jmi jurnal mikologi indonesia available online at: … · 2020. 1. 17. · jurnal mikologi...

7
Dikirimkan Desember 2019, Diterima Desember 2019, Terbit online Desember 2019 Corresponding Author: Iman Hidayat, e-mail: [email protected] JMI Jurnal Mikologi Indonesia Vol 3 No 2 (2019): 118-124 Jurnal Mikologi Indonesia Available online at: www.jmi.mikoina.or.id ISSN: 2579-8766 Online Phylogenetic Study of Curvularia on Sorghum from Indonesia Based on ITS rDNA Sequence Hidayat I 1 , Ramadhani I 1 1 Microbiology Division Research Center for Biology, Indonesian Institute of Sciences (LIPI), Jln. Raya Jakarta- Bogor KM46 Cibinong 16911 West Java, Indonesia Hidayat I, Ramadhani I. 2019. Phylogenetic Study of Curvularia on Sorghum from Indonesia Based on ITS rDNA Sequence. Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia, including species that pathogen to sorghum (Sorghum bicolor). The present study aims to determine four isolates of Curvularia isolated from sorghum in Indonesia using a combination of molecular phylogenetic analysis based on internal transcribed spacer (ITS) rDNA sequence and morphological examination. The results showed that the four isolates were genetically closed to C. lunata and C. dactyloctenicola. The morphological examination also insufficient to determine the identity of the four Curvularia isolates from sorghum until species level. Therefore, additional sequences from the partial fragments of the glyceraldehyde- 3-phosphate dehydrogenase and the translation elongation factor 1-a genes are necessary to determine the identity of the Curvularia sequences isolated from sorghum in Indonesia until species level. Keywords: ITS rDNA, Indonesia, leaf spot, phylogenetic, sorghum Introduction Curvularia Boedijn is an asexual morph genus characterized by having curved conidia with two or three central darkened cells and hyaline apical cells, one of which is enlarged and contributes to the curvature (Shoemaker 1959). Members of Curvularia have been known as pathogen to human and plants as well as saprobes on various substrates (Ellis 1971, Manamgoda et al. 2015). In Indonesia, seven species of Curvularia have been recorded (Farr & Rossman 2019). These species include C. andropogonis (Zimm.) Boedijn, C. crustacea (Henn.) Y.P. Tan & R.G. Shivas, C. eragrostidis (Henn.) J.A. Mey., C. geniculata (Tracy & Earle) Boedijn (Cochliobolus geniculatus R.R. Nelson), C. lunata (Wakker) Boedijn, C. pallescens Boedijn, and C. verruculosa Tandon & Bilgrami ex M.B. Ellis (Farr & Rossman 2019). In sorghum [Sorghum bicolor (L.) Moench], 12 species of Curvularia have been reported from sorghum, viz, these include C. borreriae (Viégas) M.B. Ellis, C. clavata B.L. Jain, C. eragrostidis, C. fallax Boedijn, C. geniculata (C. geniculatus), C. lunata, C. muehlenbeckiae Madrid, K.C. Cunha, Gené, Guarro & Crous, C. pallescens, C. penniseti (Mitra) Boedijn, C. sorghina R.G. Shivas & Sivan., C. trifolii (Kauffman) Boedijn, C. tritici S.M. Kumar & Nema (Farr & Rossman 2019, Index Fungorum 2019). In this study, we examined the morphological characters of Curvularia isolated from sorghum and analyzed their phylogenetic affinities with closely related species based on the ITS rDNA sequence data. Materials and Methods Collection of specimens and isolation Specimen collection was conducted at Cibinong Science Center, Cibinong, West Java, Indonesia in 26 February 2019. The sorghum specimen was collected by cutting off the

Upload: others

Post on 18-Nov-2020

8 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Dikirimkan Desember 2019, Diterima Desember 2019, Terbit online Desember 2019 Corresponding Author: Iman Hidayat, e-mail: [email protected]

JMI Jurnal Mikologi Indonesia Vol 3 No 2 (2019): 118-124

Jurnal Mikologi Indonesia Available online at: www.jmi.mikoina.or.id

ISSN: 2579-8766 Online

Phylogenetic Study of Curvularia on Sorghum from Indonesia Based on ITS rDNA Sequence

Hidayat I1, Ramadhani I1

1Microbiology Division Research Center for Biology, Indonesian Institute of Sciences (LIPI), Jln. Raya Jakarta-Bogor KM46 Cibinong 16911 West Java, Indonesia Hidayat I, Ramadhani I. 2019. Phylogenetic Study of Curvularia on Sorghum from Indonesia Based on ITS rDNA Sequence. Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia, including species that pathogen to sorghum (Sorghum bicolor). The present study aims to determine four isolates of Curvularia isolated from sorghum in Indonesia using a combination of molecular phylogenetic analysis based on internal transcribed spacer (ITS) rDNA sequence and morphological examination. The results showed that the four isolates were genetically closed to C. lunata and C. dactyloctenicola. The morphological examination also insufficient to determine the identity of the four Curvularia isolates from sorghum until species level. Therefore, additional sequences from the partial fragments of the glyceraldehyde-3-phosphate dehydrogenase and the translation elongation factor 1-a genes are necessary to determine the identity of the Curvularia sequences isolated from sorghum in Indonesia until species level.

Keywords: ITS rDNA, Indonesia, leaf spot, phylogenetic, sorghum Introduction

Curvularia Boedijn is an asexual morph genus characterized by having curved conidia with two or three central darkened cells and hyaline apical cells, one of which is enlarged and contributes to the curvature (Shoemaker 1959). Members of Curvularia have been known as pathogen to human and plants as well as saprobes on various substrates (Ellis 1971, Manamgoda et al. 2015). In Indonesia, seven species of Curvularia have been recorded (Farr & Rossman 2019). These species include C. andropogonis (Zimm.) Boedijn, C. crustacea (Henn.) Y.P. Tan & R.G. Shivas, C. eragrostidis (Henn.) J.A. Mey., C. geniculata (Tracy & Earle) Boedijn (Cochliobolus geniculatus R.R. Nelson), C. lunata (Wakker) Boedijn, C. pallescens Boedijn, and C. verruculosa Tandon & Bilgrami ex M.B. Ellis (Farr & Rossman 2019).

In sorghum [Sorghum bicolor (L.) Moench], 12 species of Curvularia have been reported from sorghum, viz, these include C. borreriae (Viégas) M.B. Ellis, C. clavata B.L. Jain, C. eragrostidis, C. fallax Boedijn, C. geniculata (C. geniculatus), C. lunata, C. muehlenbeckiae Madrid, K.C. Cunha, Gené, Guarro & Crous, C. pallescens, C. penniseti (Mitra) Boedijn, C. sorghina R.G. Shivas & Sivan., C. trifolii (Kauffman) Boedijn, C. tritici S.M. Kumar & Nema (Farr & Rossman 2019, Index Fungorum 2019). In this study, we examined the morphological characters of Curvularia isolated from sorghum and analyzed their phylogenetic affinities with closely related species based on the ITS rDNA sequence data. Materials and Methods Collection of specimens and isolation

Specimen collection was conducted at Cibinong Science Center, Cibinong, West Java, Indonesia in 26 February 2019. The sorghum specimen was collected by cutting off the

Page 2: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Hidayat & Ramadhani 2019

119

symptomatic leaves and placed them in paper bags. The paper bags were sealed and labelled with the name of the host, collection site, date, and collector/s. All materials were kept in ice boxes prior to isolation in the laboratory.

The isolation protocol of the fungal colony on the sorghum leaf was conducted according to the method described by Hidayat (2017). The growth of germination tube was observed after 24 h for everyday. The growing colonies were purified using hyphal tip isolation method to get a pure culture. Culture isolates obtained in this study were deposited at the Indonesian Culture Collection (InaCC) (Table 1). Table 1 Additional information of new Curvularia isolates on Sorghum from Cibinong,

Indonesia Species Strain code Host Location

C. lunata IR-1 S. bicolor Cibinong, Indonesia

C. lunata IR-2 S. bicolor Cibinong, Indonesia

C. lunata IR-3 S. bicolor Cibinong, Indonesia

C. lunata IR-4 S. bicolor Cibinong, Indonesia

Morphological examination

The micromorphological structures of Curvularia were observed using Olympus BX51 (Olympus, Japan) (Fig. 1). For cultural characterization, isolates were grown on PDA at room temperature in the dark. DNA isolation, PCR amplification and sequencing

The fungal genomic DNA was obtained by using PhytopureTM DNA extraction kit (GE Healthcare, UK). A total 25 µL of PCR mix was prepared as follow: 1.25 µL of 10 µM ITS5 (forward) (5’–TCCTCCGCTTATTGATATGC–3’) and ITS4 (reverse) (5'–TCCGTAGGTGAACCTGCGC–3') (White et al. 1990) primer pairs, 2 µL (10-100 ng) of DNA template, 25 µL GoTaq® green mastermix (Promega, USA), and 20.5 µL ultrapure water RNAse free. PCR reaction was conducted using Thermalcycler (Takara Shuzo Co., Ltd., Shiga, Japan) according to the following setting: 90 s at 95°C for initial denaturation, followed by 35 cycles of 30 s at 95°C denaturation, 30 s at 55 °C annealing, 90 s at 72 °C extension, and 5 min at 72 °C for the final extension. PCR products were run in 1% agarose gel by electrophoresis at 100 V for 30 min, and soaked in ethidium bromide (EtBr) for 15 min. Gel was then visualized using Gel DocTMXR system (BIO-RAD, Germany). PCR products were sent to 1stBASE (Malaysia) for sequencing. Phylogenetic analysis

Nucleotide sequence obtained from the respective primer, ITS5 and ITS4, were assembled in Chromas Pro 1.41 (Technelysium Pty Ltd., Australia). The sequences were aligned with sequences retrieved from DNA databases (DDBJ, NCBI) using MUSCLE (MUltiple Sequence Comparison by Log-Expectation) (Edgar 2004) in MEGA 7 (Molecular Evolutionary Genetics Analysis) (Kumar et al. 2016). GenBank accession number, strain code, and taxon name used in this study are given in figure. Phylogenetic analysis was conducted using the neighbour joining (NJ) method implemented in MEGA 7. Maximum composite likelihood was used as the substitution model for the current analysis. Strength of the internal branches of the phylogenetic trees was tested with bootstrap (BS) analysis (Felsenstein 1985) using 1000 replications. Other parameters used in the NJ analysis were

Page 3: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Hidayat & Ramadhani 2019

120

selected according to the default standard in MEGA 7 software. Bootstrap values of 50% or higher were shown. GenBank accession number, sequence name and strain code used in the phylogenetic analysis were showed in Figure 2. Results and Discussion Morphological examination

Figure 1 Curvularia dactyloctenicola. a, d–h conidiophores and conidia; b colony obverse on

PDA after 1 week; c colony reverse on PDA after 1 week. Scale bars: a, d–h = 10 µm.

Description – Asexual morphology on WA and PDA: Hyphae hyaline, branched, septate, 2–5 μm diam. Conidiophores arising singly or in groups, septate, straight, often geniculate in the upper part, size of cells not decreasing towards apex, sometimes branched, cells walls thicker

Page 4: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Hidayat & Ramadhani 2019

121

than those of vegetative hyphae, mononematous, semi- to macronematous, pale brown to brown, sometimes swollen at the apex and at the base, 80–120 μm tall. Conidiogenous cells smooth-walled to slightly verruculose, terminal or intercalary, proliferating sympodially, pale brown to brown, subcylindrical to swollen at the apex, 6–12.5 × 2.5–5 μm. Conidia slightly verruculose, curved, middle cells unequally enlarged, ellipsoidal to obovoid, pale brown to brown, apical and basal cells slightly paler than the middle cells, (2–)3-distoseptate, 12–20 × 5–8.5 μm. Microconidiation, chlamydospores and sexual morph not observed. Cultural characteristics – Colonies on PDA reaching 57–59 mm diam in 1 week, with aerial mycelium, velvety at the edge and cottony at the center, filiform margin, pale brown to pale grey in obverse, pale brown to grey in reverse. Host – Sorghum bicolor. Geographical distribution – Indonesia. Material examined – INDONESIA, West Java, Cibinong, Cibinong Science Center (CSC), InaCC greenhouse, on S. bicolor leaf, 26 February 2019, I. Hidayat and I. Ramadhani, (IR-1, IR-2, IR-3, IR-4). Phylogenetic analysis

The NJ tree of Curvularia species from sorghum showed that four new sequences of Curvularia from Indonesia nested in the same clade with C. lunata strain CBS 730.96 (NR 138223) with 100% BS (Fig. 2). This data indicates that the new Curvularia sequences isolated from sorghum in Indonesia belong to C. lunata.

The phylogenetic tree analysis involving homologous sequences (TYPE sequences) from the BLAST results showed that the new Curvularia sequences isolated from sorghum in Indonesia nested in the same clade with C. chiangmaiensis strain CPC 28829 (MF 490814), C. lunata strain CBS 730.96 (NR 138223), and C. dactyloctenicola strain CPC 28810 (MF 490815) (Fig. 3). The new Curvularia sequences isolated from sorghum in Indonesia are identical with the C. lunata strain CBS 730.96 and C. dactyloctenicola strain CPC 28810 sequences. Additional sequences from the partial fragments of the glyceraldehyde-3-phosphate dehydrogenase and the translation elongation factor 1-a genes are necessary to determine the identity of Curvularia sequences isolated from sorghum in Indonesia.

Page 5: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Hidayat & Ramadhani 2019

122

Figure 2 Neighbour Joining (NJ) tree showing relationship between Curvularia spp. on sorghum

based on the ITS rDNA sequences. Bootstrap value > 50% is shown at the branches node.

Page 6: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Hidayat & Ramadhani 2019

123

Figure 3 Neighbour Joining (NJ) tree showing relationship between Curvularia spp. on sorghum

from Indonesia with related species based on the ITS rDNA sequences. Bootstrap

value > 50% is shown at the branches node.

The current phylogenetic study showed that Curvularia sequences from Indonesia is

phylogenetically close to C. lunata and C. dactyloctenicola (Figs. 2-3), and their ITS sequences are identical. Curvularia lunata was commonly found as pathogen and saprobes on various plants in temperate and tropical regions (Farr & Rossman 2019), while C. dactyloctenicola was only found on Dactyloctenium aegyptium (L.) Willd. in Thailand (Marin-Felix et al. 2017). The morphological examination of the Curvularia specimens from sorghum in Indonesia with C. lunata and C. dactyloctenicola showed a closer relationship with C. dactyloctenicola. The conidiophores of Curvularia from sorghum in Indonesia (80–120 μm) is shorter than C. lunata (up to 650 µm) or C. dactyloctenicola (up to 400 µm), and the conidial size of the Curvularia from sorghum in Indonesia is also smaller (5–8.5 µm) than those of C. lunata (9–15 µm) and C. dactyloctenicola (7–9 µm).

The current morphological examination and phylogenetic analysis based on the ITS rDNA sequence failed to determine the identity of the Curvularia specimens from sorghum in Indonesia. Therefore, additional sequences from the partial fragments of the glyceraldehyde-3-phosphate dehydrogenase and the translation elongation factor 1-a genes are necessary to determine the identity of the Curvularia sequences isolated from sorghum in Indonesia. Acknowledgement

Pusat Unggulan Iptek Sumberdaya Mikroorganisme Nasional (PUI SMN) is thanked for financially supporting the publication of this manuscript.

Page 7: JMI Jurnal Mikologi Indonesia Available online at: … · 2020. 1. 17. · Jurnal Mikologi Indonesia 3 (2): 118-124. Abstract Seven species of Curvularia were recorded from Indonesia,

Hidayat & Ramadhani 2019

124

References Edgar RC. 2004– Muscle: multiple sequence alligment with high accurancy and high

throughput. Nucleic acids Res 32, 1792–1797. doi:10.1093/nar/gkh340. Ellis MB. 1971– Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew. Farr DF, Rossman AY. 2019– Fungal Databases, U.S. National Fungus Collections, ARS,

USDA. Retrieved July 1, 2019, from https://nt.ars-grin.gov/fungaldatabases/ Felsenstein J. 1985– Confidence limits on phylogenetic: an approach using the bootstrap.

Evolution 39, 783–791. Hidayat I. 2017– Isolasi Spora tunggal. Jurnal Mikologi Indonesia 1, 45-46. 9In Indonesian

language) Index Fungorum. 2019– Index Fungorum. Retrieved July 1, 2019, from

http://www.indexfungorum.org/names/names.asp Kumar S, Stecher G, Tamura K. 2016– MEGA7: Molecular Evolutionary Genetics Analysis

version 7.0 for bigger datasets. Molecular Biology and Evolution 33, 1870-1874. Manamgoda DS, Rossman AY, Castlebury LA, Chukeatirote E, Hyde KD. 2015– A

taxonomic and phylogenetic re-appraisal of the genus Curvularia (Pleosporaceae): human and plant pathogens. Phytotaxa 212, 175–198.

Marin-Felix Y, Groenewald JZ, Cai L, Chen Q et al. 2017– Genera of phytopathogenic fungi: GOPHY 1. Studies in Mycology 86, 99–216.

Shoemaker RA. 1959– Nomenclature of Drechslera and Bipolaris, grass parasites segregated from Helminthosporium. Canadian Journal of Botany 37, 879–887. http://dx.doi.org/10.1139/b59-073

White TJ, Bruns T, Lee S, Taylor J. 1990– Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315–322, in MA Innis et al. (eds.), PCR Protocols: a guide to methods and applications. San Diego, Academic Press.