplanin in the renal cortex. Upper panel: In control animals 21 days after birth the glomeruli are heavily stained due to podo-cytes while only a few lymphatic vessels can be identified. Lower panel: In rats, 21 days old, neonatally treated with an ACE-inhibitor, a large portion of the glomerular (podocytes) staining is lost and an increased number of lymphatic vessels can be identified.

38

No positive staining was seen for the lymphatic endothelial hyaluronan receptor LYVE-1 or CD44 in either control or treated kidneys.

In kidneys from ACE-treated animals, degeneration of the papilla at day 21 after birth was seen (Figure 13). Otherwise, there was minimal change in histological appearance this early in the process

Figure 13. Morphological comparison between a) a 21-day-old control kidney and b) a kidney of an ACE- treated animal 21 days after birth.

Renal hyaluronan content during experimental uncontrolled diabetes in rats (Paper IV) In diabetic animals, cortical hyaluronan was unaffected, whereas, papil-lary hyaluronan content was 3-fold higher than in non-diabetic rats. This increase correlated with a three-fold induction of papillary hyalu-ronan-synthase 2 mRNA expression.

In non-diabetic animals, 2 h hydration increased papillary hyaluro-nan by 93% and diuresis 17-fold. In diabetic animals, baseline diuresis was 8-fold higher than in non-diabetic animals. Hydration in diabetic animals did not further increase papillary hyaluronan or diuresis: the urine flow rate decreased.

Before water loading, urine flow rate was higher in diabetic animals than in controls (Figure 14), and urine osmolality was lower than in the controls. Urinary glucose excretion was 56-fold higher and urinary protein excretion 56% higher in diabetic rats than in control rats. Mean arterial blood pressure was similar between the groups.

39

Figure 14. Urine flow rate in non-diabetic control rats (solid lines) and in diabetic animals (dashed lines) during baseline conditions (solid markers) and during 2 h hydration (open markers). * denotes p<0.05 period E4 vs. period C1. Reprinted with permission from the Polish Physiological Society.

During hydration in control rats, urine flow rate increased 17-fold and urine osmolality decreased by 58%. In diabetic animals, 2 h hydration induced a reduction in urine flow rate and urine osmolality increased.

In diabetic animals, the cortical content of hyaluronan (Figure 15) and cor-tical HAS 2 mRNA expression (Figure 16) was similar to non-diabetic con-trols; however, papillary hyaluronan content was 3-fold higher than in the controls. The elevated papillary hyaluronan in diabetic rats coincided with a three-fold induction of papillary HAS 2 mRNA.

Figure 15. Renal papil-lary hyaluronan(HA) content in non-diabetic control animals and in diabetic animals during baseline conditions and after 2 h water loading (hydration). * denotes p<0.05 vs. baseline con-ditions. Reprinted with permission from the Polish Physiological Society.

40

During hydration in control rats, the diuretic effect coincided with increased papillary hyaluronan content by 93%, leaving cortical hyaluronan unaf-fected. In diabetic animals, the failure to respond to hydration with further diuresis coincided with a failure to further elevate papillary hyaluronan. His-tological examination of the kidneys did not reveal differences between non-diabetic and diabetic kidneys.

Figure 16. Renal cortical and papillary hyaluronan synthase 2 (HAS 2) mRNA in non-diabetic control animals and in diabetic animals. Note the logarithmic scale on the ordinate. * denotes p<0.05 vs. same parameter of non-diabetic control animals. Reprinted with permission from the Polish Physiological Society.

41

Discussion

The role of hyaluronan in homeostasis What role does a large negatively charged glycosaminoglycan such as hyalu-ronan play in regulation of fluid homeostasis? The short answer is: renome-dullary interstitial hyaluronan plays an important role in water homeostasis by changing distribution and movement of water (Fraser et al., 1997) be-tween the tubules and vessels.

During acute hydration, the renal papillary interstitial hyaluronan content

increases, whereas, during water deprivation, the opposite occurs (Hansell et al., 2000, Göransson et al., 2002). The increase in papillary interstitial hyalu-ronan content during excess water intake may antagonize water reabsorption by changing the interstitial matrix properties, resulting in resistance to water flow i.e. reduced reabsorption (Figure 17). During water deprivation, water flow is facilitated by the reduced amount of hyaluronan and by AVP-regulated aquaporins. Peak elevation in papillary hyaluronan coincides with maximal diuretic response, and hyaluronan normalizes within 6 h, despite continuous hydration (Göransson et al., 2002): this works as a rapid mechan-ism intended to help the kidney change its excretory pattern during sudden changes in hydration status.

Concentration and dilution of urine take place in the renal medulla where the levels of hyaluronan are high compared to the renal cortex (Wells et al., 1990, Johnsson et al., 1996, Hansell et al., 2000, Göransson et al., 2002). The heterogeneous distribution of hyaluronan by itself gives a different physical environment as hyaluronan forms a gel-like structure with water (Hansell et al., 2000). Depending on the concentration of hyaluronan, the properties of the gel change, pore size, charge density, and osmosis. This will differentiate the molecular traffic in the extracellular matrix. In support of the idea that elevation in hyaluronan decreases water transport, Wang et al. demonstrate that an intraperitoneal injection of hyaluronan decreases peritoneal fluid absorption (Wang et al., 1998, Wang et al., 1999). Further-more, in the interstitium, hyaluronan diminishes the water permeability of the membrane (Lai-Fook and Brown, 1991, Zawieja et al., 1992).

42

The gel creates a swelling of the interstitium, which increases the distance between the tubules and the blood (Figure 17). The entangled network that the gel consists of hinders transport through steric exclusion. Given no con-straints, a hyaluronan molecule occupies a volume about 1000 times the space of the hyaluronan molecule itself. In the extracellular space of the renal medulla, there are volume constraints and the molecule cannot expand unrestrained. When placed in a confining space, such as in the extracellular matrix, the hyaluronan molecule will push outward creating a turgor pressure that increases with the amount of water in the gel (Lodish, 2002).

The repulsion between the negatively charged carboxylate groups of the

GlcUA moieties protrude outward at regular intervals and contribute to the structure and size of the molecule (Lodish, 2002). The negatively charged gel attracts positive ions and increases osmosis, which will attract water. When water is immobilized within the gel, an antagonism of water reabsorp-tion occurs, which may involve changes in the interstitial hydrostatic pres-sure (Lai-Fook and Brown, 1991, Zawieja et al., 1992).

Figure 17. Hyaluronan (HA) and its possible role in concentrating urine. The amount of HA increases during hydration (water load), which reduces water reab-sorption and increases urine volume.

With increasing concentrations of hyaluronan, drainage of synovial fluid decreases due to chain-chain interactions through molecular interactions

43

(Scott et al., 2000). The gel has a greater exterior osmotic pressure than in the center, which will oppose fluid movement (Coleman et al., 1999). In the extracellular matrix where volume is limited, chain-chain interactions due to overlapping might occur earlier and thereby affect fluid movements. Another possible effect of the changes occurring in renomedullary interstitial hyalu-ronan is a modulated efficiency of the vasa recta working as a counter cur-rent exchanger. If the ability of these vessels to passively recirculate electro-lytes in the medulla is affected due to changes in fluid transfer, the medul-lary concentration gradient will change leading to changes in urinary con-centration.

There is an urodynamic component involved in urine production and wa-

ter reabsorption. Schmidt-Nielsen (Schmidt-Nielsen, 1995) proposes that the renal papilla should be considered a pump. The papillary wall is equipped with a pacemaker that produces rhythmic contractions that move tubular fluid in the direction of the ureter, and combined with vasopressin, the con-tractions drive water into the collecting duct cells and from there into the renal interstitium. This force compresses the hyaluronan gel structure in the medullary interstitium and can theoretically give rise to two types of effects for inner medullary concentration. One is lowering the osmolality of sur-rounding interstitial fluid and the other is to use stored mechanical energy to drive water absorption from the tubule. Therefore, Hyaluronan functions as a mechano-osmotic transducer (Knepper et al., 2003). However, the contrac-tions are shown in hamster papillas which are very long and thin (Pruitt et al., 2006). The effects are if any smaller in the rat or human papilla that is wider and thicker.

The kidneys and the intestine are the two major organs involved in fluid

transport. In the studies included in this thesis, we have focused on the changes occurring in papillary hyaluronan during control conditions and when the organism switches into a situation where excessive amounts of water are to be excreted. It is therefore interesting to note that high and low amounts of hyaluronan in different regions of both the kidney and the intes-tine correlate with the regions where small and large fluid volume transports occur (Göransson et al., 2002). In the kidney, the major fluid volume reab-sorption occurs in the cortex, where almost no hyaluronan is found. In the papilla, where less fluid volumes are reabsorbed, a very high amount of hya-luronan is detected. It is, however, important to acknowledge that the regula-tion of fluid balance occurs in the papilla (medulla) as opposed to the cortex although the papilla does not reabsorb the largest volume of fluid. When making the same line of reasoning with the intestine it fits well with the pat-tern of the kidney: the lower levels of hyaluronan are found in the duodenum and jejunum (Göransson et al., 2002) where a large part of the fluid absorp-tion takes place. The highest amounts of hyaluronan are found in the colon,

44

which actually absorbs less fluid volumes although it stands for the final regulation of fluid absorption.

As described above, the structural component hyaluronan has a role as a

modulator of water homeostasis and has many ways of doing so.

Hyaluronan and different states of body hydration In an in vitro study on cultured rat RMIC (Göransson et al., 2001), the hyalu-ronan-binding receptor CD44 is down regulated under hypo-osmotic condi-tions, mimicking hydration, but is up regulated under hyperosmotic condi-tions, mimicking water deprivation. Once hyaluronan binds to CD44, it be-comes internalized and degraded by intracellular hyaluronidases (Culty et al., 1992, Hua et al., 1993, Formby and Stern, 2003). Furthermore, in an in vitro study under cell-free conditions (Asteriou et al., 2006), low ionic strength inhibits hyaluronan hydrolysis catalyzed by hyaluronidase, implying that during water diuresis, when the ionic strength is lower in the renal me-dulla, both cellular uptake of hyaluronan over CD44 and the breakdown of hyaluronan by hyaluronidase are reduced.

Hormones involved in renal fluid balance had a regulatory influence on

the papillary hyaluronan content (Paper I). Thus, the ability to acutely in-crease papillary hyaluronan content during hydration involved mechanisms that required NO and prostaglandins. In contrast, AVP and methylpredniso-lone reduced basal hyaluronan content in vivo. AVP alone and with Ang II reduce the hyaluronan content in supernatant of cultured RMIC (Rügheimer et al., 2008a): this was supported in Paper II by the finding of reduced hyalu-ronan in dehydrated rats. During dehydration, plasma AVP and Ang II in-crease (Guyton and Hall, 2000). Even though AVP stimulates the activities of both hyaluronidase and other hyaluronan-degrading enzymes in rat renal papilla (Ivanova, 1981), 24 h of dehydration did not appear to change the gene transcript of the hyaluronidases. The action of AVP can involve activa-tion of hyaluronidases to modulate diuresis (Ginetzinsky, 1958), which is supported by findings in homozygous Brattleboro rats (Hansell et al., 2000) that lack the ability to produce AVP and where the outer papillary hyaluro-nan content is increased, indicating reduced breakdown. The AVP V1-receptor is important as desmopressin (selective V2-receptor agonist) does not reduce papillary hyaluronan (Hansell et al., 2000), whereas, AVP infu-sion does (Rügheimer et al., 2008a). V1-receptors are present in renomedul-lary interstitial cells (Zhuo, 2000) which are producers of hyaluronan (Han-sell et al., 1999, Göransson et al., 2001, Rügheimer et al., 2008a). The me-chanism underlying increased hyaluronidase activity in the renal papilla through the V1-receptor is unclear and requires further study.

45

Corticosteroids inhibit HAS (Wells et al., 1992, Agren et al., 1995, Jacob-son et al., 2000, Johnsson et al., 2004), thereby reducing interstitial hyaluro-nan. Despite this, hydration increased papillary hyaluronan (within 2 h) in animals treated with methylprednisolone. Thus, increased hyaluronan con-tent during hydration was probably due to an inhibited breakdown of the hyaluronan molecule and not to a primary increase in hyaluronan synthase activity.

What then is the correlation between nitric oxid and prostaglandins and

the change in medullary hyaluronan that occurs during hydration? Both iN-OS and COX 2 are present in RMIC (Chen et al., 2005), fibroblasts that pro-duce and degrade hyaluronan (Hansell et al., 1999, Göransson et al., 2001, Johnsson et al., 2004). Previous studies on chondrocytes, hepatocytes and endothelial cells highlight a correlation between hyaluronan, CD44 and ni-tric oxid in the sense that when hyaluronan binds to CD44, nitric oxide is produced by activation of iNOS (Rockey et al., 1998, Knudson and Knud-son, 2004, Singleton and Bourguignon, 2004, Iacob and Knudson, 2006). Furthermore, PGE2 increases hyaluronan production in renal glomerular cells (Mahadevan et al., 1995) and nitric oxid stimulates COX 2 expression and PGE2 release in RMIC through mitogen-activated protein kinases (MAPK) (Yang et al., 2006). The transcription of COX 2 is regulated by, for example, IL-1�, platelet-derived growth factor (PDGF) and tumor necrosis factor (TNF) (Harris and Breyer, 2001), the same factors that stimulate syn-thesis of hyaluronan (Laurent and Fraser, 1992). Nitric oxid acts as an auto-crine activator of the soluble guanylyl cyclase in RMICs, thereby, increasing cGMP (Lau et al., 1995). Although the exact pathway cannot be determined from paper I, it is obvious that an intact signaling mechanism involving NOS and COX is required for the hydration-induced increase in papillary intersti-tial hyaluronan to occur.

There is a correlation between papillary interstitial hyaluronan and urine

flow rate in rats (Hansell et al., 2000, Göransson et al., 2002). The inability of indomethacin-treated rats to increase hyaluronan in response to hydration, and reduction in hyaluronan in methylprednisolone-treated rats, were corre-lated with a smaller diuretic response (Paper I). However, this was not true, for L-NAME-treated animals, in which an inability to respond with an in-crease in hyaluronan after hydration correlated with higher urine flow rate. This was probably due to increased arterial pressure resulting from NOS inhibition, which caused a diuretic pressure effect that increased water con-tent in the tubular/duct structures of the papilla, despite unchanged intersti-tial hyaluronan. A similar exaggerated diuretic response due to an elevation of arterial pressure has been observed in the spontaneously hypertensive rat during fluid loading (Hansell and Sjoquist, 1992).

46

The rapid (within 2 h) elevation in papillary hyaluronan, which was evi-dent after 2 h of hydration, did not primarily involve a change in gene tran-script of the proteins producing and breaking down hyaluronan. Presumably, the change in hyaluronan levels was achieved through a change in activity of hyaluronidases or a change in the transport of hyaluronan to cellular catabol-ic sites: reduced urinary hyaluronidase activity supported this concept (Paper II). After 24 h of dehydration, the papillary hyaluronan content was reduced, which correlated with a reduction in the transcript level of the most impor-tant synthase HAS 2. The gene expression of hyaluronidases did not corre-late with a reduction in papillary hyaluronan, suggesting that longer periods of stimulation in terms of fluid challenge was required for a change to occur in the transcript. However, elevated urinary hyaluronidase activity suggested that a change in activity could reduce the interstitial hyaluronan levels during dehydration (Paper II).

HYAL 2 breaks down high molecular weight hyaluronan into low mole-

cular weight hyaluronan, but has no enzymatic activity on low molecular weight hyaluronan fragments (Lepperdinger et al., 1998). The pH optimums of the hyaluronidases vary depending on the nature of the substrates (Bollet et al., 1963). The modulation of catabolic turnover provides the rapid re-sponse mechanisms for changing levels of hyaluronan, rather than the syn-thetic reactions (Csoka et al., 2001). HYAL 2 is probably the rate-limiting step in the degradation of hyaluronan (Csoka et al., 2001) and it is unlikely that hyaluronidase activity is retained in vivo in an active form within the extracellular matrix (Csoka et al., 2001). If HYAL 2 is found within the extracellular matrix, it may be in an inactive or suppressed form bound to an inhibitor (Csoka et al., 2001). However, Formby and Stern propose that the breakdown of hyaluronan starts on the plasma membrane by HYAL 2 when hyaluronan is bound to CD44 (Formby and Stern, 2003).

HYAL 1 occur in mammalian plasma and urine, and is also found at high levels in major organs such as liver, kidney, spleen, and heart. Which one of the hyaluronidases that gave rise to the measured urinary activity in paper II could not be determined and it is unclear how hyaluronidase reached the urine except through filtration. The changes observed could reflect changes in the quantity of filtered urinary hyaluronidase, which might not primarily originate from the kidney tissue (Paper II). However, dehydration does not increase filtration, and hydration does not reduce filtration (Persson et al., 2000), which would have been required in order for an exclusive explanation based on filtered load (high activity during dehydration; low activity during hydration). Infusion of vasopressin in rats also leads to an increased urinary hyaluronidase activity (Ginetzinsky, 1958) which fit well with our findings on dehydration when vasopressin in plasma is elevated.

47

During pathological conditions of renal function, the pattern is different i.e. slow but long-lasting. During ischemia-reperfusion injury, the maximal hyaluronan response occurs with an increase in the cortex after 72 h of reper-fusion (Johnsson et al., 1996). This is true for experimental diabetes mellitus, when weeks are required to produce elevated levels that primarily affect the papilla (Melin et al., 2006, Rügheimer et al., 2008a). In both cases, the gene expression of HAS 2 is upregulated (Göransson et al., 2004, Rügheimer et al., 2008a).

Heterogeneous distribution of hyaluronan in nephrogenesis In Paper III, an explanation for the normal heterogeneous distribution in the adult kidney was sought through understanding the changes in hyaluronan in the developing kidney. The hypothesis was that normal disappearance of hyaluronan was due to development of lymphatic vessels as a complement to increased hyaluronidase activity. A large molecule such as hyaluronan can be transported along the lymph vessels, thereby, leading to drainage. Due to the proliferative and growth promoting effects of Ang II, it was speculated that the development of renal cortical lymphatics required Ang II tonus. The renal medulla is void of lymphatic vessels and contains the highest amounts of hyaluronan in the normal kidney.

Intrarenal hyaluronan content after birth is high but rapidly decreased,

primarily in the cortex during days 8-13 after birth, whereby, the normal adult heterogeneous intrarenal distribution was attained, with very low levels in the cortex and high levels still remaining in the medulla. This rapid reduc-tion required Ang II tonus and did not depend on lymph vessel expression, defined as number of podoplanin-positive cells. Neonatal interference with the renin-angiotensin system resulted in an inability to dissipate hyaluronan from the kidneys during days 10-21 after birth, despite an elevated number of podoplanin-positive cells. The remaining high levels of intrarenal hyalu-ronan might contribute to the pathological renal phenotype in the adult, i.e. tubulointerstitial inflammation and reduced urinary concentrating ability, due to the proinflammatory and extreme water-binding properties of hyalu-ronan.

The importance of intact renin-angiotensin system during renal develop-

ment has been extensively investigated and long-term the interruption of renin-angiotensin system during nephrogenesis results in severe structural and functional abnormalities. The structural abnormalities in rats and pigs resemble the renal histological changes observed in human fetuses and new-borns with ACE inhibitor fetopathy (Shotan et al., 1994). The primary me-chanisms for the prevailing renal defects appear to be caused by inhibition of the growth and proliferative properties by Ang II.

48

In the adult, the inflammatory process in response to neonatal renin-

angiotensin system inhibition is associated with infiltrating cells in the in-terstitium, which first appear in the cortical regions and then deeper in the renal medulla. Furthermore, hyaluronan may have a role in inflammatory responses, where it directly stimulates the expression of cell adhesion mole-cules, such as intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) in mouse kidney epithelial cells (Oertli et al., 1998). Based on previously reported proinflammatory activities of hyalu-ronan, including release of chemokines by macrophages (McKee et al., 1996), the recruitment of leucocytes may be initiated by hyaluronan interact-ing with the cell surface receptor CD44. Furthermore, inflammatory cells produce growth factors that stimulate the synthesis of hyaluronan by fibrob-lasts (Yaron et al., 1978, Hamerman and Wood, 1984).

It is not known at which point after birth hyaluronan results in pro-

inflammatory reactions, although, this does not primarily occur during the first 2-3 weeks after birth i.e. during nephrogenesis. Whether this occurs in parallel with development of the immune system, or is due to production of pro-inflammatory low-molecular weight hyaluronan remains to be estab-lished. The high hyaluronan levels present in the kidney during development is certainly a prerequisite for normal organ development, but it has also been proposed (Sulyok and Nyul, 2005) to have a role in antagonizing water reab-sorption and limiting urine concentration performance prior to completion of nephrogenesis.

The expression and activity of ACE in the rat kidney increase markedly

after birth and peaks at about 14 days of age, before decreasing to adult le-vels 4 weeks after birth (Jung et al., 1993, Costerousse et al., 1994). Angi-otensinogen expression in the rat kidney also peaks in the newborn period (Darby and Sernia, 1995). In Paper III, newborns were treated daily with ACE-inhibitor during days 3-13. The choice of treatment schedule was ti-trated in previous studies (Spence et al., 1995, Guron et al., 1999) showing that the “window of vulnerability” is before day 14 after birth and that AT1-receptor antagonists work equally well. Treatment with ACE inhibitor start-ing after day 14 did not result in any of the changes described in paper III. Angiotensin AT1-receptor expression continues to increase postnatally and peaks at about 7 days after birth, when AT1 mRNA levels are about twice those during adulthood (Tufro-McReddie et al., 1993, Norwood et al., 1997). In contrast, AT2 receptor expression is down regulated and undetectable at day 14 after birth (Aguilera et al., 1994, Norwood et al., 1997). This implied that the observed change in ACE-treated animals was primarily due to re-duced AT1 receptor tonus.

49

Podoplanin is a lymphatic endothelial cell specific mucoprotein (Ker-jaschki et al., 2004) and a podocyte membrane mucoprotein (Matsui et al., 1998): podoplanin is specifically and selectively expressed only in lymphatic endothelial cells. In paper III, the number of podoplanin positive cells 17-21 days after birth was 18-fold higher in ACE-inhibited kidneys than in the normal control kidney, implying that it was not an inhibition of the devel-opment of lymphatic vessels that caused the elevated levels of hyaluronan in the ACE-inhibited kidneys. The elevated podoplanin labeling probably represented an effort to compensate for the elevated hyaluronan levels. This was clear when studying podoplanin positive cells in the normal kidneys, which did not increase during the phase of rapid hyaluronan reduction. The consequences of the reduced podoplanin expression in the glomeruli (podop-lanin) in ACE-treated animals are unknown. However, podoplanin is down regulated in podocytes in a rat model of nephrosis (PAN) (Matsui et al., 1999), suggesting an involvement in the glomerular barrier and possibly in the genesis of proteinuria in this model. In the study in paper III, urinary protein excretion was not measured, although, Saez et al. (Saez et al., 2007) demonstrate that neonatal renin-angiotensin system inhibition in male rats results in proteinuria during adulthood. It can be argued that the number of podoplanin positive cells does not infer normal functional lymphatics in neonatal ACE-inhibited animals. However, the number of podoplanin posi-tive cells in the control kidneys did not increase in parallel with the rapid reduction of hyaluronan, suggesting that this was not a major mechanism. Furthermore, the medulla, where the largest reduction in hyaluronan oc-curred in absolute terms, does not contain lymphatic vessels.

This raises the question, as to what mechanism underlies the normal rapid

reduction of renal interstitial hyaluronan during the first 3 weeks of life and the obstructed disappearance in neonatal ACE-inhibited rats, if lymphatic vessels are not involved. There are three main possibilities, of which there is data to support at least one: increased degradation by hyaluronidases; re-duced synthesis by hyaluronan synthase; or, a combination of both. In the developing kidney, the HAS 2 gene is highly expressed and is the most im-portant hyaluronan synthase gene for hyaluronan production (Rosines et al., 2007). HYAL 1 and HYAL 2 are considered the primary functional hyaluro-nidases of mammalian somatic cells (Csoka et al., 2001) and have been found in the kidney (Fraser et al., 1997, Sun et al., 1998). HYAL 2 is highly expressed in the developing kidney (Rosines et al., 2007). Ang II can reduce hyaluronan in the supernatant of RMIC in culture when combined with AVP (Rügheimer et al., 2008b), the latter activates hyaluronidases (Ginetzinsky, 1958, Ivanova, 1981, Gusev et al., 1983). AVP infusion reduces renomedul-lary hyaluronan in the rat (Rügheimer et al., 2008b); thus, it is plausible that Ang II tonus during completion of nephrogenesis reduces renal interstitial hyaluronan content by activating hyaluronidases. However, that synthesis of

50

hyaluronan is reduced in parallel by inhibition of hyaluronan synthase gene expression or hyaluronan synthase activity cannot be excluded.

CD44 is the best studied and most common hyaluronan receptor found in

a variety of cells (Toole, 1990, Underhill, 1992). The receptor is known to participate in matrix-cell signaling, cell migration, cell-cell aggregation and receptor mediated internalization/degradation of hyaluronan (Culty et al., 1992). This receptor is also up regulated in the kidney during pathological conditions (Jun et al., 1997, Wüthrich, 1999, Melin et al., 2006). Inflamma-tory cells expressing the hyaluronan-binding receptor CD44 utilize this re-ceptor to gain access to inflamed areas with hyaluronan-rich matrices (Jun et al., 1997, Wüthrich, 1999). CD44 was not up regulated in ACE-treated ani-mals at day 21 after birth, and it is possible that the inflammatory process in Paper III was in its very early phases and had not yet affected CD44 expres-sion, although, some CD44 up regulation in 21 days old ACE-treated ani-mals has previously been reported (Nilsson et al., 2001). This up regulation was focal and only attributed to a few tubules of abnormal morphology. LYVE-1, a lymphatic vessel endothelial hyaluronan receptor (homolog of CD44), was not detected in the kidney under any condition studied.

Water handling in the diabetic kidney The water binding and pro-inflammatory properties of hyaluronan make it a suitable candidate for a matrix component involved in diabetic nephropathy. In Paper IV, the kidney content of hyaluronan was evaluated during uncon-trolled diabetes. Hyaluronan primarily accumulated in the interstitium of the renal papilla, whereas, the cortical content was similar to that in non-diabetic control rats. The induction of papillary HAS 2 mRNA suggested that an increased synthesis was responsible for the elevated hyaluronan levels and not a reduced degradation by hyaluronidases or abrogated lymph drainage via the cortex. During hydration in diabetic rats, the elevation in papillary hyaluronan, which occurred in non-diabetic control rats, was absent i.e. no further elevation was detected and this coincided with an inability to produce an expected diuretic response during the challenge.

The effect of hyperglycemia on cellular hyaluronan production in vitro

has previously been demonstrated: renal interstitial fibroblasts (Takeda et al., 2001), proximal tubular cells (Jones et al., 2001), glomerular (Mahadevan et al., 1995) and mesangial cells (Wang and Hascall, 2004) increase production of hyaluronan when grown with elevated glucose conditions in a medium. In interstitial fibroblasts, the high glucose stimulates hyaluronan production through the PKC/TGF-ß cascade, whereas, in proximal tubular cells, the hyaluronan elevation is associated with NF-kappaß-activated transcription of HAS 2. Whether the same cellular events, leading from hyperglycemia to

51

increased hyaluronan production, are evident in vivo i.e. as in Paper IV re-mains to be elucidated but appears plausible.

Other studies demonstrate increased hyaluronan content in diabetic kid-

neys. Malathy and Kurup (Malathy and Kurup, 1972) determined a marginal increase of hyaluronan in kidney tissues from diabetic rats and Berenson et al. (Berenson et al., 1970) found increased hyaluronan content in some, but not all, kidneys of diseased humans. Wang and Hascall (Wang and Hascall, 2004) demonstrated accumulation of hyaluronan in the glomeruli of diabetic kidneys. The expression of the enzymes responsible for prostaglandin forma-tion (cyclooxygenase -1 and -2) is elevated in the renal papilla during di-abetes and PGE2 formation is increased (Nasrallah et al., 2003): PGE2 is a known stimulator of hyaluronan production (Tomida et al., 1977, Mahade-van et al., 1995).

In diabetic rats (Paper IV), hydration did not give rise to a further eleva-

tion in papillary hyaluronan content above basal level. The underlying me-chanism to this failure in response was unknown, but may be inherent to the already severely elevated basal levels. The diabetes-induced levels were much higher than those found in the non-diabetic rats, even during hydra-tion. Therefore, the diabetic situation with for example hyperglycemia, can increase papillary COX expression (Nasrallah et al., 2003), and growth fac-tors (Schrijvers et al., 2004) represent a maximal stimulatory response in the papilla to produce hyaluronan. The involvement of the reported elevated hyaluronidase activity in the kidney of diabetic rats (Ikegami-Kawai, 2003) may also influence the ability to attain an elevation in interstitial hyaluronan during hydration. Whether the reported increased AVP level during diabetes (Zerbe et al., 1985) contributes to the increased hyaluronidase activity in this model (Ivanova, 1981), remains to be established.

The response to hydration in diabetic rats in terms of diuresis was differ-

ent to non-diabetic control rats (Paper IV). Instead of an elevation in diure-sis, as demonstrated by non-diabetic control rats, there was a surprising de-cline in diuresis upon water loading. The inability to respond with diuresis coincided with an inability to further elevate papillary hyaluronan. The ab-undance of medullary key proteins for urinary concentration, such as AQP 2 and urea transporter A1 (UT-A1), is elevated in spite of ongoing osmotic diuresis (Bardoux et al., 2001). The plasma level of AVP elevates during diabetes (Zerbe et al., 1985, Brooks et al., 1989). However, it could not be determined (Paper IV), if the already elevated levels of hyaluronan, AVP, AQP 2 and UT-A1 contributed to the inability to produce a diuretic response during hydration. It is not known if the high diuresis, evident during baseline diabetic conditions, interfered with the ability to acutely elevate diuresis upon hydration or not. However, the response to hydration could achieve a

52

higher diuresis in absolute terms in non-diabetic control rats than the basal high level in diabetic animals.

What regulates renal hyaluronan? As seen above, our results provide us with different regulatory tools, such as NOS and COX. The way of how the regulation of hyaluronan is done de-pends on if it is a long or short term regulation that is needed. During short term however, the regulation of hyaluronan most likely depend on negative feedback. Most biological systems are under negative control. Stimulation of synthesis does not usually occur when rapid responses are required, but in-stead, there is a release from negative control. Inhibition of catabolism by hyaluronidase inhibitors may be responsible for the release in negative con-trol and quick increases of hyaluronan. Little is known about hyaluronidase inhibitors.

Release in negative control appears the quickest and most likely way for

short-term regulation of hyaluronan. After 2 h of hydration, the urinary hya-luronidase activity decreased, but even after seven days of corticosteroid treatment, the acute water-induced elevation in hyaluronan (within 2 h) still occurred, suggesting an important role over inhibition of breakdown.

The amount of hyaluronidase excreted in the urine increases during dehy-dration and drops to zero after hydration (Ginetzinsky, 1958). This suggests that elevated hyaluronidase activity during dehydration reduces interstitial hyaluronan and vice versa.

During long-term environmental changes that call upon an increase in

hyaluronan, the synthases appear to bear the main responsibility, as seen in the case of four weeks of uncontrolled diabetes, where there was an induc-tion of HAS 2 mRNA. This induction implied that increased synthesis was responsible for elevated hyaluronan levels and not primarily a reduced de-gradation by hyaluronidases (Rügheimer et al., 2008a).

53

Conclusions

Hyaluronan is heterogeneously distributed within the kidney and primarily found in the medulla, where the concentration and dilution of urine occurs. The medullary interstitial content of hyaluronan, as opposed to that of the cortex, changes according to different states of body hydration.

Dehydration reduces medullary hyaluronan in parallel with reduced hya-luronan synthase 2 gene expression and increased urinary hyaluronidase activity. A reduction in renal medullary hyaluronan, in concert with vaso-pressin induced aquaporins, increases water reabsorption i.e. favouring anti-diuresis. Vasopressin reduces hyaluronan, an effect which is accentuated in concert with angiotensin II.

Acute hydration results in an increase in medullary hyaluronan via me-

chanisms that require nitric oxide and prostaglandins, and reduced urinary hyaluronidase activity. The elevation of hyaluronan together with reduced aquaporins reduces water reabsorption i.e. favouring diuresis.

Changes in hyaluronan concentration constitute a morphoregulatory

pathway that plays a key role in nephrogenesis. The reduction of renal hyalu-ronan in the neonate is dependent on an angiotensin II mediated process that does not require lymph vessel formation. If angiotensin II is blocked with an ACE inhibitor, there will be an accumulation of hyaluronan with resulting structural and functional abnormalities in the kidney. This clarifies the de-velopment of the adult heterogenous distribution of hyaluronan and suggests an important involvement of angiotensin II in nephrogenesis that is different from the traditional effect of the hormone in fluid-electrolyte homeostasis and arterial blood pressure regulation.

Renomedullary hyaluronan is elevated in uncontrolled experimental di-abetes, which coincides with induction of hyaluronan synthase 2 mRNA, hyperglycemia, glucosuria, proteinuria, and overt diuresis. The levels of hyaluronan are probably at a terminus ad quem, as no further response is seen during hydration. The higher interstitial expression of hyaluronan dur-ing diabetes may be involved in the progression of diabetic nephropathy.

54

Svensk sammanfattning / Summary in Swedish

Hyaluronan, den stora i kroppen naturligt förekommande molekylen, är kan-ske mest känd för allmänheten för att den används kosmetiskt för att trolla bort rynkor eller skapa plutande läppar. Terapeutiskt började hyaluronan användas vid ögonoperationer men har även ett stort användningsområde som smörjmedel i knäleder hos travhästar. I de nämnda fallen använder man sig av hyaluronans förmåga att binda stora mängder vatten där 1 gram kan binda upp till 1 liter. Hyaluronan bildar nämligen en gel tillsammans med vatten.

Hyaluronan finns i rikliga mängder i njurens inre där koncentre-ring/utspädning av urinen sker. I njurens yttre delar återfinns normalt mycket små mängder men dessa stiger kraftigt vid olika former av njurskador. Mängden hyaluronan i njuren varierar beroende på vårt vätskeintag. Detta, enligt vår forskning, för att bibehålla vätskebalans vilket indirekt påverkar regleringen av blodtrycket.

Målet med vår forskning har varit att förstå hyaluronans funktion i njuren samt vad som reglerar syntes och nedbrytning, alltså mängden, under olika vätskeintag.

Vid akut hydrering, dvs. ett ökat vätskeintag, ökar hyaluronan i njurens inre delar. Detta sker samtidigt som en minskad aktivitet av hyaluronidas, det enzym som bryter ned hyaluronan, ses i urinen. Inga förändringar kunde ses i genuttrycket av de enzym som bildar och bryter ned hyaluronan. Ge-nom att hyaluronan fungerar som en vätskefylld ”tätningsmassa” runt de strukturer i njuren som sparar vatten kommer mindre vatten att tas upp av njuren. Sammantaget ger detta ökade urinmängder för att återfå balans.

Vid dehydrering, dvs. vid uttorkning, minskar hyaluronan och vi ser en ökad aktivitet av hyaluronidas. Genuttrycket av hyaluronansyntas 2, ett en-zym i gruppen av tre som tillverkar hyaluronan, minskar vid dehydrering och sammantaget ger detta minskade mängder hyaluronan i njurens inre. Resul-tatet blir att mängden tätningsmassa minskar och en minskad urinmängd blir följden för att återfå balans.

För att förstå uppkomsten av hyaluronans vätskereglerande funktion och dess heterogena fördelning i njuren studerades hyaluronan under njurens

55

utveckling i obehandlade och hos råttor behandlade med ett blodtryckssän-kande läkemedel (ACE-hämmare). Man vet sedan tidigare att hyaluronan medverkar i strukturutvecklingen av njurarna. Genom att öka eller minska sin koncentration styr hyaluronan på så sätt när och var njurens vindlande rörsystem skall utvecklas.

Då angiotensin II (vätske- och blodtrycksreglerande hormon) blockeras med hjälp av en ACE-hämmare under njurens utveckling ses i vuxen ålder höga kvarstående koncentrationer av hyaluronan i speciellt njurens yttre delar. Detta ger upphov till struktur- och funktions-fel som senare i livet avspeglas i en njurfunktionsnedsättning med oförmåga att reglera vätskeba-lans. Angiotensin II är således en viktig komponent i fördelningen av hyalu-ronan under njurens färdigutveckling.

Utvecklingen av lymfkärl följdes i studien eftersom hyaluronan kan drä-neras från njurens yttre delar via dylika. Det fanns snarare fler lymfkärl efter ACE behandling vilket innebär att de höga hyaluronannivåerna i de yttre delarna av njuren inte berodde på defekt lymfkärlsutveckling.

Vår och andras forskning har visat att vid skador då njurarna utsätts för syrebrist, transplantations-avstötning eller inflammatorisk förändring ökar hyaluronan speciellt i njurens yttre delar och ger upphov till organskada och försämrad njurfunktion. Med detta som bakgrund undersöktes hyaluronan hos diabetiska råttor (studie 4). Hyaluronan visade sig vara kraftigt ökat i njurens inre där även en ökning av genuttrycket för hyaluronansyntas 2 upp-visades. Däremot sågs ingen onormal ökning av hyaluronan i njurens yttre delar vid diabetes. En obehandlad diabetiker utsöndrar dagligen stora urin-mängder. Vid hydrering av en obehandlad diabetiker kunde vare sig kon-centrationen av hyaluronan eller urinvolymerna öka ytterligare, vilket vi visar sker vid normal njurfunktion (studie 1, 2). Koncentrationen av hyalu-ronan har med största sannolikhet nått sitt maximum. De redan förhöjda koncentrationerna av hyaluronan i njurens inre kan vara inblandade i de njurskador vilka uppkommer hos diabetiker.

Avhandlingen i fysiologi, Kidney Hyaluronan – regulatory aspects during different states of body hydration, nephrogenesis & diabetes förser oss med nya mekanistiska insikter om hur hyaluronan regleras i njuren under olika förhållanden av vätskehantering och ger insikt i dess funktion. Den inklude-rar såväl in vivo som in vitro försök. Forskningen har fysiskt bedrivits på BMC och Akademiska sjukhuset i Uppsala, Sverige samt vid Georgetown University i Washington DC, USA.

56

Acknowledgement / Tack!

This work was carried out at the Department of Medical Cell Biology, Sec-tion of Integrative Physiology, the Department of Transplantation Surgery, Uppsala Hospital, Uppsala University, Sweden, and at the Department of Medicine, Georgetown University Medical Center, Washington DC, USA.

The project was supported by grants from the Swedish Research Council,

the Wallenberg Foundation, the National Kidney Foundation, the Anna Ce-derberg Foundation, Anna Maria Lundins Foundation, Astra Zeneca, Kvin-nliga Akademikers Förening, the Scandinavian Physiological Society, and the Swedish Pharmaceutical Society.

I would like to sincerely thank all of you that in one way or another have contributed to this thesis and life around it.

Haec ego non multis (scribo), sed tibi

A special thanks to: My supervisor, professor Peter Hansell, for introducing me to research and the hyaluronan project. Tack för ordning och reda, att du håller tidsplaner och för att du inkluderade kunskapen om att Tequila är något annat än finkel. Tack även Barbro för generositet, gästfrihet och att du ibland har fått ha koll på våra resplaner.

My co-supervisor, associate professor Cecilia Emanuelsson. Tack för alla goda råd, allt labbande och akutinsatser var du än har befunnit dig på jorden.

Associate professor Christine Maric for work, trips, cheese and wine, and everything that we might fit in on a 24-hour schedule.

Professor Örjan Källskog, co-supervisor, senior kunskapskälla på labbet, en outtröttlig undervisningsfördelare, en kritisk tänkare och en suverän snapsblandare, tack!

57

Thanks to my co-authors Doctor Carina Carlsson, Professor Peter Fri-berg, Professor Dontscho Kerjaschki, Johan Olerud, Doctor Kei Shimizu, Doctor Tomoko Takahashi and Doctor Annika Åstrand.

Ett stort tack till Faranak Azarbayjani, Hanna Barrefelt, Barbro Ei-narsson, Carl Huddénius, Britta Isaksson, Leif Jansson, Åsa Larsson, Astrid Nordin, Lisbeth Sagulin och My Quach för händer, klokhet, tips & trix och allt annat som kan behövas när vatten skall hämtas i kunskapens källa.

Angelica för alla timmar du satt vid min sida i början då du lärde mig att operera, din extra hand som snabbt kom till hjälp vid otaliga sövningar, för ”pynt”, goda presenter och roomie genom åren.

Lena Holm och Erik Persson för att ni månar om oss med gott bröd, middagar, konsten att öppna surströmmingsburkar på ett excellent sätt och kunskapen om att döden kan vara reversibel vilket känns skönt att veta efter ett skott i natten.

På tal om natten, alla nattsuddare; Håkan Aldskogius, Dr P-O Carlsson, Mattias Carlström, Mats Sjöquist och Johan Sällström.

Dr Anna & Dr Viktoria för introduktion och råd till forskningens värld. Johanna för Rob Lowe & Bröderna Herrey. Mina kontorskollegor Fredrik, Jenny, Malou och Per Liss. Andrei för kultur, Anna, Anitha, Annika, Cissi, Enyin for nice talks about life in general and China, Gustaf, Janos, Joel för smokingfest, Lina, Magnus för sällskap under skrivnätterna, Mats Wolgast för goda diskussioner, Mattias, Mia för surstömmingsfest, Micha-el, Olof för ett glatt bemötande Pernilla, Ruisheng, Sara, Sara och Zufu. Änglarna från ovan Joey, Johan, Magnus, Nina, Sara, Ulrika och Åsa. Neuro & alla de andra våningarna av doktorander på cellbiologen. Vad vore Sagor & Hjältar, Maffiafester, kräftskivor, grillpartyn, julgransplundringar och konferenser utan er?

Research guests from Australia and Berlin, Anita, Michael, Michelle, Russell, Andreas for talks, art & wine, Andreas, Julia, Mauricio & Monica Zetterlund and Pontus.

Prefekterna vid institutionen för medicinsk cellbiologi, Godfried Roo-mans och Arne Andersson.

Agneta Sandler Bäfwe, Marianne Ljungkvist, Göran Ståhl och Karin Öberg för det administrativa. Birgitta Klang och Gunno Nilsson för all support i samband med undervisningen. Alla ni som har tömt min pappers-

58

korg och städad runt mina fötter, Helena för all disk, SF & djurhuspersona-len för att ni har tagit god hand om mina råttor. Mrs Maud Marsden and Mrs Sue Pajuluoma for language correction.

Älskade, familj, släkt och vänner utan er hade livet varit trist. Thank you all!

Louise

59

References

Agren, U. M., Tammi, M. & Tammi, R. 1995. Hydrocortisone regulation of hyaluronan metabolism in human skin organ culture. J Cell Physiol, 164, 240-8.

Aguilera, G., Kapur, S., Feuillan, P., Sunar-Akbasak, B. & Bathia, A. J. 1994. Developmental changes in angiotensin II receptor subtypes and AT1 receptor mRNA in rat kidney. Kidney Int, 46, 973-9.

Ahn, K. Y., Mohaupt, M. G., Madsen, K. M. & Kone, B. C. 1994. In situ hybridization localization of mRNA encoding inducible nitric oxide synthase in rat kidney. Am J Physiol, 267, F748-57.

Alberts 2002. Molecular biology of the cell, New York, Garland Science. Alpern, R., Hebert, S. 2008. The Kidney Physiology and Pathophysiology,

San Diego, Elsevier. Apoteket 2007. Läkemedelsboken 2007/2008, Uppsala, Almqvist & Wiksell. Asteriou, T., Vincent, J. C., Tranchepain, F. & Deschrevel, B. 2006. Inhibi-

tion of hyaluronan hydrolysis catalysed by hyaluronidase at high substrate concentration and low ionic strength. Matrix Biol, 25, 166-74.

Aurell 1997. Njurmedicin, Stockholm, Liber AB. Bardoux, P., Ahloulay, M., Le Maout, S., Bankir, L. & Trinh-Trang-Tan, M.

M. 2001. Aquaporin-2 and urea transporter-A1 are up-regulated in rats with type I diabetes mellitus. Diabetologia, 44, 637-45.

Beck, T. R., Hassid, A. & Dunn, M. J. 1980. The effect of arginine vaso-pressin and its analogs on the synthesis of prostaglandin E2 by rat renal medullary interstitial cells in culture. J Pharmacol Exp Ther, 215, 15-9.

Belsky, E. & Toole, B. P. 1983. Hyaluronate and hyaluronidase in the devel-oping chick embryo kidney. Cell Differ, 12, 61-6.

Berenson, G. S., Ruiz, H., Dalferes, E. R., Jr., Dugan, F. A. & Radhakrish-namurthy, B. 1970. Acid mucopolysaccharide changes in diabetic kidneys. Diabetes, 19, 161-70.

Bertrand, P., Girard, N., Duval, C., d'Anjou, J., Chauzy, C., Menard, J. F., et al. 1997. Increased hyaluronidase levels in breast tumor metastases. Int J Cancer, 73, 327-31.

Bollet, A. J., Bonner, W. M., Jr. & Nance, J. L. 1963. The Presence of Hya-luronidase in Various Mammalian Tissues. J Biol Chem, 238, 3522-7.

Bono, P., Rubin, K., Higgins, J. M. & Hynes, R. O. 2001. Layilin, a novel integral membrane protein, is a hyaluronan receptor. Mol Biol Cell, 12, 891-900.

60

Brooks, D. P., Nutting, D. F., Crofton, J. T. & Share, L. 1989. Vasopressin in rats with genetic and streptozocin-induced diabetes. Diabetes, 38, 54-7.

Charlton, J. A. & Baylis, P. H. 1990. Stimulation of rat renal medullary Na+/K(+)-ATPase by arginine vasopressin is mediated by the V2 re-ceptor. J Endocrinol, 127, 213-6.

Chen, J., Zhao, M., Rao, R., Inoue, H. & Hao, C. M. 2005. C/EBP{beta} and its binding element are required for NF{kappa}B-induced COX2 expression following hypertonic stress. J Biol Chem, 280, 16354-9.

Coleman, P. J., Scott, D., Mason, R. M. & Levick, J. R. 1999. Characteriza-tion of the effect of high molecular weight hyaluronan on trans-synovial flow in rabbit knees. J Physiol, 514 ( Pt 1), 265-82.

Comper, W. D. & Laurent, T. C. 1978. Physiological function of connective tissue polysaccharides. Physiol Rev, 58, 255-315.

Costerousse, O., Allegrini, J., Huang, H., Bounhik, J. & Alhenc-Gelas, F. 1994. Regulation of ACE gene expression and plasma levels during rat postnatal development. Am J Physiol, 267, E745-E753.

Csoka, A. B., Frost, G. I. & Stern, R. 2001. The six hyaluronidase-like genes in the human and mouse genomes. Matrix Biol, 20, 499-508.

Culty, M., Nguyen, H. A. & Underhill, C. B. 1992 The hyaluronan receptor (CD44) participates in the uptake and degradation of hyaluronan. J Cell Biol, Feb;116(4).

Darby, I. A. & Sernia, C. 1995. In situ hybridization and immunohistochem-istry of renal angiotensinogen in neonatal and adult rat kidneys. . Cell Tissue Res, 281, 197-206.

DeAngelis, P. L. 1999. Hyaluronan synthases: fascinating glycosyltrans-ferases from vertebrates, bacterial pathogens, and algal viruses. Cell Mol Life Sci, 56, 670-82.

Deed, R., Rooney, P., Kumar, P., Norton, J. D., Smith, J., Freemont, A. J., et al. 1997. Early-response gene signalling is induced by angiogenic oligosaccharides of hyaluronan in endothelial cells. Inhibition by non-angiogenic, high-molecular-weight hyaluronan. Int J Cancer, 71, 251-6.

Fontoura, B. M., Nussenzveig, D. R., Pelton, K. M. & Maack, T. 1990. Atrial natriuretic factor receptors in cultured renomedullary intersti-tial cells. Am J Physiol, 258, C692-9.

Formby, B. & Stern, R. 2003. Lactate-sensitive response elements in genes involved in hyaluronan catabolism. Biochem Biophys Res Commun, 305, 203-8.

Fraser, J. R., Laurent, T. C. & Laurent, U. B. 1997. Hyaluronan: its nature, distribution, functions and turnover. J Intern Med, 242, 27-33.

Frost, G. I., Csoka, T., Stern, R. 1996. The Hyaluronidases: A chemical, Biological and Clinical overview. Trends in glycoscience and gly-cotechnology, 8, 419-434.

Gandy, S. E., Buse, M. G. & Crouch, R. K. 1982. Protective role of superox-ide dismutase against diabetogenic drugs. J Clin Invest, 70, 650-8.

61

Ginetzinsky, A. G. 1958. Role of hyaluronidase in the re-absorption of water in renal tubules: the mechanism of action of the antidiuretic hor-mone. Nature, 182, 1218-9.

Guron, G. & Friberg, P. 2000. An intact renin-angiotensin system is a pre-requisite for normal renal development. J Hypertens, 18, 123-37.

Guron, G., Marcussen, N., Nilsson, A., Sundelin, B. & Friberg, P. 1999. Postnatal timeframe for renal vulnerability to enalapril in rats. J Am Soc Nephrol, 10, 1550-1560.

Gusev, G. P., Vasileva, V. F. & Manusova, N. B. 1983. The effect of lithium on the tissue levels of electrolytes and hyaluronic acid levels in the kidney papilla in the rat. Fiziol. Zh. SSSR. Im. I M Sechenova., 69(5), 701-707.

Guyton, A. C., Hall, J.E. 2000. Textbook of medical physiology, Philadel-phia, W.B. Saunders Company.

Göransson, V., Hansell, P., Moss, S., Alcorn, D., Johnsson, C., Hällgren, R., et al. 2001. Renomedullary interstitial cells in culture; the osmolality and oxygen tension influence the extracellular amounts of hyalu-ronan and cellular expression of CD44. Matrix Biol, 20, 129-36.

Göransson, V., Johnsson, C., Jacobson, A., Heldin, P., Hällgren, R. & Han-sell, P. 2004. Renal hyaluronan accumulation and hyaluronan syn-thase expression after ischaemia-reperfusion injury in the rat. Nephrol Dial Transplant, 19, 823-30.

Göransson, V., Johnsson, C., Nylander, O. & Hansell, P. 2002. Renome-dullary and intestinal hyaluronan content during body water excess: a study in rats and gerbils. J Physiol, 542, 315-22.

Hamerman, D. & Wood, D. D. 1984. Interleukin 1 enhances synovial cell hyaluronate synthesis. Proc Soc for Exp Biol Med, 177, 205-210.

Hansell, P., Göransson, V., Odlind, C., Gerdin, B. & Hällgren, R. 2000. Hyaluronan content in the kidney in different states of body hydra-tion. Kidney Int, 58, 2061-8.

Hansell, P., Maric, C., Alcorn, D., Göransson, V., Johnsson, C. & Hällgren, R. 1999. Renomedullary interstitial cells regulate hyaluronan turn-over depending on growth media osmolality suggesting a role in re-nal water handling. Acta Physiol Scand, 165, 115-6.

Hansell, P. & Sjöquist, M. 1992. Dopamine receptor blockade and synthesis inhibition during exaggerated natriuresis in spontaneously hyperten-sive rats. Acta Physiol Scand, 144, 269-76.

Harris, R. C. & Breyer, M. D. 2001. Physiological regulation of cyclooxy-genase-2 in the kidney. Am J Physiol Renal Physiol, 281, F1-11.

Hua, Q., Knudson, C. B. & Knudson, W. 1993. Internalization of hyaluronan by chondrocytes occurs via receptor-mediated endocytosis. J Cell Sci, 106 ( Pt 1), 365-75.

Iacob, S. & Knudson, C. B. 2006. Hyaluronan fragments activate nitric oxide synthase and the production of nitric oxide by articular chondro-cytes. Int J Biochem Cell Biol, 38, 123-33.

Ikegami-Kawai M, Suzuki A, Karita I & Takahashi T. 2003. Increased hyaluronidase activity in the kidney of streptozotocin-induced diabetic

62

rats. J Biochem (Tokyo), 134, 875-880. Ikegami-Kawai, M., Okuda, R., Nemoto, T., Inada, N. & Takahashi, T.

2004. Enhanced activity of serum and urinary hyaluronidases in streptozotocin-induced diabetic Wistar and GK rats. Glycobiology, 14, 65-72.

Ivanova, L. N., Goryunova, T.E. 1981. Mechanism of the renal hyaluronate-hydrolase activation in response to adh. In: TAKACS, L. (Ed.) Ad-vances in Physiological Sciences: Kidney and Body Fluids. Perga-mon Press.

Jackson, D. G. 2003. The lymphatics revisited: new perspectives from the hyaluronan receptor LYVE-1. Trends Cardiovasc Med, 13, 1-7.

Jacobson, A., Brinck, J., Briskin, M. J., Spicer, A. P. & Heldin, P. 2000. Expression of human hyaluronan synthases in response to external stimuli. Biochem J, 348 Pt 1, 29-35.

Johnsson, C., Gerdin, B. & Tufveson, G. 2004. Effects of commonly used immunosuppressants on graft-derived fibroblasts. Clin Exp Immu-nol, 136, 405-12.

Johnsson, C., Tufveson, G., Wahlberg, J. & Hällgren, R. 1996. Experimen-tally-induced warm renal ischemia induces cortical accumulation of hyaluronan in the kidney. Kidney Int, 50, 1224-9.

Jones, S., Jones, S. & Phillips, A. O. 2001. Regulation of renal proximal tubular epithelial cell hyaluronan generation: implications for dia-betic nephropathy. Kidney Int, 59, 1739-49.

Jun, Z., Hill, P. A., Lan, H. Y., Foti, R., Mu, W., Atkins, R. C., et al. 1997 CD44 and hyaluronan expression in the development of experimen-tal crescentic glomerulonephritis. . Clin Exp Immunol, Apr;108(1), 69-77.

Jung, F. F., Bouyounes, B., Barrio, R., Tang, S. S., Diamant, D. & Ingelfin-ger, J. R. 1993. Angiotensin converting enzyme in renal ontogeny: hypothesis for multiple roles. Pediatr Nephrol 7, 834-840.

Kerjaschki, D., Regele, H. M., Moosberger, I., Nagy-Bojarski, K., Watsch-inger, B., Soleiman, A., et al. 2004. Lymphatic neoangiogenesis in human kidney transplants is associated with immunologically active lymphocytic infiltrates. J Am Soc Nephrol, Mar;15(3), 603-612.

Knepper, M. A., Saidel, G. M., Hascall, V. C. & Dwyer, T. 2003. Concentra-tion of solutes in the renal inner medulla: interstitial hyaluronan as a mechano-osmotic transducer. Am J Physiol Renal Physiol, 284, F433-46.

Knudson, C. B. & Knudson, W. 2004. Hyaluronan and CD44: modulators of chondrocyte metabolism. Clin Orthop Relat Res, S152-62.

Kreil, G. 1995. Hyaluronidases--a group of neglected enzymes. Protein Sci, 4, 1666-9.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-5.

Lai-Fook, S. J. & Brown, L. V. 1991. Effects of electric charge on hydraulic conductivity of pulmonary interstitium. J Appl Physiol, 70, 1928-32.

63

Lau, K. S., Nakashima, O., Aalund, G. R., Hogarth, L., Ujiie, K., Yuen, J., et al. 1995. TNF-alpha and IFN-gamma induce expression of nitric ox-ide synthase in cultured rat medullary interstitial cells. Am J Physiol, 269, F212-7.

Laudat, A., Guechot, J., Lecourbe, K., Damade, R. & Palluel, A. M. 2000. Hyaluronidase activity in serum of patients with monoclonal gam-mapathy. Clin Chim Acta, 301, 159-67.

Laurent, T. C. & Fraser, J. R. 1992. Hyaluronan. Faseb J, 6, 2397-404. Lepperdinger, G., Strobl, B. & Kreil, G. 1998. HYAL2, a human gene ex-

pressed in many cells, encodes a lysosomal hyaluronidase with a novel type of specificity. J Biol Chem, 273, 22466-70.

Lesavre, P., Choukroun, G., Francois, A., Noel, L. H., Mecarelli, L. & Droz, D. 1997. The hyaluronan-binding adhesion molecule CD44: expres-sion in normal and diseased kidneys and by cultured mesangial cells. Adv Nephrol Necker Hosp, 26, 317-39.

LIF 2006. FASS, Stockholm, Läkemedelsindustriföreningen. Lodish, H., Berk, A., Zipursky, L., Matsudaira, P., Baltimore, D., Darnell, J.

2002. Molecular cell biology, New York, W.H. Freeman and Com-pany.

Lokeshwar, V. B., Lokeshwar, B. L., Pham, H. T. & Block, N. L. 1996. As-sociation of elevated levels of hyaluronidase, a matrix-degrading en-zyme, with prostate cancer progression. Cancer Res, 56, 651-7.

Lokeshwar, V. B. & Selzer, M. G. 2000. Differences in hyaluronic acid-mediated functions and signaling in arterial, microvessel, and vein-derived human endothelial cells. J Biol Chem, 275, 27641-9.

Lokeshwar, V. B., Young, M. J., Goudarzi, G., Iida, N., Yudin, A. I., Cherr, G. N., et al. 1999. Identification of bladder tumor-derived hyalu-ronidase: its similarity to HYAL1. Cancer Res, 59, 4464-70.

Mahadevan, P., Larkins, R. G., Fraser, J. R., Fosang, A. J. & Dunlop, M. E. 1995. Increased hyaluronan production in the glomeruli from dia-betic rats: a link between glucose-induced prostaglandin production and reduced sulphated proteoglycan. Diabetologia, 38, 298-305.

Malathy, K. & Kurup, P. A. 1972. Metabolism of glycosaminoglycans in alloxan diabetic rats. I. Changes in tissue glycosaminoglycans. Dia-betes, 21, 1162-7.

Maric, C., Aldred, G. P., Antoine, A. M., Dean, R. G., Eitle, E., Mendelsohn, F. A., et al. 1996. Effects of angiotensin II on cultured rat renome-dullary interstitial cells are mediated by AT1A receptors. Am J Physiol, 271, F1020-8.

Maric, C., Aldred, G. P., Harris, P. J. & Alcorn, D. 1998. Angiotensin II inhibits growth of cultured embryonic renomedullary interstitial cells through the AT2 receptor. Kidney Int, 53, 92-9.

Matsui, K., Breitender-Geleff, S., Soleiman, A., Kowalski, H. & Kerjaschki, D. 1999. Podoplanin, a novel 43-kDa membrane protein, controls the shape of podocytes. . Nephrol Dial Transplant, 14 Suppl 1, 9-11.

64

Matsui, K., Breiteneder-Geleff, S. & Kerjaschki, D. 1998. Epitope-specific antibodies to the 43-kD glomerular membrane protein Podoplanin cause proteinuria and rapid flattening of podocytes. J Am Soc Nephrol, 9, 2013-2026.

Matsusaka, T., Miyazaki, Y. & Ichikawa, I. 2002. The renin angiotensin system and kidney development. Annu Rev Physiol, 64, 551-61.

McKee, C. M., Lowenstein, C. J., Horton, M. R., Wu, J., Bao, C., Chin, B. Y., et al. 1997. Hyaluronan fragments induce nitric-oxide synthase in murine macrophages through a nuclear factor kappaB-dependent mechanism. J Biol Chem, 272, 8013-8.

McKee, C. M., Penno, M. B., Cowman, M., Burdick, M. D., Strieter, R. M., Bao, C., et al. 1996. Hyaluronan (HA) fragments induce chemokine gene expression in alveolar macrophages. The role of HA size and CD44 J Clin Invest 98, 2403-2413.

Melin, J., Hellberg, O., Funa, K., Hällgren, R., Larsson, E. & Fellström, B. C. 2006. Ischemia-induced renal expression of hyaluronan and CD44 in diabetic rats. Nephron Exp Nephrol, 103, e86-94.

Mio, K. & Stern, R. 2002. Inhibitors of the hyaluronidases. Matrix Biol, 21, 31-7.

Nasrallah, R., Landry, A., Singh, S., Sklepowicz, M. & Hebert, R. L. 2003. Increased expression of cyclooxygenase-1 and -2 in the diabetic rat renal medulla. Am J Physiol Renal Physiol, 285, F1068-77.

Nielsen, S., DiGiovanni, S. R., Christensen, E. I., Knepper, M. A. & Harris, H. W. 1993. Cellular and subcellular immunolocalization of vaso-pressin-regulated water channel in rat kidney. Proc Natl Acad Sci U S A, 90, 11663-7.

Nilsson, A. B., Johnsson, C., Friberg, P. & Hansell, P. 2001. Renal cortical accumulation of hyaluronan in adult rats exposed neonatally to an-giotensin-converting enzyme inhibition. Acta Physiol Scand, 173, 343-50.

Norwood, V., Craig, M. R., Harris, J. M. & Gomez, R. A. 1997. Differential expression of angiotensin II receptors during early renal morpho-genesis. . Am J Physiol, 272, R662-R668.

Oertli, B., Beck-Schimmer, B., Fan, X. & Wuthrich, R. P. 1998. Mecha-nisms of hyaluronan-induced up-regulation of ICAM-1 and VCAM-1 expression by murine kidney tubular epithelial cells: hyaluronan triggers cell adhesion molecule expression through a mechanism in-volving activation of nuclear factor-kappa B and activating protein-1. J Immunol, 161, 3431-3437.

Palm, F., Ortsäter, H., Hansell, P., Liss, P. & Carlsson, P. O. 2004. Differen-tiating between effects of streptozotocin per se and subsequent hy-perglycemia on renal function and metabolism in the streptozotocin-diabetic rat model. Diabetes Metab Res Rev, 20, 452-9.

Persson, A. E., Gutierrez, A., Pittner, J., Ring, A., Ollerstam, A., Brown, R., et al. 2000. Renal NO production and the development of hyperten-sion. Acta Physiol Scand, 168, 169-74.

65

Philipson, L. H. & Schwartz, N. B. 1984. Subcellular localization of hyalu-ronate synthetase in oligodendroglioma cells. J Biol Chem, 259, 5017-23.

Pohl, M., Sakurai, H., Stuart, R. O. & Nigam, S. K. 2000. Role of hyalu-ronan and CD44 in in vitro branching morphogenesis of ureteric bud cells. Dev Biol, 224, 312-25.

Prehm, P. 1984. Hyaluronate is synthesized at plasma membranes. Biochem J, 220, 597-600.

Pruitt, M., Knepper, M., Graves, B. & Schmidt-Nielsen, B. 2006. Effects of peristaltic contractions of the renal pelvic wall on solute concentra tions of the renal inner medulla in the hamster. Am J Physiol Renal Physiol, 4, 892-6.

Regele, H. M., Fillipovic, E., Langer, B., Poczewki, H., Kraxberger, I., Bitt-ner, R. E., et al. 2000. Glomerular expression of dystroglycans is re-duced in minimal change nephrosis but not in focal segmental glomerulosclerosis. J Am Soc Nephrol, 11, 403-12.

Rockey, D. C., Chung, J. J., McKee, C. M. & Noble, P. W. 1998. Stimula-tion of inducible nitric oxide synthase in rat liver by hyaluronan fragments. Hepatology, 27, 86-92.

Rosines, E., Schmidt, H. J. & Nigam, S. K. 2007. The effect of hyaluronic acid size and concentration on branching morphogenesis and tubule differentiation in developing kidney culture systems: Potential appli-cations to engineering of renal tissues. Biomaterials, 28, 4806-17.

Rügheimer, L., Carlsson, C., Johnsson, C. & Hansell, P. 2008a. Renal hyalu-ronan content during experimental uncontrolled diabetes in rats. J Physiol Pharmacol, 59, 115-128.

Rügheimer, L., Johnsson, C., Maric, C. & Hansell, P. 2008b. Hormonal Regulation of Renomedullary Hyaluronan. Acta Physiol (Oxf). In press.

Saez, F., Castells, M. T., Zuasti, A., Salazar, F., Reverte, V., Loria, A., et al. 2007. Sex differences in the renal changes elicited by angiotensin II blockade during the nephrogenic period. Hypertension, Jun;49(6), 1429-1435.

Schmidt-Nielsen, B. 1995. August Krogh Lecture. The renal concentrating mechanism in insects and mammals: a new hypothesis involving hy-drostatic pressures. Am J Physiol, 268, R1087-100.

Schnedl, W. J., Ferber, S., Johnson, J. H. & Newgard, C. B. 1994. STZ transport and cytotoxicity. Specific enhancement in GLUT2-expressing cells. Diabetes, 43, 1326-33.

Schrijvers, B. F., De Vriese, A. S. & Flyvbjerg, A. 2004. From hyperglyce-mia to diabetic kidney disease: the role of metabolic, hemodynamic, intracellular factors and growth factors/cytokines. Endocr Rev, 25, 971-1010.

Scott, D., Coleman, P. J., Mason, R. M. & Levick, J. R. 2000. Concentration dependence of interstitial flow buffering by hyaluronan in synovial joints. Microvasc Res, 59, 345-53.

66

Shotan, A., Widerhorn, J., Hurst, A. & Elkayam, U. 1994. Risks of angio-tensin-converting enzyme inhibition during pregnancy: experimental and clinical evidence, potential mechanisms, and recommendations for use. Am J Med, 96, 451-6.

Singleton, P. A. & Bourguignon, L. Y. 2004. CD44 interaction with ankyrin and IP3 receptor in lipid rafts promotes hyaluronan-mediated Ca2+ signaling leading to nitric oxide production and endothelial cell ad-hesion and proliferation. Exp Cell Res, 295, 102-18.

Slevin, M., Krupinski, J., Kumar, S. & Gaffney, J. 1998. Angiogenic oligo-saccharides of hyaluronan induce protein tyrosine kinase activity in endothelial cells and activate a cytoplasmic signal transduction pathway resulting in proliferation. Lab Invest, 78, 987-1003.

Spence, S. G., Allen, H. L., Cukierski, M. A., Manson, J. M., Robertson, R. T. & Eydelloth, R. S. 1995. Defining the susceptible period of de-velopmental toxicity for the AT1-selective angiotensin II receptor antagonist losartan in rats. Teratology, 51, 367-382.

Spicer, A. P., Augustine, M. L. & McDonald, J. A. 1996. Molecular cloning and characterization of a putative mouse hyaluronan synthase. J Biol Chem, 271, 23400-6.

Stern, R. 2004. Hyaluronan catabolism: a new metabolic pathway. Eur J Cell Biol, 83, 317-25.

Sulyok, E. & Nyul, Z. 2005. Hyaluronan-related limited concentration by the immature kidney. Med Hypotheses, 65, 1058-61.

Sun, L., Feusi, E., Sibalic, A., Beck-Schimmer, B. & Wuthrich, R. P. 1998. Expression profile of hyaluronidase mRNA transcripts in the kidney and in renal cells. Kidney Blood Press Res, 21, 413-8.

Sutherland, D. E., Gores, P. F., Farney, A. C., Wahoff, D. C., Matas, A. J., Dunn, D. L., et al. 1993. Evolution of kidney, pancreas, and islet transplantation for patients with diabetes at the University of Minne-sota. Am J Surg, 166, 456-91.

Takeda, M., Babazono, T., Nitta, K. & Iwamoto, Y. 2001. High glucose stimulates hyaluronan production by renal interstitial fibroblasts through the protein kinase C and transforming growth factor-beta cascade. Metabolism, 50, 789-94.

Tamakoshi, K., Kikkawa, F., Maeda, O., Suganuma, N., Yamagata, S., Ya-magata, T., et al. 1997. Hyaluronidase activity in gynaecological cancer tissues with different metastatic forms. Br J Cancer, 75, 1807-11.

Thorup, C., Sundler, F., Ekblad, E. & Persson, A. E. 1993. Resetting of the tubuloglomerular feedback mechanism by blockade of NO-synthase. Acta Physiol Scand, 148, 359-60.

Tigerstedt, R., Bergman, PG 1898. Niere und Kreislauf. Skand Arch Physiol, 8, 223-271.

Tomida, M., Koyama, H. & Ono, T. 1977. Effects of adenosine 3':5'-cyclic monophosphate and serum on synthesis of hyaluronic acid in con-fluent rat fibroblasts. Biochem J, 162, 539-43.

67

Toole, B. P. 1990. Hyaluronan and its binding proteins, the hyaladherins. Curr Opin Cell Biol, 2, 839-44.

Toole, B. P. 2000. Hyaluronan is not just a goo! J Clin Invest, 106, 335-6. Toole, B. P., Yu, Q. & Underhill, C. B. 2001. Hyaluronan and hyaluronan-

binding proteins. Probes for specific detection. Methods Mol Biol, 171, 479-85.

Tufro-McReddie, A., Harrison, J. K., Everett, A. D. & Gomez, R. A. 1993. Ontogeny of type 1 angiotensin II receptor gene expression in the rat. . J Clin Invest, 91, 530-537.

Uchigata, Y., Yamamoto, H., Kawamura, A. & Okamoto, H. 1982. Protec-tion by superoxide dismutase, catalase, and poly(ADP-ribose) syn-thetase inhibitors against alloxan- and streptozotocin-induced islet DNA strand breaks and against the inhibition of proinsulin synthe-sis. J Biol Chem, 257, 6084-8.

Underhill, C. 1992. CD44: the hyaluronan receptor. J Cell Sci, 103 ( Pt 2), 293-8.

Wang, A. & Hascall, V. C. 2004. Hyaluronan structures synthesized by rat mesangial cells in response to hyperglycemia induce monocyte ad-hesion. J Biol Chem, 279, 10279-85.

Wang, T., Cheng, H. H., Heimburger, O., Chen, C., Waniewski, J., Bergstrom, J., et al. 1999. Hyaluronan decreases peritoneal fluid ab-sorption: effect of molecular weight and concentration of hyalu-ronan. Kidney Int, 55, 667-73.

Wang, T., Cheng, H. H., Heimburger, O., Waniewski, J., Bergstrom, J. & Lindholm, B. 1998. Hyaluronan prevents the decreased net ultrafil-tration caused by increased peritoneal dialysate fill volume. Kidney Int, 53, 496-502.

Varki 1999. Essential Glycobiology, Los Angeles, The consortium of glyco-biology Editors.

Weigel, P. H., Hascall, V. C. & Tammi, M. 1997. Hyaluronan synthases. J Biol Chem, 272, 13997-4000.

Wells, A. F., Klareskog, L., Lindblad, S. & Laurent, T. C. 1992. Correlation between increased hyaluronan localized in arthritic synovium and the presence of proliferating cells. A role for macrophage-derived factors. Arthritis Rheum, 35, 391-6.

Wells, A. F., Larsson, E., Tengblad, A., Fellstrom, B., Tufveson, G., Klare-skog, L., et al. 1990. The localization of hyaluronan in normal and rejected human kidneys. Transplantation, 50, 240-3.

West, D. C., Hampson, I. N., Arnold, F. & Kumar, S. 1985. Angiogenesis induced by degradation products of hyaluronic acid. Science, 228, 1324-6.

Wolf, G. 2002. Angiotensin II and tubular development. Nephrol Dial Transplant, 17 Suppl 9, 48-51.

Wüthrich, R. P. 1999. The proinflammatory role of hyaluronan-CD44 inter-actions in renal injury (editorial). Nephrol Dial Transplant, 14, 2554-2556.

68

Yang, T., Zhang, A., Pasumarthy, A., Zhang, L., Warnock, Z. & Schner-mann, J. B. 2006. Nitric oxide stimulates COX-2 expression in cul-tured collecting duct cells through MAP kinases and superoxide but not cGMP. Am J Physiol Renal Physiol, 291, F891-5.

Yaron, M., Yaron, I., Wiletzki, C. & Zor, U. 1978. Interrelationship between stimulation of prostaglandin E and hyaluronate production by poly (I)-poly (C) and interferon in synovial fibroblast culture. Arthritis Rheum, 21, 694-698.

Zawieja, D. C., Garcia, C. & Granger, H. J. 1992. Oxygen radicals, enzymes, and fluid transport through pericardial interstitium. Am J Physiol, 262, H136-43.

Zerbe, R. L., Vinicor, F. & Robertson, G. L. 1985. Regulation of plasma vasopressin in insulin-dependent diabetes mellitus. Am J Physiol, 249, E317-25.

Zhuo, J. L. 2000. Renomedullary interstitial cells: a target for endocrine and paracrine actions of vasoactive peptides in the renal medulla. Clin Exp Pharmacol Physiol, 27, 465-73.

Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Medicine 351

Editor: The Dean of the Faculty of Medicine

A doctoral dissertation from the Faculty of Medicine, UppsalaUniversity, is usually a summary of a number of papers. A fewcopies of the complete dissertation are kept at major Swedishresearch libraries, while the summary alone is distributedinternationally through the series Digital ComprehensiveSummaries of Uppsala Dissertations from the Faculty ofMedicine. (Prior to January, 2005, the series was publishedunder the title “Comprehensive Summaries of UppsalaDissertations from the Faculty of Medicine”.)

Distribution: publications.uu.seurn:nbn:se:uu:diva-8724

ACTA

UNIVERSITATIS

UPSALIENSIS

UPPSALA

2008

kidney hyaluronan172039/fulltext01.pdf · the entire plasma volume is filtered and processed about...

Documents