isolation and characterization of novel thermophilic...

Isolation and characterization of novel thermophilic bacterium

Page 31

3.1. Introduction

Microbial diversity has been traditionally studied by the assessment of occurrence

in particular species by different phenotypic and genotypic methods (Curtis and Sloan,

2004, Farber, 1996; Dahllof, 2002). The term polyphasic taxonomy was suggested in the

1970, aiming at the integration of different kinds of consensual data and information on

microorganisms (phenotype, genotype, phylogeny), and eventually at the determination

of typical patterns specific to the isolates (Vandamme et al., 1997). Various phenotypic

and genotypic information that are generally used as polyphasic taxonomical tools were

described below.

3.1.1. Sources and types of thermophilic bacteria

Thermophilic bacteria were more widespread and represented by various species.

Although, great variety of sources from which they have been isolated from all types of

terrestrial and marine hot environments, including natural and synthetic environments

(Stetter, 2006; Ovreas, 2000). Those includes, continental solfataras, deep geothermally

heated oil containing stratifications, shallow marine, deep sea hot sediments and

hydrothermal vents located as far as 4,000 m below sea level (Vieille and Zeikus, 2001).

The sporadically heated environments such as those generated by solar energy or the

decomposition of organic occasionally permit the growth of thermophiles (Cava et al.,

2009) Thermophiles and hyperthermophiles have also been isolated from hot industrial

environments. However, a great variety of bacteria has been isolated from hot springs.

These include, mats of cyanobacteria and other photosynthetic bacteria (purple and, green

bacteria), Thermus, thermotogales, Aquificals were commonly found in Hot springs

environments. Certain enterobacteria such as Bacillus, Clostridium and thionic bacteria

(Thiobacillus) were also inhibiting hot springs (Stetter, 2006; Curtis and Sloan, 2004).


Page 32

3.1.2. Characterization of thermophilic bacteria

The Bergey’s Manual of Systematic Bacteriology was a major taxonomic

compilation of prokaryotes gives information in all recognized species of prokaryotes and

contains number of keys to evaluate the properties given (Madigan et al., 1997). In

identifying bacteria, certain general characteristics have primary importance for

determining the major groups to which the new isolate was likely to belong.

Characteristics, which were important and widely used, include morphology (rod, coccus,

helical or other), Gram reaction and nutritional classification (phototrophy,

chemoorganotrophy, chemolithotrophy). The products of fermentation, temperature and

pH requirements, antibiotic sensitivity, pathogenicity, immunological characteristics were

also important (Smibert and Krieg, 1994; Madigan et al., 1997). Since phenotypic

markers may not be stably expressed under certain environmental or culture conditions.

The phenotypic methods alone cannot be satisfactory and reliable for the differentiation

of microorganisms (Farber, 1996).

The molecular characterization methods involve DNA based analysis of

chromosomal and extra chromosomal genetic material (Farber, 1996). The comparison of

ribosomal RNA sequences, established a molecular sequence-based phylogenetic tree that

would be used to relate all organisms and reconstruct the history of Life (Woese and Fox,

1997; Woese et al., 1990). Because of the likely antiquity of the protein synthesizing

process, ribosomal RNA turned out to be an excellent evolutionary chronometer.

Ribosomal RNA was an ancient molecule, functionally constant, universally distributed

and moderately well conserved across broad phylogenetic distances (Madigan et al.,

1997). Moreover, there was no evidence of lateral gene transfer of rRNA genes between


3

different species and therefore rRNA genes can bring true information regarding

evolutionary relationships (Pace, 1997).

Several other genotypic methods such as; denaturing gradient gel electrophoresis

(DGGE) (Muyzer, 1999) and The amplified rDNA restriction analysis (ARDRA)

(Ovreas, 2000)

were given less interests due to the latest development in high throughout

clone libraries management systems as well as sequencing techniques, which made

possible to process more detailed access in a relatively short period (Abd-El-Haleem,

2002).

3.2. Materials and Methods

3.2.1. Chemicals

All the chemicals used for the experiments were of analytical grade. For the

preparation of culture media, the chemicals used were such as Bacto peptone, Beef

extract, Tryptone, Starch, Yeast extract and Agar were purchased from Himedia chemical

laboratory (Mumbai, India). Other inorganic salts such as, Sodium chloride, Manganese

sulphate, Ferrous sulphate, Magnesium chlorides were purchased from Merck Chemicals

Ltd (Mumbai, India) and Himedia chemical laboratory (Mumbai, India). Simple sugars

such as, Cellobiose, D-Xylose, D-Galactose, Glycerol, Inositol, and D-Lactose were

purchased from Fluka (Switzerland) and Merck Chemicals (Mumbai, India).The

oligonucleotide primer for PCR amplification was purchased from Sigma Chemical

Company (St. Louis, Mo. USA).

3.2.2. Thermostable strain isolation from hot water sample

The dilution plate method was used for isolation of thermophilic bacterial strain

(Holt et al., 1994). Approximately 10 ml of hot water sample was diluted in 90 ml of 0.9


Page 34

% saline water in a sterile culture flask. Asceptically transfer one milliliter of previously

treated sample in to serially diluted (up to 10-9

) using sterile culture tubes containing

0.9% saline water. For enumeration of thermophilic isolates, serially diluted samples

were plated on appropriate solid media (PBTA) containing Peptone (0.2%), Beef extract

(0.5%), Tryptone (0.1%), NaCl (0.04%) and Agar (2%). The pH of the medium was

adjusted to 8.0 previously using 1N HCL. The plates were covered with radiation

resistive laboratory barrier film (Parafilm M) (PPP Company, Menasha, WI) to prevent

drying of agar at elevated temperature and the plates were incubated for 24h at 60°C.

After 24 hr of incubation, isolated colonies on the plates were picked and they were

purified using streak plate method (Holt et al., 1994).

3.2.3. Preservation of the isolates

The isolates were stored in isolation broth (PBT medium without agar) containing

20% glycerol. Cultures were grown overnight and 0.5 ml of each culture were transferred

into cryo tubes. About 0.5 ml broth, containing 40% glycerol was added in to the cryo

tubes. Then tubes were mixed gently and were stored at -80°C.

3.2.4. Screening of isolates for enzyme production

The amylase and lipase production of the isolates was determined by enrichment

culture methods.

Glycerol preserved isolates were sub cultured in SYPB media containing starch

(2%), yeast extract (1%), peptone (0.1%), beef extract (0.1%), MgSO4 (0.05%), CaCl2

(0.04%) and agar (2%). The pH of the medium was adjusted to 7.0 and incubated at 60°C

for 24 hours. A clear zone around the colonies after flooding with 1% iodine solution

indicates the amylase activity of the isolate. For screening of lipase producer, each


Page 35

isolates were screened by qualitative plate assay in Tributyrin agar base [neutral

Trybutyrin (10%), peptone (5.0%), yeast extract (3%), agar (12%); pH 7.5 ± 0.2]. Filtered

sterilized neutral Trybutyrin was added when the medium was at about 80°C. A zone of

clearance was observed due to hydrolysis of Trybutyrin when incubated the plates at

60°C for two days. Among the bacteria showing high amylase and lipase activity, the

“Isolate 5” (Iso 5) was selected for the enzyme production.

3.2.5. Morphology and Gram Reaction

A loop full of the overnight culture of the isolate (Iso5) was spread onto the

microscope slides until a thin film formed. After drying, they were fixed by passing the

slide through flame for one to three seconds. The heat fixed smear was first stained with

crystal violet for one min. After rinsing under the tap water, the slides were transferred

into iodine solution and was kept for one min. Then the slides were washed in 95%

alcohol for six seconds and stained with safranin for thirty seconds. The stained slides

were dried on paper towels and the cells were examined under light microscope. Gram

(+) cells assumed purple color while Gram (-) cells appeared pink or red (Sneath, 1994;

Claus and Berkeley, 1986; Ananthanarayan and Paniker, 2006).

3.2.6. Motility test

To determine motility, strains were grown on slopes of PBTA media and after 6 h.

A loop full of liquid at the base of the slope was examined at 1000 X magnification by

phase contrast microscopy (Sneath, 1994; Ananthanarayan and Paniker, 2006)

3.2.7. Endospores

Isolate (Iso 5) was grown on sporulation media [Nutrient broth containing (g/l);

Yeast extract (5%); Agar (15%); CaCl2 (0.04%); MgCl2 (0.05%); MnCl2 (0.01%)] for two


Page 36

days. The cells were suspended in 3-5 µl of sterile distilled water on a glass slide and

covered with another slide. Endospores were observed under the phase contrast

microscope. For the determination of cell and spore diameters, a micrometric slide and

micrometric ocular disc were used. First, diameter (mm or µm) of one space of ocular

disc according to the objective and ocular had to be calculated. For this reason, the

beginning points of micrometric slide and ocular disc were overlapped for each objective

was recorded. The diameter of the cell and spore was determined in terms of spaces on

ocular disc (Sneath, 1994; Ananthanarayan and Paniker, 2006).

3.2.8. Optimum growth temperature

The optimum growth range of the isolate was determined on the PBTA medium

containing 1% starch and then incubating at temperature range 40 to 90°C (Logan and

Berkeley, 1984; Claus and Berkeley, 1986)

3.2.9. Growth at different NaCl concentration

The ability of the isolate to grow in 1% to 10% NaCl was tested in T1N1 liquid

media (1% Bacto tryptone containing the appropriate amount of NaCl) and allowed grow

for 1-3 days at optimum temperature (Claus and Berkeley, 1986)

3.2.10. Growth at different pH range

The ability of the isolate to grow at pH 7 to pH 10 was tested in PBTA medium.

pH was adjusted with sodium carbonate (separately autoclaved). Isolate was grown on

media for 1-3 days at optimum temperature (Claus and Berkeley, 1986).

3.2.11. Production of acids

Hugh and Leifson medium was used to determined production of acids without

gas anaerobically from isolate. The Hugh and Leifson medium composed of Peptone


Page 37

(2%), NaCl (5%), and KH2PO4 0.3%. The sugars (1%) such as; D(+)-Cellobiose, D(+)-

Galactose, D(+)-Glycerol, D(+)- Inositol, D(+)-Lactose, D(+)-xylose was added after

autoclaving (Sneath, 1994; Hugh and Leifson, 1953).

3.2.12. Hydrolytic properties and proteolytic activity

Hydrolytic property of the isolate was tested by agar medium containing 2%

starch. Observing presence or absence of clearing around the colony after spreading with

the 1% iodine solution. Proteolytic activity of the isolate was determined by the medium

containing 2% gelatin and 2% casein (Ananthanarayan and Paniker, 2006).

3.2.13. IMViC tests (Indol; methyl red; Voges-Proskauer; Citrate)

Voges-Proskauer

A single inoculated tube of VP broth (1:1 glucose and peptone) was conducted to

Voges-Proskauer (VP) test for the isolate. The plate was incubated for 24-48 hours at

optimum temperature. Positive VP test was determined by appearance of pink-burgundy

on the broth (Ananthanarayan and Paniker, 2006).

Citrate test

The isolate was grown in Simmon's citrate media to determine if isolate can grow

utilizing citrate as its sole carbon and energy source. Simmon's media contains

Bromothymol blue, a pH indicator with a range of 6.0 to 7.6. Growth of isolate in the

media leads to development of a Prussian blue color (positive citrate) after incubation at

60°C for 2 to 3 days (Ananthanarayan and Paniker, 2006).

Acetate test

The isolate was inoculated in the Acetate differential agar containing; Sodium

Acetate (2%); Magnesium Sulfate (0.2%);Sodium Chloride (5%); Monoammonium


Page 38

Phosphate (1%); Dipotassium Phosphate(1%); Bromothymol Blue (0.08%); Agar (15%).

After incubation at 60°C for 5-7 days, isolate capable of utilizing acetate as the sole

carbon source will grow on the medium and produce an alkaline reaction (blue color)

(Ananthanarayan and Paniker, 2006).

3.2.14. Fatty Acid Methyl Ester (FAME) analysis

The 48 h cultures of either strain, grown in trypticase soy broth at 55ºC, were

used. Fatty acids were extracted, methylated with methanolic HCl and analyzed by gas

chromatography. The FAME analysis was performed by Sherlock microbial

identification system (MIDI Inc, USA) using Bacillus thermocatenulatus as standard

(Raja et al., 2007).

3.2.15. Preparation of Genomic DNA

The CTAB/NaCl method with some minor modifications of Ausubel et al., 1994

was used for preparation of genomic DNA. Twenty-four hour cultures grown on solid

media was suspended in 1.5 ml sterile water. Cells were pelleted by centrifugation for 5

min at 5000 rpm. Pelleted cells were resuspended in 567 µl 1X TE buffer. 30 µl 10%

SDS and 3 µl proteinase K solution (20 mg/ml) were added and the solution was mixed

thoroughly. The sample was incubated for 1 h at 37⁰C. After the incubation, 100 µl 5 M

NaCl was added and mixed thoroughly. After this step 80 µl CTAB/NaCl solution (10%

cetyltrimethylammonium bromide, 0.7 M NaCl ) were added, mixed thoroughly and the

samples were then incubated for 10 min at 65⁰C. Chloroform extraction was performed

twice. DNA prep was obtained by the addition of isopropanol (0.6 volumes) and was then

washed in 500 µl ethanol (70%). DNA was pelleted, dried and dissolved in 100 µl TE

using vertex heat shocks (10 min at 80oC, 20 min at -20

oC and 10 min at 80

oC). The


Page 39

DNA solution was preserved at -20oC and used as template for PCR amplification

(Ausubel et al., 1994).

3.2.16. G+C content

The DNA was isolated and G+C content of the isolate was determined using RP-

HPLC as described in the previous methods (Cashion et al., 1977; Yoon et al., 1996;

Tamaoka and Komagata, 1984).

3.2.17. Preparation of oligonucleotide Primers

GbR5 -5`-ACGGCTACCTTGTTACGACTT-3`.

350 µg primer GbR5 was dissolved in 175 µl of sterile deionized water to obtain

2 µg/µl stock solutions. 4 µl of stock solution were then taken and mixed with 96 µl

sterile deionized water. Therefore, 100 µl, 10 picomole/µl working solution was

obtained. Stock and working solutions were stored at -20°C.

GbF5- 5`-AGAGTTTGATCCTGGCTCGA-3`

590 µg primer EGE 1 was dissolved in 295 µl of sterile deionized water to obtain

2 µg/µl stock solutions. 5 µl of stock solution were then taken and mixed with 95 µl

sterile deionized water. Therefore, 100 µl, 10 picomole/µl working solution were

obtained. Stock and working solutions were stored at -20°C.

3.2.18. Amplification of 16s rRNA gene

Polymerase chain reaction (PCR) was performed with the final volume of 50 µl

containing approximately 10-12 ng of DNA template, 0.2 mM dNTPs, 1.5 mM MgCl2,

25 mM of each primers, 1X PCR buffer, and 2.5 u Taq DNA polymerase.

Two universal bacterial specific primers; GbR5 (Reverse):

5`ACGGCTACCTTGTTACGACTT-3 and GbF5 (forward):

5`AGAGTTTGATCCTGGCTCGA 3 were used to amplify in a Biometra T personal


Page 40

thermocycler (Biometra GmbH, Goettingen, Germany). The initial denaturation at 95ºC

for 120 s, followed by 20 cycles of denaturation at 95ºC for 60 s, primer annealing at 45

ºC

for 45 s, elongation at 72ºC for 90 s with a final extension at 72

ºC for 600 s. PCR products

were run on 2% agarose gels containing ethidium bromide. The amplified 1.5 kb product

was purified by QIAquick gel extraction kit (Qiagen, Germany) and directly sequenced

on ABI Prism 3100 (Applied BioSystem, Sigma, Mumbai) automated sequencer using

three forward and three reverse sequencing primers as recommended by manufacturer

(Marchant et al., 2002b; Goto et al., 2000).

3.2.19. Phylogenetic analysis

The nucleotide sequences of the 16S rRNA genes from thermophilic isolate were

aligned manually against representatives of the genus Bacillus and related taxa available

from the latest versions of ClustalX (Thompson et al., 1997) and GenBank databases. A

phylogenetic tree was constructed by the neighbor-joining method (Saitou & Nei, 1987)

with the bootstrap analysis of 100 trees by the MEGA 3.1 software (Kumar et al., 2004).

3.2.20. GenBank deposition

The 16S rRNA aligned gene sequence from thermophilic isolate was deposited

electronically with the assignment of accession number GQ140232

3.3. Results

The microbial analysis of geothermal water samples from Bendruthirtha (Irde)

spring was revealed the presence of five thermophilic, aerobic strains (Iso1 to Iso5).

Based on the strains capable of producing desired enzyme at high temperature, strain 5

(Iso5) was selected for further work


Page 41

3.3.1. Colony and cell morphology

On the surface of nutrient agar, isolate was found to be small, colorless rod

shaped Bacillus cells. The diameter of the cell was about approximately 1.3-1.5 µm in

width and 3-6 µm in length and having an irregular margin. The vegetative cells were

non-motile but some time appears as motile by means of peritrichous flagella. The cells

were clustered and occurring in short chains. Spore formation is also a defining character

of Bacillus and Geobacillus only when prolonged storage of plate cultures. The spores

were appearing to be cylindrical, located terminally in slightly central swollen structure.

The cell wall structure was Gram-positive (G+) and appears to be produce pigments on

certain media were the norm for this group

3.3.2. Phenotypic characteristics

The characterization of Bacillus was shown a temperature range for growth of 85-

90°C. The isolate (Iso5) was found to be stable between pH 6.0 to 9.0 at the temperature

of 70°C but tolerance was minimized to pH 8.0 at 90°C. The salt tolerance of the strain

was determined at 10% NaCl concentration. The biochemical characteristic of the isolate

was observed to utilized acetate, lactate, citrate, starch and casein, but unable to utilize

gelatin at 70°C. The strain was also able to produce acids from glycerol, cellobiose,

galactose and xylose. Inositol and lactose consumption was not revealed the production

of acids by the isolate. The methyl red and the urea tests of isolate was shown negative

signs of decomposition at the optimized condition. The fatty acid methyl ester (FAME)

profile of isolate was largely consists of Iso-C15:0, Iso-C16:0 and Iso-C17:0, which was

relevant to the genus Geobacillus. The morphological and cultural characteristics are

presented in Table 3.1


Page 42

*Characteristics are describes as, ‘+’ as positive, ‘-‘ as negative, ‘V’ as variable and ‘ND’ as not determined in the available literature

Table 3.1: Comparative physiological characteristic of thermophilic Geobacillus sp. Iso5

isolated from Irde thermal spring with reference strains. Detailed description of

characteristics features of Taxa, 1. Geobacillus sp. Iso5; 2. G. Thermoleovorans (DSM

5366T); 3, G. Kaustophilus (DSM 7263

T)

3.3.3. Genotypic characteristics

The genomic DNA G+C base composition of the isolated strain was composed of

55% ± 0.2 mol % summing to 74.4% and 80.8% of the total, closely resembled and was

clearly distinguishable from other Geobacillus species. Both values were close to that

originally reported for which showed the highest similarity values in the 16S rRNA gene

sequence comparisons. Almost complete 16S rRNA sequences of strain Iso 5 (more than

1400 nucleotides) were determined (Fig. 3.1 & 3.2) The 16S rRNA sequence analysis

showed that the new strains fall within group 5 of the genus Geobacillus of the Gram-

Characteristic 1 2 3 Cell width (µm)

Cell length (µm)

Motility

Production of acids from

Cellobiose

Galactose

Glycerol

Inositol

Lactose

D-xylose

Hydrolytic property

Casein

Gelatin

Starch

Utilization of

Acetate

Lactate

Citrate

Voges-Proskauer reaction

Nacl stability

pH

Temperature(°C)

G+C (mol %)

1.3–1.5 1.5 0.9

3.0–6.0 3.5 3.0

No ND ND

+ + +

+ + V

+ ND ND

- - +

- - -

+ V +

+ + +

- - +

+ + ND

+ + +

- + -

+ + +

- - -

0–10% ND 5%

8.0 6.2-7.5 6.0-8.0

45-90 45-70 37-68

55 52-58 51-55


Page 43

positive subdivision of the Bacteria. The phylogenetic tree of the partial 16S rRNA gene

sequence of length 1493 bp was constructed using the neighbor-joining method (Fig.3.3).

The sequences of 16S rRNA of strain was identical to G. kaustophilus (99.5%) and G.

thermoleoverance (99%) and the other phylogenetically coherent groups of thermophilic

Geobacillus with sequence homology valve of 96.0% - 99.4%. The partial 16S rRNA

gene sequence was deposited in NCBI as Geobacillus sp. Iso5 with the accession number

GQ140232.

A B

Figure 3.1: PCR amplified 1.5 kb rRNA of novel Geobacillus sp. Iso5 on 2% agarose gel

electrophoresis pattern. Lane A: Standard molecular weight markers (3.5 kb to 100 bp)

and Lane B: Amplified 1.5 kb DNA fragments from thermophilic isolate


Page 44

Figure 3. 2: Electrogram of amplified 16S rRNA gene showing the sequence recognized

on ABI automated DNA sequencer


Page 45

Figure 3.3: Aligned 16S rRNA sequences gene sequence from thermophilic isolate.

Based on the results of the phenotypic and genotypic analyses, we conclude that

strain belongs to the member of Geobacillus and the strain isolate number was 5; for

which it was designated as Geobacillus sp. Iso5


Page 46

Figure 3.4: Phylogenic Dendrogram showing a UPGMA position of Geobacillus sp. Iso

5 among the same genetic group 5 Geobacillus with validly described species of the

Bacillus. The phylogenetic tree was inferred by using neighbor-joining methods. MEGA

3.1 was used for analysis. Number nodes represent the percentage of boot strap valve

obtained from 1000 sampling. Bar 0.01 nucleotide substitutions per site with E.coli were

used as an out group. The well known members of both genus include, Geobacillus sp.

N60; G. kaustophilus HTA 426; G. thermoleoverance DMS3; Thermus aquaticus;

Bacillus caldotex BCRC 1196.

3.3.4. Description of Geobacillus sp. Iso5 for accessibility

Geobacillus sp. Iso5 [Isolate 5. Reference to type strain. I·so·late. L. adj. 5. L. adj /verb.

Referring to the numbering the strain]

Straight rods, 1.3-1.5 µm in width and 3-6 µm in length, single cells, sometimes in short

chains, Gram-positive, non-motile. Thermophilic and form cylindrical terminal

endospores. Grow at 85-90ºC, with an optimum at 70ºC; the pH range for optimal growth


Page 47

is 6-9. For additional strain specific features were listed in Table 3.1. Negative for the

Voges–Proskauer reaction and acid production from basal medium. 55 %±0.2 mol %

G+C content. The major cellular fatty acids are iso-C15:0, iso-C16:0, iso-C17:0.

3.4. Discussion

Geothermally hot reservoirs with a temperature of 40-60°C or higher, in which

liquids were versatile ecological niche for thermophilic (Nazina et al., 2000; 2001). We

have studied the microbiological analysis of a moderate temperature based hot spring of

southern India. All five isolates were thermophilic, aerobic or facultative anaerobic, spore

forming rods that utilize a range of organic compounds, carbohydrates and oils. One of

the interesting features observed in morphological characters was that during initial

isolations, some of the strain on the surface of agar plate showed bulbous structures at

terminal ends (Sneath, 1994), reduced to minimum during subsequent sub culturing of

each isolates. The characteristic features of all isolates were different to other type strain

available. In the present study, Polyphasic taxonomic (phenotypic, genotypic and

phylogenetic) characters of thermostable Geobacillus sp. were given emphasis (Sneath,

1994; Vandamme et al., 1996). Biochemical and physiological characters are important

as they provide clues for selection of efficient strains for further investigations. Such as

tolerance to high temperature and low nutrient environments, occurrence of sporangium

like structures containing spores and production of desired enzymes such as amylases and

lipase were important criteria for selection of the strain. In this contrast, isolate 5 (Iso5)

was selected for identification and characterization of type strain which is potential

applicable in desired enzyme production.


Page 48

Based on microscopic observation, the isolate was closely resembles to the

previously reported genus Bacilli (Sharp et al., 1992; Sunna et al., 1997; Priest et al.,

1988; Claus and Berkeley, 1986). The observation of its vegetative cells, motility and

chains linkage of cells clearly defining the characteristic of Bacillus spp. (Sunna et al.,

1997; Sneath, 1994; Claus and Berkeley, 1986). The spores were appeared to be

cylindrical and central swollen structure also referring to Bacillus spp. and Geobacillus

spp. (Nazina et al., 2001; Sunna et al., 1997). The original description of the genus

Geobacillus by Nazina et al., (2001) gave species as rod shaped cells of varying

dimensions but less than 10 mm long. Although there were references to these

thermophilic Bacilli producing chains of cells, some isolates produce enormously long

and undivided. Due to different in the distinctive feature of isolate from Bacillus spp. and

Geobacillus spp., certain physiological methods were employed. These results of present

investigation and observation of previous reports on Geobacillus thermoleovorans (DSM

5366T), G. stereothermophilus (DSM 22

T) and G. Kaustophilus (ATCC 8005

T). (Nazina

et al., 2001; Priest et al., 1988; White et al., 1993), G. gargensis (Nazina et al., 2004), G.

thermocatenulatus (DSM 730T) (Nazina et al., 2001), G. vulcani and all other strains of

genus Geobacillus have a close resembles with the isolated strain (Kuisiene et al., 2004;

Schaffer et al., 2004; Banat et al., 2004; Nazina et al., 2001).

The physiological character was studied by temperature growth range (85-90°C),

pH (6.0 to 9.0) and NaCl tolerance. Other various biochemical characteristic of the isolate

was observed to utilized acetate, lactate, citrate, starch and casein, ability to produce

acids from sugars were determined the clear distinction of isolate from Bacillus spp. to

thermophilic Geobacillus spp. (Nazina et al., 2000; 2001; Zarilla & Perry, 1987; Priest et


Page 49

al., 1988; White et al., 1993). Strain Iso5 can be distinguished from Geobacillus

thermoleovorans (DSM 5366T) and Geobacillus kaustophilus (DSM 7263

T)

phenotypically by lactate utilization test, inositol, lactose and gelatin hydrolysis. A

unique feature of strain Iso5 which can be differentiate from Geobacillus

thermoleovorans (DSM 5366T) and Geobacillus kaustophilus (DSM 7263

T) by the

production of acids from gelatin. The differentiation of strain Iso5 with reference strain

Geobacillus thermoleovorans (DSM 5366T) and Geobacillus kaustophilus (DSM 7263

T)

were listed in Table 3.1.

Result of chemotaxonomic analyses was given in the species description. The

fatty acid profile (FAME) of strain was typical for the thermophilic Geobacillus strains

such as Geobacillus thermoleovorans (DSM 5366T), G. Kaustophilus (ATCC 8005

T)

(Nazina et al., 2001). The major content of cellular fatty acids of strain Iso5 was Iso fatty

acids. Among them, iso-branched pentadecanoic acid (Iso-C15:0), hexadecanoic acid (Iso-

C16:0) and heptadecanoic acid (Iso-C17:0) making up 62 % of the total fatty acids for strain

Iso5. However, percentage varies on each Iso fatty acids among the various species of

Geobacillus (Nazina et al., 2001). The strain can be distinguished from Geobacillus

thermoleovorans (DSM 5366T), G. Kaustophilus (ATCC 8005

T) and G.

thermocatenulatus (DSM 730T) based on percent composition of Iso-fatty acids making

up 62.1%, 61% and 60% respectively (Nazina et al., 2001).

The partial 16S rRNA gene sequence of strain Iso 5 (more than 1400 nucleotides)

shows 99.5% and 99% similarity to validly described Geobacillus kaustophilus and

Geobacillus thermoleovorans respectively (Nazina et al., 2001; Rainey et al., 1994; Ash

et al., 1991). The levels of 16S rRNA gene sequence similarity are higher than 96±5% for


Page 50

the members of this genus. However, other lateral species of Geobacillus are closely

related homology of about (96-98%) 16S rRNA gene sequence. In the earlier reports, it

was described that, all the strains of genus Geobacillus appeared to be closer to the

genetic and phenotypic content (Avanish et al., 2009; Nazina et al., 2001; Priest et al.,

1988; White et al., 1993). However, it was suggested that the predominant use of 16S

rRNA gene sequences to differentiate species of Geobacillus may not be the most

satisfactory and has carried out a comparison using full length RecN sequences for all 68

strains of Geobacillus. Later he concluded that while 16S rRNA gene sequences provide

a satisfactory means of differentiating organisms at higher taxonomic levels RecN

sequence analysis is better at species level (Zeigler, 2005). In contrast to this, the

phylogenetic relationship of Iso5 was extended to more thermophilic genus Bacillus and

Thermus along with the genus Geobacillus was shown in Figure 3.4. The G+C content of

DNA is 55% ± 0.2 mol % summing to 74.4% and 80.8% of the total. This clearly

distinguishable from other species of genus Geobacillus (Nazina et al., 2001; Priest et al.,

1988; White et al., 1993).


Page 51

3.5. Reference

1. Abd-El-Haleem D, Layton AC, Sayler GS (2002) Long PCR-Amplified

rDNA for PCR RFLP and Rep-PCR based approaches to recognize closely

related microbial species. J. Microbiol. Meth. 49: 315-319

2. Ananthanarayan, Paniker (2006) Textbook of Microbiology. (Paniker CKG:

ed.). 7th

edition. Orient Blackswan. Hyderabad, India

3. Ash C, Farrow JAE, Wallbanks S, Collins MD (1991) Phylogenetic

heterogeneity of the genus Bacillus revealed by comparative analysis of small-

subunit-ribosomal RNA sequences. Lett. Appl. Microbiol. 13: 202-206

4. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA,

Struhl K (1994) Current Protocols in Molecular Biology. John Wiley & Sons

Inc. New York City.

5. Avanish S, Anita P, Yogesh SS, Bhavesh K, Girish K (2009) Characterization

and identification of Geobacillus spp. isolated from Soldhar hot spring site of

Garhwal Himalaya, India. J. Basic. Microbiol. 49: 187–194

6. Banat IM, Marchant R, Rahman TJ (2004) Geobacillus debilis sp. nov., a

novel obligately thermophilic bacterium isolated from a cool soil

environment, and reassignment of Bacillus pallidus to Geobacillus pallidus

comb. nov. Int. J. Syst. Evol. Microbiol. 54: 2197-2201

7. Cashion P, Holder FMA, McCully J, Franklin M (1977) A rapid method for

the base ratio determination of bacterial DNA. Anal. Biochem. 81: 461-466

8. Cava F, Hidalgo A, Berenguer J (2009) Thermus thermophilus as biological

model. Extremophiles. 13(2): 213-231

9. Claus D, Berkeley RCW (1986) Genus Bacillus: Cohn (1872) In Bergey's

Manual of Systematic Bacteriology. (Sneath PHA, Mair NS, Sharpe ME, Holt

JG: eds.). vol. 2, pp:1105-1139. Williams & Wilkins, Baltimore.

10. Curtis TP, Sloan WT (2004) Prokaryotic diversity and its limits: microbial

community structure in nature and implications for microbial ecology. Curr.

Opin. Microbiol. 7: 221-226

11. Dahllof I (2002) Molecular community analysis of microbial diversity. Curr.

Opin. Biotechnol. 13: 213-217.

12. Farber JM (1996) an introduction to the hows and whys of molecular typing.

J. Food Prod. 59: 1091-1101.

13. Goto K, Omura T, Hara Y, Sadale Y (2000) Application of partial 16S rDNA

sequence as an index for rapid identification of species in the genus Bacillus.

J. Gen.Appl. Microbiol. 46: 1-8

14. Holt JG, Krieg NR, Sneath PHA, Staley JT, Williams T (1994) (eds) Bergey’s

Manual of Determinative Bacteriology, 9th

edition. Williams & Wilkins,

Baltimore.

15. Hugh R, Leifson E (1953) The taxonomic significance of fermentative versus

oxidative metabolism of carbohydrates by various Gram-negative bacteria. J.

Bactriol. 66: 24-26

16. Kuisiene N, Raugalas J, Chitavichius D (2004) Geobacillus lituanicus sp. nov.

Int. J. Syst. Evol. Microbiol. 54: 1991-1995.


Page 52

17. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for

molecular evolutionary genetics analysis and suquence alignment. Brief.

Bioinfo. 5: 150-163

18. Logan NA, Berkeley RCW (1984) Identification of Bacillus strains using the

API system. J. Gen. Microbiol. 130: 1871-1882

19. Madigan MT, Martinko JM, Parker J (1997) In: Brock Biology of

Microorganisms. (Madigan MT, Martinko JM & Parker J: eds.). Prentice Hall

International Editions. Upper Saddle River, NJ, USA.

20. Marchant R, Banat IM, Rahman TJ, Berzano M (2002b) The frequency and

characteristics of highly thermophilic bacteria in cool soil

environments. Environ. Microbiol. 4: 595-602.

21. Muyzer G (1999) DGGE/TGGE: A method for identifying genes from natural

ecosystems. Curr. Opin. Microbiol. 2: 317-322.

22. Nazina TN, Lebedeva EV, Poltaraus AB, Tourova TP, Grigoryan AA,

Sokolova DS, Lysenko AM, Osipov GA (2004) Geobacillus gargensis sp.

nov., a novel thermophile from a hot spring, and the reclassification of

Bacillus vulcani as Geobacillus vulcani comb. nov. Int. J. Syst. Evol.

Microbiol. 54: 2019-2024

23. Nazina TN, Tourova TP, Poltaraus AB, et al (2001) Taxonomic study of

aerobic thermophilic Bacilli: descriptions of Geobacillus subterraneus gen.

nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs

and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus,

Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus

thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the

new combinations G. stearothermophilus, G. thermocatenulatus, G.

thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G.

thermodenitrificans. Int. J. Syst. Evol. Microbiol. 51: 433-446.

24. Nazina TN, Tourova TP, Poltaraus AB, Novikova EV, Ivanova AE,

Grigoryan AA, Lysenko AM, Belyaev SS (2000) Physiological and

phylogenetic diversity of the thermophilic spore forming hydrocarbon-

oxidizing bacteria from oil fields. Microbiol. 69: 96-102.

25. Olive D, Bean P (1996) Principles and applications of methods for DNA-

based typing of microbial organisms. J. Clin. Microbiol. 37: 1661-1669.

26. Ovreas L (2000) Population and community level approaches for analyzing

microbial diversity in natural environments. Ecol. Lett. 3: 236-251

27. Pace NJ (1997) A molecular view of microbial diversity and the biosphere.

Science 276: 734-740.

28. Priest FG, Goodfellow M, Todd C (1988) A numerical classification of the

genus Bacillus. J. Gen. Microbiol. 134: 1847-1882.

29. Rainey FA, Fritze D, Stackebrandt E (1994) the phylogenetic diversity of

thermophilic members of the genus Bacillus as revealed by 16S rDNA

analysis. FEMS. Microbiol. Lett. 115: 205-211.

30. Raja NZRAR, Thean CL, Abu BS, Mahiran B (2007) Geobacillus zalihae sp.

nov., a thermophilic lipolytic bacterium isolated from palm oil mill effluent in

Malaysia. BMC. Microbiol. 7:77


Page 53

31. Saitou N, Nei M (1987) The neighbor-joining method: a new method for

reconstructing phylogenetic trees. Mol Biol Evol. 4: 406-425

32. Schaffer C, Franck WL, Scheberl A, Kosma P, McDermott TR, Messner P

(2004) Classification of isolates from locations in Austria and Yellowstone

national park as Geobacillus tepidamans sp. nov. Int. J. Syst. Evol. Microbiol.

54: 2361-2368.

33. Sharp RJ, Riley PW, White D (1992) Heterotrophic thermophilic Bacilli. In

Thermophilic Bacteria. (Kristjansson JK: ed.) pp- 19-50. CRC Press, Boca

Raton.

34. Smibert RM, Krieg NR (1994) Phenotypic characterization: In methods for

general and molecular bacteriology. (Gerhardt P: ed.). pp: 607. ASM

Publications, Washington DC.

35. Sneath PHA (1994) Endospore forming gram-positive rods and cocci. In

Bergey’s Manual of Systematic Bacteriology. (Hensyl WM: ed.). pp 1104-

1139. Williams & Wilkins Co, Baltimore.

36. Stetter KO (2006) Hyperthermophilic prokaryotes. FEMS. Microbiol. Rev. 18:

149-158

37. Sunna A, Tokajian S, Burghardt J, Rainey F, Antranikian G, Hashwa F (1997)

Identification of Bacillus kaustophilus, Bacillus thermocatenulatus and

Bacillus strain HSP as members of Bacillus thermoleovorans. Syst. Appl.

Microbiol. 20: 232-237

38. Tamaoka J, Komagata K (1984) Determination of DNA base composition by

reversed-phase high-performance liquid chromatography. FEMS. Microbiol.

Lett. 25: 125-128.

39. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997)

The clustal X windows interface: flexible strategies for multiple sequence

alignment aided by quality analysis tools. Nucl. Acids. Res. 24: 4876-4882.

40. Vandamme P, Pot B, Gillis M, Vos PDe, Kersters K Swings J (1996)

Polyphasic taxonomy: A consensus approach to bacterial systematic.

Microbiol. Rev. 60(2): 407–438.

41. Vieille C, Zeikus GJ (2001) Hyperthermophilic enzymes: sources, uses and

molecular Mechanisms for thermostability. Microbiol Mol Biol Rev. 65: 1-43

42. White D, Sharp RJ, Priest FG (1993) A polyphasic taxonomic study of

thermophilic bacilli from a wide geo-graphical area. Antonie Leeuwenhoek.

64: 357-386

43. Woese CR, Fox GE (1977) Phylogenetic structure of the prokaryotic domain:

The primary kingdoms. Proc. Natl. Acad. Sci. 74: 5088-5090

44. Woese CR, Kandler O, Wheelis ML (1990) towards a natural system of

organisms: proposal for the domains Archaea, Bacteria and Eukarya. Proc.

Natl. Acad. Sci. 87: 4576-4579

45. Yoon JH, Kim H, Kim SB, Kim HJ, Kim WY, Lee ST, Goodfellow M, Park

YH (1996) Identification of Saccharomonospora strains by the use of

genomic DNA fragments and rRNA gene probes. Int. J. Syst. Bacteriol. 46:

502-505.


Page 54

46. Zarilla KA, Perry JJ (1987) Bacillus thermoleovorans, sp. nov., a species of

obligately thermophilic hydrocarbon utilizing endospore forming bacteria.

Syst. Appl. Microbiol. 9: 258-264.

47. Zeigler DR (2005) Application of a recN sequence similarity analysis to the

identification of species within the bacterial genus Geobacillus. Int. J. Syst.

Evol. Microbiol. 55: 1171-1179.

isolation and characterization of novel thermophilic...

Documents