is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lecturea.pdf · • the genetic control of many...

22
1 Is it genetic?

Upload: others

Post on 26-Jun-2020

3 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

1

Is it genetic?

Page 2: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

2

BIOLOGY 321 GENETICS MWF 8:30-9:50 am in BI 212

Dr. Carol Trent [email protected] Office Hours: Mon & Wed 10-11:30am If you need to see me outside of office hours, please contact me via email to set up a specific appointment time.

Page 3: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

3

• This class meets three days a week for 80

minutes. • We will not have a formal break during

the 80 minute session – so much genetics so little time……

• Typically, 60 minutes a week will be set aside for an informal discussion of the lecture material and the problem sets.

• These informal sessions may consist of one 60 minute session or 2 or 3 shorter sessions.

Page 4: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

4

LECTURE DATE COURSE TOPICS

The lecture schedule may change without prior notice Week 1 Jan 6 & 8

Introduction to Genetics Mendel & model organisms Mendel & Probability

Week 2 Jan 11, 13 & 15

Meiosis & Sex-linkage Start pedigrees Fri Jan 15: QUIZ 1 (20 pts. 20 min.)

Week 3 Jan 20 & 22 HOLIDAY: Jan 18

Independent Study on Pedigree analysis: come to class on 1/20 prepared to analyze pedigrees Pedigrees and probability Start complications to Mendelian analysis Fri Jan 22: QUIZ 2 (20 pts. 20 min.)

Week 4 Jan 25, 27 & 29

Factors affecting the expression of a genetic trait Norm of reaction Complementation and other gene interactions Fri Jan 29: QUIZ 3 (20 pts. 20 min.)

Week 5 Feb 1, 3 &5

Gene interactions continued Multifactorial inheritance and complex traits

Week 6 Feb 8, 10 & 12

Horizontal Gene Transfer in Bacteria Fri Feb 12: EXAM 1 (80 pts. 80 min.)

Week 7 Feb 17, & 19 HOLIDAY: Feb 15

Independent Study/Review of Basic Molecular Biology : come to class on 2/17 prepared to discuss DNA structure, replication & transcription DNA structure and the molecular basis of mutation Mutagens & Effects of mutations on gene function Fri Feb 19: QUIZ 3 (40 pts. 40 min. )

Week 8 Feb 22, 24 & 26

Direct detection of mutation & PCR DNA fingerprinting and genetic variability Allele frequencies, Hardy Weinberg and DNA fingerprinting

Week 9 March 1, 3 & 5

Genetic linkage and recombination The generation of a genetic map & positional cloning Fri Mar 5: QUIZ 4 (40 pts. 40 min. )

Week 10 March 8, 10 & 12

Special topics such as: Cancer Genetics; Polymorphisms that confer resistance to HIV/AIDS; GM foods; Gene therapy

Finals Week Final Exam 80 pts on Thursday March 18 10:30-12:30pm

Page 5: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

5

COURSE WEB SITE

http://fire.biol.wwu.edu/trent/trent/Biol321index.html

Lecture Materials are available on the 321 web site

BUT, they are absolutely not a substitute forcoming to class or

reading the textbook

See cautionary comments on web page

Page 6: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

6

REQUIRED TEXT: The 9th edition of Introduction to Genetic Analysis by Anthony Griffiths et al. Earlier editions of this text are OK, but it is the student’s responsibility to check a copy* of the 9th edition to figure out reading and problem assignment equivalents *One copy of the text is on reserve in Wilson Library

Page 7: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

7

READING ASSIGNMENTS AND PROBLEM SETS: • Each week or so you will receive a reading and

problem set assignment. • After reading through the assigned material, work

through the assigned problems at the end of the chapter and the additional problem set handed out in class.

• The answers to the problems will be available online at the Biology 321 web site. Try writing out the answers yourself before checking the posted answers.

• Make sure that you understand the genetic principles underlying the answers.

• We will review some of the assigned problems in the informal discussion sessions.

THESE ARE STUDY PROBLEMS TO PREPARE YOU FOR QUIZZES AND EXAMS. YOU ARE NOT TO HAND IN THE ANSWERS.

Page 8: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

8

EVALUATION Mid term and Final Exams: 2 @ 80 pts. ….............. 160 Quizzes: 3 @ 20 pts and 2 @ 40 pts. ………………140 Total Points: 300 Grading Correction = 6 pts (see explanation below) REQUESTS FOR REGRADES • Requests for regrades of exam and quiz questions

must be in writing and must be submitted within one week of the return date of the graded exam/quiz.

• Inquiries or concerns about arithmetic errors in point totals or obvious mis-marks (ie on multiple choice questions, etc.) do not require a written request for correction.

• See also info on automatic grading correction

Page 9: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

9

AUTOMATIC GRADING CORRECTION At the end of the quarter, 6 points will be automatically added to to your point total to correct for grading inaccuracies. You will forfeit all of these 6 points if you request written quiz or exam regrades during the quarter. NOTE: Inquiries or concerns about arithmetic errors in point totals or obvious mis-marks will NOT result in forfeiture of the correction points.

ACADEMIC HONESTY POLICY AND PROCEDURE See Appendix D of the 2009-2010 General Catalog http://www.wwu.edu/wwu_catalog/index.shtml

Page 10: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

10

! ! !

No points are allocated specifically for

class participation.

! ! !

BUT: if you have a borderline grade at the end of the quarter, and you attended lectures consistently, were an active class participant and your performance on quizzes and exams has steadily improved, I will “bump” you up to the higher grade.

Page 11: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

11

Goal of this course to stuff your brain with genetical knowledge

Page 12: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

12

Okay, so here are the real

Goals of this course (i) To develop your analytical skills via problem solving and data analysis (ii) To introduce you to the science underlying modern genetics (you will learn some facts…) (ii) To help you become sophisticated and critical consumers of scientific information in general and genetic information in specific.

Page 13: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

13

Goal One: To develop your analytical skills via problem solving and data analysis

Over the course of the quarter you will receive several reading and problem assignments • the problem assignments will be a combination of textbook

problems and problems from old quizzes and exams • we will work through some problems during lecture and during the

informal “discussion” sessions • these informal sessions will be most useful if come prepared to tell

me what you are having problems with • so, ideally, before you come to the discussion, you have will have

reviewed the lecture material and worked (or at least tried to work) most of the assigned problems -- so you know where the trouble spots are.

• BEFORE EACH LECTURE: take time to review lecture notes and figure out which material has gelled and makes sense and which material is not falling into place

Page 14: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

14

Review Assignment Set 1 http://fire.biol.wwu.edu/trent/trent/assignmentset1.pdf

Page 15: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

15

Goal Two: To introduce you to the science underlying modern genetics (you will learn some facts…) Themes: • transmission genetics • molecular genetics • genomics • special topics

Page 16: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

16

Transmission Genetics: the transfer of genetic information from generation to generation of a cell or individual Includes: • Chromosome mechanics including mitosis,

meiosis, linkage and crossing-over • Mendelian genetics (simple and complex

traits) Phenotypes representing simple (pigmented versus non-pigmented) and complex (more versus less pigment) traits are illustrated in this picture sent by a former Western biology major

Page 17: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

17

Is it genetic?

The complex relationship between genotype and phenotype To what extent are variations in behavior within a group of individuals due to variations in genotype? In other words to what extent is our behavior “determined” by our genes? Do we have any clues to the answer to this question?

Page 18: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

18

Molecular genetics • molecular definition of the gene • the molecular basis of information storage

and expression of genetic information • the molecular basis of mutation >gi|17488858|ref|XM_010627.4| Homo sapiens SRY (sex determining region Y)-box 13 (SOX13) GGCATGTGAGCGGGAAGCCTAGGCTGCCAGCCGCGAGGACCGCACGGAGGAGGAGCAGGAGCGCGGAGCCGCGAGCCCCGAGCCCCGAGCCCGGCGCCTGGCTGAGTAGATGTCCATGAGGAGCCCCATCTCTGCCCAGCTGGCCCTGGATGGCGTTGGCACCATGGTGAACTGCACCATCAAGTCAGAGGAGAAGAAAGAGCCTTGCCACGAGGCCCCCCAGGGCTCAGCCACTGCCGCTGAACCTCAGCCTGGAGACCCAGCCCGGGCCTCCCAGGATAGTGCTGACCCCCAAGCTCCAGCCCAGGGGAATTTCAGGGGCTCCTGGGACTGTAGCTCTCCAGAGGGTAATGGGTCCCCAGAACCCAAGAGACCAGGAGTGTCGGAGGCTGCCTCTGGAAGCCAGGAGAAGCTGGACTTCAACCGAAATTTGAAAGAAGTGGTGCCAGCCATAGAGAAGCTGTTGTCCAGTGACTGGAAGGAGAGGTTTCTAGGAAGGAACTCTATGGAAGCCAAAGATGTCAAAGGGACCAAGAGAGCCTAGCAGAGAAGGAGCTCCAGCTTCTGGTCATGATTCACCAGCTGTCCACCCTGCGGGACCAGCTCCTGACAGCCCACTCGGAGCAGAAGAACATGGCTGCCATGCTGTTTGAGAAGCAGCAGCAGCAGATGGAGCTTGCCCGGCAGCAGCAGGAGCAGATTGCAAAGCAGCAGCAGCAGCTGATTCAGCAGCAGCATAAGATCAACCTCCTTCAGCAGCAGATCCAGCAGGTTAACATGCCTTATGTCATGATCCCAGCCTTCCCCCCAAGCCACCAACCTCTGCCTGTCACCCCTGACTCCCAGCTGGCCTTACCCATTCAGCCCATTCCCTGCAAACCAGTGGAGTATCCGCTGCAGCTGCTGCACAGCCCCCCTGCCCCAGTGGTGAAGAGGCCTGGGGCCATGGCCACCCACCACCCCCTGCAGGAGCCCTCCCAGCCCCTGAACCTCACAGCCAAGCCCAAGGCCCCCGAGCTGCCCAACACCTCCAGCTCCCCAAGCCTGAAGATGAGCAGCTGTGTGCCCCGCCCCCCCAGCCATGGAGGCCCCACGCGGGACCTGCAGTCCAGC T ………….. {SO WHAT?}

Page 19: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

19

Biologist live in privileged times: in the past several years, the complete genome sequences of representatives from all the major groups of organisms on earth have been determined and more genome sequences are being completed at a rapid rate Genomics • a genome is the entire complement of

genetic information in a set of chromosomes

• genomics is the molecular characterization of entire genomes including the complete sequence of DNA of each chromosome and all of the encoded proteins

Page 20: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

20

• The DNA sequence of our genome and that of

the chimpanzee differ by only a few %: • Which of these genetic differences between the

two genomes make us human?

Page 21: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

21

Goal three : To help you become sophisticated and critical consumers of scientific information in general and genetic information in specific. Required Readings Assignments (distributed in class and also available on the course web site) Zebrafish researchers hook gene for human skin color Science 310: 1754 Dec. 16, 2005

Model organism and an animal from your aquarium: the zebrafish Brachydanio rerio

Page 22: Is it genetic?fire.biol.wwu.edu/trent/trent/10.01.06lectureA.pdf · • The genetic control of many traits is not yet fully understood • The complicated & confusing business of

22

Zebrafish researchers hook gene for human skin color Science 310: 1754 Dec. 16, 2005 http://fire.biol.wwu.edu/trent/trent/zebrafishskincolor.pdf This article reflects important themes that we will explore in this course: • The value of studying model organisms • The molecular basis of allelic variation and how it affects

phenotype • In complex traits, allelic variation in more than one gene

underlies phenotypic variation • Allele frequencies vary with the population under

consideration • The genetic control of many traits is not yet fully

understood • The complicated & confusing business of gene names.

Genes are often named for the phenotype produced by a mutation in the gene: the golden mutation in zebrafish defined the golden gene; the equivalent gene in humans, though, was named for the protein it specifies: SLC24A5 = solute carrier family 24, member 5.