joint work with many colleagues at fda | taha a. kass-hout, md, ms fda chief health informatics
DESCRIPTION
Genetic test (upstream) Clinician orders test/services for patient, collects sample Sample preparation and sequencing Core processing (Mapping, Variation Calling) Special processing (Annotation, Filtering, Interpretation) + (downstream) Clinician discusses outcome with patient NGS-based Genetic Test (end-to-end product)TRANSCRIPT
![Page 1: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/1.jpg)
Joint work with many colleagues at FDA
precision.fda.gov | [email protected] | @precisionFDA
Taha A. Kass-Hout, MD, MSFDA Chief Health Informatics OfficerDirector, FDA’s Office of Health Informatics
David Litwack, PhDPolicy AdvisorFDA’s Center for Devices and Radiological Health
Elaine R. JohansonDeputy, FDA Chief Health Informatics OfficerDeputy Director, FDA’s Office of Health Informatics
![Page 2: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/2.jpg)
![Page 3: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/3.jpg)
Genetic test
(upstream)
Clinician orders test/services for patient,
collects sample
Sample preparation
and sequencing
Core processing(Mapping,
Variation Calling)
Special processing(Annotation, Filtering, Interpretation)
+
(downstream)
Clinician discusses outcomewith patient
NGS-based Genetic Test (end-to-end product)
![Page 4: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/4.jpg)
Initial Focus
Genotype
Location 9: C → G mutation...
File with variants (VCF)
" You are at risk for X outcome. "
Report
Predicted Outcome
Analytical Benchmark Clinical Benchmark
![Page 5: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/5.jpg)
Initial Focus – Analytic Benchmarking
•Assess reproducibility of a test
•Assess accuracy using reference samples
•Assess agreement with other methods
•Assess test performance on synthetic data
![Page 6: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/6.jpg)
Features
Private or community areas
Data
Apps
Comparisons
Notes
![Page 7: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/7.jpg)
![Page 8: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/8.jpg)
![Page 9: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/9.jpg)
![Page 10: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/10.jpg)
![Page 11: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/11.jpg)
![Page 12: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/12.jpg)
![Page 13: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/13.jpg)
![Page 14: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/14.jpg)
![Page 15: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/15.jpg)
![Page 16: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/16.jpg)
![Page 17: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/17.jpg)
![Page 18: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/18.jpg)
![Page 19: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/19.jpg)
![Page 20: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/20.jpg)
![Page 21: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/21.jpg)
![Page 23: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/23.jpg)
![Page 24: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/24.jpg)
>930 members from >450 organizations
![Page 25: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/25.jpg)
precision.fda.gov
![Page 28: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/28.jpg)
… AGCATCGATGCAGAAGATTACAAGACGATCCGCTC …
DNA
Gene
![Page 29: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/29.jpg)
We are all unique
… AGCATCGATGCAGAAGATTACAACATAAAAAGATTACACGCGATCCGCTC …
… AGCATCGATGCATAAGATTACAAGATAAAAAGATTACACGCGATCCGCTC …
… AGCATCGATGCATAAGATTACAACATAAAAAGATTACATGCGATCCGCTC …
… AGCATCGCTGCAGAAGATTACAACATAAAAAGATTACATGCGATCCGCTC …
reference
David
Taha
Elaine
![Page 30: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/30.jpg)
![Page 31: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/31.jpg)
The Internet Cloud
![Page 32: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/32.jpg)
Community Assurance
![Page 33: Joint work with many colleagues at FDA | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics](https://reader036.vdocuments.mx/reader036/viewer/2022062600/5a4d1bb07f8b9ab0599cc303/html5/thumbnails/33.jpg)
Add new Feature (Discussion)
New Feature