journal of bio~ical chemis~y no. of 8, by molecular ... · the journal of bio~ical chemis~y 0 1994...

THE JOURNAL OF B I O ~ I C A L C H E M I S ~ Y 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 14, Issue of April 8, pp. 10384-10392, 1994 Printed in U S A .

The Human Chorionic Somatomammotropin Gene Enhancer Is Composed of Multiple DNA Elements That Are Homologous to Several SV40 Enhansons”

(Received for publication, September 17, 1993, and in revised form, December 17, 1993)

Shi-Wen Jiand and Norman L. EberhardtSI From the $Endocrine Research Unit, Departments of Medicine and Biochemistry /Molecular Biology, Mayo Clinic, Rochester, Minnesota 55905

Previous studies indicate that a human chorionic somatomammotropin (hCS) gene enhancer (CSEn) associated with the growth hormone (hGH) gene locus is involved in directing cell-specific expression of the hCS genes in placenta. In the current studies, we report a detailed structural analysis of this enhancer. CSEn stimulated transcription of a variety of promoters, including the hCS, human growth hormone, thymidine kinase, and Rous sarcoma virus promoters, in human choriocarcinoma cell lines (BeWo and JEG-3) but not HeLa cells or rat somatolactotrophes ( G C ) . Maximal enhancer activity was confined to a 242-base pair DNA segment. Of several CSEn subfragments, only the En-571242 subfrag- ment retained activity (33.6% wild-type). The CSEn DNA sequence contained direct and inverted repeat motifs and sequences related to the SV40 enhansons, GT-IIC, GT-I, and SphYSphII. DNase I footprint analysis re- vealed that most of these sites were protected by nuclear proteins derived from BeWo, JEG-3, HeLa, and GC cells. Site-specific block mutation of the GT-IIC-related and inverted repeat motifs virtually abolished enhancer activity, and mutation of all but the GT-I-related motif resulted in significant loss (3&60%) of activity. These data demonstrate that the CS enhancer is comprised of multiple elements related to SV40 enhansons that interact cooperatively to generate enhancer function.

Human chorionic somatomammotropin (hCS’ or placental lactogen, hPL), is a member of the growth hormone gene family. This gene family, localized on band q22-24 of chromosome 17, is composed of three hCS genes and two hGH genes spanning 66 kilobases of DNA (Hirt et al., 1987; Chen et al . , 1989). These genes share a high degree of sequence identity through relatively recent gene duplication and gene conversion events (Hirt et a l . , 1987; Chen et al . , 1989). The hGH-1 gene is expressed in the pituitary, and the hCS-1, hCS-2, and hGH-2 genes are expressed exclusively in the placenta; the hCS-5 gene appears

~ ~~

DK41206 (to N. L. E.). The costs of publication of this article were * This work was supported by National Institutes of Health Grant

therefore be hereby marked “advertisement” in accordance with 18 defrayed in part by the payment of page charges. This article must

U.S.C. Section 1734 solely to indicate this fact.

Mayo Clinic, Rochester, MN 55905. “el.: 507-255-6554; Fax: 507-255- 5 To whom correspondence should be addressed: 4-407 Alfred, SMH,

4828; Internet: [email protected]. ‘The abbreviations used are: hCS, human chorionic somatomam-

motropin (also known as placental lactogen); CSEn and En, placental-

the hGH/hCS gene locus; hGH, human growth hormone; rGH, rat specific chorionic somatomammotropin gene enhancer associated with

growth hormone; GHFliPitl, pituitary-specific transcription factor; LUC, luciferase; 5’-FR, 5‘-flanking region; bp, base pair; nt, nucleotide; RSV, Rous sarcoma virus; TK, thymidine kinase; PCR, polymerase chain reaction; ANOVA, analysis of variance.

to be a pseudogene (Hirt et al., 1987). The biological function of hCS is not fully understood. CS acts as a lactogenic hormone that may supplement andor complement the actions of prolac- tin, and it may stimulate lipolysis to increase free fatty acid in maternal blood and promote fetal growth (for review see, Hand- werger, 1991; Walker et al . , 1991; Soares et a l . , 1991). However, it may not be an essential hormone, since individuals lacking the genes for CS have had normal pregnancies (Nielsen et al., 1979; Wurzel et al., 1982). Through its carbohydrate regulating actions, CS does appear to play a role in pregnancy-associated diabetes (reviewed in Walker et al., 1991).

Although the hCS 5’-flanking, promotor, and coding regions are nearly identical (93.5-96% sequence identity) to the corresponding regions of the hGH gene (Miller and Eberhardt, 1983), its distinct cell-specific expression in placental syncy- tiotrophoblasts indicates that unique mechanisms account for its cell-specific expression. Cell-specific control of pituitary hGH gene expression is mediated by the pituitary-specific factor GHFlP i t l (Bodner and Karin, 1987; Bodner et al., 1988) which binds to the hGH promoter; however, no placental-specific transcription factor that binds to the hCS promoter has been identified. Saunders and co-workers have identified a placental-specific enhancer (Rogers et al., 1986; Walker et al., 1990; Fitzpatrick et al . , 1990) that is localized to the 3’-flanking region of the hCS-2 gene. Nearly identical copies (-97%) of this enhancer sequence are localized 3’ to the hCS-5 and hCS-1 genes; however, it is not known whether these sequences are functional. The enhancer, designated CSEn, functions in human choriocarcinoma cell lines (BeWo and JEG-31, but not other cell types (e.g. HeLa or HepG2), suggesting that this enhancer exerts a major effect on cell-specific hCS expression in placenta.

The bulk of CSEn activity (-90%) has been localized to a 138-bp fragment (Walker et al . , 1990), and DNase I footprint analyses have shown protection of the central part of this DNA fragment (nucleotides 139-150) by nuclear proteins from human placenta and HeLa cells. This footprint region overlaps with a TEF-1 consensus binding site, a transcription factor that binds to the SV40 GT-IIC and SphVSphII enhansons, and which participates in SV40 enhancer activity (Davidson et a l . , 1988; Xiao et al . , 1991). Accordingly, it has been proposed that TEF-1 or a closely related factor may be involved in mediating enhancer activity (Walker et al., 1990). Nevertheless, the data do not provide insight into the factors that govern the cell- specific control of the enhancer. For example, if TEF-1 is involved in enhancer function, why does not CSEn function in HeLa cells where TEF-1 is abundant? Thus, it is likely that other factors, in addition to TEF-1 or TEF-1-related factors, account for CSEn cell-specific function.

Many enhancers have been shown to consist of diverse, multipartite DNA elements termed enhansons that act cooperatively to provide enhancer function. Examples include the SV40

10384

Structure of the Chorionic Somatomammotropin Gene Enhancer 10385

enhancer (Herr et al., 1986; Ondek et al., 1988; Davidson et al., 1988), the fushi tarazu (ftz) autoregulatory enhancer AE that directs expression of the homeodomain gene ftz (Schier and Gehring, 1993), the T lymphocyte-specific SL3-3 virus enhancer (LoSardo et d., 19901, and the rat muscle creatine kinase enhancer (Horlick and Benfield, 1989). No detailed analysis of the placental-specific enhancer has been reported. Consequently, we have undertaken a more detailed character- ization of the enhancer to identify potential regions which may be involved in the cell-specific control of CSEn function. Here we report structural and functional studies indicating that CSEn consists of multipartite DNA sequences, all of which are required for maximal enhancer function. These sequences bear striking homology to the SV40 GT-IIC, GT-I, and SphYSphII enhansons. Mutation of the TEF-1 binding motif, GT-IIC, virtually eliminated enhancer activity; however, a 49-nucleotide region containing this element lacked enhancer activity when linked to the hCS promoter, indicating that TEF-1 or related factors were necessary but not sufficient for enhancer activity. Mutation of a separate region containing an inverted repeat (IR) almost abolished enhancer function whereas mutations of several other SV40 enhanson-related sequences diminished enhancer activity significantly (3040%). The enhancer was ca- pable of functioning with several promoters including the hGH, TK, and RSV promoters, suggesting that unique features of promoter structure were not required for enhancer function or cell-specific action. The data indicate that the CS enhancer is composed of multiple, distinct enhansons that act cooperatively to mediate enhancer function.

EXPERIMENTAL PROCEDURES Materials-Oligonucleotides were synthesized by the Molecular Bi-

ology Core Facility, Mayo Clinic. [Y-~~PIATP (5,000 Ci/mmol) and [5'-a- 35S]dATP (1,000 Ci/mmol) were obtained from Amersham Corp.

Cell Culture-Bewo, JEG-3, and HeLa 63 ) cells were purchased from the American Type Culture Collection. Rat anterior pituitary tumor (GC) and HeLa cells were maintained in Dulbecco's modified Eagle's medium (Life Technologies, Inc.); Bewo and JEG-3 cells were maintained in RPMI 1640 (Life Technologies, Inc.). All media were supplemented with 10% fetal bovine serum (Whittaker), 100 unitdml penicillin (Life Technologies, Inc.), 100 pg/ml streptomycin (Life Tech- nologies, Inc.) and 2 m~ L-glutamine (Life Technologies, Inc.), and the cells were maintained at 37 "C in an atmosphere containing 5% CO, and 100% humidity.

Cell Zhmsfection and Luciferase Assays-Cells were grown to con- fluence in T175 flasks (Becton Dickinson). After rinsing with 10 ml of phosphate-buffered saline (Life Technologies, Inc.), cells were harvested by digestion with 5 ml of trypsin (0.25%, Life Technologies, Inc.) for 5 min. Cells were collected by centrifugation (5,000 revolutiondmin x 1 min), washed twice with 40 ml of media, and resuspended in phosphate- buffered saline containing 0.1% glucose at a concentration of 2.5 x 10' celldml. For each transfection, 5 x lo6 cells (200 pl) were mixed with 15 pg of plasmid DNA previously diluted in 20 pl of 10 nm Tris-HC1, pH 7.5, 1 m~ EDTA, and the cells were subjected to electroporation (Gene Pulser, Bio-Rad) in standard cuvettes with a 0.4-cm electrode gap (Bio- Rad). Plasmid DNA was purified by CsCl, gradient ultracentrifugation. Optimal conditions for electroporation of Bewo and JEG-3 cells were 960 microfarads at 250 V; GC and HeLa cells were electroporated using 500 microfarads at 350 V. The electroporated cells were allowed to stand a t room temperature for 6 min, resuspended in 0.8 ml of medium, and plated on 6.0-cm tissue culture dishes (Becton Dickinson) containing 5 ml of media. &r 20 h of incubation, cells were scraped off carefully with a policeman and washed twice with 5 ml of cold phosphate-buffered saline. Cells were suspended in 200 pl of lysis buffer (100 m~ KHPO,, pH 7.8, 1 m~ dithiothreitol), and lysis was accomplished by three cycles of freezing on dry ice and thawing in a 37 "C water bath. Following centrifugation (13,000 x g x 10 min), the supernatant was saved for luciferase and protein assays. Luciferase activity was meas- ured by luminometry (Monolight 2010, Analytical Luminescence Labo- ratory). The luciferase assay buffer contained 25 m~ glycylglycine, pH 7.8, 15 m~ MgSO,, and 5.5 m~ ATP. The reaction was initiated by automatic injection of 100 pl of 1 m~ o-luciferin. The protein concentration of cell lysates was determined by Coomassie dye binding assay

(Pierce Chemical Co.). The data were expressed as light unitdpg protein.

Plasmid Constructions-The luciferase vector pA,LUC (Maxwell et al., 1989; Wood et al., 1989) was kindly provided by Dr. William Wood (University of Colorado Health Science Center). A 242-bp AccI-PuuII fragment containing the hCS enhancer (CSEn) localized to the 3'-end of the hCS-2 gene (Rogers et al., 1986) cloned into pUC19 was generously provided by Dr. Peter Cattini (University of Manitoba). A 262-bp EcoRI- PstI fragment containing CSEn and part of the pUC19 multiple cloning site was removed from this plasmid by enzyme digestion, treated with T4 polymerase, and BglII linkers were added; this fragment was designated En. The En fragment was inserted into p&LUC at the BglII site upstream of the three polyadenylation (poly(A)) stops. Plasmids with enhancer inserted in different orientations were designated E& p&LUC and EnB-pA,LUC, respectively. The nonspecific activities from the promoterless vectors, p&LUC, EAp&LUC, and EnB_pA,LUC were indistinguishable from buffer background control assays (data not shown) due to the poly(A) stops preceding the luciferase reporter gene (Maxwell et al., 1989). The hCS promoter was inserted into p&LUC, E&p&LUC, and EnB-p&LUC between the Sal1 and Hind111 sites, immediately upstream of the luciferase reporter gene using standard cloning techniques to yield hCSp.LUC, En&hCSp.LUC, and EnB- hCSp.LUC, respectively. The hGH and other promoters were subcloned into these vectors in the same fashion and were given similar name designations.

The truncated hCS enhancers were generated using PCR amplifica- tion of the En fragment. Site-specific mutagenesis of selected sites within the enhancer were accomplished by inverse PCR mutagenesis (Hemsley et al., 1989). The oligonucleotides that were used as primers for these reactions are shown in Table I. En_103/151, containing the TEF-1 motif (Davidson et al., 1988; Xiao et al., 1991), was obtained by annealing the two complementary oligonucleotides, En-TEF and En- TEFrev, digesting with BamHI, and subcloning into the BglII site of hCSp.LUC. Fragment En-l/180 was amplified using universal (Life Technologies, Inc.) and En-04 primers with EnB-p&LUC as template. Similarly, En-57/242 was generated using universal and E ~ 0 5 as primers with EnA-p&LUC as template. Primers En-04 and En-05 were used to create fragment En-57/180. These amplified fragments were isolated from agarose gels by Geneclean (Bio 101), digested with BglII, and subcloned into hCSp.LUC. Fragment En-202/242 was obtained from XmnYBglII double digestion of EnAhCSp.LUC. After T4 polymerase treatment and BglII linker addition, the XmnVBglII fragment was subcloned into hCSp.LUC. En-A70/157 carrying an internal deletion was created with primers En-12 and En-17 using inverted PCR (see below). For the site-specific mutagenesis, block mutants were designed that contained specific restriction sites. Individual mutants, designated EK1-EM-8 are shown in Fig. 4, and the primers for gen- erating these mutants are shown in Table I. A small plasmid (3.99 kilobases) generated from EAhCSp .LUC by BarnHI digestion and religation to remove the hCS promoter and LUC reporter gene was used as template to increase the efficiency of inverted PCR. Template DNA (20-50 ng) and 0.5-1.0 pg primers were used in a 100-pl reaction containing at a final concentration 10 m~ Tris-HC1, pH 8.3,50 m~ KCl, 1.5 m~ MgCl,, and 500 p~ each dNTP. PCR was carried out for 30 cycles using 1.25 units of F'fu polymerase (Stratagene) after an initial 94 OC by 10 min of denaturation as follows: denature (94 "C for 30 s); anneal (52-58 "C for 1 min); extend (72 "C for 8 min); final extension (72 "C for 10 min). PCR products were treated with T4 DNA polymerase (New England Biolabs), electrophoresed on 0.5% agarose gels, and the linear plasmids were purified (Geneclean). The linear fragments were treated with polynucleotide kinase (New England Biolabs), and the phospho- rylated fragments were subjected to a second round of gel purification to remove traces of supercoiled template. The linear plasmids were recir- cularized by T4 DNA ligase treatment. Positive clones were screened by digestion with specific restriction enzymes whose corresponding sites had been designed into the primers, and the mutants were confirmed by dideoxy sequencing. The mutated enhancers were cut out with BglII digestion and resubcloned into hCSp.LUC.

DNase I Footprinting Assays-All DNA probes were generated by PCR. Ten pmol of one of the two primers used to prepare DNAprobes by PCR was 5'-end labeled with [Y-~~PIATP and polynucleotide kinase. The labeled primers were directly used in PCR without further purification. DNA probes were purified (Geneclean) from 2.0% agarose gels. A 278-bp probe (probe A) for the upstream region (nts 1-180) of CSEn was generated using the oligonucleotide En-04 (Table I) and universal primers with EnB-p&LUC as template (the universal primer site is 65 bp upstream of the BglII enhancer cloning site in p&LUC). A226-bp probe (probe B) for the central enhancer region (nts &234) was prepared

10386 Structure of the Chorionic Somatomammotropin Gene Enhancer

TABLE I Primers for CSEn mutagenesis and footprinting probes

Name Oligonucleotide sequence" Purposdconstruct

En-01 . TTTCAGCTCATCAAC Probe B En-02 TCATCTTTGCGGTCC En-TEF

Probe B CCGGATCCGATTCTGATATAATTAGA Ed-103/151 CTGGAATGTGGTCCAGGCAAGAGTAG CTCGAGGGATCCGG

En-TEF-rev CCGGATCCCTCGAGCTACTCTTGCCT EnA-103/151 GGACCACATTCCAGTCTAATTATATC AGAATCGGATCCGG

GCAGATCTATGCCTAGGATGTTTTC Probe C, Ed-571242, and EnA-57/180 En-04 GCAGATCTTGTTAGAATCACCTGGG En-05 En-07 GCAGAGCTCATCAACTTGGT EM-1 En-08 AGCGGACCCAGATCTGCAAG EM-1 En-09 TTCGCGGCAATTTCTGCTG EM-2 En-10 GCTTAAGTTGATGAGCTG EM-2 En-11 GGGAAACGATGCATACGTG EM-3 En-12 GGGCATCCTAGGCATCTC EM-3, EnA-A70/157 En-13 GATTGAGCCCTCACTCCC EM-4 En-14 GATCATCGTTTAGAAAAC EM-4 En-15 TCCTTCCAGGCAAGAGTAG EM-5 En-16 TCCGCAGTCTAATTATATCAG EM-5 En-17 GACACTTTCCCAGGTGATTC EM-6, EnA-A701157 En-18 GACACTACTCTTGCCTGGACC EM-6 En-19 CTGCAGCAACCTTGTTTACATG EM-7 En-20 TACACCTTAGGGACCGCAAAG EM-7 En-2 1 TACACCTCACAGGGGTACAGAG EM-8 En-22 ATCGATCATCTTTGCGGTCCC EM-8

Probe A, EnA-Vl80, and Ed-571180

All sequences shown in 5'-3' orientation. ~

using E e O l and E ~ 0 2 primers with EnAphLUC as template. Simi- larly, a 308-bp probe (probe C) for the downstream region (nts 58-242) of the enhancer was generated using E e 0 5 (Table I) and universal primers with EAp&LUC as template.

Crude nuclear extracts were isolated from cultured cells according to Dignam et al. (1983). Different amounts of proteins (20-60 pg) were diluted to 30 pl with dialysis buffer D (20 m~ HEPES, pH 7.9, 20% glycerol, 0.1 M KCI, 0.2 m~ EDTA, 0.5 m~ phenylmethylsulfonyl fluo- ride, 0.5 m~ dithiothreitol). MgC1, and Poly(d1-dC) were added to final concentrations of 6.0 m~ and 0.08 mg/ml, respectively, and the reactions diluted to a final volume of 48 p1 with H,O. After preincubation on ice for 15 min, 15,000 countdmin 5'-end labeled probe (2.0 pl) was added to the mixture, and incubation was continued for 15 min. Subsequently, the mixture was incubated at room temperature for 2 min. Varying amounts (0.15-1.2 units) ofDNase I (Boehringer Mannheim), diluted to 0.12 unitlpl in dilution buffer (10 m~ Tris-HC1, pH 7.5, 25 m~ CaCI,), were added to the reaction mixtures and allowed to incubate a t room temperature for 1 min. Stop buffer (100 pl in 200 m~ NaCl, 20 m~ EDTA, pH 8.0,1.0% SDS, 250 pg/ml tRNA) was added to terminate the reaction. Partially digested DNA fragments were subjected to phenol chloroform extraction and ethanol precipitation and were analyzed on 8% polyacrylamide, 8 M urea sequencing gels. Dideoxy sequencing reactions performed with the same primer as the one labeled for PCR were run on gels as markers. After electrophoresis, gels were dried in uacuo and exposed to Kodak x-ray film at -80 "C with intensifying screens for 16-24 h.

Data Analysis-All data groups were analyzed by analysis of variance (ANOVA) to determine if the effect being monitored, e.g. cell line, promoter, enhancer position and orientation, or mutation, among the data was significant a t the p < 0.05 level. The results of the ANOVA are provided in the figure legends. For all experimental groups which sat- isfied the initial ANOVA criterion, individual comparisons were performed against the control using Student's t tests with the use of a Bonferroni inequality to compensate for error introduced due to the multiple comparison analyses (Snedecor and Cochran, 1980). The controls for the comparisons are designated in the figure legends. In cases where the differences in means were very large and the variances were not equivalent, the logarithmical transformed (log,,) data were analyzed.

RESULTS

CSEn Stimulates hCS Promotor Activity Specifically in Hu- man Placental Choriocarcinoma Cells-Although CSEn has been shown to function in a cell-specific fashion previously (Rogers et al., 1986; Walker et at., 1990; Fitzpatrick et al.,

19901, we characterized the enhancer activity in the context of the pA,LUC vector with a variety of promoters in various cells. As shown in Fig. lA, CSEn stimulates hCSp.LUC activity 9.5- 22.0-fold in an orientation-independent manner in human choriocarcinoma cell lines (BeWo and JEG-3) but has no effect on promoter activity in rat anterior pituitary tumor GC cells (0.8- 1.2-fold) or HeLa cells (0.6-0.9-fold). This confirms previous studies (Walker et al . , 1990) which have shown that CSEn activity is found in JEG-3 and JAR cells but not HeLa, HepG2, a human liver cell line, or U-373MG cells, a human glioblas- toma cell line. CSEn was shown to have moderate activity in 18-54,SF pituitary lactotrophes (Rogers et al., 19861, suggesting that its activity was not strictly limited to the placenta. Our data (Fig. lA) indicate that CSEn lacks activity in the pituitary somatolactotrophe, GC cells, suggesting that this enhancer may not function generally in pituitary cells. The data indicate that there is a high degree of cell specificity associated with the enhancer.

CSEn Functions with Homologous and Heterologous Pro- moters-To determine whether CSEn activity was limited to the hCS promoter, constructs containing the homologous hGH and heterologous herpes simplex virus thymidine kinase (TK) and RSV promoters coupled to the luciferase gene were exam- ined in transiently transfected BeWo cells. The hGH 5"flanking region (nts -493/+2) and promoter is 96.5% identical with the hCS 5"flanking region. No difference in the ability of CSEn to stimulate the hGH (11.8-fold) and hCS (12.0-fold) promoters was observed (Fig. 1B ), indicating that the enhancer functions equally well with these homologous promoters. The thymidine kinase promoter (nts -198/+52) was stimulated 12.9-fold, a value not significantly different from the hGH or hCS promoters. By contrast, CSEn stimulated the RSV130 promoter (nts -130/+48) 4.2-fold, a value that was significantly less ( p < 0.05) than the hCS, hGH, or thymidine kinase promoters. Thus, enhancer activity does not appear to be promoter specific, although the relative level of stimulation may vary with differing promoters. These data suggest that factors interacting with the enhancer but not the promoter determine the cell specificity of enhancer action.

Structure of the Chorionic Somatomammotropin Gene Enhancer 10387 A .

B.

C.

FOLD STIMULATION

0 5 10 1 5 2 0 2 5 30

0.01

EnA Sense Orientation EnB Antisense Orientation

EnB-CS

FOLD STIMULATION 0 5 10 1 5

C e l l n Construct I I

FOLD STIMULATION

C e l l n Construct . 0 5 0 100 150 200

EnA Sense Orientation EnB Antisense Orientation

FIG. 1. CSEn is a cell-specific, promoter-, orientation-, and distance-independent enhancer. Cells were transfected by electroporation as described under “Experimental Procedures.” The number of independent transfections is given by the number n. Cells were transfected with 15 pg of hCSp.LUC or 15 pg of the indicated constructs containing the 242-bp CSEn fragment in the sense (stippled bars) or antisense orientation (solid bars). A, CSEn stimulation of hCS promoter activity in transiently transfected BeWo, JEG-3, GC, and HeLa cells. Basal activities for hCSp.LUC in the various cells are given as light unitdpg protein f S.E. x 10“: BeWo cells, 1.7 k 0.2; JEG-3 cells, 0.5 f 0.1; GC cells: 2.8 f 0.7; HeLa cells, 10.3 2 3.4. ANOVA analysis for the effect of cell line was significant a t the p = 0.000 level. All comparisons were made to the basal activity of hCSp.LUC in the relevant cell line. Individual p values for significance were derived as described under “Experimental Procedures.” B, CSEn stimulation of the homologous hCS and hGH and heterologous thymidine kinase and RSV promoters in transiently transfected BeWo cells. Basal activities for the parent constructs are given in parentheses as light unitdpg protein f S.E. x 10“: hCSp.LUC (1.7 -c 0.2), RsVl3Op.LUC (24.4 2 1.8), and TKp.LUC

the p = 0.006 level. Data are compared relative to EnA-hCSp.LUC as (8.5 f 0.8). ANOVA analysis for the effect of promoter was significant at

indicated under “Experimental Procedures.” C, effect of distance and multiple copies of CSEn on the hCS promoter in transiently transfected

of the enhancer cloned into the PstI site (nt -282) of the hCS 5“flanking BeWo cells. EnAP-CSp.LUC and EnBP-CSp.LUC contain a single copy

DNA in the sense (stippled bar) and antisense (solid bar) orientation, respectively. EnAEnAP-CSp.LUC and EnA-EnBP-CSp.LUC contain two copies of the enhancer, a copy cloned in the sense orientation upstream of the three polyadenylation stop sites at the BglII site of ppSLUC and another copy cloned into the PstI site of the hCS 5‘- flanking DNA in the sense (stippled bar) and antisense (solid bar) orientation, respectively. ANOVA analysis for the effect of enhancer position and copy number were significant at the p = 0.000 level. Data comparison is relative to EnA-hCSp.LUC as indicated under “Experi- mental Procedures.”

CSEn Functions in a Distance-independent Manner, and Multiple Copies Act Synergistically on Promoter Function--To determine if the enhancer operated in a distance-independent manner, a single copy of the enhancer was cloned in both orientations into the PstI site (nt -282) within the hCS promoter.

6. FOLD STIMULATION

0 5 10

P < 0.01

FIG. 2. Deletion analysis indicates that maximal CSEn activity requires the entire 242-bp CSEn fragment. A, schematic represen- tation of CSEn deletion fragments inserted into the hCSp.LUC vector in the sense orientation. B, activity of wild-type and CSEn deletion mutants in transiently transfected BeWo cells. Plasmid DNA (15 pg) was used in each electroporation as described under “Experimental Proce- dures,’’ The number of independent transfections is denoted by n. ANOVA analysis for the effect of deletion was significant at the p = 0.000 level. Statistical comparisons are relative to hCSp.LUC as indicated under “Experimental Procedures.” Basal activity for hCSp.LUC was 5.3 0.5 (S.E.) light unitdpg protein x 10“.

The activities of the resulting constructs, EnAF’hCSp.LUC and EnBPhCSp.LUC, were not significantly different than those for EnA_hCSp.LUC and EnBhCSp.LUC in transiently transfected BeWo cells (Fig. 1 0 , indicating that CSEn function was independent of its distance from the promoter. Insertion of an additional enhancer copy upstream of the polyadenylation sequences in EnAF’hCSp.LUC and EnBPhCSp.LUC did re- sult in synergistic activation of the hCS promoter, suggesting that elements within the multiple enhancers can interact cooperatively to stimulate transcription.

Localization of DNA Elements Required for CSEn Ac- tivity-To determine if the enhancer activity could be localized to a smaller region of the 242-bp CSEn, we made a series of deletion mutants corresponding to CSEnJ180, CSE1~57/242, CSEn_57/180, CSE1~202/242, and an internal deletion mutant CSEn470/157 as illustrated in Fig. 2 A . Of these deletion mutants, only CSEr~57/242 retained any appreciable ability to stimulate (2.7-fold) the hCS basal promoter activity (Fig. 2 B ) ; however, this effect was not significant at the p < 0.05 level. These data indicate that the enhancer required multiple elements distributed throughout the 242-bp DNA. Previous studies (Walker et al., 1990) localized a significant fraction of CSEn activity to a 138-bp fragment (corresponding to CSE1~103/241) that contained a region (nts 116-134) protected by choriocarcinoma and HeLa cell nuclear extracts. This footprinted region corresponded to a sequence with significant matches (819) to the SV40-binding site for TEF-1. Thus, it seemed possible that TEF-1 or a TEF-1-related factor might provide substantial enhancer activity. To test this possibility, we inserted a synthetic oligonucleotide corresponding to CSE~103/151 tha t contained the TEF-1-binding site at the BglII site of hCSp.LUC and ex-


A. E. C.

Probe '

C e l l . .

NE (pg)' 0 2 0 060 0 0 4 0 6 0 0 A

1

FP''1;

8 1 k

1 1 5 ' t

FP3

1 4 0

145

FP4

1 6 4 .

Fp4 I j 145 1

FP3 1 1 5

F P3

1 4 0

1 1 5 t

8 9 ,

FP2

68

FP4' '1

D.

P r o b e

Cel l

NE (1191

E. F. E d ' 0 6 0 4 0 0 6 0 4 0

FP2'/l

6 9

241

FP5

2 4 4 19

1 6

2 8

FP1

F P4

4 " g I) 1 5

FIG. 3. DNase I footprinting analysis indicates that the CSEn 242-bp fragment is protected by multiple proteins from nuclear extracts of BeWo, JEG-3, GC, and HeLa cells in very similar patterns. DNase I footprinting analyses were performed as described under "Experimental Procedures" with nuclear extracts (NE) prepared according to Dignam (1983) from BeWo, JEG-3, GC, and HeLa cells. Three probes, spanning nts 1-180 (probe A ) , 8-238 (probe B ) , and 58-242 (probe C), were prepared by PCR to increase the sensitivity of the analyses. The locations of the five footprints (FPI-FP5) are indicated by solid burs; number designations denote the nucleotide boundaries, Hypersensitive sites are designated by asterisks (*). Sense and antisense strands are designated by (+) and (-), respectively. Lanes designated G , A, or T represent specific Sanger dideoxy nucleotide sequencing reactions performed with the appropriate primer and template used to generate the probes (see "Experimental Procedures").

amined the activity of the construct in transiently transfected retained on the partially active CSEn_57/242 construct but is BeWo cells (Fig. 2 4 ) . This fragment failed to confer any signifi- deleted in the CSEn470/157 construct lacking enhancer ac- cant enhancer activity (Fig. 2B ). Since the TEF-1-related site is tivity, the data indicate that the region containing the TEF-1-


related binding site is necessary but not sufficient for expression of enhancer activity. Accordingly, multiple enhancer elements that act cooperatively and are located throughout the 242-bp fragment probably account for CSEn activity.

DNase Z Footprinting Analysis of the hCS Enhancer-To fa- cilitate identification of potentially important CSEn regulatory regions, DNase I footprinting assays were employed to estab- lish the location of putative transcription factors. The sensitivity of DNase I analyses was increased by employing three probes covering selected segments of the 242-bp CSEn frag-

Sph-U78

5’-GTCTACA’PCPC~CTCATCAAC~CfCfCGACGGCAATTTCTCCTGCAAATPTGAGATG 3’-CAGA‘PGTAAACTCGAGTAGTTGAAC~CAC~CCGTTAAAGAGGACGTTTAAACTCTAC

I I I

cqctqcaq

20 t o 60

Sph-UI1178

u t - 3 ULt cccqqq a tcqa t

G G A T C ~ A C A A A A C A T . T T ~ A ~ T A T G C A C T C G G G A G T G A G G G A C T C T A A G A C T A T A T T A A T CCTAGGATG’PCPT~AAACGAfCCATACGTGAGCCCTCACTCCCTGAGATTCTCATATAATTA

BO I

FP-2 /- LOO

I

cqqatcct E L 5

qtcqac G A ~ C A A f C ~ G T C C A G G C A A G A G T A C ~ A A M C P T T C C C A G G T G A T T C T A A C A T G T A A A

140 1 6 0 LBO

EK 7

DR Dl a )

ctqci t icacc tcqat tacacc C A A G G ~ A G A A C C A C T C ‘ P G ~ A G G G A C C G C A A A G A f C A G A C C C A ~ T G T T C A C A G - 3 ’ GTTCCM~~TGACACAATCCCPGGCGTTTCTA~CTCGCTACACAACTGTC-5’

200 I

2 2 0 I

2f0 I

FIG. 4. CSEn sequence motifs bear a striking relationship to several enhansons comprising the SV40 enhancer. Nucleotide sequence of the CSEn 242-bp fragment and localization of the identified footprints FP1-FP5 (Fig. 3, A-F shown as striped bar) and sequence motifs (bold capitals) with varying homology to SV40 enhansons GT- IIC, GT-I, SphUSphII, octamer motifs (Oct), and inverted and direct repeat sequences (ZR and DR, respectively). Arrows indicate the orientation of the various motifs. Percent sequence identity to known tran- scriptional elements is indicated by the numbers after the name desig- nation. Site-specific mutagenesis of these regions (bold lower case),

esis (Hemsley et al., 1989). Analysis of the E K l - E K 8 mutants is designated E K 1 - E K 8 , was accomplished by inverse PCR mutagen-

shown in Fig. 5.

ment enhancer to allow maximal resolution on DNA sequencing gels (see “Experimental Procedures”). Generally, five protected regions, designated FP1-FP5, were observed with nuclear extracts from Bewo, JEG-3, HeLa, and GC cells (Fig. 3, A-F); in no case was a footprint specific to choriocarcinoma cells observed. FP3 is identical to that described by Walker et al. (1990) using HeLa cell and placental nuclear extracts and contains the putative TEF-1-binding site. This DNA motif was protected by all the extracts tested (Fig. 3, A and C), suggesting that the binding of TEF-1 or a TEF-1-related factor alone cannot account for the cell-specific CSEn activity. In addition, two other regions, FP2 and FP4 that flank FP3, were routinely protected with extracts from all four cell types (Fig. 3, A-F). FP2 is more readily observed in GC and HeLa cells than with BeWo or JEG-3 cells and represents an AT-rich region (Fig. 3, A-C). Interestingly, FP4 occurs in an AT-rich region whose sequences on the alternate strand are nearly identical to those within FP2. Thus, the core elements in FP2 and FP4 appear to comprise an inverted repeat (IR). FP5 located at the 3‘-end of the enhancer (Fig. 3, E and F ) protects a region of DNA that includes a direct repeated sequence (DR). A final protected region, FP1 (Fig. 3D), was localized to the 5’-end of the enhancer using probe A.

Since the major footprint includes a region homologous with the GT-IIC enhanson of SV40 that represents one of two unrelated binding sites for TEF-1 (Davidson et al., 19881, we compared sequences within the footprinted regions for homology to other SV40 enhansons to ascertain whether CSEn bore a more extended relationship to the SV40 enhancer. As shown in Fig. 4 and Table 11, the footprinted regions either contained or were near structures with varying homology (>75%) to the SV40 enhansons GT-I, SphYSphII, and GT-IIC. In addition, the IR found in FP2 and FP4 may be related to SphYSphII enhansons (Fig. 4; see “Discussion”); however, the DR within FP5 ap- peared to be unique to CSEn. FP1 straddles sequences with homology to GT-IIC (719 matches) and GT-I (819 matches). FP2 contains the IR and two sequences related to the SV40 SphY SphII motifs (719 and 819 matches). As discussed previously, FP3 contains an almost perfect GT-IIC motif (819 matches). FP4 contains the second member of the IR which itself contains an SphI-related structure (719 matches). These findings suggest that CSEn may be composed of multiple enhansons that are related to SV40 enhansons. To ascertain the functional significance of these footprinted regions, we performed a mutagenesis analysis as discussed below.

Multiple Elements Are Required for Maximal CSEn Func- tion-The deletion analyses (Fig. 2B 1, footprinting studies (Fig. 3, A-F), and comparative analysis with SV40 enhanson motifs (Fig. 4 and Table 11) provide strong evidence that CSEn is composed of multiple elements that interact cooperatively to provide CSEn function. To test this directly, we performed a site-specific mutational analysis of each of the individual regions. As a first approach toward designing site-specific mu-

TAEILE 11 Comparison of SV40 enhanson sequences to related CSEn sequences

Enhanson SV40 sequence CSEn sequence“ Matches Positiod strand

GT-IIC GT-IIC GT-I SphUSphII SphUSphII SphIISphII SphIISphII

GTGGAATGT GTGGAATGT GGGTGTGGA AAGYATGCA AAGYATGCA AAGYATGCA AAGYATGCA

cTGaAATGT CTGGAATGT tGGTGTGGA AAaTaTGCA AAcgATGCA ACGTATGCA AAGTtTtCA

719 819 819 719 719 819 719

126-134/(+) 24-32/(+)

77-85/(+)

5-131(-)

46-531(-)

82-90/(-) 154-1621(-)

inspection and by GAP and FIND analyses (GCG Sequence Analysis Sofiware, Devereux et al . , 1984). Lowercase nucleotides (bold) represent differences relative to the respective SV40 enhanson sequence. Sequences were localized by visual


LIGHT UNITSlpg PROTEIN x 10-3

Cell n p Construct I I I I 0 50 100 1 5 0 200

1 6 I - I hCSp. LUC

En Sense Orientation En Antisense Orientation

FIG. 5 . CSEn sequences related to multiple SV40 enhansons are required for maximal CSEn activity. The site-specific CSEn mutants (EM-1-EM-8) shown in Fig. 4.4 were analyzed for enhancer activity in transiently transfected BeWo cells as described under “Ex- perimental Procedures.” Site-specific mutants were inserted in the hC Sp.LUC vector at the EgZII site upstream of the polyadenylation stop signals in the vector p&LUC. CSEn enhancer mutants in both orientations were analyzed (sense = stippled bars, antisense = solid bars) In each case, 15 pg of hCSp.LUC (striped bar), EnAhCSp.LUC, E d - hCSp.LUC, and the indicated mutants were transfected separately by electroporation. The number of independent transfections is indicated by n. ANOVA analysis for the effect of mutation was significant at the p = 0.000 level for both the EnA (sense) and EnB (antisense) enhancer orientations within the plasmid. Significance levels were determined as described under “Experimental Procedures,” and the comparisons were made relative to EnA-hCSp.LUC and EnB-hCSp.LUC, respectively.

tants, we elected to insert block mutations into the SV40-related sequences within the footprinted regions as shown in Fig. 4. Eight CSEn block mutants, E K 1 - E K 8 , were inserted into hCSp.LUC at the BglII site upstream of the polyadenylation stop signals in either orientation, and their activities were compared with EnA-hCSp.LUC and EnBhCSp.LUC in transiently transfected Bewo cells as shown in Fig. 5. All of the block mutants except E m , a mutation of the GT-I-like motif, showed significant loss of enhancer activity, indicating that these sequences were important for enhancer activity. Muta- tion of the upstream member of the IR ( E K 3 ) and the GT-IIC motif ( E K 5 ) completely eliminated or severely crippled enhancer activity (0-13% wild-type CSEn activity), indicating that these two elements are essential for enhancer activity. Mutation of the upstream, more degenerate copy of the GT-IIC motif in the FP1 region resulted in loss of 45% of enhancer activity, suggesting that the binding of a TEF-1- like factor at multiple sites may be required for maximal enhancer activity. Similarly, mutations of the downstream members of the IR (EM-6) and DR ( E K 8 ) reduced the enhancer activity -51 and -34%, respectively. Interestingly, the mutation of the upstream DR (EM-7) resulted in only a 36%, non-significant re- duction in activity in the sense orientation but an 89% reduc- tion in the antisense orientation, suggesting that individual elements within an enhancer may exert orientation-dependent effects on enhancer activity. Taken together, these data demonstrate that multiple enhancer elements which are related to

individual SV40 enhansons interact cooperatively to mediate maximal placental enhancer function.

DISCUSSION

We have performed a more detailed structural and functional analysis of the placental-specific enhancer, CSEn, to begin to understand what DNA elements are involved in its cell-specific function. The data demonstrate that CSEn is a complex structure composed of multiple, distinct DNA elements or enhansons, whose cooperative interaction is required for enhancer function. Multiple sequences within CSEn have varying de- grees of homology (7849%) with several SV40 enhansons (Fig. 41, including GT-IIC, GT-I, and SphIISphII, suggesting a close relationship between the viral SV40 and CSEn enhancers. In addition, CSEn contained inverted (IR) and direct (DR) repeat structures that represented potential enhansons due to the anticipated modular structure of enhancers (reviewed in Dy- nan 1989; Frankel and Kim, 1991). DNA footprint analyses (Fig. 3) indicated a close correspondence to the SV40 enhanson- related, IR and DR structures and the sites of DNA-binding proteins present in cervical carcinoma (HeLa), anterior pituitary (GO, and human choriocarcinoma cells (BeWo and JEG- 31, suggesting that these structures recognize widely distributed transcription factors. Mutagenesis of the DR, IR, and all SV40-enhanson-related structures except the GT-I-related structure either abolished or resulted in partial (3040%) loss of enhancer function (Fig. 5), demonstrating that these regions are essential for maximal CSEn activity and that CSEn function results from the cooperative interaction of all of the elements contained within this 242-bp DNA fragment.

It was previously shown that a central CSEn region that was protected by nuclear proteins from HeLa and choriocarcinoma cells corresponded to the SV40 GT-IIC enhanson that binds the transcription factor TEF-1 (Walker et al., 1991); however the functional importance of this region was not established. Our studies demonstrate that this region is one of two essential DNA elements in CSEn, since site-specific mutations within this central region virtually destroy enhancer function (Fig. 5). Nevertheless, the GT-IIC-related region is not sufficient for enhancer activity, since a single copy of this sequence inserted upstream of the hCS promoter did not stimulate promoter activity (Fig. 2 B ) . These properties underscore the relatedness of CSEn to other modular enhancers whose function depends on cooperative interactions between a number of factors (Dynan 1989; Frankel and Kim, 1991).

TEF-1 plays a major role in the control of the SV40 enhancer (Davidson et al., 1988, Xiao et al., 1991). In addition, recent studies have implicated TEF-1 or TEF-1-related proteins in the control of other enhancers. The cell-specific expression of the human papillomavirus-16 (HPV-16) E6 and E7 oncogenes in keratinocytes and cervical carcinoma cells is due to a 5’ enhancer that is controlled by TEF-1 and an associated co-activator (Ishiji et al., 1992). The factor binding to the HPV-16 enhancer was identified as TEF-1 on the basis of DNA-protein complex mobility, relative binding to wild-type and mutant SV40 and HPV-16 enhansons and recognition by two anti- TEF-1 antibodies. Similarly, the “CAT binding factor (MCBF), which controls the activity of the cardiac troponin T gene promoter in cardiac muscle cells and developing skeletal muscle cells has been shown to be indistinguishable from TEF-1 on the basis of binding site recognition, DNA-agarose fractionation, and apparent molecular weight (Farrance et al., 1992).

A comparison of the HPV-16 and SV40 enhansons that bind TEF-1 indicates that only 3/9 nucleotides are preserved in each TEF-1-binding site (Ishiji et al., 1992). This, coupled with the fact that TEF-1 binds to the unrelated GT-IIC and SphUSphII


motifs (Davidson et al., 1988; Xiao et al., 19901, indicates that TEF-1 binds to relatively degenerate sequences. Thus, there is a strong likelihood that TEF-1 or a related protein regulates CSEn activity in placental cells. Our finding that the region containing the TEF-1-binding motif is essential for CSEn function provides additional evidence that TEF-1 or TEF-l-related proteins are involved in the control of a variety of enhancers.

The other essential region of CSEn, whose mutation virtually abolishes enhancer activity, corresponds to the upstream member of the IR, an AfI"rich sequence that does not corre- spond to any known transcription control element. The IR is contained within a region (FP2) protected by a nuclear protein(s) present in GC, HeLa, BeWo, and JEG-3 cells, suggesting that a relatively common factor may recognize the IR. This region is unusual, since the individual members of the IR are homologous (7/11 and 7/10 matches, respectively) with an internal region of the SV40 enhancer overlapping the adjacent SphI and SphII enhansons. Moreover, the IR plus adjacent downstream sequences form motifs with significant homology (7/9 or 8/9 matches) with SphUSphII-binding sites, suggesting that this structure might be related in some way to these SV40 enhansons. This is noteworthy because TEF-1 also binds to the SphI and SphII enhansons, and an Oct transcription factor- binding site (CAAAGCAT) is contained in the region overlapping the SphI and SphII sites in the SV40 enhancer, and TEF-1 competes for Oct binding at these sites (Fromental et al., 1988; Ondek et al., 1988). Additionally, an Oct element overlaps one of the TEF-1-binding sites in the HPV-16 enhancer. Interest- ingly, there are two Oct-related sequences in the upstream member of the IR ( E M 3 , Fig. 4). These Oct-related sequences, GAAAACAT and CGATGCAT, form a quasi- inverted repeat that include sequences that lie just beyond the IR boundaries. Since mutation of the downstream member of the IR which lacks the Oct-related sequences reduces enhancer activity by 45-57% (Fig. 5), a function of the IR sequence itself is supported; however, the possibility that Oct transcription factors interacting with the more critical upstream member of the IR may act to modulate CSEn function as proposed for the HPV-16 enhancer (Ishiji et al., 1992) cannot be excluded. Such interactions represent one possible mechanism that could restrict enhancer function, thereby contributing to the enhancer's cellular specificity.

The cumulative data indicate that CSEn function is re- stricted to placental cells (Fig. 1; Walker et al., 1991; Fitz- patrick et al., 1990; Rodgers et al., 1986). Thus, if TEF-1 or a related factor represents a major factor involved in the control of CSEn function, the question arises: what accounts for the cell-specific expression of this enhancer? Previous studies of the SV40 and HPV-16 enhancers indicate that enhancer function depends on a co-activator that interacts with TEF-1. First, expression of TEF-1 fails to activate the GT-IIC or Sph enhansons in the lymphoid cell line MPC11 in which these enhansons are inactive. Second, over-expression of cloned TEF-1 in HeLa cells represses endogenous TEF-1 activity. Finally, expression of chimeras containing the COOH-terminal portion of TEF-1 lacking its DNA-binding domain fused to the GAL4 DNA-binding domain inhibited the expression of a TKp.CAT construction containing two copies of the GT-IIC enhanson, indicating that the COOH-terminal region of TEF-1 was involved in the repression by an intracellular competition or squelching mechanism (Xiao et al., 1991). Similar squelching of HPV-16 and GT-IIC enhanson-dependent TKp.CAT reporter activity was observed in HaCaT keratinocytes transfected with TEF-1 expression plasmid or the GAL4-TEF-1 chimera (Ishiji et al., 1992). These results indicate that enhancer function is dependent on a limiting cellular co-activator that is directly associated

with TEF-1 and that does not bind DNA. Accordingly, cellular specificity may arise from interactions of a number of factors, including TEF-1, its co-activator, and other enhanson-binding transcription factors that contribute to enhancer function (Fro- mental et al., 1988; Ondek et al., 1988; Dynan, 1989; Frankel and Kim 1991). Because no significant differences were observed between the footprints detected on CSEn among placental and non-placental cell nuclear extracts (Fig. 3), protein- protein interactions may play a central role in the determination of cell specificity. Such a mechanism is distinct from the cases of a single cell-specific factor which directly contacts DNA and mediates gene expression as in the case of MyoD in striated smooth muscle (Weintraub et al., 1991) or GHFlP i t l in anterior pituitary cells (Bodner and Karin, 1987; Bodner et al., 1988).

I t is noteworthy that CSEn functions equally well with the hGH promoter in transfected placental cells. Evidence has been presented that the locus control regions for the hGH/hCS chromosomal locus lie downstream of the hCS-1, hGH-2, and hCS-2 genes and -20 kilobases upstream of the hGH-1 gene (Jones et al., 19921, suggesting that all of these genes would be in an open configuration in cell types which express genes within this locus. Since the placental-specific enhancer can function at a distance and the chromosomal loop may be flexible enough to allow the hGH-1 gene to approach one of the several enhancer copies, some factor(s) may be required to extinguish hGH expression in placental cells. Such a mechanism could be analo- gous to the pituitary-specific repression of placental members of the hGH-1 gene in somatotrophes, as recently demonstrated by Nachtigal et al. (1993).

Acknowledgments-We express our appreciation to Dr. Peter Cattini for providing the plasmid containing the 242-bp CSEn fragment and for helpful discussions during the performance of these studies. We thank Drs. Drew Arnold, Endocrine Research Unit, Peter C. OBrien, Biosta- tistics, and Terry M. Therneau, Research Computing Facility, Mayo Clinic/Mayo Foundation for advice with data analyses. We are grateful to Dr. Allan Shepard for advice with the inverse PCR mutagenesis procedures and for helpful criticism of the manuscript, to Dr. William Wood for providing phLUC, and Mary Craddock for secretarial and editorial help with the preparation of the manuscript.

REFERENCES

Bodner, M., and Karin, M. (1987) Cell 60,267-275 Bodner, M., Castrillo, J. L., Theill, L. E., Deerinck, T., Ellisman, M., and Karin, M.

Chen, E. Y., Liao, Y.-C., Smith, D. H., Barrera-Salda, H. A., Gelinas, R., and

Davidson, I., Xiao, J. H., Rosales, R., Staub, A,, and Chambon, P. (1988) Cell 64,

Devereux, J., Haeberli, P., and Smithies, 0. (1984) Nucleic Acids Res. 12,387395 Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11,

Farrance, I. K. G., Mar, J. H., and Ordahl, C. P. (1992) J. Bid. Chem. 267,17234-

Fitzpatrick, S. L., Walker W. H., and Saunders, G. F. (1990) Mol. Endocrinol. 4,

Handwerger, S. (1991) Endocrine Reu. 12,329-336 Hemsley, A,, Arnheim, N,, Taney, M., D., Cortopassi, G., and Galas, D. J. (1989)

Herr, W., and Clarke, J. (1986) Cell 45,461470 Hirt, H., Kimelman, J., Birnbaum, M., Chen, E. Y., Seeburg, P. H., Eberhardt, N.

Jones, B. K., Gerhard, G. S., Liebhaber, S. A,, and Cooke, N. E. (1992) Endocrine Horlick, R. A,, and Benfield, P. A. (1989) Mol. Cell. Biol. 9, 239tL2413

LoSardo, J. E., Boral, A. L., and Lenz, J. (1990) J. Virol. 64, 1756-1763 Maxwell, I . H., Hamson, G. S., Wood, W. M., and Maxwell, F. (1989)Bionchniques

Nachtigal, M. W., Nickel, B. E., and Cattini, P. A. (1993) J. Biol. Chem. 268,

Neilsen, P. V., Pedersen, H., and Kampmann, E. M. (1979)Am. J. 06stet. Gynecol.

Ondek, B., Gloss, L., and Herr, W. (1988) Nature 333,4045 Rodgers, B. L., Sobnosky, M. G., and Saunders, G . F. (1986) Nucleic Acids Res. 14,

(1988) Cell 66,505418

Seeburg, P. H. (1989) Genomics 4,479-497

931-942

1475-1489

17240

18151826

Nucleic Acids Res. 17, 654%6551

L., and Barta, A. (1987) DNA 6, 59-70

Society Program and Abstracts 74, 446

7,276-280

84734479

136,322-326

7641-7659

10392 Structure of the Chorionic Somatomammotropin Gene Enhancer Schier, A. E, and Gehring, W. J. (1993) EMBO J . 12, 1111-1119 Saunders, G. F. (1991) Endocrine Reu. 12,31&328 Snedecor, G. W., and Cochran, W. G . (1980)StatisticaZ Methods, 7th ed., p. 116, The Walker W. H., Fitzpatrick, S. L., and Saunders, G. F. (1990) J. Biol. Chern. 265,

Iowa State University Press, Ames, IO Soares, M. J., Faria, T. N., Roby, K. F., and Deb, S. (1991) Endocrine Reu. 12, Wurzel, J. M., Parks, J. S., Herd, J. E., and Nielsen, P. V. (1982) DNA 1,251-257

402-423 Xiao, J. H., Davidson, I., Matthes, H., Garneir, J.-M,, and Chambon, P. (1991) Cell Walker, W. H., Fitzpatrick, S. L., Barrera-Saldaiia. H. A,, Resendez-Phrez, D., and 66, 551-568

12940-12948

journal of bio~ical chemis~y no. of 8, by molecular ... · the journal of bio~ical chemis~y 0 1994...

Documents