isolation and identification of lactic acid bacteria from plants and other vegetable matrices and...

1503

AMERICAN RESEARCH THOUGHTS ISSN: 2392 – 876X Available online at: www.researchthoughts.us

http://dx.doi.org/10.6084/m9.figshare.1425170

Volume 1 │ Issue 7 │ May 2015

Impact Factor: 2.0178 (UIF)

ISOLATION AND IDENTIFICATION OF LACTIC

ACID BACTERIA FROM PLANTS AND OTHER

VEGETABLE MATRICES AND MICROBIAL

RECOMBINATION WITH ENTEROCOCCUS SPP.

Immacolata Anacarsoi, Lara Bassoli, Carla Sabia, Ramona Iseppi,

Carla Condò

Dept. Life Sciences, University of Modena and Reggio Emilia, Italy

Abstract: Twenty-two lactic acid bacteria (LAB) belonging to Lactobacillus, Lactococcus and

Enterococcus genera were isolated from plants, flowers and other vegetable matrices. The predominant

LAB species were Lactobacillus brevis (57%) followed to Lactobacillus delbrueckii subsp. bulgaricus

(14%) and Lactococcus lactis (14%). Among enterococci E. faecalis (4 /50%), E. faecium (2 /25%), E.

hirae (2 /12,5%) were isolated. The strains were identified previously with biochemical kits and then

confirmed by PCR. Bacteria isolated were tested against nine strains selected among pathogenic and

opportunistic strains to evaluate their capacity to produce BLS (bacteriocin like substance).

Subsequently to demonstrate the horizontal transfer of genes coding for the production of bacteriocin

substances, a conjugation experiment was positively carried out between an Enterococcus faecium

used as donor and a Lactobacillus acidophilus used as recipient.

Key Words: Lactobacillus, Enterococcus, conjugation, bacteriocin.

INTRODUCTION

The lactic acid bacteria (LAB) are generally defined as a cluster of lactic acid-producing,

low %G + C, non-spore-forming, Gram-positive rods and cocci, catalase negative

bacteria which share many biochemical, physiological, and genetic properties. LAB i Dr. Immacolata Anacarso – Dept. Life Sciences University of Modena and Reggio Emilia

Via Campi, 287 – 41125 - Modena (Italy)

Tel. +39 0592055795, Fax +39 0592055483.

E-mail: [email protected]

http://www.researchthoughts.us/

Immacolata Anacarso, Lara Bassoli, Carla Sabia, Ramona Iseppi, Carla Condò- ISOLATION AND

IDENTIFICATION OF LACTIC ACID BACTERIA FROM PLANTS AND OTHER VEGETABLE MATRICES

AND MICROBIAL RECOMBINATION WITH ENTEROCOCCUS SPP.

1504 AMERICAN RESEARCH THOUGHTS- Volume 1 │ Issue 7 │2015

group include the most important groups of microorganisms like Lactobacillus,

Lactococcus, Enterococcus, usually used in food fermentations. These microorganisms in

fact contribute to the taste and to the texture of fermented products and inhibit the food

spoilage and pathogenic bacteria by producing an array of antimicrobial substances

such as large amounts of lactic acid (and other organic acids), hydrogen peroxide,

antifungal peptides, and bacteriocins (Daeschel, 1989; Dobrogosz and Lindgren, 1990).

Bacteriocins are the best-known antimicrobial compounds isolated from LAB.

These antimicrobial compounds show bactericidal activity against species closely

related to producers (Paker et al., 1989; Cintas et al., 2001) and they can exhibit

heterogeneous characteristics such as resistance to very low pH values, stability at a

very wide range of temperatures, resistance to organic acids, salts and enzymes. Some

studies show the potential use of bacteriocins as food preservatives or additives to

packaging for extend the products shelf life.

The importance of the LAB is because these bacteria have beneficial effects to the

consumers in different ways. Probiotic lactobacilli, for example, are known to confer an

array of health promoting activities on their host after either parenteral or oral

administration (Oyetayo and Osho, 2004). The other beneficial effects of the LAB

include prevention of intestinal infections (Casas and Dobrogosz, 2000),

anticarcinogenic activity (Kumari et al., 2011), control of serum cholesterol, immunity

promotion (Aattouri et al., 2001), and growth enhancement of animals (Chang et al.,

2001). The mechanism by which these probiotics affect their host and bring an

improvement in the gut barrier can be thanks to competition for the adhesion site, the

production of inhibitory compounds, the rebalancing of disturbed gastrointestinal

microbial composition and of the metabolism (FAO/WHO, 2001). Many are the study

about the new isolated LAB capable to produce natural bacteriocin substances, with a

broad spectrum. Many times the best bacteriocins producers belonging to the

Enterococcus genera. Though enterococci are LAB, and are the natural flora of some

fermented foods (cheese, salami etc.) they are however opportunistic bacteria capable to

produce many virulence factors and able to cause important pathologies (Sabia et al.,

2002); for these reasons the use of enterococci or bacteriocins produced from these

bacteria not always is well accepted. Always actual is the research of new bacteriocin

substances product by LAB as Lactobacillus or Lactococcus. Different are the matrices

from which these LAB were isolated, like kefir grains (Leite et al., 2015), fermented





sausages (Golneshin et al., 2015), wine (Ndlovu et al., 2015), olive (Hikmate et al., 2015)

usually starting to a fermented substrates.

In this study we have isolated different bacterial strains from plants, flowers and

other vegetable matrices, showing that also in these sample it was possible to isolate

LAB as Lactobacillus and Lactococcus plus Enterococcus. The strains isolated were

interesting because in large part were good BLS (bacteriocins like substances)

producers. The study here presented has also shown a conjugation experiment between

an Enterococcus donor and a Lactobacillus recipient to obtain a best bacteriocins

producers with an broad antimicrobial activity typically of a Enterococcus but from

Lactobacillus producers.

MATERIAL AND METHODS

Sample analysis

Forty different vegetable matrices derived from houseplants (including cacti, potted

flowers, bushes flowers, climber plants, seeds), leaves and flowers trees, were subjected

to microbiological analysis for the research of LAB.

Samples were weighted and diluted in a 1:10 ratio with physiological solution

and then homogenized by Stomacher for 1 minute. The obtained solutions, after

appropriate dilutions in physiological solution, were plated in Kanamycin Aesculin

Azide agar and MRS agar (Biomerieux, Milan-Italy) and incubated at 30°C in aerobic

and anaerobic conditions respectively for 48-72 h.

Bacterial identifications

For a preliminary recognition of isolated strains, several preliminary tests like Gram

stain, microscopic view and catalase analysis were carried out.

All strains grown on MRS agar that were Gram-positive, catalase negative and

cocco- or rod-shaped were before identified with API 50 CHL (Biomerieux, Milan-Italy)

and lastly identified by PCR. All strains grown on Kanamycin Aesculin Azide agar with

a typical aspect for enterococci were before identified with API 20 Strep (Biomerieux,

Milan-Italy) and lastly identified by PCR. DNA was extracted according to the method

of Marzotto et al., (2006). The PCR reactions were carried out by Techne Termal cycler

TC312 (Bibby Scientific, Italy). The following conditions were used: 2 min at 94°C, 30

cycles of 1 min at 92°C, 1 min at optimum temperature based on primers used, 1 min at





72°C and finally 10 min at 72°C. PCR primers and conditions used are listed in the Table

1. Also, negative controls containing no DNA template were included in the

experiment. All PCR products were electrophoresed in a 1% (w/v) agarose gel with 1 X

Tris/borate/EDTA buffer and viewed under UV light.

Evaluation of BLS (Bacteriocins like Substances) production

BLS production was performed by using the agar-spot-test method (Todorov and Dicks,

2005) on MRS (Man Rogosa Sharp) (Oxoid, Italy) for the LAB, correcting the cell-free

supernatant to pH 6.0 with 1M NaOH to prevent the inhibitory effect of lactic acid, and

on TSA (tryptic soy agar) (Oxoid, Italy) for enterococci. Nine strains were used as

indicators selected among pathogenic and opportunistic strains from registered

collections (ATCC - American Type Culture Collection; NCTC - National Collection of

Type Cultures): Listeria monocytogenes ATCC 13932, Enterococcus casseliflavus 416/K1

(Sabia et al., 2002), Listeria monocytogenes NCTC 10888, Staphylococcus aureus ATCC 6538,

Enterococcus faecalis ATCC 29212, Bacillus subtilis ATCC 6633, Candida albicans ATCC

10231, Escherichia coli ATCC 8739, Pseudomonas aeruginosa ATCC 27853.

Conjugation experiment

This experiment was performed with two of the strains isolated to demonstrate the

horizontal transfer of genes coding for the production of bacteriocins. Twelve different

conjugation experiments to obtain a positive result were done.

A strain of Enterococcus faecium EN313 (KanamycinR, TeicoplaninS), was selected

as donor, because producer of a bacteriocin with high antibacterial activity against

Listeria monocytogenes NCTC 10888, that was used as indicator. A strain of Lactobacillus

acidophilus LB813 (KanamicynS, TeicoplaninR), was selected as recipient, totally

incapable to produce any antibacterial substances vs Listeria monocytogenes NCTC 10888.

Overnight MRS broths of both strains were then combined in a ratio of 1:2 and

maintained under agitation for 48-72 h at 30°C and anaerobic conditions.

Conjugation broths were filtered on cellulose acetate filters with 0.45 µM pores

(Millipore, Italy), which were laid on MRS agar with the selective agents (Kanamycin 64

mg ml-1 and Teicoplanin 32 mg ml-1) and incubated at 30°C for 24h under anaerobic

conditions.

The donor and recipient were subjected to plasmid-DNA extraction by

O’Sullivan-Klaenhammer method (1993), to evaluate the presence of plasmids; the





extracts were electrophoresed in 0.7% (w/v) agarose gel with 1% Tris/borate/EDTA

buffer at 100 mV for 35 min and viewed under UV light.

Isolation of transconjugant

The colonies grown on filter surface were collected, suspended in 1 ml of MRS broth

and then aliquots of 100 µl were plated on MRS agar plates with the addition of both

selective agents (Kanamycin 64 mg ml-1 and Teicoplanin 32 mg ml-1). Plates were

incubated for 48-72 h at 30°C under anaerobic conditions and the bacteria colonies

grown after the incubation were used for a subsequent Gram stain and morphological

viewing under the microscope. Those with a rod-shape (easily distinguishable from the

cocco-shape of the donor strain) were isolated and extracted by O’Sullivan-

Klaehnammer method to evaluate the plasmidic bands. To confirm the belonging of

trasconjugats at the Lactobacillus specie, PCR with L. acidophilus primers listed in the

Table 1 was performed. Lastly, to exclude the contamination by E. faecium a PCR for the

research of a specie-specific ligase ddl E. faecium was performed (Dutka-Malen and al.,

1995). Transconjugant strains were tested by agar-spot-test method; previously

indicated, using L. monocytogenes NCTC 10888 as indicator, for evaluate the presence of

antimicrobial activity against the indicator.

RESULTS

Bacterial identification

Only from 6 vegetable matrices (Pteridium aquilinum leaves, Linum usitatissimum seeds,

Daucus carota root, Ficus benjamin leaves, Aloe Barbadensis leaves, Prunus cerasifera

flowers), of the 40 tested it was possible to isolate 14 different LAB including

Lactobacillus and Lactococcus and 8 different enterococci. The strains identification was

made in first time using API kits and lastly by PCR analysis, confirming the biochemical

results. For the LAB strains, 8 (57%) Lactobacillus brevis, 2 (14%) Lactobacillus delbrueckii

subsp. bulgaricus, 2 (14%) Lactococcus lactis, 1 (7%) Lactobacillus acidophilus and 1 (7%)

Leuconostoc were recovered. For the strains grown with the typical enterococci aspect,

on Kanamycin Aesculin Azide agar, 4 (50%) E. faecalis, 2 (25%) E. faecium, 2 (12,5%) E.

hirae were identified.

In Table 2 are listed the bacterial identifications and vegetable matrices from

which they derived.





Evaluation of BLS (Bacteriocin like Substance) production

The strains were tested for BLS production by agar spot method earlier indicated, using

9 different indicators. Most of the LAB strains showed an antibacterial activity against

L. monocytogenes NCTC 10888, and 3 strains in particular (L. lactis LC214, L. brevis

LB1013, L. brevis LB1113 demonstrated a broad antimicrobial activity against the

majority of the indicator strains. Regarding the enterococci only one not showed

antimicrobial activity vs L. monocytogenes NCTC 10888 and 2 in particular EN313,

EN317 showed a broad antimicrobial activity (Table 3).

Conjugation experiment

Out of 12 matings performed, the successful transfer was obtained in one conjugation,

subsequently confirmed, between Enterococcus faecium EN313 (KanamycinR,

TeicoplaninS), used as donor and Lactobacillus acidophilus LB813 (KanamicynS,

TeicoplaninR), used as recipient. The plasmid-DNA analysis of parental strains showed

a high weight molecular plasmid for E. faecium EN313 and none plasmid line for

Lactobacillus acidophilus LB813 (data not shown).

Isolation of transconjugants

Transconjugant strains with the following characteristics: rod-shaped, KanamicinR and

TeicoplaninR with a high antimicrobial activity against L. monocytogenes NCTC 10888,

were isolated. The plasmid-DNA analysis of the trasconjugants showed the passage of

plasmid from donor to recipient. The PCR results confirmed the belonging of

transconjugant strains to the L. acidophlilus species. None amplifications was performed

with specie-specific ligase ddl E. faecium, excluding the enterococci cells presence as

contamination and confirming definitively that the conjugation experiment was

successfully performed.

DISCUSSION

Lactobacilli and other bacteria close related have high potentialities. Many could be

their applications in food as well as in medical fields, remembering that the

effectiveness of LAB is strain-dependent. For all these reasons, new strains are always

researched with characteristics that can help the human health, searching the new

desirable strains in natural niches as plants, foods, fermented products, animals and





humans that constitute natural ecological systems and good sources for LAB. The

beneficial characteristics may be also obtained by genetic manipulation for example to

improve the pH resistance or the antibacterial capacity, tied to capacity to inhibit the

pathogens, in particular in the human gut, that is a typical characteristic recognized for

many LAB. In this study were isolated some LAB, including bacteria belonging to

Lactobacillus, Lactococcus and Enterococcus genera, from different plants or other

vegetable matrices. In particular from 40 vegetable matrices only from 6 of these

(Pteridium aquilinum leaves, Linum usitatissimum seeds, Daucus carota root, Ficus benjamin

leaves, Aloe Barbadensis leaves, Prunus cerasifera flowers), it was possible to isolate 14

different LAB including Lactobacillus and Lactococcus and 8 different enterococci.

Plants may be a good source of LAB but as Stirling and Whittenburg (1963)

suggest, the LAB are not usually part of the normal microflora of the growing plant

indicating the role of insects in the spread of these organisms. Other studies reported

the occurrence of LAB on leaving or decayed plants (Mundt and Hammer, 1968; Mundt

et al., 1969) but not so recent, as well as part of the accumulated information about the

occurrence of lactobacilli (and other LAB members) on plants is derived from

microbiological studies of the fermentation process. The microbial population of LAB is

known in several vegetable products (cabbage, silage raw materials, carrots and beets,

olives and fruits such as grapes and pears, etc.). However, scarce information about the

occurrence of LAB on flowers and other parts of plants is available in the literature.

Moreover, LAB are well known for their antagonism towards other Gram-positive

bacteria, especially taxonomically related species (Listeria spp., Bacillus spp. Micrococcus

spp., etc.), but also against Escherichia coli, Salmonella spp., Helicobacter pylori and

Pseudomonas aeruginosa. It is well known that the presence of lactobacilli is important for

maintenance of the intestinal microbial ecosystem, thanks the inhibitory activity against

pathogenic bacteria. This inhibition could be due to the production of inhibitory

compounds such as organic acids, hydrogen peroxide, and bacteriocins (Todorov and

Dicks, 2005; Kumari et al., 2011; Anacarso et al., 2014).

The results reported here indicate that 20 LAB were isolated and most of these

strains have shown an antibacterial activity against L. monocytogenes NCTC 10888 and

other eight pathogenic/opportunistic bacteria, including the Gram-negative indicator

strains. Inhibition caused by hydrogen peroxide and organic acids was ruled out, in fact

the producer strains were cultured anaerobically and the culture supernatants were

neutralized (pH 6.0) before assaying the antimicrobial activity. These results are in





accordance with earlier results reported by Trias et al. (2008), who showed that most

LAB originating from fruits and other vegetables displayed good antagonistic activity

against foodborne pathogens, such as, Listeria monocytogenes, Salmonella typhimurium

and Escherichia coli.

In this study was also performed a conjugation to pass the antimicrobial activity

showed against L. monocytogenes from a donor strain, Enterococcus faecium EN313 and a

recipient, Lactobacillus acidophilus LB813. Enterococcus spp. is the most controversial

genus of LAB group and if these bacteria are frequently isolated from several fermented

foods, they are always seen with fear owing to their potential risk in human health

(Klein et al., 1998). In many studies, different enterococci are great bacteriocin

producers with a high activity against pathogenic bacteria as Listeria or others. In our

conjugation experiment it was formed a strain with a high antibacterial activity against

L. monocytogenes typical of a Enterococcus strain but produced from a L. acidophilus,

eliminating the apprehension dated to potential risk for human health of the

enterococci. The positive result of this experiment was displayed by a plasmidic band in

trasconjugant and confirmed with a PCR reaction where the absence of a specie-specific

ligase ddl E. faecium it excluded the enterococci cells presence as contamination. Our

results are of interest considering the important probiotic characteristics of lactobacilli

and their possible use, in particular during antimicrobial therapy and more interesting

is the possibility of to have a probiotic capable to produce a bacteriocin with a high

antimicrobial activity against the main food pathogenic bacteria.

Table 1: Primer sequences used for the identifications

Specie

product

size

(pb)

oligonucleotide

primer sequence ( 5’-3’) Tm (°C)

Leuconostoc 976 LeuF / LeuR

CGA AAG GTG CTT GCA CCT TTC

AAG

TTT GTC TCC GAA GAG AAC A

55

L. brevis 1340 BREVDIR /

BREVREV

CTT GCA CTG ATT TTA ACA

CCC ACT GCT GGG CGG TGT GTA

CAA GGC

40

L. delbrueckii 450 LDEL7 / Lac2 ACA GAT GGA TGG AGA GCA GA

CCT CTT CGC TCG CCG CTA CT 50





L. acidophilus 1000 Acido / Lac

TGA ACC AAC AGA TTC ACT TC

TGA CGA CAG CCA TGC ACC A

45

L. lactis 380 G1 / L1

GAA GTC GTA ACA AGG

CAA GGC ATC CAC CGT

40

E. faecium 941 E1 / E2

ATCAAGTACAGTTAGTCT

ACGATTCAAAGCTAACTG

45

E. faecium 190 Efm1 / Efm2

TKCAGCAATTGAGAAATAC

CTTCTTTTATTTCTCCTGTA

50

E. faecalis 209 Efs1 / Efs2

CTGTAGAAGACCTAATTTCA

CAGCTGTTTTGAAAGCAG

50

E. hirae 263 Eh1 / Eh2

AAACAATCGAAGAACTACTT

TAAATTCTTCCTTAAATGTTG

50

Table 2: Bacterial Identifications and vegetable matrices of origins

Matrix Strain identification

LAB enterococci

Pteridium aquilinum LB113 - L. brevis EN313 - E. faecium

Linum usitatissimum

LB213 - L. delbrueckii

LB313 - L. brevis

LB413 - L. brevis

Daucus carota

LC114 - L. lactis

LC214 - L. lactis

LC314 - Leuconostoc

EN315 - E. faecium

EN316 - E. hirae

Ficus benjamin LB513 - L. brevis

EN314 - E. faecalis

EN319 - E. faecalis

EN320 - E. hirae

Aloe Barbadensis LB613 - L. brevis

LB713 - L. brevis





LB813 - L. acidophilus

Prunus cerasifera

LB913 - L. delbrueckii

LB1013 - L. brevis

LB1113 - L. brevis

EN317 - E. faecalis

EN318 - E. faecalis

Table 3: Antibacterial activity of isolated LAB

Indicators

L. i. E. c. 1 C. a E. c. 2 S. a. E. f. L. m. P. a. B. s.

LB113 ++ - - - - - - - -

LB213 ++ - - - - - +++ - -

LB313 ++ - - - - - +++ - -

LB413 + - - - - + - - -

LB513 + - - - - - - - +

LB613 + - - - - - - - +

LB713 + - - - - - + - -

LB813 - - - - - - - - -

LB913 + - - - - - - - +

LB1013 +++ + - + + + +++ + +

LB1113 + + - + + + ++ + -

LC114 ++ - - - - - +++ - -

LC214 ++ + - + ++ + ++ + +

LC314 ++ - - - - - ++ - -

EN313 ++ - - + + - ++ - +

EN314 + - - - - - + - -

EN315 + - - - - - - + -

EN316 + - - - - - + - -

EN317 +++ - - + + - +++ - ++

EN318 + - - - - - + - -

EN319 ++ - - - - - + - +

EN320 + - - - - - + - -

L .i.: L. ivanovii ATCC 13932; E. c. 1: E. casseliflavus 416/k1; C. a.: C. albicans ATCC 10231;

E. c. 2: E. coli ATCC 6538; E. f.: E. faecalis ATCC 29212; L. m.: L. monocytogenes NCTC 10888;

P. a.: P. aeruginosa ATCC 27853; B. s.: B.subtilis ATCC 6633





REFERENCES

1. Aattouri N.M., Bouras D., Tome A., Marcos Lemonnier D. (2001). Oral ingestion

of lactic acid bacteria by rats increases lymphocyte proliferation and interferon

production. Br J Nutr 87: 367-373.

2. Anacarso I., Messi P., Condò C., Iseppi R., Bondi M., Sabia C., de Niederhäusern

S. (2014). A bacteriocin-like substance produced from Lactobacillus pentosus 39 is a

natural antagonist for the control of Aeromonas hydrophila and Listeria

monocytogenes in fresh salmon fillets LWT - Food Science and Technology 55: 604-611.

3. Casas I.A., Dobrogosz W.J. (2000). Validation of the probiotic concept:

Lactobacillus reuteri confers broad spectrum protection against disease in humans and

animals. Microbial Ecol Health Dis 12: 247-285.

4. Chang Y.H., Kim J.K., Kim H.J., Kim W.Y., Kim Y.B., Park Y.H. (2001). Selection

of potential probiotic Lactobacillus strain and subsequent in vivo studies. Antonie van

Leeuwenhoek 80: 193-199.

5. Cintas L.M., Casaus M.P., Herranz C., Nes I.F., Hernández P.E. (2001). Review:

Bacteriocins of Lactic Acid Bacteria. Food Science and Technology International 7: 281-

305.

6. Daeschel M.A. (1989). Antimicrobial substances from lactic acid bacteria for use

as food preservatives. Food Technol 43: 164-169.

7. Dobrogosz W.J., and Lindgren S.W. (1990). Antagonistic activities of lactic acid

bacteria in food and feed fermentations. FEMS Microbiol Rev 87: 149-164.

8. Dutka-Malen S., Evers S., Courvalin P. (1995). Detection of glycopeptide

resistance genotypes and identification to the species level of clinically relevant

enterococci by PCR. J Clin Microbiol 33: 24–27.

9. FAO/WHO (2001). Report of a joint FAO/WHO expert consultation on evaluation

of health and nutritional properties of probiotics in food including powder milk with

live lactic acid bacteria (LAB).

10. Golneshin A., Adetutu E., Ball A.S., May B.K., Van T.T., Smith A.T. (2015).

Complete genome sequence of Lactobacillus plantarum strain B21, a bacteriocin-

producing strain isolated from vietnamese fermented sausage Nem Chua. Genome

Announc 2;3.

11. Hikmate Abriouel, Nabil Benomar, Antonio Cobo, Natacha Caballero, Miguel

Ángel Fernández Fuentes, Rubén Pérez-Pulido, Antonio Gálvez (2012). Characterization





of lactic acid bacteria from naturally-fermented Manzanilla Aloreña green table olives.

Food Microbiology 32: 308-316-

12. Klein G., Pack A., Reuter G. (1998). Antibiotic resistance patterns of enterococci

and occurrence of vancomycin resistant enterococci in raw minced beef and pork in

Germany. Appl Environ Microbiol 64: 1825–1830.

13. Kumari A., Catanzaro R., Marotta F. (2011). Clinical importance of lactic acid

bacteria: a short review. Acta Biomed 82: 177-180.

14. Leite A.M., Miguel M.A., Peixoto R.S., Ruas-Madiedo P., Paschoalin V.M., Mayo

B., Delgado S. (2015). Probiotic potential of selected lactic acid bacteria strains isolated

from Brazilian kefir grains. J Dairy Sci (in press).

15. Marzotto M., Maffeis C., Paternoster T., Ferrario R., Rizzotti L., Pellegrino M.,

Dellaglio F., Torriani S. (2006). Lactobacillus paracasei A survives gastrointestinal

passage and affects the fecal microbiota of healthy infants. Res Microbiol 157: 857–866.

16. Mundt J.O., Beatrie W.G., Wieland F.R. (1969). Pediococci residing on plants. J

Bacteriol 98: 938–942.

17. Mundt J.O., Hammer J.L. (1968). Lactobacilli on plants. Appl Microbiol 16: 1326–

1330.

18. Ndlovu B., Schoeman H., Franz C.M., du Toit M. (2015). Screening, identification

and characterization of bacteriocins produced by wine-isolated LAB strains. J Appl

Microbiol 118: 1007-1022.

19. O’ Sullivan D.J. and Klaenhammer, T.R. (1993). Rapid miniprep isolation of high-

quality plasmid DNA from Lactococcus and Lactobacillus spp. Appl Environ Microbiol

59: 2730–2733.

20. Oyetayo V.O., Osho B. (2004). Assessment of probiotic properties of a strain of

Lactobacillus plantarum isolated from fermenting corn slurry. J Food Agric Environ 2:

132-134.

21. Paker M.W., Pattus F., Tucker A.D., Tsernoglou D. (1989). Structure of the

membrane forming fragment of the colicin A. Nature 37: 93-96.

22. Sabia C., Manicardi G., Messi P., de Niederhäusern S., Bondi M. (2002). Enterocin

416K1, an antilisterial bacteriocin produced by Enterococcus casseliflavus IM 416K1

isolated from Italian sausages. Int J Food Microbiol 75: 163-70.

23. Stirling A.C., Whittenburg R. (1963). Sources of the lactic acid bacteria occurring

in silage. J Appl Bacteriol 26: 86–90.





24. Todorov S.D., Dicks L.M.T. (2005). Lactobacillus plantarum isolated from

molasses produces bacteriocins active against Gram-negative bacteria. Enzyme Microb

Technol 36: 318–326.

25. Trias R., Bañeras L., Badosa E., Montesinos E. (2008). Lactic acid bacteria from

fresh fruit and vegetables as biocontrol agents of phytopathogenic bacteria and fungi.

Int Microbiol 11: 231–236.

isolation and identification of lactic acid bacteria from plants and other vegetable matrices and...

Education

lactic acid bacteria

bacteria isolated

pathogenic bacteria

cluster of lactic acid

enterococcus faecium

large amounts of lactic

lactobacillus brevis

enterococcus genera