Rice Science, 2014, 21(2): 123−126 Copyright © 2014, China National Rice Research Institute Published by Elsevier BV. All rights reserved DOI: 10.1016/S1672-6308(13)60171-7

Introgression of Gene for Non-Pollen Type Thermo-Sensitive Genic Male Sterility to Thai Rice Cultivars

TANEE Sreewongchai, WEERACHAI Matthayatthaworn, CHALERMPOL Phumichai, PRAPA Sripichitt (Department of Agronomy, Faculty of Agriculture, Kasetsart University, Bangkok, Thailand)

Abstract: For the two-line hybrid rice system, pollen sterility is regulated by recessive gene that responds to

temperature. The recessive gene controlling thermo-sensitive genetic male sterility (TGMS) is expressed

when the plants are grown in conditions with higher or lower critical temperatures. To transfer tgms gene(s)

controlling TGMS to Thai rice cultivars by backcross breeding method, a male sterile line was used as a donor

parent while Thai rice cultivars ChaiNat 1, PathumThani 1, and SuphanBuri 1 were used as recurrent parents.

The BC2F2 lines were developed from backcrossing and selfing. Moreover, the simple sequence repeat (SSR)

markers were developed for identifying tgms gene and the linked marker was used for assisting selection in

backcrossing. The identification lines were confirmed by pollen observation. The results showed the success

of introgression of the tgms gene into Thai rice cultivars. These lines will be tested for combining ability and

used as female parent in hybrid rice production in Thailand.

Key words: hybrid rice; thermo-sensitive genic male sterility; non-pollen type; molecular marker; marker

assisted selection; marker assisted backcrossing Rice (Oryza sativa L.) is the most important staple food crop for half of the world’s population. The Green Revolution technology developed at the International Rice Research Institute (IRRI) in the 1960s increased world rice production. However, during the past decade, production potential of modern cultivars has remained stagnant. It is imperative to increase rice production to feed the increasing world population (Khush, 2005). Hybrid rice technology has tremendously improved rice productivity as effectively demonstrated in China and other Asian countries. Hybrid rice includes three-line and two-line systems that are developed via cytoplasmic male sterility and photo/thermo-sensitive genic male sterility, respectively. The application of thermo-sensitive genic male sterile (TGMS) lines has made a great contribution to hybrid rice production by providing the two-line system instead of the commonly used three-line system. Developing TGMS lines is one of the basic steps in obtaining superior two-line hybrid rice.

Thermo-sensitive genic male sterility, developed in China (Yuan, 1987), Japan (Maruyama et al, 1990), and at IRRI (Virmani and Voc, 1991), is controlled by a single recessive nuclear gene which interacts with temperature to express pollen fertility or sterility (Maruyama et al, 1990; Borkakati and Virmani, 1996). The non-pollen abortion is more difficult to revere from sterile to fertile phase than typical abortion. Under the same critical sterility point temperature (CSPT), the male

sterility of non-pollen abortion is more stable than that of typical abortion, and thus TGMS line of non-pollen abortion can be more stably fixed than typical abortion in two-line hybrid seed production (Peng et al, 2010).

Marker-assisted selection (MAS) can be used for monitoring the presence or absence of target genes in breeding populations and can be combined with conventional breeding approaches (Jena and Mackill, 2008). In hybrid rice breeding, the transfer of TGMS gene to different backgrounds will be highly facilitated by using the MAS technique in a simple and accurate way with those identified molecular markers linked to TGMS genes.

This study took advantages of the known information regarding chromosomal location of the tmsX gene, and the availability of many mapped microsatellite markers in rice (Matthayatthaworn et al, 2011). The objective of this study was to develop new TGMS line by transferring the non-pollen type from TGMS line to Thai rice by using marker assisted backcrossing.

MATERIALS AND METHODS

Rice materials

TGMS line, a non-pollen type thermo-sensitive genic male sterile, has been identified to carry single recessive gene (Matthayatthaworn et al, 2011). The TGMS line originating from China is poor in adaptability for growing in Thailand, while ChaiNat 1 (CNT1), PathumThani 1 (PTT1), and SuphanBuri 1 (SPR1) (Thai improved varieties) are popular Thai rice cultivars well adapted in Thailand. In the backcross breeding

Received: 13 March 2013; Accepted: 27 July 2013 Corresponding author: WEERACHAI Matthayatthaworn

(pojairak@hotmail.com)

Rice Science, Vol. 21, No. 2, 2014

124

program, a TGMS line and these three Thai rice cultivars were used as recurrent parents. The backcross breeding procedure was used in this study.

Markers for genotyping

T2 marker was developed by Matthayatthaworn et al in 2011, which is located on rice chromosome 2. In addition, we designed nine simple sequence repeat (SSR) markers (Table 1) from the region surrounding the tmsX gene reported by Peng et al (2010). All the nine markers are tightly linked to the tmsX locus and were used for screening polymorphism between the two parents of each cross. The markers showing polymorphism were used in genotyping the offspring of each generation. The amplified products were analyzed on 6% polyacrylamide gels and detected by silver staining (Benbouza et al, 2006).

Phenotyping for male sterile

To determine the CSPT in new Thai TGMS lines, rice plants at the elongation stage were grown in a growth chamber, in which daily mean temperatures were set at below 20 ºC, 25 ºC and higher than 30 ºC for 11.5 h day-length. Separated three tillers from each genotype were sampled for each treatment to examine the type of pollen abortion. Pollen and spikelet fertility were determined at the flowering stage using 1% I2-KI solution straining. Plants with no stained pollen were considered to be completely male sterile, whereas plants having more than 95% darkly stained pollen were classified as male fertile. At the

same time, self-pollination was tested to confirm the sterility and fertility (Wang et al, 2003).

RESULTS

Screening markers for MAS

The T2 marker can be used as MAS in breeding programs only for TGMS/PTT1 cross because this marker showed polymorphism between TGMS lines and PTT1. Two markers (T9 and T14) showed polymorphism between TGMS lines and CNT1. Unfortunately, no marker showed polymorphism between TGMS lines and SPR1, therefore, it needs to develop more markers specific to this region.

Phenotyping and MAS in BC2F1 and BC2F2 generations

The T2 marker was used to identify BC2F1 plants carrying the tmsX allele. The banding patterns of the BC2F1 individuals can be classified into those homozygous for PTT1 and heterozygous displaying both bands of TGMS lines and PTT1. The selected plants were heterozygous at this locus. The seeds of selected plants were harvested. As the same in the cross of TGMS/CNT1, the favorite genotype plants were selected and harvested on heterozygous plants. Unfortunately, the cross of TGMS/SPR1 can not classify homozygous and heterozygous plants. Therefore, the seeds of all plants were harvested.

The BC2F2 plants were grown under the temperatures higher

Table 1. Sequences of primers used for marker assisted selection.

Marker Forward primer Reverse primer

T6 GTAGATCATGTTGAATGGGAG AGACGGCTGGAATCAATA T7 GTGAAACCCACACCATACTT GCCCATATTCATTCAGATGT T8 CGATAAATAGCCGTACAAGG GTTACCACCAGAAAGTTCCA T9 TCCATTTGTCACCCTTCTAT GACATGGTTAAGCCCAAG

T10 CTGGGGTAGTAGAGGCTGA CACTTCCTTACCAGCAGTTC T11 TCTCCAGTAGTGTTTCCTCC ATCTTCGTCGTCACCAAC T12 ACAAGAGTTACCCACGGTC TTATAGGACTCACGTAGGCTG T13 TTAAAATGAGAGCGTGTGTG GGGAAGGAGATGAAGATAGG T14 CGTAGTAGTAGTTGCCCACC CTCTGCTTCGTTTCCTTCT

Fig. 1. Banding pattern of SSR marker T2 in BC2F2 population. M is a size marker; PS and PF are thermo-sensitive genic male sterile donor line and PathumThani 1 variety, respectively; F1 is F1 hybrid cross of

these varieties. Lanes 5 to 35 are BC2F2 individual plants. The stars indicate homozygous allele (tt).

TANEE Sreewongchai, et al. Introgression of Non-Pollen Type tgms Gene to Thai Rice Cultivars

125

than 30 ºC, and all lines from the crosses of TGMS/PTT1 and TGMS/CNT1 were genotyped using T2 and T9 SSR markers, respectively. All selected lines had three segregation classes of homozygous dominant, heterozygous, and homozygous recessive bands (Fig. 1). These types of bands were identified by using phenotype observation. As in the result, homozygous dominant and heterozygous genotype showed fertile plants. Homozygous recessive genotype showed sterile plants. However, the cross of TGMS/ SPR1 was observed by phenotype and fertile and sterile plants were identified in BC2F2 generation.

Performance of new TGMS lines in different temperature

regimes

The TGMS lines (donor parent) showed male sterility when exposed to high temperature. However, when exposed to low temperature at the critical stage, they showed male fertility. The new TGMS lines with Thai rice genetic background from the three crosses produced no pollen when they were grown in daily temperature higher than 30 ºC. Additionally, at low temperature (20 ºC), these plants showed male fertility. Interestingly, at 25 ºC, these plants produced unstained pollen which was considered to be male sterile (Fig. 2). These results indicated the success of introgression of TGMS allele to Thai rice cultivars.

DISCUSSION

The application of the TGMS lines has greatly facilitated the utilization of two-line system in hybrid rice production (Wang et al, 2003). In order to facilitate the transfer of TGMS allele to desirable genetic background via MAS and more accurately identify the TGMS individuals at earlier stages, closely linked markers of the tmsX gene were developed and used in MAS (Peng et al, 2010).

The possibility of MAS for tmsX gene has been demonstrated in this study. Development of specific SSR markers for non-pollen type TGMS gene in rice have facilitated the development of tropical TGMS lines with Thai cultivar background (Matthayatthaworn et al, 2011). In generating advanced lines, the use of these markers can select heterozygous-fertile (Tt) and

homozygous-sterile (tt) plants at the seedling before transplanting stage, which can reduce number of plants before transplanted to paddy fields. It can also reduce experimental area and effort expended to rice breeding program (Collard et al, 2005; Sreewongchai et al, 2010).

In this study, we used backcross breeding program incorporated with pedigree method of selection. The BC2F2 generation carried 87.5% of recurrent genetic background. Thus, some offspring lines will display the agronomic characters differing from the recurrent parent. The shorter plant height of the offspring lines than that of the recurrent parent is one of favorite phenotypes when using pedigree method of selection after backcrossing (Jin et al, 2010; Wongsaprom et al, 2010). Moreover, these results showed that marker assisted backcrossing (MAB) and conventional backcrossing (CB) for recessive gene use the same time of selection. The advantage of MAB is due to small amount of plants in breeding program. However, cost saving with CB aids in selecting favorite phenotype in large population.

The performances of new TGMS lines showed stable male sterility in two-line system. These lines can be used in developing tropical hybrid rice. However, the study about critical temperature under different genetic backgrounds is necessary (Peng et al, 2010). Seed-setting rate of TGMS lines should be at least 30% to economize their seed multiplication (Lopez and Virmani, 2000). The stable male sterility of new TGMS lines is critical for the application of two-line hybrid rice system in Thailand.

REFERENCES

Benbouza H, Jacquemin J M, Baudoin J P, Mergeai G. 2006.

Optimization of a reliable, fast, cheap and sensitive silver

staining method to detect SSR markers in polyacrylamide gels.

Biotechn Agron Soc Environ, 10(2): 77–81.

Borkakati R P, Virmani S S. 1996. Genetics of thermosensitive

genic male sterility in rice. Euphytica, 88(1): 1–7.

Collard B C Y, Jahufer M Z Z, Brouwer J B, Pang E C K. 2005.

An introduction to markers, quantitative trait loci (QTL)

mapping and marker-assisted selection for crop improvement:

Fig. 2. Mature anthers of new thermo-sensitive genic male sterile line when grown in three different daily temperature conditions and was squashed with 1% I2-KI solution.

A, Higher than 30 °C, no pollen was found in anthers; B, At 25 °C, an irregular shaped and unstained pollen was depicted; C, Below 20 °C,pollen was round and dark stained. Scale bar = 200 µm.

Rice Science, Vol. 21, No. 2, 2014

126

The basic concepts. Euphytica, 142(1/2): 169–196.

Jena K K, Mackill D J. 2008. Molecular markers and their use in

marker-assisted selection in rice. Crop Sci, 48(4): 1266–1276.

Jin L, Lu Y, Shao Y F, Zhang G, Xiao P, Shen S Q, Corke H, Bao

J S. 2010. Molecular marker assisted selection for improvement

of the eating, cooking and sensory quality of rice (Oryza sativa

L.). J Cereal Sci, 51(1): 159–164.

Khush G S. 2005. What it will take to feed 5.0 billion rice

consumers in 2030. Plant Mol Biol, 59(1): 1–6.

Lopez M T, Virmani S S. 2000. Development of TGMS lines for

developing two-line rice hybrids for the tropics. Euphytica, 114:

211–215.

Maruyama K, Araki H, Kato H. 1990. Thermosensitive genetic

male sterility induced by irradiation. In: Proceeding of the

Second International Rice Genetic Symposium, International

Rice Research Institute. Manila, Pilippines.

Matthayatthaworn W, Sripichitt P, Phumichai C, Rungmekarat S,

Uckarach S, Sreewongchai T. 2011. Development of specific

simple sequence repeat (SSR) markers for non-pollen type

thermo-sensitive genic male sterile gene in rice (Oryza sativa L.).

Afr J Biotechn, 10(73): 16437–16442.

Peng H F, Chen X H, Lu Y P, Peng Y F, Wan B H, Chen N D, Wu

B, Xin S P, Zhang G Q. 2010. Fine mapping of a gene for non-

pollen type thermosensitive genic male sterility in rice (Oryza

sativa L.). Theor Appl Genet, 120(5): 1013–1020.

Sreewongchai T, Toojinda T, Thanintorn N, Kosawang C,

Vanavichit A, Tharreau D, Sirithunya P. 2010. Development of

elite indica rice lines with wide spectrum of resistance to Thai

blast isolates by pyramiding multiple resistance QTLs. Plant

Breeding, 129(2): 176–180.

Virmani S S, Voc P C. 1991. Induction of photo- and thermo-

sensitive male sterility in indica rice. Agronomy. Abstract: 119.

Wang Y G, Xing Q H, Deng Q Y, Liang F S, Yuan L P, Weng M L,

Wang B. 2003. Fine mapping of the rice thermo-sensitive genic

male-sterile gene tms5. Theor Appl Genet, 107(5): 917–921.

Wongsaprom C, Sirithunya P, Vanavichit A, Pantuwan G, Jongdee

B, Sidhiwong N, Lanceras-Siangliw J, Toojinda T. 2010. Two

introgressed quantitative trait loci confer a broad-spectrum

resistance to blast disease in the genetic background of the

cultivar RD6 a Thai glutinous jasmine rice. Field Crops Res,

119(2/3): 245–251.

Yuan L P. 1987. Strategy conception of hybrid rice breeding.

Hybrid Rice, 1: 1–4. (in Chinese)