issn: 1412-033x (printed edition) issn: 2085-4722...

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

J o u r n a l o f B i o l o g i c a l D i v e r s i t y V o l u m e 1 1 – N u m b e r 1 – J a n u a r y 2 0 1 0

FIRST PUBLISHED: 2000

ISSN:1412-033X (printed edition)

2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan),

Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Poorbabaei (Iran), Hwan Su Yoon (USA), John Morgan (Australia), Joko R. Witono (Indonesia), Katsuhiro Kondo (Japan), Mahendra K. Rai (India),

María La Torre Cuadros (Peru), Mochamad A. Soendjoto (Indonesia), Peter Green (Australia), Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF:S u t a r n o

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana ([email protected])

Technical Editor & Banking: Solichatun ([email protected]) Distribution & Marketing: Rita Rakhmawati ([email protected])

Webmaster: Ari Pitoyo ([email protected])

MANAGING EDITORS: Ahmad Dwi Setyawan ([email protected])

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and

The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: [email protected]

BANKING:Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: www.unsjournals.com

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTATION AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS:GENETIC DIVERSITY: Alan J. Lymbery ([email protected]), Hwan Su Yoon ([email protected]), Mahendra K. Rai

([email protected]), Salvador Carranza ([email protected]), Sonia Malik ([email protected]). SPECIES DIVERSITY:Dato A. Latiff Mohamad ([email protected]), Joko R. Witono ([email protected]), Katsuhiro Kondo ([email protected]),

Thaweesakdi Boonkerd ([email protected]). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou ([email protected]), Ali Saad Mohamed ([email protected]), Bambang H. Saharjo ([email protected]), Charles H. Cannon Jr. ([email protected]), Edi Rudi ([email protected]), Guofan Shao ([email protected]), Hassan Poorbabaei ([email protected]), John Morgan

([email protected]), Mochamad A. Soendjoto ([email protected]), Peter Green ([email protected]), Shahabuddin ([email protected]), Sugiyarto ([email protected]). ETHNOBIOLOGY: María La Torre Cuadros

([email protected]).

BIODIVERSITAS ISSN: 1412-033X (printed edition)Volume 11, Number 2, April 2010 ISSN: 2085-4722 (electronic)Pages: 55-58 DOI: 10.13057/biodiv/d110201

Microsatellite DNA polymorphisms for colony management of long-tailed macaques (Macaca fascicularis) population on the Tinjil Island

DYAH PERWITASARI-FARAJALLAH1,2,♥, RANDALL C. KYES1,3, ENTANG ISKANDAR11Primate Research Center, Bogor Agricultural University (IPB), Jalan Lodaya II/5, Bogor 16151, West Java, Indonesia, Tel./Fax. +62-251-8320417/

8360712, e-mail: [email protected]; [email protected] of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680, West Java, Indonesia

3Department of Psychology, Center for Global Field Study and Washington National Primate Research Center, University of Washington, Seattle,Washington 98195-7330, USA

Manuscript received: 26 February 2009. Revision accepted: 17 July 2009.

ABSTRACT

Perwitasari-Farajallah D, Kyes RC, Iskandar E (2010) Microsatellite DNA polymorphisms for colony management of long-tailedmacaques (Macaca fascicularis) population on the Tinjil Island. Biodiversitas 11: 55-58. Polymorphic genetic markers are the basicrequirement for studies on population and conservation genetics of non-human primates. In this paper, we screened microsatellites fortheir polymorphism and gene typing of DNA samples from blood of wild long-tailed macaques (Macaca fascicularis) from Tinjil Islandpopulation. Among the three primer sets tested, two are polymorphic. They were D1S548 and D3S1768. Average observedheterozygosity (Ĥ) within populations ranged between 0.264-0.555. D1S1768 locus was highly polymorphic and 24 alleles weredetected among two loci. Estimation of genetic variability for the Tinjil population (Ĥ) was 0.485. The results obtained provide furtherinsight into the long-term viability of the population and help in creating genetic management of both captive and natural habitatbreeding colonies of primates.

Key words: microsatellite, variations, social groups, long-tailed macaques, Macaca fascicularis.

INTRODUCTION

Microsatellite sequences are valuable genetic markersdue to their dense distribution in the genome, greatvariation, co-dominant inheritance and easy genotyping. Inrecent years, they have been extensively used in parentagetesting, linkage analyses, population genetics and othergenetic studies (Goldstein and Pollock 1997). They arevery useful to analyze the degree and pattern of geneticvariability within and between populations. Their variationis mainly explained by factors such as genetic drift, geneflow and mutation, since they are generally considerednon-selective markers (Pérez-Lezaun et al. 1997). Althoughthey show some limitations in the analyses ofphylogenetically distant organisms, due to their irregularmutation processes involving range constraints andasymmetries (Nauta and Weissing 1996), they have provenvery useful in intra-species population studies.

At present, many PCR based primers designed for onespecies are applicable to closely related species. For non-human primates in particular, cross species amplificationhas benefited greatly by the human genome project thatcloned far more microsatellite in human than in any otherliving organisms (Morin et al. 1997; Nurnberg et al. 1998).One can assign sizes to tetranucleotide alleles more reliablythan dinucleotide alleles using a variety of instruments. To

accomplish maximal genetic information at the lowestpossible costs, the loci included on the test should alsoexhibit high estimates of gene diversity. These markersalso enable one to make unique genetic characteristics.

Tinjil Island is located off the south coast of westernJava (Banten Province), Indonesia. The island, approximately600 ha in size, was established as a natural habitat breedingfacility (NHBF) for simian retrovirus (SRV)-free long-tailed macaques, Macaca fascicularis (Kyes 1993).Between 1988 and 1994, 520 adult macaques (from sites inWest Java and South Sumatra; 58 ♂ and 462 ♀) werereleased onto the island to establish a free-ranging breedingpopulation (Kyes et al. 1998). Over the past few years, anadditional 83 macaques (3 ♂ and 80 ♀) have been releasedto introduce new genetic stock. In 2007 survey dataindicated a population of approximately 2000 individualson the island. The Primate Research Center at BogorAgricultural University has maintained a long-term studyof the socio-ecology and serology of the Tinjil macaques.

The present study aimed to generate important baselineinformation on microsatellite DNAs for geneticmanagement of both captive and natural habitat breedingcolonies of primates. We hope to contribute to thedevelopment of a standardized genetic managementstrategy for breeding colonies using well-characterizedmicrosatellite markers.

BIODIVERSITAS 11 (2): 55-58, April 201056

MATERIALS AND METHODS

During 2005 a total 55 blood samples were collectedfrom long-tailed macaques, Macaca fascicularis, in sevendifferent social groups on Tinjil Island, Indonesia namelyBuntung (n=6), Jambul (n=13), Jebag (n=4), Mata Beruk(n=6), Ranca (n=7), Sipit (n=13), and Topeng (n=6).Genomic DNA was extracted from buffy coat using themodified method of Kan et al. (1977).

Amplification of microsatelliteThe 55 macaque samples were screened for each of the

three tetranucleotide repeats. All these loci are located ondifferent chromosomes. The loci were selected based onthe results of a preliminary study on long-tailed and pig-tailed macaques (Perwitasari-Farajallah et al. 2004,Perwitasari-Farajallah 2007) and research on rhesusmacaques, M. mulatta (Smith et al. 2000). PCRamplification of three human microsatellite loci was carriedout in 12.5 μL volumes with a reaction mix containing 25mM MgCl2, 0.83 U Taq polymerase and its buffer(Promega), 2.5 mM dNTP, and 25pM of each forward andreverse primers (Table 1).

Amplifications were performed in a GeneAmp PCRSystem 9600 thermocycler (Applied Biosystems) using thefollowing cycling parameters: 30 cycles of 40 sdenaturation at 94oC, 40-60s primer annealing at 48-57oC,and 5 min final extension at 72oC.

All PCR products were separated on a 5%polyacrylamide gel and silver-stained following thetechnique described by Tegelström (1986). Allele sizeswere determined using DNA size standard of 20 bp ladder(BioRad).

Data analysesAllele frequencies were calculated by direct count. The

amount of variation was measured by averageheterozygosity (Ho: observed heterozygosity). Estimates ofgene diversity were obtained according to Nei (1987)equation as follows:

mĤ = 1- Σ Xi 2

i=1

Xi is the frequency of the i-th allele, m is the number ofalleles and average proportion of heterozygosity (Ĥ) is theaverage over all loci.

Relative proportion of gene diversity between socialgroups (DST), within social groups (HST), and total genediversity (HT) were calculated using Hartl and Clark (1997)equations. Genetic distance (D) was estimated by applyingthe equation of Nei (1987).

RESULTS AND DISCUSSION

We were able to reliably amplify DNA from all 55samples. Of three loci screened, two loci revealedpolymorphisms. They were D1S548 and D3S1768.D3S1768 locus was highly polymorphic and 24 alleleswere detected. D1S548 and D3S1768 were found to bepolymorphic in rhesus macaques, M. mulatta(Kanthaswamy et al. 2006). Additionally the resultsobtained by Chu et al. (1999) in Taiwanese macaques, M.cyclopis, Nurnberg et al. (1998) in rhesus macaques andGoossens et al. (2000) in chimpanzees, Pan troglodytestroglodytes demonstrated that D1S548 locus waspolymorphic. The present study indicated that D2S1777was monomorphic as observed in our previous study(Perwitasari-Farajallah et al. 2004). In contrast Perwitasari-Farajallah (2007) and Ely et al. (1998) demonstrated thatthis locus was polymorphic in pigtailed macaques (M.nemestrina) and chimpanzees (P. troglodytes troglodytes)respectively. The present results indicate that these two lociare useful for assessing genetic variability in longtailedmacaques.

Overall average heterozigosity within social groupsranged between 0.26 for Topeng to 0.56 for Sipit (Table 2).An estimate of genetic variability (Ĥ) for the Tinjilpopulation was 0.485.

In comparison with previous studies in long-tailed andpig-tailed macaques using D1S548, D2S1777, D3S1768,and D5S820 loci with average heterozygosities (Ĥ) 0.5796and 0.6141, respectively (Perwitasari-Farajallah et al. 2004;Perwitasari-Farajallah 2007), the present study revealedslightly low genetic variability. The data however suggesthigh genetic diversity if the Topeng social group isexcluded from the analyses. In fact, Topeng social groupcould be classified as an outlier, at present however wehave no detail information including behavior observationto explain the low genetic diversity of Topeng social group.Additionally protein analyses using three protein locitransferrin (Tf), thyroxine binding pre-albumin (TBPA) andalbumin (Alb) performed in the same group revealed anaverage heterozygosity (Ĥ) of 0.23 (Perwitasari-Farajallah,

Table 1. Description of chromosomal location, GenBank Accessions Numbers, and sequences of each primer

Locus M. mulattachromosomeGenBank acession

numberRepeatmotif

Primer sequences(5’ 3’)

Size range (bp) inhuman

D1S548 1 GDB: 228890 tetra F: GAACTCATTGGCAAAAGGAA 212R: GCCTCTTTGTTGCAGTGATT

D2S1777 - GDB: 693873 tetra F: TCCCCAAGTAAAGCATTGAG 242R: GTATGTAGGTAGGGAGGCAGG

D3S1768 2 GDB: 228929 tetra F: GGTTGCTGCCAAAGATTAGA 197R: CACTGTGATTTGCTGTTGGA

Note: F: forward; R: reverse

PERWITASARI-FARAJALLAH et al. – Microsatellite variations in long-tailed macaques 57

unpublished data). Although only two loci showedpolymorphisms (Tf and TBPA), it has been showed other inmacaque population genetics studies that Tf is the mostpolymorphic locus (Kondo et al. 1993; Kawamoto et al.1984, 2008; Perwitasari-Farajallah et al. 1999, 2001), andinitially it can be applicable for assessment of allelicdiversity.

Table 2. Estimates of genetic variability within groups

Social group n Ĥ + SE1. Buntung 6 0.54 + 0.272. Jambul 13 0.55 + 0.283. Jebag 4 0.50 + 0.254. Mata Beruk 6 0.53 + 0.265. Ranca 7 0.46 + 0.236. Sipit 13 0.56 + 0.287. Topeng 6 0.26 + 0.13

The total gene diversity (HT = 0.583) of the seven socialgroups can be distributed into intra- (HS = 0.485) and inter-(DST=HT-HS = 0.098) social groups gene diversity. GST(=DST/HT) was 0.167, it represented that 17% of the totalgene diversity was attributed to differences between socialgroups. This result suggested that low differentiationbetween social groups may result from frequent gene flowby adult male migration among neighboring social groups(Koyama et al. 1981; de Ruiter and Geffen 1998;Perwitasari-Farajallah et al. 1999). Males leave their natalgroup typically before sexual maturity and may changesocial groups many times during their lifetime (de Ruiterand Geffen 1998). Changing social groups is associatedwith high variation in male reproductive success (de Ruiteret al. 1992; Keane et al. 1997) and even mortality (Dittus1975). This behavior serves as a guard against inbreedingand homogenizes the distribution of genetic variation in thenuclear genome within a deme (Melnick and Hoelzer 1992,1996). Upon the obtained results further studies wereessential due to lack of samples on the present study.

The value of the absolute amount of genetic diversitybetween social groups was calculated by Nei’s standardgenetic distance (Nei 1987) as given in Table 3.

Table 3. Nei' genetic distance (D) and genetic similarity (I)between social groups

1 2 3 4 5 6 71 0.187 0.258 0.196 0.151 0.104 0.1672 0.829 0.219 0.226 0.183 0.085 0.4853 0.773 0.803 0.291 0.259 0.211 0.5584 0.822 0.798 0.748 0.287 0.107 0.3325 0.860 0.832 0.771 0.750 0.172 0.3456 0.901 0.919 0.810 0.899 0.841 0.3977 0.846 0.616 0.572 0.718 0.708 0.672

Note: above diagonal: Nei’s genetic distance (D); below diagonal:genetic similarity; 1-7: social groups as indicated in Table 3.

The largest distance was found between Jebag andTopeng (average of D = 0.558), while Jambul and Sipitrevealed the smallest genetic distance (average D = 0.085).

Genetic differentiation between adjacent groups estimatedby Nei’s standard genetic distance in general was less thanthose between non-adjacent groups (Perwitasari-Farajallahet al. 1999).

CONCLUSIONS

Microsatellite loci which were cloned from the humangenome can provide informative genetic markers forstudying population structure and genetic differentiation oflong-tailed macaques, Macaca fascicularis. D1S548 andD3S1768 were polymorphic loci, and can be applied forestimating allelic diversity.

ACKNOWLEDGMENTS

We are grateful to the staff of the laboratory of Biologyand Reproduction, Primate Research Center, BogorAgricultural University for laboratory assistance, and thestaff of the Division of Animal Biosystematics andEcology, Department of Biology, Bogor AgriculturalUniversity for valuable advices. We would like to sincerelythank to three anonymous reviewers who provided helpfulcomments on the manuscript.

REFERENCES

Chu J, Wu H, Yang H, Takenaka O, Lin Y (1999) Polymorphicmicrosatellite loci and low-invasive DNA sampling in Macacacyclopis. Primates 40: 573-580.

de Ruiter JR, Geffen E (1998) Relatedness of matrilines, dispersing malesand social groups in long-tailed macaques (Macaca fascicularis).Proc R Soc Lond B (Bio) 265: 79-87.

de Ruiter JR, Scheffrahn W, Trommlen GJJM, Uitterlinden AG, MartinRD, van Hooff JARAM (1992) Male social rank and reproductivesuccess in wild long-tailed macaques. In: Martin RD, Dixson AF,Wickings EJ (eds) Paternity in primate: genetic tests and theories.Karger, Basel.

Dittus WPJ (1975) Population dynamics of the toque macaque, Macacasinica. In: Tuttle RH (ed) Socioecology and psychology of primates.Mounton, The Hague.

Ely JJ, Gonzales DL, Reeves-Daniel A, Stone WH (1998) Individualidentification and paternity determination in chimpanzees (Pantroglodytes) using human short tandem repeat (STR) markers. Int JPrimatol 19: 255-271.

Goldstein DB, Pollock DD (1997) Launching microsatellites: a review ofmutation processes and methods of phylogenetic inferences. J. Hered88: 335-342.

Goossens B, Latour S, Vidal C, Jamart A, Ancrenaz M, Bruford MW(2000) Twenty new microsatellite loci for use with hair and faecalsamples in the chimpanzee (Pan troglodytes troglodytes). FoliaPrimatol 71: 177-180.

Hartl DL, Clark AG (1997) Principles of population genetics. SinauerAssociates, Massachusetts.

Kan YW, Dozy AM, Trecartin R, Todd D (1977) Identification of anondeletion defect in -Thalassemia. N Engl J Med 297: 1081-1084.

Kanthaswamy S, von Dollen A, Kurushima JD, Alminas O, Rogers J,Ferguson B, Lerche NW, Allen PC, Smith DG (2006) Microsatellitemarkers for standardized genetic management of captive colonies ofrhesus macaques (Macaca mulatta). Am J Primatol 68: 73-95.

Kawamoto Y, Kawamoto S, Matsubayashi K, Nozawa K, Watanabe T,Stanley MA, Perwitasari-Farajallah D (2008) Genetic diversity oflongtail macaques (Macaca fascicularis) on the island of Mauritius:an assessment of nuclear and mitochondrial DNA polymorphisms. JMed Primatol 37: 45-54.


Kawamoto Y, Ischak TbM, Supriatna J (1984) Genetic variations withinand between troops of the crab-eating macaques (Macacafascicularis) on Sumatra, Java, Bali, Lombok, and Sumbawa,Indonesia. Primates 25: 131-139.

Keane B, Dittus WPJ, Melnick DJ (1997) Paternigy assessment in wildgroups of toque macaques Macaca sinica at Polonnaruwa, Sri Lankausing molecular markers. Mol Ecol 6: 267-282.

Kondo M, Kawamoto Y, Nozawa K, Matsubayashi K, Watanabe T,Griffiths O, Stanley MA (1993) Population genetics of crab-eatingmacaques (Macaca fascicularis) on the island of Mauritius. Am JPrimatol 29: 167-182.

Koyama NA, Asuan A, Natsir N (1981) Socioecological study of crab-eating monkeys in Indonesia. Kyoto University Overseas ResearchReport of Studies on Indonesian Macaque 1: 1-10.

Kyes RC (1993) Survey of the long-tailed macaques introduced into Tinjilisland, Indonesia. Am J Primatol 31: 77-83.

Kyes RC, Sajuthi D, Iskandar E, Iskandriati D, Pamungkas J, CrockettCM (1998) Management of a natural habitat breeding colony oflongtailed macaques. Trop Biodiv 5: 127-137.

Melnick DJ, Hoelzer GA (1992) Differences in male and female macaquedispersal lead to contrasting distributions of nuclear andmitochondrial DNA variation. Int J Primatol 13: 379-393.

Melnick DJ, Hoelzer GA (1996) Genetic consequences of macaque socialorganization and behaviours. In: Fa JE, Lindburg DG (eds) Evolutionand ecology of macaque societies. Cambridge University Press,Cambridge.

Morin P, Kanthaswamy S, Smith DG (1997) Simple sequence repeat(SSR) polymorphisms for colony management and populationgenetics in rhesus macaques (Macaca mulatta). Am J Primatol 42:199-213.

Nauta MJ, Weissing F (1996) Constraints on allele size at microsatelliteloci: implications for genetic differentiation. Genetics 133: 1021-1032.

Nei M (1987) Molecular evolutionary genetics. Columbia UniversityPress, New York.

Nurnberg P, Sauermann U, Kayser M, Lanfer C, Manz E, Widdig A,Berard J, Bercovitch FB, Kessler M, Schmidtke J, Krawczak M(1998) Paternity assessment in rhesus macaques (Macaca mulatta):multilocus DNA fingerprinting and PCR marker typing. Am JPrimatol 44: 1-18.

Pérez-Lezaun A, FE Calafell, D Mateu, D Coma, R Ruiz-Pacheco, JBertranpetit (1997) Allele frequencies for 20 microsatellite in aworldwide population survey. Hum Hered 47: 189-196.

Perwitasari-Farajallah D (2007) Human short tandem repeats (STRs)markers for paternity testing in colony of pig-tailed macaques(Macaca nemestrina). Hayati 14: 39-43.

Perwitasari-Farajallah D, Farajallah A, Kyes RC, Sajuthi D, Iskandriati D,Iskandar E (2004) Genetic variability in a population of long-tailedmacaques (Macaca fascicularis) introduced onto Tinjil Island,Indonesia: Microsatellite loci variations. Hayati 11: 21-24.

Perwitasari-Farajallah D, Kawamoto Y, Suryobroto B (1999) Variation inblood proteins and mitochondrial DNA within and between localpopulations of longtail macaques, Macaca fascicularis, on the islandof Java, Indonesia. Primates 40: 581-595.

Perwitasari-Farajallah D, Kawamoto Y, Kyes RC, Lelana RPA, Sajuthi D(2001) Genetic characterizationof long-tailed macaques (Macacafascicularis) on Tabuan Island, Indonesia. Primates 42: 141-152.

Smith DG, Kanthaswamy S, Viray J, Cody L (2000) Additional highlypolymorphic microsatellite (STR) loci for estimating kinship in rhesusmacaque (Macaca mulatta). Am J Primatol 50: 1-7.

Tegelström H (1986) Mitochondrial DNA in natural populations: Animproved routine for the screening of genetic variation based onsensitive silver staining. Electrophoresis 7: 226-229.


Examination of uropathogenic Escherichia coli strains conferring largeplasmids

SUHARTONO♥Department of Biology, Faculty of Mathematics and Natural Science, Syiah Kuala University (UNSYIAH), Darussalam, Banda Aceh 23111, Aceh,

Indonesia, Tel. +62-0651-7428212, Fax. +62-0651-7552291, e-mail: [email protected]

Manuscript received: 2 June 2009. Revision accepted: 9 July 2009.

ABSTRACT

Suhartono (2010) Examination of uropathogenic Escherichia coli strains conferring large plasmids. Biodiversitas 11: 59-64. Of majoruropathogens, Escherichia coli has been widely known as a main pathogen of UTIs globally and has considerable medical and financialconsequences. A strain of UPEC, namely E. coli ST131, confers a large plasmid encoding cephalosporinases (class C β-lactamase) orAmpC that may be disseminated through horizontal transfer among bacterial populations. Therefore, it is worth examining such largeplasmids by isolating, purifying, and digesting the plasmid with restriction enzymes. The examination of the large plasmids wasconducted by isolating plasmid DNA visualized by agarose gel electrophoresis as well as by PFGE. The relationship of plasmids amongisolates was carried out by HpaI restriction enzyme digestion. Of 36 isolates of E. coli ST 131, eight isolates possessed large plasmids,namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with the largest molecular size confirmed by agarose gel electrophoresis and PFGE was~42kb and ~118kb respectively. Restriction enzyme analysis revealed that isolates 9, 10, 12, 17 and 18 have the common restrictionpatterns and those isolates might be closely related.

Key words: large plasmids, uropathogenic E. coli, electrophoresis, RE, PFGE.

INTRODUCTION

Urinary tract infections (UTI), the most commoninfectious diseases triggering significant medical andfinancial implications, are defined as the presence ofmicrobial pathogens within urinary tracts identified by awide spectrum of symptoms ranging from mild irritativevoiding to bacterimia, sepsis, or even death (Foxman2002). Many factors are attributed to these infections suchas bacterial invasion, anatomical and functionalabnormalities of urinary tracts and host immune status. Interms of bacterial invasion, a various uropathogens havebeen identified as the common causative agents of theseinfections, namely Escherichia coli, Klebsiella sp.,Proteus, Pseudomonas, Staphylococcus saprophyticus andEnterococcus (Barnett and Stephens 1997). Of theseuropathogenic bacteria, Escherichia coli is the most widelyknown accounting for more than half of UTI incidences(Kucheria 2005). These bacteria possess not only virulencefactors but also antibiotic resistance in promoting andpersisting colonization and infection of the urinary tract(Oelschlaeger 2002; Rijavec et al. 2006).

One of the antibiotic resistant features of E. coli thatshould be concerned is cephalosporinase, a class C -lactamase enzyme that hydrolyses cephalosporins, as aresult of increasing use of ceftazidime and other third-generation cephalosporins. This enzyme is encoded byampC genes located on the chromosomes as well asplasmids (Philippon et al. 2002). The location of these

genes in the plasmid potentially allows disseminationamong different species by horizontal transfer (Su et al.2008).

A clone of antibiotic uropathogenic E. coli in thenorthwest of England that its entire genome sequence hasbeen obtained, namely ST 131, carried these genes on itsplasmids (Su et al. 2008). Certainly, an examination of theoccurrence of the plasmid is crucial since it may bedisseminated through horizontal transfer among bacterialpopulations leading to an increase of the prevalence ofcephalosporinases within the strains.

The aim of the research is to isolate as well as to purifylarge plasmids containing cephalosporinase conferred by apanel of uropathogenic E. coli isolates. Restriction enzymedigestion of the large plasmids will be conducted tocompare the restriction profile of such isolates, as this willallow a deeper understanding of the relationships of theisolates.


Bacterial isolatesA total of 36 routine clinical E. coli isolates designated

ST 131 appearing to be resistant to extended-spectrumcephalosporins were used in this study. The source of theisolates were from laboratories across the northwest ofEngland, namely Manchester (isolate 1, 2, 25-32), Preston(isolate 3-6, 13-24 and 33-36), Lancaster (isolate 7 and 8)


and Barrow (isolate 9-11). Those isolates were then sub-cultured on nutrient agar and incubated at 37°C overnight.The antimicrobial susceptibility of each isolate wasdetermined by Vitek 2 system by using the AST-N054 card(BioMerieux). For plasmid isolation purposes, the isolateswere inoculated into Luria-Bertani broth followed byaerobic incubation at 37ºC for 18 hours. Before harvestingthe cells, the optical density of the culture were measuredby spectrophotometer (Cecil Instruments Ltd., Cambridge,UK) at wavelength 600nm. The number of cells wasconfirmed by total plate count.

Plasmid isolationPlasmids were isolated by using Wizard® plus SV

minipreps DNA purification system (Promega, Madison,USA) according to manufacturer’s instruction. Briefly, aneach overnight culture of E. coli in 1.5 mL LB broth waspelleted in sterile 1.5 mL eppendorf tube by centrifugationat 10.000g for 5 minutes at room temperature. The cellswere then resuspended thoroughly and plasmid isolationperformed. Plasmid DNA was eluted from spin columns byadding 100µl of nuclease free-water and centrifuging at14.000g for one minute at room temperature. The elutedplasmid DNA was stored at -20ºC or run in a gelelectrophoresis.

Gel electrophoresisGel electrophoresis was performed as described

(Voytas 2000). The gel (5 mm thick) containing 0.7% ofagarose was used in electrophoresis to resolve the isolatedplasmid. In order to facilitate visualization of DNAfragments during the run, 0.5µg/mL of ethidium bromidewas added before pouring the melted agarose to the gel-casting platform. After loading the DNA sample andLambda DNA/EcoR I + HindIII marker (Promega,Madison, USA) mixed with 0.03 mL of 5x loading buffer(Bioline Inc., London, UK), the gel was run in 1x TBEbuffer (in g/l: Tris, 10.8; EDTA, 10.3; boric acid, 5.5, pH8.0) at 10V/cm for 75 minutes. Photographs of the gelsfollowed by molecular weight measurements were taken byvideo imaging systems (Alpha Innotech Corp., SanLeandro, California, USA).

Restriction enzyme analysisA set of large plasmids from selected isolates were

digested by using HpaI restriction enzyme. For analysis,the enzyme was diluted by mixing 10µl of RE (10u/µl) and40 µl of 1x RE buffer (buffer J). In a 0.5 mL sterileeppendorf tube, 2µl of 10x buffer J and 0.2µl of acetylatedBSA were mixed gently by pipetting. A total of 15.3µl ofplasmid DNA sample was then added to the suspensionbefore adding 2.5µl of diluted restriction enzyme yielding afinal volume 20µl. The tube was then centrifuged for a fewsecond followed by incubation at 37 ºC for four hours.After adding 3µl of 5x loading buffer, the sample wasloaded in agarose gel for electrophoresis.

Pulsed Field Gel Electrophoresis (PFGE)The PFGE was conducted as describe previously

(Sambrook and Russel 2001) with modification. Briefly,

the PFGE was performed in four steps, namely preparationDNA plugs, washing, electrophoresis and gel staining.Initially, an each overnight selected culture of E. coli in 9mL of LB was centrifuged at 3,400g for 15 minutes. Thesupernatant was removed followed by adding 10 mL ofTBE buffer and re-centrifuged for 15 minutes at 3.400g atroom temperature. The supernatant was once againdiscarded and 0.5 mL of suspension buffer was added. Thebacterial suspension was then gently mixed with 0.75 mLof melted 3% low melting point agarose (maintained at50ºC) and quickly pipetted into the slots of a plastic plugmould (BIORAD). The plugs were allowed to solidify at 4ºC for one hour before they were transferred to a sterileglass bijou containing 1 mL RNAse (50µg/mL) followedby incubation at 37ºC for 4 days. RNAse was subsequentlyreplaced by lyses buffer (500µg/mL lysozyme solution)before the plugs were incubated overnight at 37ºC. Havingbeen incubated overnight, the lyses buffer was replacedwith 1 mL proteolysis buffer (1% SDS solution) followedby adding proteinase K solution (1mg/mL) per sample. Forthe digestion to take place, the plugs were incubatedovernight at 55ºC at a shaking water bath before the nextstep, washing, was carried out.

The washing step was performed six times every hourat room temperature by replacing the proteinase K solutionwith 2 mL TE buffer in order to eliminate cell debris andproteinase K activity as well as to equilibrate the agaroseplugs. The washing step was carried out carefully withoutdisturbing the plugs. After washing, the plugs were storedat 4ºC prior to using in further steps.

In the third step, the DNA plugs were sliced and loadedinto appropriate wells of 1.2% agarose gel and sealed with3% low melting point agarose. A DNA molecular weightmarker plug (Sigma-Aldrich, Inc, Missouri, USA) was alsoloaded in one of the wells. The gel was then placed inelectrophoresis chamber of a CHEF Mapper System (BIO-RAD Laboratories Ltd., Hemel Hempstead, UK) that hadbeen poured with 2 liters of 0.5x TBE buffer. The systemwas run with parameters: initial switch time, 6s; finalswitch time, 8s; run time, 24h, angle, 120º; gradient,4.5V/cm; temperature, 14ºC; ramping factor, linear.Ultimately, in the last step, ethidium bromide (0.5 µg/mLin water) and distilled water were used to stain and washthe gel respectively for 20 minutes for each step followedby visualization of stained gel under UV light with videoimaging systems.


Colonial morphology and cell densityA total of 36 E. coli ST 131 isolates grew well on the

nutrient agar showing typical colonial appearance withdiameter 2-4mm, circular, slightly convex, gray and moist.Incubation overnight at 37ºC in LB yielded cell numbers ofE. coli of 3.7 x 109 colonies with optical density at 600 nm(OD600) of 0.803.

LB used in this project has given a profound effect toallow fast growth and good growth yield of E. coli to reachexponential state of bacterial growth. LB is a rich medium

SUHARTONO – Uropathogenic of Escherichia coli strains 61

containing catabolizable amino acids as carbon sourcesaccounting for the alkalinisation of the medium duringgrowth. It is important to note that exponential growth ofculture in plasmid isolation is crucial since in this rate, theplasmids of E. coli increase rapidly due to replicationprocess in parallel with cell division every 20 minutes(Sezonov et al. 2007). Furthermore, improper time andtemperature incubation will yield relatively low amount ofplasmid DNA because of insufficient density of bacterialcells. Likewise, overgrown cultures may also result insuboptimal yields as well as impurity yields due toexcessive chromosomal DNA contamination as part ofautolysis of bacterial cells after reaching stationary phase(Promega 2008)

Antimicrobial susceptibilityAntimicrobial agent susceptibilities of E. coli ST131

used in this study is listed in Table 1. It is worth noting thata total of 36 E. coli ST131 isolates, phenotypically, showedresistance to penicillins such as ampicillin, amoxicillin-clavulanic acid and piperacilin with rates approximately89%, 67% and 80% respectively (Table 1). These isolateswere also resistant not only to cefalotin (73%), a firstgeneration cephalosporins, but also to quinolone drugs suchas nalidixic acid with rates over 83% and ciprofloxacin withrates of 80%. Likewise, the rate of trimethoprim resistanceof these isolates was also considerably high (80%).

Plasmid isolationOf the 36 isolates of E. coli ST 131, eight of them

harbored a large plasmid, namely isolate 9 (Figure 1; lanec), 10 (lane d), 12 (lane e), 17 (lane g), 18 (lane h), 26 (lanek) and 30 (lane m) with molecular weight approximately

above the chromosomal DNA artifacts (~21kb). Based onthe migration patterns, those large plasmids were classifiedas plasmid w (~42kb), plasmid x (~40kb), plasmid y(~30kb) and plasmid z (~28kb). Isolate 10 possesses bothplasmid w and z, whereas isolate 9, 12 and 17 possessplasmid w only. The remaining isolates which are isolate18, 26 and 30, posses plasmid x, y and z, respectively.

In this agarose gel, small plasmids, possibly with threebands were also detected. Conversely, in particular isolates,there were only chromosomal DNA band that had beendetected instead of plasmid i.e. isolate 8 (lanes b), isolate14 (lanes f), isolate 19 (lanes i), isolate 20 (lanes j) andisolate 27 (lanes l). The resolution of those isolates on theagarose gel is shown in Figure 1.

Restriction enzyme analysisActivity of HpaI is most likely active to digest almost

all of the plasmid of E. coli isolates harboring largeplasmids yielding some restriction fragments. It is apparentthat isolate 9, 10, 12, 17 and 18 have the commonrestriction patterns yielding 10.000bp, 7.000bp, 5.000bp,2.750bp, 2.000bp and 1.400bp fragments as shown inFigure 2 lanes b, c, d, e and f respectively. Theseindistinguishable fragments may indicate that the plasmidsamong those isolates are closely related. On the other hand,HpaI digested the large plasmid of isolate 26 yielding quitedistinct fragments than the previous isolates, namely inbase pairs 10.000, 8.500, 7.000, 5.500 and 4.500. The moststriking feature of this restriction enzyme digestion,however, was there is no restriction activity on the plasmidof isolate 30 as indicated by no resolved fragments on thegel (lanes h).

Table 1. Summarized susceptibilities of E coli ST131 (n = 36) against antimicrobial agents.

Resistant Intermediate SusceptibleAntimicrobial agentsn (%) n (%) n (%)

Total

Ampicillin 32 (88.89) 0 (0) 4 (11.11) 36Amoxicillin/Clavulanic Acid 24 (66.67) 2 (5.56) 10 (27.78) 36Piperacillin 29 (80.56) 3 (8.33) 4 (11.11) 36Piperacillin/Tazobactam 0 (0) 14 (38.89) 22 (61.11) 36Cefalotin 26 (72.22) 5 (13.89) 5 (13.89) 36Cefuroxime 26 (72.22) 0 (0) 10 (27.78) 36Cefuroxime Axetil 26 (72.22) 0 (0) 10 (27.78) 36Cefoxitin 22 (61.11) 0 (0) 14 (38.89) 36Cefotaxime 8 (22.22) 18 (50) 10 (27.78) 36Ceftazidime 2 (5.56) 24 (66.67) 10 (27.78) 36Cefepime 1 (2.78) 25 (69.44) 10 (27.78) 36Aztreonam 1 (2.78) 25 (69.44) 10 (27.78) 36Lmipenem 0 (0) 0 (0) 36 (100) 36Meropenem 0 (0) 0 (0) 36 (100) 36Ertapenem 0 (0) 0 (0) 36 (100) 36Amikacin 0 (0) 17 (47.22) 19 (52.78) 36Gentamicin 5 (13.89) 1 (2.78) 30 (83.33) 36Tobramycin 16 (44.44) 1 (2.78) 19 (52.78) 36Nalidixic Acid 30 (83.33) 0 (0) 6 (16.67) 36Ciprofloxacin 29 (80.56) 0 (0) 7 (19.44) 36Nitrofurantoin 0 (0) 1 (2.78) 35 (97.22) 36Trimethoprim 29 (80.56) 0 (0) 7 (19.44) 36


Figure 1. The resolution of some E. coli ST 131 plasmids on the 0.7% agarose gel run at 10V/cm. (M) Lambda DNA/EcoR I + HindIIImarkers, (a) isolate 3, (b) isolate 8, (c) isolate 9, (d) isolate 10, (e) isolate 12, (f) isolate 14, (g) isolate 17, (h) isolate 18, (i) isolate 19, (j)isolate 20, (k) isolate 26, (l) isolate 27 and (m) isolate 30. The large plasmids with their bands above the chromosomal (chr) artifacts(~17kb) were grouped as plasmid w (~42kb), plasmid x (~40kb), plasmid y (~30kb) and plasmid z (~28kb). Numbers indicate base pairs(bp).

Figure 2. The restriction profiles of E. coli ST131digested by HpaI restriction enzyme on the 0.7% of agarose gel run at 10V/cm for 75minutes. (M) molecular marker of Hyperladder I (Bioline, UK), (a) isolate 3, (b) isolate 9, (c) isolate 10, (d) isolate 12, (e) isolate 17, (f)isolate 18, (g) isolate 26 and (h) isolate 30. Numbers indicate base pairs (bp).

SUHARTONO – Uropathogenic of Escherichia coli strains 63

HpaI used in this study is an endonuclease enzymerecognizing as well as digesting in the middle of doublestranded DNA at the sequence 5’- GTT ↓ AAC -3’ leavingblunt ends (Ito et al. 1992). Based on the patterns ofrestriction fragments in Figure 2, isolate 9, 10, 12, 17 and18 are likely to be closely related as these isolates share thesame digestion patterns. Compared to previous works, therestriction patterns of these isolates also shared the similarrestriction profile with pTcTN49 (Lavollay et al. 2006), butquite different from the profile of pC15-1a (Boyd et al.2004). Plasmid of pTcTN49 is a plasmid harboring CTX-M-15 that has clonally disseminated in Paris (France),Tunis (Tunisia) and Bangui, Central African Republic(CAR), whereas pC15-1a has disseminated in Toronto,Canada. Isolate 26 and 30, on the other hand, tend to bedifferent strains with the previous isolates as these isolatespossessed quite distinguishable digested fragments or nofragments at all respectively. However, the restrictionpattern of isolate 26 shared the same profile with pEpTU(Lavollay et al. 2006).

Pulsed Field Gel ElectrophoresisPFGE patterns of selected E. coli ST131 isolates

harboring large plasmids comprised various profiles,designated a-h (Figure 3). Three large plasmids weredetected in both isolate 10 (lanes c) and isolate 17 (lanes e).The descending molecular size in of three copies of largeplasmids in isolate 10 were ~92kb, ~45kb and ~28kb as

opposed to ~118kb, ~46kb and ~33kb of isolate 17 respectively.Two plasmids were detected in five isolates, namely isolate9 (lanes b), isolate 12 (lanes d), isolate 18 (lanes f), isolate26 (lanes g) and isolate 30 (lanes h), whereas singleplasmid was only detected in isolate 3 (lanes a).

The presence of large plasmids in E. coli ST131 isolatesconferring antibiotic resistance may allow ST131 confervirulence genes as well since plasmids encoding adaptivetrait genes certainly preceded antibiotic resistance, maycontain genes with a role in bacterial colonization andvirulence (Martinez and Baquero 2002). These genes areencoded as a response of a local transient adaptation to awide range of hosts and are able to be fine-tuned in order toallow a degree of genetic flexibility, which would not beavailable if the relevant genes were located on thechromosomes (Summers 1996). These plasmid-encodedvirulence genes have been implicated in adhesions,toxinogenesis, serum resistance and cell invasiveness(Martinez and Baquero 2002).

It is imperative to note that the plasmids may alsoconfer plasmid transfer genes to promote the virulencedissemination among bacterial populations. Chen et al.(2006) reported plasmid of uropathogenic E. coli UTI89,namely pUTI89, share conjugative genes and severalvirulence genes indicating a role of pathogenesis. pUTI89encodes tra operon involved in conjugative DNA transfer,whereas virulence genes such as cjrA, cjrB, cjrC and senBcoding for iron uptake proteins and enterotoxin.

Figure 3. Plasmid bands (triangle) resolved by PFGE of selected E. coli ST131 isolates. (M) molecular marker, (a) isolate 3, (b) isolate9, (c) isolate 10, (d) isolate 12, (e) isolate 17, (f) isolate 18, (g) isolate 26 and (h) isolate 30; Chr, chromosomal DNA. Numbers indicatekilo-base pairs (kb).


CONCLUSIONS

Of 36 isolates of E. coli ST131 showing high resistanceto penicillins, cephalosporins and trimethoprim, largeplasmids have been isolated and detected in eight isolates,namely isolates 3, 9, 10, 12, 17, 18, 26 and 30 with thelargest molecular size was ~42kb confirmed by agarose gelelectrophoresis and ~118kb by PFGE. There might be closerelation among those isolates owing to the commonrestriction patterns in restriction enzyme analysis. Bothagarose gel electrophoresis and PFGE are considerablyuseful not only to resolve the isolated large plasmids butalso to measure their molecular size.

REFFERENCES

Barnett BBJ, Stephens DDS (1997) Urinary tract infection: an overview.Am J Med Sci 314: 245-249.

Boyd DA, Tyler S, Christianson S, McGeer A, Muller MP, Willey BM,Bryce E, Gardam M, Nordmann P, Mulvey MR (2004) Completenucleotide sequence of a 92-kilobase plasmid harboring the CTX-M-15 extended-spectrum beta-lactamase involved in an uutbreak in long-term-care facilities in Toronto, Canada. Antimicrob AgentsChemother 48: 3758-3764.

Chen SL, Hung C-S, Xu J, Reigstad CS, Magrini V, Sabo A, Blasiar D,Bieri T, Meyer RR, Ozersky P, Armstrong JR, Fulton RS, LatreilleJP, Spieth J, Hooton TM, Mardis ER, Hultgren SJ, Gordon JI (2006)Identification of genes subject to positive selection in uropathogenicstrains of Escherichia coli: a comparative genomics approach. PNAS103: 5977-5982.

Foxman BB (2002) Epidemiology of urinary tract infections: Incidence,morbidity, and economic costs. Am J Med 113 (1 SUPPL. 1): 5S-13S.

Ito H, Shimato H, Sadaok A, Kotani H, Kimizuka F, Kato I (1992)Cloning and expression of the HpaI restriction-modification genes.Nucleic Acids Res 20: 705-709.

Kucheria RR (2005) Urinary tract infections: New insights into a commonproblem. Postgrad Med J 81: 83-86.

Lavollay M, Mamlouk K, Frank T, Akpabie A, Burghoffer B, Ben RedjebS, Bercion R, Gautier V, Arlet G (2006) Clonal dissemination of aCTX-M-15 β-lactamases-producing Escherichia coli strain in theParis area, Tunis, and Bangui. Antimicrob Agents Chemother 50:2433-2438.

Martinez JL, Baquero F (2002) Interactions among strategies associatedwith bacterial infection: pathogenicity, epidemicity, and antibioticresistance. Clin Microbiol Rev 15: 647-679.

Oelschlaeger TA (2002) Virulence factors of uropathogens. Curr OpinUrol 12: 33.

Philippon AA, Arlet GG, Jacoby GA (2002) Plasmid-determined AmpC-type beta-lactamases. Antimicrob Agents Chemother 46: 1-11.

Promega (2008) DNA purification. Protocol and application Ch.9. URLhttp: //www.promega.com/paguide/chap9.htm] [September 2, 2008].

Rijavec MM, Starcic-Erjavec MM, Ambrozic-Avgustin JJ, Reissbrodt RR,Fruth AA, Krizan-Hergouth VV, Zgur-Bertok DD (2006) Highprevalence of multidrug resistance and random distribution of mobilegenetic elements among uropathogenic Escherichia coli (UPEC) ofthe four major phylogenetic groups. Curr Microbiol 53: 158-162.

Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual.CSHL Press, New York.

Sezonov G, Joseleau-Petit D, D'Ari R (2007) Escherichia coli physiologyin Luria-Bertani broth. J Bacteriol 189: 8746-8749.

Su L-H, Chu C, Cloeckaert A, Chiu C-H (2008) An epidemic of plasmids?Dissemination of extended-spectrum cephalo-sporinases amongSalmonella and other Enterobacteriaceae. FEMS Immunol MedMicrobiol 52: 155-168.

Summers DK (1996) The biology of plasmids. Blackwell, Cambridge.Voytas D (2000) Resolution recovery of large DNA fragments. In:

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, StruhlK (eds) Current protocols in molecular biology. John Wiley & Sons,New York.


Bacterial communities associated with white shrimp (Litopenaeusvannamei) larvae at early developmental stages

ARTINI PANGASTUTI 1,2,♥, ANTONIUS SUWANTO2, YULIN LESTARI2, MAGGY TENNAWIJAYA SUHARTONO21Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University (UNS), Jl. Ir. Sutami 36A, Surakarta 57126, Central

Java, Indonesia, Tel. +62-271-663375, Fax.: +62-271-663375, email: [email protected] of Biology, School of Graduates, Bogor Agricultural University (IPB), Bogor 16680, West Java, Indonesia

Manuscript received: 22 October 2009. Revision accepted: 14 November 2009.

ABSTRACT

Bacterial communities associated with white shrimp (Litopenaeus vannamei) larvae at early developmental stages. Biodiversitas 11 (2):65-68.Terminal Restriction Fragment Length Polymorphism (T-RFLP) was used to monitor the dynamics of the bacterial communitiesassociated with early developmental stages of white shrimp (Litopenaeus vannamei) larvae. Samples for analysis were egg, hatchingnauplii, 24 hours old nauplii, and 48 hours old nauplii which were collected from one cycle of production at commercial hatchery. T-RFLP results indicated that the bacterial community associated with early stages of shrimp development might be transferred verticallyfrom broodstock via egg. There was no significant difference between bacterial communities investigated, except the bacterialcommunity of 48 hours old nauplii. Diversity analyses showed that the bacterial community of egg had the highest diversity andevenness, meanwhile the bacterial community of 48 hours old nauplii had the lowest diversity. Nine phylotypes were found at all stageswith high abundance. Those TRFs were identified as γ- proteobacteria, α-proteobacteria, and bacteroidetes group.

Key words: Litopenaeus vannamei, bacterial community, T-RFLP.

INTRODUCTION

White shrimp (Litopenaeus vannamei) is one of themajor cultured shrimp species in the world. Since the year2000, L. vannamei production is growing rapidly. InIndonesia, L. vannamei production increased five fold infive years between 2000 and 2005 and is expected tooutpace the other species in the next few years. Anincreasing demand for white shrimp had forced intensiveculture of this species, which brought many problems dueto increasing disease outbreaks caused by microorganismthat lead to mass mortality. A number of emerging reportsindicated that microbial community plays a major role inaquaculture. Microbiota that lived in association withaquatic animal may enhance host growth and survival byproducing some digestive enzymes (Sugita et al. 1995;Seeto et al. 1996; Izvekova 2006), out-competingpathogenic bacteria, and supplying essential compoundimportant for host metabolism. Rapid growth of shrimpoccurred in unfiltered pond water, which contained organicparticle including bacteria (Moss and Pruder 1995).

Most of the works to study the microbial community ofshrimp were done based on the culture method. Thismethod has limitation, since less than 1% of bacteria thathave been successfully cultured in artificial media untilnow (Amann et al. 1995; Rappe and Giovannoni 2003).Artificial medium and culture condition preferred thegrowth of particular group of bacteria. Molecular methodsbased on the amplification of 16S rRNA genes were usedto overcome this problem. This gene is ubiquitous and

highly conserved among procaryotic organisms; make ituseful as molecular marker for microbial communityanalyses. One of the techniques that used this approach wasterminal restriction fragment length polymorphism analysis(T-RFLP). T-RFLP provides several advantages over othertechniques because it saves time and cost especially whenthere are many samples to be analyzed. T-RFLP has beensuggested more sensitive and has a greater resolution thanother fingerprinting techniques such as DenaturingGradient Gel Electrophoresis (Marsh 1999). However, thistechnique has limitation in accurate identification ofspecies in the community, since one terminal restrictionfragment (TRF) can be generated from multiple taxa.

This research was aimed to characterize bacterialcommunity associated with white shrimp larvae at earlydevelopmental stages. Characterization of typicalmicroorganism profiles will provide a basis for future workto understand the host-microbe interaction and the efficacyof some practices in shrimp farming.


Sample preparationSamples of egg and nauplii were from a single cycle of

production, obtained from the hatchery of PT. CentralPertiwi Bahari, Lampung, Indonesia. Nauplii were sampled3 times, i.e. just after hatching, 24 hours after hatching, and48 hours after hatching. Prior to DNA extraction, 0.1 g ofeach egg or larvae samples was washed 3 times in 0.85%


sterile NaCl on sterile filter paper to minimize non-associated microorganisms.

DNA isolationBacterial DNA was extracted from egg/larvae samples.

DNA isolation was performed employing UltraClean SoilDNA Isolation kit (MoBio, California). Egg or larvaesample was homogenized in lyses buffer provided in thekit. Lysozyme with final concentration of 10 mg/ml wasadded to the homogenate and then incubated at 37°C for 1hour. Further procedure followed the instruction suggestedby manufacturer.

PCR amplification63f primer that 5’ end labeled (5’-(6FAM)

CAGGCCTAACACATGCAAGTC-3’) and 1387r primer(5’-CCCGGGAACGTATTCACCGC-3’) were used toamplify 16S rRNA gene (Marchesi et al. 1998). Reactionmixtures for PCR contained 100 ng DNA, 1x buffer (NEB,MA), 200 µM of each dNTP, 1 U Taq DNA Polymerase(NEB, MA), 5 pmol of each primer, in a final volume of 50µl. DNA amplification was performed with specificationsas follows: 3 minutes denature step at 94° C; 30 cycles of 1minute at 94° C, 1 minute at 55° C, 1 minute at 72° C; finalextension step at 72° C for 10 minutes. PCR product wastreated with mung bean nuclease (NEB, MA) to eliminatepseudo TRF (Egert and Friedrich 2003). Then the PCRproduct was run on 0,8% agarose gel. The DNA band withapproximately 1500 bp in size was excised prior topurification using Qiaquick Gel Extraction Kit (Qiagen,Germany).

Restriction enzymedigestion

Purified PCR productwas single-digested withAluI or RsaI (NEB, MA)in separate tubes. Reactionmixtures contained 5Uenzyme, 1x buffer, 100-200 ng DNA in totalvolume of 20 µl andincubated in 37ºCovernight. Digested DNAwas then purified withQiaquick NucleotideRemoval Kit (Qiagen,Germany) and eluted with30µl elution buffer.

T-RFLP analysis1 µl of digested DNA

was mixed with 0.5 µl ofHD-400 [ROX] as internalstandard and thendenatured at 95ºC for 5minutes then placed onice. The length of variousTRF was analyzed usingan ABIprism™ 3100

Automated DNA Sequencer and determined usingGeneScan Programme (Perkin Elmer, Norwalk). The sizesof TRFs were compared with the database of RibosomalDatabase Project to identify their closest relatives.

Diversity analysesBacterial phylotype richness (S) was expressed as total

number of peaks within each sample. Shannon Wienerindex (H’) and the evenness (E) were calculated to describethe diversity of community and relative importance of eachphylotype within the entire assemblage. H’ was calculatedas follows: H’= -Σ (pi) (ln pi) where pi is the relativeabundance of fragment i. Evenness was measured based onequation: E = H’/ Hmax where Hmax = ln S (Margalef 1958).


ResultsT-RFLP was employed to monitor the changes in

microbial community as the larvae undergo their naupliidevelopmental stages. Sample data consist of the size inbase pair and peak area for each TRF peak inelectrophoregram. One TRF is considered as a phylotypewhile each peak area shows the relative abundance of theTRF. Restriction enzyme AluI yielded greater resolution(produced more TRFs) than RsaI. Therefore, furtheranalyses were conducted based on this enzyme TRFs.

The electrophoregram of T-RFLP result was shown inFigure 1. There were only minor changes in bacterialcommunity composition after the hatching process until thelarvae reach Nauplii 1 stage (24 hours after hatching). The

Figure 1. T-RFLP profiles of bacterial communities in early developmental stages of white shrimplarvae: (a) egg, (b) hatching nauplii, (c) 24 h old nauplii, and (d) 48 h old nauplii.

Vibrio α-Proteobacteria

D

B

A

C

PANGASTUTI et al. – Bacterial communities in Litopenaeus vannamei larvae 67

most abundant phylotypes in egg, hatching nauplii, and 24hours old nauplii were the same, but in 48 hours oldnauplii, this phylotype was not dominant.

Bacterial richness, Shannon-Wiener index, andevenness in every stage were shown in Table 1. Bacterialcommunities associated with early stage of white shrimplarvae development had high diversity and also had highevenness consistently. This result suggesting that thebacterial community in early larvae development was verydiverse. High evenness value meant that all phylotype weredistributed evenly. There was no phylotype that was reallydominant comparing to the others here. However, thediversity of bacterial community which detected at 48hours old nauplii was sharply decline. This might be relatedto the molting stage at which the sampling was conducted.The highest diversity and evenness was observed in eggwhile the lowest was in 48 hours old nauplii.

Table 1. Bacterial diversity in each stage of larvae development.

Stage S H’ E Dominant AluITRF size (bp) Group

Egg 161 4.24 0.83 152 VibrioHatching Nauplii 114 3.68 0.78 152 Vibrio24 h old nauplii 139 3.97 0.81 152 Vibrio48 h old nauplii 10 1.59 0.69 215 α-Proteo-

bacteriaNote: S: bacterial richness; H’: Shannon-Wiener index; E:evenness.

Some phylotypes could be found all stages of larvaldevelopment that had been analyzed (Table 2). Nine AluIphylotypes were found consistently throughout the entirenauplii stages of larval development, i.e. 37 bp, 149 bp,152 bp, 213 bp, and 215 bp, which were grouped into γ-proteobacteria class, while 36 bp belonged to bacteroidetesclass. Three TRF, 58 bp, 259 bp, 357 bp did not match anyspecies in database. Phylotype that was represented by 152bp TRF was the most abundant phylotype in bacterialcommunities of egg and nauplii until 24 hour afterhatching.

Table 2. Phylotypes found in all stages of larval development thatwere analyzed.

TRF size (bp) Group36 Bacteroidetes37 Pseudomonas58 No match in database

149 Vibrio152 Vibrio213 α-Proteobacteria215 α-Proteobacteria259 Bacteroidetes357 No match in database

DiscussionUntil now, studies about bacteria that lived associated

with white shrimp were only conducted based on culturetechniques. The bacteria that were commonly found in thisorganism were Vibrio, Staphylococcus, Brevibacterium,and Micrococcus (Goodwin 2005). Moss et al. (2000)found that Vibrio, Aeromonas, and Pseudomonas

dominated the gut of juvenile L. vannamei, but accordingto Vandenberghe et al. (1999), Vibrio was not the dominantgroup in L. vannamei. To our knowledge, this is the firststudy to investigate the dynamics of microbial communityassociated with shrimp larvae employing molecular-basedtechnique.

Each TRF could be identified by matching the size ofTRF with database. Not all of TRFs could beunambiguously identified employing RDP database. Thelimitation of T-RFLP is its ability to identify phylotypessince only a small fragment of the 16S rRNA gene that isanalyzed, i.e. the 5’ terminal. Many genus of bacteria sharethe same TRF sizes, makes it difficult to obtain the realidentity of TRF. The use of two or more restrictionenzymes can reduce the possible identities of each TRF. Inthis study, the use of two restriction enzymes still gavemany possibilities for phylotype identity, at the specieslevel. Therefore, we identified the TRF at class level.

In bacterial community of egg, hatching nauplii, and 24hours old nauplii, the dominant phylotype belonged towhile the dominant phylotype in bacterial community of 48hours old nauplii belonged to. Overall, Proteobacteriagroup seemed to be dominant in bacterial communityassociated with white shrimp larvae. However, since allsamples in this study were originated from single hatchery,the results obtained in this study might not necessarilyreflect bacterial communities associated with white shrimplarvae derived from other hatcheries. Differentenvironment and culture conditions could lead to differentbacterial communities established in other places.

The composition of bacterial community was notsignificantly different between egg and nauplii stages oflarvae. At early stages of development, the gut and immunesystem of shrimp larvae have not fully developed. Themolting process of the host may also have a directinfluence on the composition of bacterial community.Dempsey et al. (1989) found high individual variability inthe types and the numbers of colony forming units thatcould be isolated from penaeid shrimp gut that might beattributed to the molting stage of the shrimp. Duringmolting, the exoskeleton and also the chitinous hindgutlining is replaced. A study in millipede showed that thenew hindgut lining was devoid of microbes (Crawford et al.1983). After molting processes, new bacterial communitieswere established and the environment has great influence todetermine the composition of new communities. This couldexplain why in 48 hours nauplii the diversity was very low.Possibly, the nauplii were sampled just after they undergothe molting process that only a small number of bacteria inthe bacterial community newly established.

The establishment of bacterial community in L.vannamei larvae is still unclear. The composition ofbacterial community at early developmental stages wasvery similar to the community at egg (sharing 83 phylotypewhich were the same), suggesting that there had been avertical transmission from broodstock to larvae. The innerpart of egg is sterile, but the surface might be colonized bybacteria that originated from broodstock during spawningprocess. In this case, the bacteria at the surface of egg arebeing transferred to nauplii when they hatch. Bacteria from

d


broodstock determine the composition of bacterialcommunity of larvae, especially at early developmentalstages where the additional feed has not introduced yet tothe larviculture system. Even though we did not examinethe status of bacterial community in broodstock, verticaltransmission of bacteria might be one of the importantprocesses for the establishment of bacterial community inL. vannamei.

It is also possible that the bacteria in the communityassociated with larvae at early developmental stage wereoriginated from the water, since the shrimp larvae is a filterfeeder. Large amount of water is always taken into thelarval gut, makes it an important source of bacteria tooccupy the gut. On the other hand, larval feces arecontinuously released to the water, bringing bacteria fromlarval gut into rearing water.

TRFLP analysis showed that two phylotypes were verydominant in comparison to other phylotypes incommunities, i.e. 152 bp, 213 bp, and 215 bp. Thosephylotypes represented γ-Proteobacteria, α-Proteobacteria,and α-Proteobacteria group respectively. The dominantphylotypes in early developmental stages of larvae couldplay key roles in determining the survival of shrimp larvae.The 152 bp TRF identified as genus Vibrio, which isusually pathogenic to shrimp. However, in this study, thedominant phylotypes apparently did not harm their host asshown by high survival rate of the larvae (data not shown).This finding suggested that not all of Vibrio species arepathogenic to shrimp. The role of the diversity in shrimpbacterial community is to maintain the balance betweenharmful bacteria and the beneficial ones. High diversitycould prevent the opportunistic bacteria to growth andcause the disease.

Despite of its limitation in precise identification, T-RFLP proved to be a useful tool for monitoring thepopulation dynamics in complex bacterial community. Thistechnique could be used to detect changes in bacterialcommunity due to specific treatment, such as introductionof feed supplement or probiotics to improve the growth orsurvival of L. vannamei larvae. T-RFLP had been used tomonitor the effect of Lactobacillus acidophilus NCFMsupplementation in rats (Kaplan et al. 2001) or changes inhuman microbiota after antibiotic treatment and probioticsupplementation (Jernberg et al. 2005). We initiated tostudy on microbial community in the development of L.vannamei larvae employing T-RFLP technique. This studywill provide critical data of bacterial community associatedwith L. vannamei larvae for future work in order toincrease shrimp production and minimize problemsassociated with microorganism in aquaculture.

CONCLUSIONS

Terminal Restriction Fragment Length Polymorphismproved to be a useful tool to reveal the diversity in acomplex bacterial community which might giveinformation about the establishment of this bacterialcommunity in early development of white shrimp larvae.Bacterial community associated with early developmental

stage of white shrimp larvae was very diverse andcontained phylotypes that were evenly distributed. Mostbacteria in the bacterial community were acquired fromvertical transmission via egg.

ACKNOWLEDGEMENT

This research was funded by PT. Charoen PhokphandIndonesia. We thank Yepy Hardy Rustam for bio-informatics analyses.

REFERENCES

Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic identificationand in situ detection of individual microbial cells without cultivation.Microbiol Rev 59: 143-169.

Crawford CS, Minion GP, Boyers MD (1983) Intima morphology,bacterial morphotypes, and effect of annual molt on microflora in thehindgut of the dessert millipede, Orthoporus ornatus (Girard)(Diplopoda: Spirostreptidae). Int J Insect Morphol Embryol 12: 301-312.

Dempsey AC, Kitting CL, Rosson RA (1989) Bacterial variability amongindividual Penaeid shrimp digestive tracts. Crustaceana 56: 267-278.

Egert M, Friedrich MW (2003) Formation of pseudo-TRF, a PCR relatedbias affecting Terminal Restriction Fragment Length Polymorphismanalysis of microbial community structure. Appl Environ Microbiol69: 2555-2562.

Goodwin S (2005) Polyphasic characterization of bacteria isolated fromshrimp larva. J Young Investigator 12: 1-4.

Izvekova GI (2006) Hydrolytic activity of enzyme produced by symbioticmicroflora and its role in digestion process of bream and its intestinalparasites Caryophyllaeus laticeps (Cestoda, Caryophyllidea). BiolBull 33: 287-292.

Jernberg C, Sullivan A, Edlund C, Jansson JK (2005) Monitoring ofantibiotic induced alteration in the human intestinal microflora anddetection of probiotic strains by use of terminal restriction fragmentlength polymorphism. Appl Environ Microbiol 71: 501-506.

Kaplan CW, Astaire JC, Sanders ME, Reddy BS, Kitts CL (2001) 16SRibosomal DNA terminal restriction fragment pattern analysis ofbacterial communities in faeces of rats fed Lactobacillus acidophilusNCFM. Appl Environ Microbiol 67: 1935-1939.

Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ,Dymock D, Wade WG (1998) Design and evaluation of usefulbacterium-specific PCR primers that amplify genes coding forbacterial 16S rRNA. Appl Environ Microbiol 64: 795-799.

Margalef R (1958)) Information theory in ecology. Gen Syst 3: 56-71.Marsh TL (1999) Terminal restriction fragment length polymorphism (T-

RFLP): An emerging method for characterizing diversity amonghomologous population of amplification products. Curr OpinMicrobiol 2: 323-327.

Moss SM, Pruder GD (1995) Characterization of organic particlesassociated with rapid growth in juvenile white shrimp, Penaeusvannamei Boone, reared under intensive culture condition. J ExpMarine Biol 187: 175-191.

Moss SM, LeaMaster BR, Sweeney JN (2000) Relative abundance andspecies composition of gram negative, aerobic bacteria associatedwith the gut of juvenile white shrimp L. vannamei reared inoligotrophic well water and eutrophic pond water. J World AquacultSoc 31: 255-263.

Rappe MS, Giovannoni SJ (2003) The uncultured microbial majority. AnnRev Microbiol 57: 369-394.

Seeto GS, Veivers PC, Clements KD, Slaytor M (1996) Carbohydrateutilization by microbial simbionts in the marine herbivorous fish Odaxcyanomelas and Crinodus lophodon. J Comp Physiol 165: 571-579.

Sugita H, Kawasaki J, Deguchi Y (1995) Production of amylase by theintestinal microflora in cultured freshwater fish. Lett Appl Microbiol24: 105-108

Vandenberghe J, Verdonck L, Robles-Arozarena R, Rivera G, Bolland A,Balladares M, Gomez-Gil B, Calderon J, Sorgeloos P, Swings J (1999)Vibrios associated with Litopenaeus vannamei larvae, postlarvae, brood-stock, and hatchery probionts. Appl Environ Microbiol 65: 2592-2597.


Intervention of Genetic Flow of the Foreign Cattle toward Diversity ofPhenotype Expressions of Local Cattle in the District of Banyuwangi

MOHAMAD AMIN♥Department of Biology, Faculty of Mathematics and Natural Sciences, State University of Malang (UM), Jl. Surabaya 6, Malang 65145, East Java,

Indonesia, Tel. +62-3415-88077, Fax. +62-341-588077, e-mail: [email protected]

Manuscript received: 22 February 2009. Revision accepted: 21 June 2009.

ABSTRACT

The aims of the present research are two folds: to know the phenotypic diversity and to reconstruct the cross-breeding pattern of localcattle in Banyuwangi. Based on three sampling areas, it was found that there were 32 phenotypic cattle (10 in the sub districts ofRogojampi, 16 in Tegaldlimo and 6 in Glagah areas). The phenotypic varieties were caused by two factors, namely the flow of geneticintervention of the other local cattle (Bali, Ongole, and Brahman cattle) and the artificial insemination program using the semen ofLimousine, Simmental, Aberdeen Angus and Santa Gertrudis cattle.

© 2010 Biodiversitas, Journal of Biological Diversity

Key words: flow of genetic intervention, local cattle, phenotypic variation.

INTRODUCTION

One of national assets in husbandry fields in Indonesiais beef cattle which has economic potentials to bedeveloped. The existence of beef cattle can be intensified tocreate job opportunities, to meet national meat production,increase breeders’ income and farmer prosperity, andfinally it is importance source of government’s incomegenerating units. Besides that it will also reduce thedependency on meat import.

In Indonesia, Bos sp. is one kind of cattle which gives asignificant contribution to national meat supplies to fulfillanimal protein needs of peoples. But, the addition of cattlepopulation is not balanced with the national needs (Putu etal. 1997). Table 1 is a list of cattle which gives the biggestcontribution among five kinds of key livestock in meatsupplies at a national scale. Since the economic crisis thathappened in 1997, a significant decrease in the populationof cattle has happened in some areas, so that the cattlepopulation is now believed to be less than before. As aconsequence, the beef cattle potential from year to yearhave decreased significantly. For example, in NusaTenggara, the case is shown at the figure of 15.92%(Sumadi 2002). If this condition is uncontrolled, there is achance that in about 10 years later the existence of beefcattle will be drained. By then, we will have lostgermplasms which are one of the national assets in thehusbandry field.

This problem becomes more serious because, on oneside, there has still been a lack of accurate observations inthe breeding of the local cattle; and on the other side,efforts for production increase are not yet optimum.Negative selections by the breeders and the lack ofobservation in the breeding of local cattle cause the rest of

local cattle to be the cattle with a bad quality, which letalone, commonly will serve as the cattle seed on whichfurther cattle is to be produced. This happens because ofthe practice of conventional husbandry by the local people.If this case happens continuously, it is predicted that oneday local cattle extinction will happen and we will lose thebenefit because of losing germplasms (Hardjosubroto 2000,2002; Mahaputra 2002). Setiadi (1997) states that a‘friendly’ cross-breeding program can threaten the localcattle source which has not been renewed.

Table 1. Fluctuation of big livestock production from 1995-1998(in thousands).

Livestock 1995 1996 1997 1998Cattle 11,534 11,816 11,938 11,663Dairy milk 341 348 335 321Goat 3,136 3,171 3,064 2,829Buffalo 13,167 13,890 14,164 13,560Sheep 7,168 7,724 7,698 7,114(Yudhohusodo 2003)

In the effort to conserve the pure genetic traits and thelocal cattle, the government makes development programs,for example to keep the purity of Bali cattle. Thegovernment has stated four areas that develop pure breedsof Bali cattle, namely Bali, South Sulawesi, West NusaTenggara, and East Nusa Tenggara (Pane 1991;Handiwirawan 2003).

According to statistics in the Banyuwangi district(BAPPEDA Kabupaten Banyuwangi 2007), the potential ofagriculture land in Banyuwangi is in the third rank afterMalang and Jember, so that Banyuwangi becomes one offood rice bran in East Java Province. Besides of thepotential of agriculture fields, Banyuwangi is a place that


has the potential for cattle production. The development ofhusbandry in this region has the same line with the historyof Banyuwangi. This can be seen from the pluralism ofBanyuwangi people. The majority is the Osingese, butthere are Javanese and Madurese who are significantenough and there are minority Balinese and Buginese. TheOsingese is the indigenous inhabitants of Banyuwangi, andthey can be considered as a sub ethnic group of theJavanese. The culture from ethnic groups which arepluralistic is very colorful in the living of cattle breeding.The Osingese as a sub ethnic group of Javanese will defendtheir breeding culture utilizing the local Java cattle. TheBalinese will defend Bali cattle. Two of major ethnicgroups besides the Osingese (Javanese and Madurese), ofcourse will influence in terms of the presence of thehusbandry model in Banyuwangi. Besides, to make thegovernment program in the cattle production developmentsuccessful, in 1990s the Banyuwangi governmentintroduced the artificial insemination (AI) with theexcellence of the cattle from Australia, Switzerland and theNetherlands (Simmental, Limousine, Angus, Brahman andOngole). The AI program which is also a geneticintervention directly will influence the genetic diversity inBanyuwangi cattle breeding practices. As a consequence ofthis, tracing and identification needs to be performed onphenotype diversity of the Banyuwangi cattle as a result ofgenetic intervention from the AI program and culture whichis brought by different ethnic groups who live in this area.

The aims of the research are to examine the phenotypicdiversity and to reconstruct the cross-breeding pattern ofthe local cattle in Banyuwangi and to predict factors thatinfluence these phenotypes.

MATERIAL AND METHODS

This research is a survey which aims to examine thephenotype of the local cattle in Banyuwangi, to study thephenotype expression variation including fur color (head,body and leg), shape of horn growth, ear shape, absence ofgrowth, hump, mouth color (Fries and Ruvinsky 2004).This research was conducted from February to April 2008,in three phases taking out samples including those locatedin sub district areas as Rogojampi, Tegaldlimo, andGlagah. The decision to include these three areas is basedon the central husbandry development for the Banyuwangiarea. Tegaldlimo sub district area serves as a centralartificial insemination with local cattle Java and Balidescent; Rogojampi sub district area is a central artificialinsemination with local cattle Madura cattle, Java and Bali,Ongole hybrid and Brahman. Glagah sub district functionsas a central artificial insemina-tion with local cattlecrossing resulting from Java and Bali cattle. Sampling wasconducted by following the schedule of health services setup by husbandry department for breeder on everyWednesday.

This research is divided into two phases. The first isfield research which is field data collecting in the form ofphenotype data and the second is the data tabulation usingthe observation matrix as shown in Table 2.

Table 2. Sample of field collecting data table.

Sub district area: ..........................................................

Phenotype *)

Samplenumber

Color(head,

body, leg)

Shape/directionof horn growth

Earshape Hump

Mouthcolor

123

......Note: *) this phenotype decision is based on principalcharacteristic cattle in Kabupaten Banyuwangi. Notice: Bodycolor: Bali cattle (brown), Ongole (white), Brahman (white),Simmental (brown), Angus (black), Limousine (brown). Shape ofhorn growth: Bali cattle (no horn/very small horn), Ongole (growlong and make 45o angle with body, Brahman (grow long andmake 45o angle with body, Simmental (grow short), Angus (growshort), Limousine (grow short). Ear shape: Bali cattle (growstraight parallel with horn), Ongole (hanging), Brahman(hanging), Simmental (make 90o angle with body’s axis,Limousine (make angle with body’s axis). Mouth color: Balicattle (black), Ongole (black), Brahman (black), Simmental(white), Angus (black), Limousine (brown).

The results of analyzing the phenotype data provideevidence of the pattern of the crossbreeding of the localcattle sample which was examined. Phenotype datarecording will be analyzed descriptively to decide thecrossing pattern so that the ancestor of sample cattle whichis researched can be traced.


Based on research in three research area sampling werefound 42 cows in Rogojampi area, 48 cows in Tegaldlimoarea and 18 cows in Glagah area. Research finding localcattle phenotype in Rogojampi area from 42 samplesinvestigated, it could be found 11 kinds of phenotype(variation). For cattle from Rogojampi area was given Rinitial, and number series was a kind of number ofphenotype cattle with detail as follow: R1 (Simmental), R2(Java-PO), R3 (Java-Limousine), R4 (Java), R5 (Madura),R6 (Java-Simmental), R7 (Java Limousine Simmental), R8(Limousine), R9 (Brahman Angus Limousine), R10(Simmental) (Figure 1). There were 6 cows from 18 cowsthat were researched in Glagah area (with “G” initial, theordinal number is the number of cow’s phenotype variety)with detail as G1 (Java-Ongole-Bali), G2 (Rambon-Limousine), G3 (Rambon Keling), G4 (Rambon-Java), G5(Rambon-Java (Java horn) and G6 (Bali-Limousine)(Figure 2).

The result of phenotype research in Tegaldlimo areashows there are 17 kinds of phenotype (with “T” initial andthe ordinal number is the number of cows’ phenotypevariety) with the detail as follow: T1 (Simmental), T2(Java-Limousine), T3 (Java-Ongole), T4 (Limousine), T5(Java-PO-Simmental), T6 (Java-PO), T7 (Java-Ongole), T8(Rambon Keling-Ongole), T9 (Rambon Manis-Ongole),T10 (Simmental-Angus), T11 (Simmental-Limousine), T12

AMIN – Genetic diversity of local cattle in Banyuwangi 71

Figure 1. Phenotypic variation of cattle from Rogojampi (R): R1 (Simmental), R2 (Java-PO), R3 (Java-Limousine), R4 (Java), R5(Madura), R6 (Java-Simmental), R7 (Java-Limousine-Simmental), R8 (Limousine), R9 (Brahman-Angus-Limousine), R10 (Simmental)(left to right, above to bottom).

Figure 2. Phenotypic variation of cattle from Glagah (G): G1 (Java-Ongole-Bali), G2 (Rambon-Limousine), G3 (Rambon Keling), G4(Rambon-Java), G5 (Rambon-Java/Java horn) and G6 (Bali-Limousine) (left to right, above to bottom).


Figure 3. Phenotypic variation of cattle from Tegaldlimo (T): T1 (Simmental), T2 (Java-Limousine), T3 (Java-Ongole), T4(Limousine), T5 (Java-PO-Simmental), T6 (Java-PO), T7 (Java-Ongole), T8 (Rambon Keling-Ongole), T9 (Rambon Manis-Ongole),T10 (Simmental-Angus), T11 (Simmental-Limousine), T12 (Simmental), T13 (Limousine-Brahman-Angus), T14 (Ongole-Limousine),T15 (Ongole), T16 (Bali-Limousine) (left to right, above to bottom).

(Simmental), T13 (Limousine-Brahman-Angus), T14(Ongole-Limousine), T15 (Ongole), T16 (Bali-Limousine)(Figure 3). Based on observation, there were 31 phenotypevariations, namely the color of fur (head, body, leg), theshape of the horn growth, the shape of ear, the humps, the

color of mouth. Banyuwangi cattle history background isexplained below (Figure 5).

In the beginning of the Banyuwangi cattle development,many people breeded the local Java and Bali cowsaccording to the people’s social conditions. In the Dutch

AMIN – Genetic diversity of local cattle in Banyuwangi 73

Colonial era, they imported a lot of Ongole and Brahmancows. This gave an opportunity for the three kinds of cowsto mingle and as a result, a new phenotype variant was born(produced). This represents the characteristic of the threekinds of cows, the local Java cow, the Bali cow, Ongolecharacteristics (including PO or Ongole breed) and theBrahman cow.

The crossbreeding of local Java and Bali cow is calledRambon cattle. It can be finding in Osing people’s area(Glagah sub-district). Rambon is the breed of Java andBali; it has phenotype expression of them (Java and Balicattle). Rambon divided into many kinds of variety; theyare Rambon, Rambon Java, Rambon Manis and RambonKeling. Rambon Java (“Java” describes the characteristicof Bali cattle especially the pinkish fur and white leg(Banyuwangi people call it “sock”, it is not characteristic oflocal Java cattle cow. But this cattle shows the Java cattle’shorn that grows same way as the body. Bali cattle show thesame characteristic with local Java cattle. Rambon Manishas brown furs as Bali cattle and it does not have white legs(socks). The other is Rambon Keling. It has brighter furand legs, but it has the same type of horn with local Java

cattle. Based on the characteristic,the appearance of the Rambon isexplained as follow: Rambon Javais a crossbreed of Bali and Ongolecattle. The offspring (F1) is crossedby Bali cattle. Rambon Manis is acrossbreed of Bali and Brahmancattle (no horn) and RambonKeling is a crossbreed of RambonManis and Bali cattle and Kelingcattle (Ongole or PO (Ongolebreed). Rambon is a crossbreedRambon Manis and Bali cattle.

A lot of Rambon cattle breederby Osing people practicedaccording to this cattle quality orability to help the farmer in thefield. This practiced can beunderstood because of the wholelife of Osing people is farmer.Rambon cattle known to has astrong slim leg that help farmer tocultivate plant in the field. Theformed pattern of Rambon cowvarieties is shown in Figure 4.

In the beginning of 70’s, theGovernment of the Republic ofIndonesia introduced a program toincrease cattle quality through anartificial insemination program.The program invited importedsemen from the best quality ofcattle from abroad, namelyLimousine, Simmental andAberdeen cattle. This programenriched the number of phenotypeof the local cattle. The structure ofthe phenotype variation is shown inFigure 2. A study conducted by

MacHugh et al. (1999) studied five extant Nordic and Irishcattle breeds and suggested that the cattle used by theVikings of the early medieval Dublin were similar to themodern cattle population found in the northern Europe. Themedieval population displayed similar levels of mtDNAdiversity to the modern European breeds.

In general, the appearances of the phenotype variationsare seen in the hair of body color. Based on research result,it is shown that there is a variation of the body color (as acolor parameter) signed by 31 kinds of cattle. For Indonesiaas a tropical area, the adaptive color for the cattle to obtainthe fitness is a bright color with a pigmented darker skin.The basis of the coat color and cattle and all mammals isthe presence of melanin in the hair (Searle 1968). Melaninis found in the melanosomes of the cytoplasm of themelanocytes. These melanosomes are transferred to the hairas it grows through a process exocytosis. The melanocytesmigrate from the neural crest during embryonicdevelopment and only areas of the body in which they arefound are pigmented. White spotting occurs in the areawhere the skin or hair lacks melanocytes.

Figure 4. The pattern of Rambon cow varieties.

Figure 5. The general pattern of forming the thirty two cattle variants

Java/Bali cattle Ongole/PO andBrahman

Rambon RambonJava

Rambonmanis

Rambonkeling

Limousine, Simmental, Aberdeen Angus,Santa Getrudis

32 cattles variants

Java/Bali cattle Ongole/PO andBrahman

Rambon RambonJava

Rambonmanis

Rambonkeling


The expression of the observed pigmentation in thecattle is caused by pigmentation that is controlled by genes.The Extension (E) locus is responsible for most of thevariation in the cattle coat color. Three alleles present atthis locus include: ED, dominant black, E+ responsible formost combination of red or reddish brown and black, and e,recessive, red (Olson 2004). Based on the observation thereis the color change from normal which is gene mutationexpression. The normal color is red and darker black(brown black) and the modification in the three basic colorsis brown, black and red. Here genes that control hair colorin the cattle breed reflect on the variety of the cattle that isdiscovered in Banyuwangi.

The extension locus encodes the melanocyte-stimulating hormone receptor (MSHR; also known asMC1R1). This receptor controls the level of tyrosinasewithin melanocytes. Tyrosinase is the limiting enzymeinvolved in synthesis of melanin: high levels of tyrosinaseresult in the production of eumelanin (dark color, e.g.brown or black) while low levels result in the production ofphaeomelanin (light color, e.g. red or yellow). Whenmelanocyte-stimulating hormone binds to its receptor, thelevel of tyrosinase is increased, leading to production ofeumelanin. The wild-type allele at the extension locuscorresponds to a functional MSHR, and hence to darkpigmentation in the presence MSH. The wild-type allele(E+) encodes the normal functional receptor for MSH. TheED allele contains a mis-sense mutation, changing the 99th

amino acid from leucine to proline. The e allele contains asingle base deletion (a frame-shift mutation), which givesrise to a non-functional receptor, and hence to low levels oftyrosinase, resulting in production of phaeomelanin (redcoat color) (Nicholas 2004).

Of the cattle body gen controlling the color of body fursidentified by Olson (2004), the variety of cattle body colorin Banyuwangi is controlled by gene on all the allelesexcept ED. It can be understood because black is rare to befound in all observed population. The rest of black color iscaused by the crossbreeding between the local and theAngus cattle at the beginning of 70’s in which a program toincrease the cattle quality by government through artificialinsemination program was introduced.

Genetic variation that is discussed is a generalcharacteristic in population among individuals. Appearanceof variation is caused by some variables, e.g. migration,mutation, natural selection process and breeding (Drent1995). Breeding has a purpose to enrich the geneticvariation of population. The gene frequency from onegeneration to the next generation is defended. Thecondition without changing gene frequency is calledgenetic balance. It means the number of variety is constant.It seems in big population which has random breeding(Caughiey and Gunn 1996). Individual breed with familymember (relationship population member) in a smallpopulation is called inbreeding. If it happens continuously,an increase in the number of homozygote individual in thatpopulation will take place (Klug and Cummings 2002).Some researches about inbreeding on fish showed thephenotype production decreasing, e.g. growth, immunityand abnormality (Tave 1993; Tamarin 2002).

CONCLUSION

There are 32 kinds of phenotypes in Banyuwangi basedon the color of furs (head, body, and leg), the shape of thehorn growth, shape of ear, the humps and the color ofmouth. The pattern of breeding which causes the phenotypevariation of cattle in Banyuwangi can be stated as follows:there are interactions between Java cattle, Bali cattle,Ongole cattle and Brahman cattle. This result is supportedby an artificial insemination program with Limousine,Simmental, Aberden Angus and Santa Gertrudis cattlesperms. So, the research on genotype is suggested toexplore the genetic variation and it will be useful in theconservation and the genetic tracing of population of cattlein Banyuwangi.

REFERENCES

BAPPEDA Kabupaten Banyuwangi (2007) Kabupaten Banyuwangi dalamAngka. Dinas Infokom Kabupaten Banyuwangi, Banyuwangi.

Caughiey G, Gunn A. (1996) Conservation Biology in Theory andPractice. Blackwell Science, Cambridge, Massachusetts.

Drent A (1995) DNA and Genetic Variation in DNA Fingerprinting PlantPathology: an Introduction. Lincoln University, Lincoln, New Zealand:.

Fries R, Ruvinsky A.(2004) The Genetics of Cattle. CAB International,Cambridge, MA.

Handiwirawan E (2003) Penggunaan Mikrosatellite HEL9 dan INRA035sebagai Penciri Khas Sapi Bali. [Tesis]. Program Pasca Sarjana IPB,Bogor.

Hardjosubroto W (2000) Seleksi sapi bali berdasarkan penampilan dansifat genetik. Seminar Sapi Bali. Denpasar, 25-26 Mei 2000.

Hardjosubroto W (2002) Arah dan sasaran penelitian dan pengem-bangansapi potong di Indonesia: tinjauan dari segi pemuliaan ternak.Workshop Sapi Potong. Malang, 11-12 April 2002.

Klug WS, Cummings MR (2002) Essentials of Genetics. 4th ed. PrenticeHall, New Jersey.

MacHugh DE, Troy CS, McCormick F, Olsaker I, Eythrsdttir E, BradleyDG (1999) Early medieval cattle remains from a Scandinaviansettlement in Dublin: genetic analysis and comparison with extantbreeds. Phil Trans Royal Soc B: Biol Sci 354: 99-109.

Mahaputra L (2002) Arah dan Sasaran Penelitian Reproduksi Sapi Potongdi Indonesia. Workshop Sapi Potong. Malang, 11-12 April 2002.

Nicholas FW (2004) Introduction to Veterinary Genetics. In: Freis R,Ruvinsky A (eds.). Genetic of Cattle. CABI, Wallingford.

Olson TA (2004) Genetics of Colour Variation. In: Freis R, Ruvinsky A(eds.). Genetic of Cattle. CABI, Wallingford.

Pane I (1991) Productivitas dan Breeding Sapi Bali. Proceeding SeminarNasional Sapi Bali. Fakultas Peternakan Universitas Hasanudin,Ujung Pandang, 2-3 September 1991.

Putu LG, Dewyanto P, Sitepu TD (1997) Ketersediaan dan kebutuhanteknologi produksi sapi potong. Proceeding Seminar Nasional danVeteriner. Bogor, 7-8 Januari 1997.

Searle AG (1968) Comparative Genetics of Coat Color in Mammals.Logos Press, London.

Setiadi (1997) Plasma Nutfah pada Domba dan Kambing. Modul danBimbingan Teknis Manajemen Penelitian pada Pengkajian BidangPeternakan. Bo

issn: 1412-033x (printed edition) issn: 2085-4722...

Documents