increase in temperature affects the growth, immune, and ... · received: 26 june 2016 accepted: 10...

Habte-Michael Habte-Tsion et al.

Increase in temperature affects the growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock

proteins of blunt snout bream, Megalobrama amblycephala fry,

Science & Technology, 2016, 2(8), 408-426,

www.discoveryjournals.org © 2016 Discovery Publication. All Rights Reserved

ARTICLE

Pag

e40

8

RESEARCH

Habte-Michael Habte-Tsion1,3☼, Mingchun Ren1,2, Xianping Ge1,2☼, Vikas Kumar4, Bo

Liu1,2, Jun Xie1,2, Ruli Chen2

1. Wuxi Fisheries College, Nanjing Agricultural University, Wuxi, Jiangsu 214081, PR China

2. Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences，Wuxi, Jiangsu 214081, PR China;

3. Ministry of Marine Resources the State of Eritrea, P.O.Box: 27, Massawa, Eritrea

4. Division of Aquaculture, College of Agriculture, Food Science and Sustainable Systems, Kentucky State University, Frankfort, KY,

USA)

☼Correspondence: Wuxi Fisheries College, Nanjing Agriculture University, Wuxi, Jiangsu 214081, PR China. E-mail: [email protected] (X.P.

Ge, PhD); and [email protected] (H.-M. Habte-Tsion, PhD)

Publication History

Received: 26 June 2016

Accepted: 10 July 2016

Online First: 15 July 2016

Published: 1 October 2016

Citation

Habte-Michael Habte-Tsion, Mingchun Ren, Xianping Ge, Vikas Kumar, Bo Liu, Jun Xie, Ruli Chen. Increase in temperature affects the

growth, immune, and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock proteins of

blunt snout bream, Megalobrama amblycephala fry. Science & Technology, 2016, 2(8), 408-426

Publication License

This work is licensed under a Creative Commons Attribution 4.0 International License.

General Note

Article is recommended to print in recycled paper.

Science & Technology, Vol. 2, No. 8, October 1, 2016 RESEARCH

Science & Technology

Increase in temperature affects the growth, immune, and antioxidant

status and hepatopancreatic gene expressions of antioxidant enzymes

and heat-shock proteins of blunt snout bream,

Megalobrama amblycephala fry

ISSN 2394–3750

EISSN 2394–3769

An International Journal






ARTICLE

Pag

e40

9

RESEARCH

ABSTRACT

This study performed a 10-week experiment to assess the effects of normal, acute and chronic temperatures on the growth, stress,

immune and antioxidant status and hepatopancreatic gene expressions of antioxidant enzymes and heat-shock proteins (HSPs) of

blunt snout bream fry, and cumulative mortality under Aeromonas hydrophila infection. For this purpose, similar size of fish fry (initial

weight, 16.08±0.03g) was randomly selected and assigned into 6 tanks (300 liter/tank), fed with an optimum semi-purified diet, and

reared at 25°C (normal temperature group) and 32°C (chronic temperature group) in triplicates. After 10 weeks, sub-sample of the

normal temperature group was challenged with acute high temperature (32°C, acute temperature group) for 7 days. At the end of

the challenge experiment, sub-samples of normal, acute and chronic temperature groups were submitted to A. hydrophila infection

and mortality was recorded at different time intervals. The results showed that poor growth performances (final body weight,

specific growth rate and feed conversion rate) were observed in the chronic temperature group compared to the normal

temperature group (P<0.05). Increase in temperature significantly (P<0.05) affected the stress responses (cortisol, glucose and

aspartate aminotransferase), immune responses (complements C3 and C4) and antioxidant enzymes activity (superoxide dismutase

(SOD), catalase (CAT) and glutathione peroxidase (GPx)). Temperature differences induced the gene expression levels of antioxidant

enzymes (Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and glutathione S-transferase mu (GST)) and HSPs (HSP60, 70 and 90). After A.

hydrophila infection, high cumulative mortality was recorded in the chronic temperature group. Indeed, these results could provide a

new molecular tool for further studies and shed light on the regulatory mechanisms that rearing temperature affects the antioxidant

and immune capacities and disease resistance of fish.

Key words: Blunt snout bream (Megalobrama amblycephala); Temperature; Growth; Stress response; Immune response; Antioxidant

status; Gene expression

Abbreviation: WGR-Weight gain rate, SGR-Specific growth rate, FCR-Feed conversion ratio, AST-aspartate aminotransferase, SOD-

superoxide dismutase, CAT-catalase, GPx-glutathione peroxidase, GST-glutathione S-transferase mu, C3 -complement component 3,

C4-complement component 4, HSPs - heat-shock proteins

1. INTRODUCTION

Among the environmental factors that affect fish growth, temperature is the most important, as it is a controlling factor that

governs the growth of ectothermic animals (Bureau et al. 2002). Freshwater fish have an optimum growing temperature in the range

of 25-30oC (Anonymous 1983). However, when the temperature becomes below or above the optimum, it has a negative impact

instead of a stimulatory influence (Jobling 1993). Temperature is also an important factor affecting physiological functions, including

adaptive and innate immunity, increase susceptibility to infection and even cause death (Ndong et al. 2007, Kling et al. 2007). When

the temperature reaches the upper extreme of the tolerated range, it can result into stress. Based on the intensity and time, thermal

stress can be either acute or chronic stress. In nature most stress can be considered as acute stress as derived from a challenge

situation normally over a short term and with a high intensity.

Fish hepatopancreas is a tissue that contains large quantities of unsaturated lipids (polyunsaturated fatty acids, PUFAs), which

are essential for membrane function (Bayir et al. 2011). A large PUFA content implies an elevated risk of oxidative stress, since these

lipids are major targets for reactive oxygen species (ROS) (Abele and Puntarulo 2004, Martinez-Alvarez et al. 2005). Fish are

equipped with a variety of enzymatic and non-enzymatic antioxidant scavenging systems, to maintain endogenous ROS at relatively

low levels and to attenuate the damage related to the high reactivity of ROS (Wilhelm Filho et al. 2001). The key antioxidant enzymes

in this antioxidant defense system include superoxide dismutase (SOD), glutathione peroxidase (GPx) and catalase (CAT) (Martinez-

Alvarez et al. 2005). These antioxidant defenses can be influenced by intrinsic and extrinsic factors including water temperature

(Martinez-Alvarez et al. 2005, Cunha et al. 2007, Aras et al. 2009, Solé et al. 2009). The activities of antioxidant enzymes could partly

result from an induction of antioxidant enzymes gene expression (Yeh et al. 2009). However, no study has been reported about the

effect of temperatures on the hepatopancreatic antioxidant status of blunt snout bream.






ARTICLE

Pag

e41

0

RESEARCH

An organism's response to environmental and physiological stressors includes a highly ordered set of events that are often

represented by rapid changes in heat shock proteins (HSPs) gene expression followed by synthesis of the proteins involved in

adaptation (Staib et al. 2007). HSPs are a group of highly conserved cellular proteins synthesized in response to a variety of stressors

(Sanders 1993). They are classified, according to their molecular weight, into HSP90, HSP70, HSP60, and smaller HSP families which

are present in all organisms including fish (Basu et al. 2002). HSPs levels differ from species to species and among different tissues

and all of them play important role in maintaining cellular homeostasis (Sanders 1993, Song et al. 2006). Nevertheless, no study was

reported regarding the effects of temperature differences on HSPs gene expression in blunt snout bream.

Blunt snout bream is an herbivorous freshwater fish endemic to China, also introduced to North America, Europe, Africa and

other Asian countries. Aquaculture of this species in China has been rapidly expanded during the last decade and its production

level reached approximately 0.7 million tons in 2012 (Ministry of Agriculture of the People’s Republic of China 2013). In recent years,

high water temperature caused disease outbreaks showed an increasing trend in cultured blunt snout bream and resulted into high

mortality, especially during summer (He et al. 2006). However, little is known about the responses (growth, stress, immune and

antioxidant) of this species to the elevation of ambient water temperature. We hypothesized that an increase in temperature may

influence the growth, antioxidant and immunity capacity, hepatopancreatic gene expressions of antioxidant enzymes and HSPs, and

disease resistance of blunt snout bream fry. Indeed, the present study was carried out to investigate this hypothesis.

2. MATERIALS AND METHODS

2.1. Experimental procedures

The experiment was conducted in a facility of indoor re-circulating system at Freshwater Fisheries Research Center (FFRC), Chinese

Academy of Fishery Sciences, Wuxi, China. Fry of blunt snout bream was obtained from FFRC, and acclimatized to the experimental

conditions and diet for two weeks. After acclimatization, similar size of fish (mean weight, 16.08±0.03g) was selected and randomly

assigned into 6 tanks (300 L/tank) at a stocking density of 25 fish per tank. The 6 tanks were randomly assigned into normal (25oC)

and chronic temperature groups (32oC). The use of experimental fish was under scientific research protocols of Chinese Academy of

Fishery Sciences and Ministry of Agriculture of China that complied with all relevant local and national animal welfare laws,

guidelines and policies (FAO 2004).

An optimum semi-purified diet (Habte-Tsion et al. 2014) with proximate composition: crude protein, of 32.16%; energy,

15.56kJ/g; and lipid, 6.17% in dry matter, was prepared in FFRC (Table 1). Fish were hand-fed with the optimum diet to apparent

satiation three times daily for 10 weeks. During the experimental period, water temperature for the normal and chronic groups was

kept at 25±1°C and 32±1°C, respectively. The following parameters were maintained during the experimental period: pH, 7.0-7.5;

ammonia nitrogen, < 0.05mg/ L; dissolved oxygen, ≥ 6.0mg/ L; photoperiod, natural (light-dark cycle).

Table 1 Ingredients and proximate composition of the optimum semi-purified diet1

Ingredients % Proximate composition (%, DM)2

Casein3 20.80 Moisture 6.81

Gelatin4 5.50 Crude protein 32.16

Fish meal5 11.50 Crude lipid 6.17

α-starch6 25.20 Ash 8.77

Dextrin7 10.00 Carbohydrate 26.01

Microcrystalline cellulose8 6.90 Gross Energy (KJ/g)10 15.56

Carboxyl-methyl cellulos4 10.00 P/E ratio (mg/KJ)11 20.66

Soybean Oil 5.40

Vitamin & mineral additives9 1.00

Soy lecithin 1.00






ARTICLE

Pag

e41

1

RESEARCH

Calcium dihydrogen

phosphate 2.50

Chlorinated choline 0.15

Ethoxyquin 0.05

1Adopted from our previous study (Habte-Tsion et al. 2014)

2Values for the proximate composition of the test diets are means of triplicate analyses.

3Purchased from Lin Xia Huaan Biological Products Co., Ltd, P.R. China;

4Purchased from Shanghai Zhan Yun Chemical Co., Ltd, P.R. China;

5Provided by Tongwei Feed Group Co., Ltd, P.R. China (origin, Coprinca, Lima, Peru);

6Purchased from Jin Ling Tower Starch Co., Ltd, P.R. China.

7Purchased from Xi Wang Chemical Co., Ltd., P.R. China;

8Purchased from Linghu Xinwang Chemical Co., Ltd, P.R. China;

9Vitamin (IU or mg/kg of premix) and mineral premixes (g/kg of premix) were used as described in our previous study (Habte-Tsion

et al. 2014). Provided by Wuxi Hanove Animal Health Products Co. Ltd., Jiangsu, China

10Gross Energy (kJ/g) calculated by 23.64kJ/g protein, 39.54kJ/g lipid and 17.15kJ/g carbohydrate

11Protein to energy ratio in mg/ kJ;

2.2. Challenge experiments

Acute temperature challenge - After 10 weeks, only the normal temperature group was submitted to an acute high temperature

challenge and this was called “acute temperature group”. The water temperature of 25°C system was quickly raised to 32°C within 3

hour by adjusting data logger. The following parameters were maintained during the challenge period: temperature, 32±1°C; pH,

7.0-7.5; ammonia nitrogen, < 0.05mg/ L; dissolved oxygen, ≥ 6.0mg/ L; photoperiod, natural (light-dark cycle); and minimal human

interference to prevent fish from additional challenge. Samples were taken at 3 hours or 0.125 day (0.125d, once the temperature

reached 32°C), 0.5d, 1d, 2d, and 7d during acute stress.

Pathogenic infection - The infection purpose was to investigate disease resistance of the normal, acute and chronic temperatures

groups by calculating the cumulative mortality of blunt snout bream fry at different time interval. Sub-samples of fish (5 fish/ tank)

from the normal, acute and chronic temperature groups were infected with bacterial septicemia pathogen Aeromonas hydrophila

(Ah, WJ2011BJ44) at the same facility. A. hydrophila was provided by the Key Laboratory of Freshwater Fisheries and Germplasm

Resources Utilization, FFRC, Chinese Academy of Fishery Sciences，Wuxi, China. According to the method described by Xie et al.

(2008), A. hydrophila was activated twice and diluted by sterile normal saline, and the final concentration was set to 1×108 cells/mL.

Bacterial suspension (0.5mL, per 50g body weight) was injected into the abdominal cavity of the fish and mortality was checked at

0.125day (3h), 0.5d, 1d, 2d and 5d after infection.

2.3. Sample collection

At the end of the 10 weeks experiment, sampling was conducted after 24h of the last feeding. Three fish from each tank were

anaesthetized with 100 mg/L MS-222 and blood samples were obtained from the caudal vein. To prepare blood serum, blood

samples were left to clot at 4°C for 1-2h, and then centrifuged at 3,000×g and 4°C for 10min. The serum was stored at -20°C for

subsequent serum biochemical measurement. Meanwhile, the three sampled fish were dissected and samples of hepatopancreas

were quickly collected and stored at -80°C for subsequent antioxidant enzymes activity and gene expression assay. Samples were

collected from normal temperature group (once), acute temperature group (five times: at 0.125d (3h), 0.5d, 1d, 2d, and 7d during

acute stress), and chronic temperature group (once).






ARTICLE

Pag

e41

2

RESEARCH

2.4. Blood parameters measurement

Serum glucose content and aspartate aminotransferase (AST) activity were determined by a colorimetric test kit (Mindray Bio

Medical Co., Ltd., Shenzhen, PR China) according to Trinder (1969) and Reitman and Frankel (1957), respectively. Serum Cortisol was

measured by radioimmunoassay (RIA) as described by Pickering and Pottinger (1983), using a test kit from New Industries

Biomedical Engineering Co., Ltd., Shenzhen, China. Serum complement component 3 (C3) and 4 (C4) levels were determined

according to the method described by Habte-Tsion et al. (2015b), using a reagent kit from Zhejiang Yilikang Biotech Co., Ltd., China.

2.5. Hepatopancreatic antioxidant enzyme activity assay

Hepatopancreas samples were homogenized in 10 volumes (w/v) of ice-cold physiological saline and centrifuged at 6000×g for

20min at 4°C, and the supernatant was conserved for enzyme activity analysis (Habte-Tsion et al. 2016). Hepatopancreatic protein

content was measured using the method of Bradford (1976). Superoxide dismutase (SOD) and glutathione peroxidase (GPx)

activities were assayed according the protocol described by Zhang et al. (2008). Catalase (CAT) activity was determined by the

decomposition of hydrogen peroxide (Aebi 1984).

2.6. Real-time PCR analysis

Real-time PCR analysis was conducted according our previous studies (Habte-Tsion et al. 2015a,b,c,d,2016). Briefly: total RNA was

extracted from the hepatopancreas of blunt snout bream fry using an RNAiso plus kit (Takara, Dalian, China). Agarose gel

electrophoresis at 1% and spectrophotometric analysis (A260: 280 nm ratio) were used to assess RNA quality and quantity.

Subsequently, cDNA was synthesized using a PrimeScriptTM RT reagent kit (Takara, Dalian, China), according to the manufacturer’s

instructions. Briefly, oligo dT primers (50µM) were used to reverse transcribe the respective RNA in the presence of PrimeScriptTM RT

enzyme mix I, 5× PrimeScriptTM buffer, and RNase free distilled water at 37°C for 15min followed by inactivation at 85°C for 5s.

Specific primers for the genes of antioxidant enzymes were designed according to the partial cDNA sequences of the target genes

using the M. amblycephala transcriptome analysis (Gao et al. 2012, Habte-Tsion et al. 2016), and primers for HSP60, HSP70, HSP90

and β-actin were designed using the published sequences of blunt snout bream (Accession No.: EU884290.2, FJ375325, KC521466.1,

AY170122.2, respectively). All primers were synthesized by Shanghai Biocolor, BioScience & Technology Company, China (Table 2).

Table 2 Real-time PCR primer sequences

Target genes Primer sequences Amplicon length (bp)

Cu/Zn-SOD: Forward 5'-AGTTGCCATGTGCACTTTTCT-3' 21

Reverse 5'-AGGTGCTAGTCGAGTGTTAGG-3' 21

Mn-SOD: Forward 5'-AGCTGCACCACAGCAAGCAC-3' 20

Reverse 5'-TCCTCCACCATTCGGTGACA-3' 20

CAT: Forward 5'- CAGTGCTCCTGATACCCAGC -3' 20

Reverse 5'- TTCTGACACAGACGCTCTCG -3' 20

GPx1: Forward 5'-GAACGCCCACCCTCTGTTTG-3' 20

Reverse 5'-CGATGTCATTCCGGTTCACG-5' 20

GST: Forward 5'-AACCTCTGTGGGGAAACTGAAGAAG-3' 25

Reverse 5'-TAGAGTTCCTGGCAGATTCTCATCG-3' 25

HSP60: Forward 5’- AGGAGTAATGATGGCGGTGGAAG-3’ 23

Reverse 5’- AACACCCTTGCGTCCAACTTTCT-3’ 23

HSP70: Forward 5’- TACACGTCCATCACCAGAGCGC-3’ 22

Reverse 5’- CCCTGCCGTTGAAGAAATCCT-3’ 21

HSP90: Forward 5'- CATCAAAGGCGTTGTGGACTC-3' 21

Reverse 5- AGGCGAGTTCTGTTGGAGTGAT-3 22

β-Actin: Forward 5’-TCGTCCACCGCAAATGCTTCTA-3’ 22

Reverse 5’-CCGTCACCTTCACCGTTCCAGT-3’ 22






ARTICLE

Pag

e41

3

RESEARCH

Cu/Zn-SOD, copper-zinc superoxide dismutase; Mn-SOD, manganese superoxide dismutase; CAT, catalase; GPxl, glutathione

peroxidase 1; GST, glutathione S-transferase mu; HSP60, heat-shock protein 60; HSP70, heat-shock protein 70; HSP90, heat-shock

protein 90. Note: primer sequences for Cu/Zn-SOD, Mn-SOD, CAT, GPxl, GST and β-Actin were adopted from Habte-Tsion et al.

(2016).

Real-time PCR was used to determine mRNA levels using a PrimerScriptTM reagent kit (Takara, Dalian, China). Real-time PCR for

the target genes were performed according to standard protocols. Briefly, cDNA (2.0μL) was reacted with 10.0μL SYBR® Premix Ex

Taq II (2×), 0.8μL forward primer (10μM), 0.8μL reverse primer (10μM), 0.4μL ROX reference dye or dye II (50×), and 6.0μL RNase-free

distilled water in a 20μL final reaction volume. The real-time PCR was carried out in a 7500 Real-Time PCR System (Applied

Biosystems, USA). The thermocycling conditions for the target genes were as follows: initiated with a denaturation step at 95°C for

30s followed by forty cycles at 95°C for 5s, 60°C for 34s and 95°C for 30s, 95°C for 3s, 60°C for 30s, respectively. The melting curve

analysis was performed over a range of 50-95°C to verify that a single PCR product was generated. The concentration of the target

genes was based on the threshold cycle number (CT), and CT for each sample was determined using 7500 Software version 2.0.4

(Applied Biosystems). The expression levels of the target genes were normalized to those of a housekeeping gene (β-actin) of blunt

snout bream. The expression results were analyzed using the 2-∆∆CT method after verifying that the primers were amplified with an

efficiency of approximately 100% (Livak and Schmittgen 2001). Besides, cDNA concentration in each sample was determined

according to gene-specific standard curves. Standard curves were generated for both target and endogenous control genes based

on 10-fold serial dilutions. All standard curves exhibited correlation coefficients > 0.99.

2.7. Calculations and data analysis

The following formulas were used to calculate the growth performance of blunt snout bream fry reared at normal and chronic

temperatures for 10 weeks:

Weight gain rate (WGR, %) = 100 x [(W2- W1) /W1]

Specific growth rate (SGR; %/day) = 100 x [(lnW2 – lnW1) /T]

Feed conversion ratio (FCR) = [feed intake (g) / weight gain (g)]

Where W1 and W2 are the initial and final body weight, respectively, and T is the number of days in the feeding period.

Data were analyzed using SPSS version 19 (Chicago, IL, USA). Differences between the means in Table 3 were

determined by Independent-Samples T-Test. The data in all figures were subjected to one-way ANOVA followed by LSD

multiple comparisons, and significant differences (P<0.05) among the group means were further compared using Duncan's

multiple range tests. The broken-line regression model (Robbins et al. 1979) was used to estimate the cumulative mortality

of blunt snout bream fry after A. hydrophila infection. All results are presented as means plus or minus standard error ( X ±

SE) of three replicates.

Table 3 The effects of normal and chronic temperature on the growth performance of blunt snout bream fry reared for 10 weeks1

Parameters Temperature (oC)

25 32

FBW2 (g) 37.74 ± 1.52b 31.24 ± 1.11a

WGR3 (%) 135.09 ± 9.79b 93.58 ± 6.32a

SGR4 (%) 1.22 ± 0.06b 0.94 ± 0.05a

FCR5 1.88 ± 0.02a 2.87 ± 0.13b

Survival rate (%) 99.00 ± 0.58 94.67 ± 3.53

1Results are mean of triplicate estimations ± S.E and means in the same row with different superscripts are significantly (P<0.05)

different in Independent-Samples t-tests.

2FBW, final body weight

3WGR, weight gain rate

4SGR, specific growth rate

5FCR, feed conversion ratio






ARTICLE

Pag

e41

4

RESEARCH

Figure 1 The stress responses such as serum cortisol level (A), glucose content (B) and aspartate aminotransferase (AST) activity (C)

of blunt snout bream fry reared at different temperatures. Note: Results are mean of triplicate estimations plus or minus standards

error ( X ± SE). Significant differences (P<0.05) between the values obtained before stress and during acute stress and chronic stress

are marked by small letters in Duncan's multiple range tests.

3. RESULTS

3.1. Growth performance

Table 3 shows the effect of normal and chronic temperature on the growth performance of blunt snout bream fry reared for 10

weeks. Final body weight (FBW), weight gain rate (WGR) and specific growth rate (SGR) of the chronic temperature group were

significantly (P<0.05) lower than those normal temperature group; while the reverse was found in feed conversion ratio (FCR)

(A)

(C)

(B)






ARTICLE

Pag

e41

5

RESEARCH

(P<0.05). Lower survival rate was observed in the chronic temperature group compared to the normal temperature group, but it was

not in significant manner. No pathological signs were observed during the experiment period.

3.2. Serum stress responses

The effects of normal, acute and chronic temperatures on serum cortisol level, glucose content and aspartate aminotransferase (AST)

activity in blunt snout bream fry are presented in Fig.1. Both acute and chronic temperatures significantly elevated the levels of

cortisol compared to normal temperature (P<0.05, Fig.1A). The highest cortisol level was found in the acute temperature group at

0.5d during acute stress followed by 0.125d during acute stress (P<0.05). Acute temperature increased serum glucose content (at 1-

2d during acute stress) and AST activity (at 0.125-1d during acute stress) (P<0.05, Fig.1B,C). No significant differences were observed

between the normal temperature and chronic temperature groups in glucose content and AST activity.

3.3. Serum immune responses

Fig.2 shows the effects of normal, acute and chronic temperatures on the immune responses, such as serum complement C3 and C4

concentrations in blunt snout bream fry. The serum complement C3 concentration increased, reached peak at 0.125d-0.5d during

acute stress (P<0.05) and thereafter tended to decrease up to the chronic temperature group, and back to the level similar to that

normal temperature group (Fig.2A). The serum C4 concentration elevated, reached peak at 0.125d-1d during acute stress (P<0.05)

and thereafter decreased up to the chronic temperature, and back to the level similar to that normal temperature group (Fig.2B).

Figure 2 The immune responses such as serum complement C3 (A), C4 (B) of blunt snout bream fry reared at different

temperatures. Note: Legends are the same as on Fig.1.

(A)

(B)






ARTICLE

Pag

e41

6

RESEARCH

3.4. Hepatopacreatic antioxidant enzymes activity

The effects of normal, acute and chronic temperatures on the antioxidant enzymes activity, such as SOD, CAT and GPx in the

hepatopancreas of blunt snout bream fry are shown in Fig.3. High temperatures (both acute and chronic) increased SOD, CAT and

GPx activities in the hepatopancreas of blunt snout bream fry (P<0.05, Fig.3). Higher SOD activity was found at 1d during acute

stress followed by 0.5d, 0.125d, 2d, 7d, and chronic stress compared to that normal temperature group (P<0.05, Fig.3A). The

activities of CAT and GPx at 0.5d during acute stress were significantly (P<0.05) higher than the others acute stress time, chronic

temperature and normal temperature (Fig.3B,C). The lowest SOD, CAT and GPx activities were measured in the normal temperature

group (Fig.3).

(A)

(B)






ARTICLE

Pag

e41

7

RESEARCH

Figure 3 Hepatopancreatic antioxidant enzymes activity such as copper-zinc superoxide dismutase (SOD, A), catalase (CAT, B) and

glutathione peroxidase (GPx, C) of blunt snout bream fry reared at different temperatures. Note: Legends are the same as on Fig.1.

3.5. Hepatopancreatic antioxidant enzymes gene expression

Fig.4 shows the effects of normal, acute and chronic temperatures on the relative gene expressions of antioxidant enzymes such as

Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and GST in the hepatopacreas of blunt snout bream fry. High temperature (both acute and chronic)

significantly induced the relative expression levels of Cu/Zn-SOD, with high expression levels in the acute temperature group

(P<0.05, Fig.4A). CAT mRNA expression levels of the acute temperature group elevated significantly, reached peak at 1-2d during

acute stress (P<0.05), and thereafter tended to decrease (Fig.4C). Mn-SOD, GPx1 and GST mRNA expression levels were up-

regulated at 0.125-1d during acute stress and thereafter decreased (P<0.05, Fig.4B,D,E).

(C)

(A)






ARTICLE

Pag

e41

8

RESEARCH

(B)

(C)

(D)






ARTICLE

Pag

e41

9

RESEARCH

Figure 4 The relative gene expression levels of antioxidant enzymes such as copper-zinc superoxide dismutase (Cu/Zn-SOD, A),

manganese superoxide dismutase (Mn-SOD, B), catalase (CAT, C), glutathione peroxidase 1 (GPx1, D) and glutathione S-transferase

mu (GST, E) in the hepatopancreas of blunt snout bream fry reared at different temperatures. Note: Legends are the same as on

Fig.1.

3.6. Hepatopacreatic heat-shock proteins (HSPs) gene expression

The relative expression levels of HSP60, HSP70 and HSP90 mRNA were induced in time-dependent manner after acute temperature

challenge (Fig.5). The highest level of HSP60 mRNA was obtained at 1d during acute stress (P<0.05, Fig.5A). The relative expression

level of HSP70 mRNA was significantly (P<0.05) up-regulated at 0.125d during acute stress followed by 0.5d compared with others

acute temperature time interval, normal temperature and chronic temperature groups (Fig.5B). HSP90 mRNA expression level at 1d

during acute stress was significantly (P<0.05) higher than the others acute temperature time intervals and normal temperature

group, but not significantly different from 2d during acute stress and chronic temperature group (Fig.5C).

(E)

(A)






ARTICLE

Pag

e42

0

RESEARCH

Figure 5 The relative gene expression levels of heat-shock proteins (HSPs) such as HSP60 (A), HSP70 (B) and HSP90(C) in the

hepatopancreas of blunt snout bream fry reared at different temperatures. Note: Legends are the same as on Fig.1.

Figure 6 The cumulative mortality of blunt snout bream fry after Aeromonas hydrophila (1x108 cells/mL) infection, reared at different

temperatures. Note: Results are mean of triplicate estimations plus or minus standard error ( X ± SE). Significant differences

(B)

(C)






ARTICLE

Pag

e42

1

RESEARCH

(P<0.05) between the temperature groups at each observation point after infection are marked by asterisks in Duncan's multiple

range tests.

3.7. Cumulative mortality after Aeromonas hydrophila infection

Sub-samples of fish from normal, acute and chronic temperature groups (5 fish/ tank) were infected with a bacterial septicemia

pathogen A. hydrophila, and cumulative mortality was calculated for 5days (0.125d, 0.5d, 1d, 2d and 5d after infection, Fig.6). The

maximum cumulative mortality was observed between 1d and 2d after infection in all groups. At 1d after infection, the cumulative

mortality of the chronic temperature group (58.33%) was significantly higher than the normal (20.00%) and acute (26.67%)

temperature groups (P<0.05).

4. DISCUSSION

If an organism cannot acclimate, adapt or maintain homeostasis, several changes may occur: at the behavioral level, growth,

resistance to disease and reproduction capacity (Iwama et al. 1999, Barton 2002). Prolonged exposure of fish to stress can eventually

alter population demographics and dynamics. Impacts can be critical when it comes to early stages because growth is of crucial

importance to their fitness at these stages. In this study, poor growth performances of blunt snout bream fry were investigated in

the chronic temperature group compared to the normal temperature group (Table 3). Generally, lower survival was observed in the

chronic temperature group than the normal group. These results are in accordance with previous study reported in the same species

(Shi et al. 1988).

Exposure of fish to stressing environmental factors gives rise to a series of biochemical and physiological changes mediated by

the neuroendocrine system and characterized by increased cortisol level (Wendelaar Bonga 1997). This stress hormone, synthesized

by the head kidney interrenal cells, regulates osmolarity and metabolism, and modulates immune responses (Vazzana et al. 2002,

Vizzini et al. 2007). In the present study, the cortisol level of the acute temperature group abruptly elevated up to 0.5d during acute

stress and thereafter decreased towards chronic temperature group, but still higher than that normal temperature group. This is

most likely due to the cortisol level during chronic stress (distress), either persists long after the stressor has ceased or reduces its

level. Similar studies had been reported in the same species (Ming et al. 2012), Atlantic cod (Pérez-Casanova et al. 2008) and

gilthead seabream (Ortuño et al. 2001).

As the level of cortisol increased, blood glucose level might also increased (Pérez-Casanova et al. 2008, Ortuño et al. 2001, Ming

et al. 2012) to meet the increasing energy demand in fish under stress (Hsieh et al. 2003). An enhanced release of glucose in the

blood during acute stress becomes apparent during chronic stress with the support of cortisol (gluconeogenesis) (Iwama et al.

2006). In this study, the serum glucose content increased up to 2d during acute stress and thereafter tended to decrease towards

chronic temperature group, and reached similar to the level of normal temperature group. It can be suggested that stress has some

instantaneous effect on blood glucose level and when the stress lasts for a while blood glucose can recover back to the original level

(Hsieh et al. 2003). This is supported by the result reported in sea bass submitted to acute temperature heat shock (Enes et al. 2006).

Aspartate aminotransferase (AST) is ubiquitous aminotransferases that is found in the mitochondria of fish which is an

important index for the diagnosis of hepatopancreas function and damage (Yamamoto 1981, Habte-Tsion et al. 2014, 2015b).

Elevated level of AST has been used extensively in studies that evaluate finfish response to stress, toxins, disease and malnutrition. In

the present study, the serum AST activity abruptly increased at 0.125d during acute stress and thereafter decreased towards chronic

temperature group. No significant differences were measured in serum AST activity among the 2d and 7d during acute stress,

chronic temperature group and normal temperature group. This is most likely to be when fish is exposed to stress for a prolonged

period, the AST activity could be reduced, and fluctuated activity of AST can be considered as stress response.

Several physiological and biochemical adjustments can be involved during stress and it is regulated by stress hormones

(adrenaline and cortisol) which activate metabolic pathways that lead to biochemical alterations (Barton and Iwama 1991), and

changes in the immune functions (Barton 2002). In the present study, elevated temperature significantly affected the immune

responses (C3 and C4 concentrations), suggesting that it resulted changes in immune functions. Meanwhile, greater immune

responses were found in the acute temperature group (during 0.125-1d for C3 and 0.125-2d for C4) compared to the normal and

chronic temperature groups in this study. It indicated that acute stress may be often associated with eustress or hormesis (stress






ARTICLE

Pag

e42

2

RESEARCH

resulting in potential advantages), thus involving short-time challenges that result in immunoactivation or immunoenhancing

processes (Mattson 2008, Calabrese and Mattson 2011).

Hepatopancreas is the target organ in fish research studies (Aras et al. 2009, Chen et al. 2012, Feng et al. 2013, Habte-Tsion et

al. 2016,2015c) including in blunt snout bream research study (Habte-Tsion et al. 2015c, 2016). Fish hepatopancreas is a tissue that

contains large quantities of unsaturated lipids (polyunsaturated fatty acids, PUFAs), which are essential for membrane function (Bayir

et al. 2011). A large PUFA content implies an elevated risk of oxidative stress, since these lipids are major targets for reactive oxygen

species (ROS) (Abele and Puntarulo 2004, Martinez-Alvarez et al. 2005). Oxidative damage is an important consequence of oxidative

stress, which is a state characterized by an imbalance between the generation of ROS and the antioxidant defense capacity of the

body (Zheng et al. 2013). In general, antioxidant defense systems in fish consist of low-molecular-weight antioxidants and

antioxidant enzymes including SOD, GPx and CAT (Martinez-Alvarez et al. 2005). SOD can catalyze dismutation of superoxide

radicals to hydrogen peroxide (Zhou et al. 2013), which can be removed by GPx (Livingstone 2003). CAT is an essential defense

against the potential toxicity of free radical like hydroxyl radical by catalyzing the degradation of hydrogen peroxide (David et al.

2008). In this study, high temperature increased the activities of SOD, GPx and CAT in the hepatopancreas of blunt snout bream fry,

suggesting that high temperature could be triggered oxidative stress in the hepatopancreas of this fish. Similarly, antioxidant

enzymes activities increased in abalones exposed to high temperatures (Park et al. 2015).

The antioxidant enzyme activities of fish are closely related to their mRNA levels (Fontagné-Dicharry et al. 2014). In present

study, high temperature significantly increased mRNA levels of Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and GST in the hepatopancreas of

blunt snout bream fry, which showed a similar trends with antioxidant enzymes activity, suggesting that the increments of

antioxidant enzyme activity is partly attributed to the fact that high temperature (especially acute high temperature) up-regulated

the gene transcription of antioxidant enzymes in the hepatopancreas of fish. The up-regulation of the antioxidant enzymes mRNA

expression by acute high temperature stress may be related an increased signaling molecules syntheses (target of rapamycin (TOR)

and nuclear factor erythroid 2-related factor 2 (Nrf2)), which play important roles in the regulation of antioxidant enzyme gene

transcriptions in fish. However, the specific mechanisms behind the relation between high temperature and these signaling

molecules syntheses need further study.

HSPs play important roles in stress response (Iwama et al. 1999), in both innate and adaptive immune responses (Roberts et al.

2010, Sung and MacRae 2011, Xie et al. 2015). In this study, acute high temperature induced the expression patterns of HSP60,

HSP70 and HSP90 in the hepatopancreas of blunt snout bream fry. Similar results have been reported that the expression levels of

HSPs abruptly induced under heat shock in different aquatic species (Palmisano et al. 2000, Qian et al. 2012, Yang et al. 2013). In our

study, the expression of HSP70 mRNA increased significantly at 0.125d during acute stress; whereas those HSP60 and HSP90

increased at 1d during acute stress, which indicated that the high sensitivity of HSP70. Qian et al. (2012) also reported that the

expression of HSP60 is very sensitive to heat shock, but less than that of HSP70. Different HSP genes may play different roles in

mediating cell stress caused by a specific environmental stressor. As a result, HSPs mRNA levels could contribute to the different

expression patterns of HSP60, HSP70, and HSP90 (Qian et al. 2012, Szymańska et al. 2009). These results indicated that the critical

roles of HSP genes in coping with heat stress in organisms.

The present study investigated that high cumulative mortality at 1d after infection in the chronic temperature group; suggesting

that this group had less resistance to A. hydrophi1a infection than the normal temperature and acute temperature groups. The low

cumulative mortality in the acute stressed group could be due to high levels of biomarkers produced during acute stress, which are

an efficient cross-tolerance phenomenon when fish were exposed to infection (Lindquist and Craig 1988, Clegg et al. 1998). On the

other hand, during chronic stress, there is a mechanism of continuous energy availability by the immune system such as the

production of antibodies, the synthesis of proteins such as complements, antioxidants and HSPs, the production and differentiation

of different types of leukocytes, etc., subjected to lack of resources. Thus decreasing its efficiency and therefore leading to immune

depression. At the end pathogenic infection resistance can be reduced and fish can be easily susceptible to disease.

5. CONCLUSION

This study indicates that poor growth and disease resistance were observed in the chronic temperature group. High temperature

increased stress and immune responses (acute temperature) and antioxidant enzymes activities (both acute and chronic

temperatures). Temperature induced the gene expression of antioxidant enzymes (Cu/Zn-SOD, Mn-SOD, CAT, GPx1 and GST) and

HSPs (HSP60, 70 and 90) in the hepatopacreas of blunt snout bream fry, which may explain further the adverse effects of high






ARTICLE

Pag

e42

3

RESEARCH

temperature in cultured fish. This study expected to contribute useful insight to the knowledge for developing blunt snout bream

sustainable aquaculture, especially in summer resulting high mortality due to diseases outbreak caused by high temperature stress.

SUMMARY OF RESEARCH

1. Chronic high temperature resulted poor growth of blunt snout bream fry.

2. High temperature influenced stress and immune responses.

3. High temperature increased antioxidant enzymes activities.

4. Increase in temperature up-regulated the gene expressions of antioxidant enzymes.

5. Acute high temperature induced the gene expression of heat-shock proteins (HSPs).

6. Increase in temperature affects immune and antioxidant status, and disease resistance of fish.

ACKNOWLEDGEMENTS

The authors acknowledge to the post graduate students of Fish Disease and Nutrition Department, Freshwater Fisheries Research

Center (FFRC) for their help throughout the research period. This work was financially supported by the Modern Agro-industry

Technology Research System, PR China (CARS-46); the Special Fund for Agro-Scientific Research in the Public Interest (201003020);

and the National Nonprofit Institute Research Grant of FFRC, CAFS (2014A08XK02). H.M.H.T., B.L., G.X.P. and J.X. designed the study;

H.M.H.T., M.C.R. and R.C. performed the feeding trial and collected sample; H.M.H.T. and M.C.R. analyzed data; H.M.H.T. wrote the

manuscript, with input from all other authors; and M.C.R., B.L. and G.X.P. provided advice and critical review of the manuscript. All

authors read and approved the final version of the manuscript. The authors declare no competing financial interests.

REFERENCES

1. Abele D, Puntarulo S. Formation of reactive species and

induction of antioxidant defense systems in polar and

temperate marine invertebrates and fish. Comp. Biochem.

Physiol., 2004, 138A, 405-415.

2. Aebi H. Catalase “in vitro”. Method Enzymol., 1984, 105, 121-

127.

3. Anonymous. Nutrient requirements of warm water fish and

shellfish. National Research Council. National Academy

Press, Washington DC, 1983, 114.

4. Aras N M, Bayır A, Sirkecioğlu A N, Bayır M, Aksakal E,

Haliloğlu H I. Seasonal changes in antioxidant defense

system of liver and gills of Salmo trutta caspius, Salmo trutta

labrax and Salmo trutta macrostigma. J. Fish. Biol., 2009, 74,

842-856.

5. Barton B A, Iwama G K. Physiological changes in fish from

stress in aquaculture with emphasis on the response and

effects of corticosteroids. Ann. Rev. Fish Dis., 1991, 1, 3-26.

6. Barton B A. Stress in Fishes: a diversity of responses with

particular reference to changes in circulating

corticosteroids. Integ. Comp. Biol., 2002, 42, 517-525.

7. Basu N, Todgham A E, Ackerman P A, Bibeau M R, Nakano

K, Schulte P M, et al. Heat shock protein genes and their

functional significance in fish. Gene, 2002, 295, 173-183.

8. Bayir A, Sirkecioglu A N, Bayir M, Haliloglu H I, Kocaman E

M, Aras N M. Metabolic responses to prolonged starvation,

food restriction, and refeeding in the brown trout, Salmo

trutta: Oxidative stress and antioxidant defenses. Comp.

Biochem. Physiol., 2011, 159B, 191-196.

9. Bradford M M. A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein–dye binding. Anal. Biochem., 1976, 72,

248-254.

10. Bureau D P, Kaushik S J, Cho C Y. Bioenergetics. In: Halver J

E, Hardy R W, editors. Fish Nutrition. Academic Press,

California, 2002, 1-59.

11. Calabrese E J, Mattson M P. Hormesis provides a

generalized quantitative estimate of biological plasticity. J.

Cell Commun. Signal., 2011, 5, 25-38.

12. Chen G F, Feng L, Kuang S Y, Liu Y, Jiang J, Hu K, et al. Effect

of dietary arginine on growth, intestinal enzyme activities

and gene expression in muscle, hepatopancreas and

intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Br.

J. Nutr. 2012, 108, 195-207.

13. Clegg J S, Uhlingher K R, Jackson S A, Cherr G N, Rifkin E,

Friedman C S. Induced thermotolerance and heat shock

protein-70 family in Pacific oyster Crassostrea gigas. Mol.

Mar. Biol. Biotechnol., 1998, 7, 21-30.

14. Cunha Bastos V L F, Salles J B, Valente R H, León I R, Perales






ARTICLE

Pag

e42

4

RESEARCH

J, Dantas R F, et al. Cytosolic glutathione peroxidase from

liver of pacu (Piaractus mesopotamicus), a hypoxia-tolerant

fish of the Pantanal. Biochimie., 2007, 89, 1332-1342.

15. David M, Munaswamy V, Halappa R, Marigoudar S R.

Impact of sodium cyanide on catalase activity in the

freshwater exotic carp, Cyprinus carpio (Linnaeus). Pestic.

Biochem. Phys., 2008, 92, 15-18.

16. Enes P, Panserat S, Kaushik S, Oliva-Teles A. Rapid

metabolic adaptation in European sea bass (Dicentrarchus

labrax) juveniles fed different carbohydrate sources after

heat shock stress. Comp. Biochem. Physiol., 2006, 145A, 73-

81.

17. FAO. In: Spreij M, editor. National aquaculture legislation

overview-China. National aquaculture legislation OVERVIEW

(NALO) fact sheets. Rome: FAO Fisheries and Aquaculture

Department, 2004. http://www.fao.org/fishery/legalfram

ework/nalo_china/en#tcNB0041.

18. Feng L, Peng Y, Wu P, Hu K, Jiang W D, Liu Y, et al.

Threonine Affects Intestinal Function, Protein Synthesis and

Gene Expression of TOR in Jian Carp (Cyprinus carpio var.

Jian). PLoS ONE, 2013, 8(7), e69974.

doi:10.1371/journal.pone.0069974

19. Fontagné-Dicharry S, Lataillade E, Surget A, Larroquet L,

Cluzeaud M, Kaushik S. Antioxidant defense system is

altered by dietary oxidized lipid in first-feeding rainbow

trout (Oncorhynchus mykiss). Aquaculture, 2014, 424-425:

220-227.

20. Gao Z X, Luo W, Liu H, Zeng C, Liu X L, Yi S K, et al.

Transcriptome analysis and SSR/SNP markers information

of the blunt snout bream (Megalobrama amblycephala).

PLoS One, 2012, 7 (8), e42637.

doi:10.1371/journal.pone.0042637.

21. Habte-Tsion H M, Ge X P, Liu B, Xie J, Ren M C, Zhou Q L, et

al. A deficiency or an excess of dietary threonine level

affects weight gain, enzyme activity, immune response and

immune-related gene expression in juvenile blunt snout

bream (Megalobrama amblycephala). Fish Shellfish

Immunol., 2015b, 42, 439-446.

22. Habte-Tsion H M, Liu B, Ge X P, Xie J, Xu P, Ren M C, et al.

Effects of dietary protein levels on the growth performance,

muscle composition, blood composition and digestive

enzymes activities of Wuchang bream, Megalobrama

amblycephala fry. Israeli J. Aquac., 2014, 65, 1-9. Bamidgeh

2013 IJA_65. 925.

23. Habte-Tsion H M, Liu B, Ren M C, Ge X P, Xie J, Zhou Q L, et

al. Dietary threonine requirement of juvenile blunt snout

bream (Megalobrama amblycephala). Aquaculture, 2015a,

437, 304-311.

24. Habte-Tsion H M, Ren M C, Liu B, Ge X P, Xie J, Chen R, et

al. Threonine influences the absorption capacity and brush-

border enzyme gene expression in the intestine of juvenile

blunt snout bream (Megalobrama amblycephala).

Aquaculture, 2015d, 448, 436-444.

25. Habte-Tsion H M, Ren M C, Liu B, Ge X P, Xie J, Chen R.

Threonine modulates immune response, antioxidant status

and gene expressions of antioxidant enzymes and

antioxidant-immune-cytokine-related signaling molecules

in juvenile blunt snout bream (Megalobrama amblycephala).

Fish Shellfish Immunol., 2016, 51, 189-199.

26. Habte-Tsion H M, Ren M C, Liu B, Xie J, Ge X P, Chen R, et

al. Threonine affects digestion capacity and

hepatopancreatic gene expression of juvenile blunt snout

bream (Megalobrama amblycephala). Br. J. Nutr., 2015c,

114, 533-543.

27. He L J, Liao Yuan J F, Tang H Y, Wu Q, Zhang G W.

Pathological observation of bacterial septicemia in

Megalobrama amblycephala. J. Southwest Univer., 2006, 3,

483-490 (in China).

28. Hsieh S L, Chen Y N, Kuo C M. Physiological responses,

desaturase activity and fatty acid composition in milkfish

(Chanos chanos) under cold acclimation. Aquaculture, 2003,

220, 903-918.

29. Iwama G K, Afonso L O B, Vijayan M M. Stress in fishes. In:

Evans D H, Claiborne J B, editors. The Physiology of Fishes,

3rd edition. CRC Press, New York, 2006, 319-342.

30. Iwama G K, Vijayan M M, Forsyth R B, Ackenrian P A. Heat

shock proteins and physiological stress in fish. Am. Zool.,

1999, 39, 901-909.

31. Jobling M. Bioenergetics: feed intake and energy

partitioning. In: Rankin J C, Jensen F B (eds) Fish Eco-

physiology. Chapman & Hall, London, 1993, 1-44.

32. Kling L J, Muscato H J, Jordaan A. Growth, survival and feed

efficiency for post-metamorphosed Atlantic cod (Gadus

morhua) reared at different temperatures. Aquaculture,

http://www.fao.org/fishery/legalfram%20ework/nalo_china/en#tcNB0041

http://www.fao.org/fishery/legalfram%20ework/nalo_china/en#tcNB0041






ARTICLE

Pag

e42

5

RESEARCH

2007, 262, 281-288.

33. Lindquist S, Craig E A. The heat-shock proteins. Annu. Rev.

Genet., 1988, 22, 631-677.

34. Livak K J, Schmittgen T D. Analysis of relative gene

expression data using real-time quantitative PCR and the 2-

∆∆CT method. Methods, 2001, 25, 402-408.

35. Livingstone D R. Oxidative stress in aquatic organisms in

relation to pollution and aquaculture. Rev. Med. Vet., 2003,

154, 427-430.

36. Martinez-Alvarez R M, Morales A E, Sanz A. Antioxidant

defenses in fish: biotic and abiotic factors. Rev. Fish Biol.

Fish, 2005, 15, 75-88.

37. Mattson M P. Hormesis defined. J. Ageing Res. Rev., 2008, 7,

1-7.

38. Ming J H, Xie J, Xu P, Ge X P, Liu W B, Ye J Y. Effects of

emodin and vitamin C on growth performance, biochemical

parameters and two HSP70s mRNA expression of Wuchang

bream (Megalobrama amblycephala Yih) under high

temperature stress. Fish Shellfish Immunol., 2012, 32, 651-

661.

39. Ministry of Agriculture of the People’s Republic of China.

Chinese fishery statistical yearbook. Chinese Agricultural

Press, Beijing, China, 2013 (in Chinese).

40. Ndong D, Chen Y Y, Lin Y H, Vaseeharan B, Chen J C. The

immune response of tilapia Oreochromis mossambicus and

its susceptibility to Streptococcus iniae under stress in low

and high temperatures. Fish Shellfish Immunol., 2007, 22,

686-694.

41. Ortuño J, Esteban M A, Meseguer J. Effects of short-term

crowding stress on the gilthead seabream (Sparus aurata L.)

innate immune response. Fish Shellfish Immunol., 2001, 11,

187-197.

42. Palmisano A N, Winton J R, Dickhoff W W. Tissue-specific

induction of Hsp90 mRNA and plasma cortisol response in

Chinook salmon following heat shock, seawater challenge,

and handling challenge. Mar. Biotechnol., 2000, 2, 329-338.

43. Park K, Lee J S, Kang J C, Kim J W, Kwak I S. Cascading

effects from survival to physiological activities, and gene

expression of heat shock protein 90 on the abalone Haliotis

discus hannai responding to continuous thermal stress. Fish

Shellfish Immunol., 2015, 42, 233-240.

44. Pérez-Casanova J C, Rise M L, Dixon B, Afonso L B O, Hall J

R, Johnson S C, Gamperl A K. The immune and stress

responses of Atlantic cod to long-term increases in water

temperature. Fish Shellfish Immunol., 2008, 24, 600-609.

45. Pickering A D, Pottinger P. Seasonal and diet changes in

plasma cortisol levels of the brown trout, Salmo trutta L.

Gener. Comp. Endocrinol., 1983, 49, 232-239.

46. Qian Z Y, Liu X L, Wang L J, Wang X Z, Li Y, Xiang J H, et al.

Gene expression profiles of four heat shock proteins in

response to different acute stresses in shrimp, Litopenaeus

vannamei. Comp. Biochem. Physiol., 2012, 156C, 211-220.

47. Reitman S, Frankel S. Colorimetric determination of

glutamic oxaloacetic and glutamic pyruvic transaminases.

Am. J. Clin. Pathol., 1957, 28, 53-56.

48. Robbins C T, Cohen Y, Davitt B B. Energy expenditure by elk

calves. J. Wildl. Manage., 1979, 43, 445-453.

49. Roberts R J, Agius C, Saliba C, Bossier P, Sung Y Y. Heat

shock proteins (chaperones) in fish and shellfish and their

potential role in relation to fish health: a review. J. Fish Dis.,

2010, 33, 789-801.

50. Sanders BM. Stress proteins in aquatic organisms: an

environmental perspective. Crit. Rev. Toxicol., 1993, 23, 49-

75.

51. Shi W L, Shan J, Liu M Z, Yan H, Huang F Q, Zhou X W, et al.

A study of the optimum demand of protein by blunt snout

bream (Megalobrama amblycephala). FAO library, 1988,

Accession no. 289611.

52. Solé M, Rodríguez V, Papiol F, Maynou F, Cartes ĵ E.

Xenobiotic metabolism in marine fish with different trophic

strategies and their relationship to ecological variables.

Comp. Biochem. Physiol. 2009, 149C, 83-89.

53. Song L, Wu L, Ni D, Chang Y, Xu W, Xing K. The cDNA

cloning and mRNA expression of heat shock protein 70

gene in the haemocytes of bay scallop (Argopecten

irradians, Lamarck 1819) responding to bacterial challenge

and naphthalin stress. Fish Shellfish Immunol., 2006, 21,

335-345.

54. Staib J L, Quindry J C, French J P, Criswell D S, Powers S K.

Increased temperature, not cardiac load, activates heat

shock transcription factor 1 and heat shock protein 72

expression in the heart. Am. J. Physiol. Regul. Integr. Comp.

Physiol., 2007, 292, R432-439.

55. Sung Y Y, MacRae T H. Heat shock proteins and disease






ARTICLE

Pag

e42

6

RESEARCH

control in aquatic organisms. J. Aquac. Res. Dev., S2 2011,

006.

56. Szymańska Z, Zylicz M. Mathematical modeling of heat

shock protein synthesis in response to temperature change.

J Theor Biol 2009; 259: 562-9.

57. Trinder P. Determination of glucose concentration in the

blood. Annals of Clinical Biochemistry, 1969, 6, 24-27.

58. Vazzana M, Cammarata M, Cooper E L, Parrinello N.

Confinement stress in sea bass (Dicentrarchus labrax)

depresses peritoneal leukocyte cytotoxicity. Aquaculture,

2002, 210, 231-243.

59. Vizzini A, Vazzana M, Cammarata M, Parrinello N. Peritoneal

cavity phagocytes from the teleost sea bass express a

glucocorticoid receptor (cloned and sequenced) involved in

genomic modulation of the in vitro chemiluminescence

response to zymosan. Gen. Comp. Endocrinol., 2007, 150,

114-123.

60. Wendelaar Bonga S E. The stress response in fish. Physiol.

Rev., 1997, 77, 591-562.

61. Wilhelm Filho D, Tribess T, Gáspari C, Claudio F D, Torres M

A, Magalhães A R M. Seasonal changes in antioxidant

defenses of the digestive gland of the brown mussel (Perna

perna). Aquaculture, 2001, 203, 149-158.

62. Xie J, Liu B, Zhou Q L, Su Y T, He Y J, Pan L K, et al. Effects of

anthraquinones extract from rhubarb R. officinale Bail on

the crowding stress response and growth of common carp

(Cyprinus carpio var. Jian). Aquaculture, 2008, 281, 5-11.

63. Xie Y J, Song L, Weng Z H, Liu S, Liu Z J. Hsp90, Hsp60 and

sHsp families of heat shock protein genes in channel catfish

and their expression after bacterial infections. Fish Shellfish

Immunol., 2015, 44, 642-651.

64. Yamamoto Y. Determination of toxicity by biochemical

method. In: Egami N, editor. Fishes as Laboratory. Soft

Science, Tokyo, 1981, 568-574 (Chapter 4).

65. Yang Y N, Ye H H, Huang H Y, Li S J, Liu X L, Zeng X L, et al.

Expression of Hsp70 in the mud crab, Scylla paramamosain

in response to bacterial, osmotic, and thermal stress. Cell

Stress and Chaperone, 2013, 18, 475-482.

66. Yeh C T, Ching L C, Yen G C. Inducing gene expression of

cardiac antioxidant enzymes by dietary phenolic acids in

rats. J. Nutr. Biochem., 2009, 20, 163-171.

67. Zhang X D, Zhu Y F, Cai L S, Wu T X. Effects of fasting on the

meat quality and antioxidant defenses of market-size

farmed large yellow croaker (Pseudosciaena crocea).

Aquaculture, 2008, 280, 136-139.

68. Zheng P, Yu B, He J, Tian G, Luo Y H, Mao X B, et al.

Protective effects of dietary arginine supplementation

against oxidative stress in weaned piglets. Br. J. Nutr., 2013,

109, 2253-2260.

69. Zhou Q C, Wang Y L, Wang H L, Tan B P. Dietary threonine

requirements of juvenile Pacific white shrimp, Litopenaeus

vannamei. Aquaculture, 2013, 392-395, 142-147.

increase in temperature affects the growth, immune, and ... · received: 26 june 2016 accepted: 10...

Documents