in vivo role of jak2 in the pathogenesis of obesity and ... · lacking jak2 in their adipocytes...
TRANSCRIPT
In Vivo Role of JAK2 in the Pathogenesis of Obesity and
the Metabolic Syndrome
By
Sally Yu Shi
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Institute of Medical Science
University of Toronto
© Copyright by Sally Yu Shi 2015
ii
In Vivo Role of JAK2 in the Pathogenesis of Obesity and the
Metabolic Syndrome
Sally Yu Shi
Doctor of Philosophy
Institute of Medical Science
University of Toronto
2015
Abstract
Obesity and the metabolic syndrome represent a serious global public health issue due to
their long-term complications including type 2 diabetes, non-alcoholic fatty liver disease,
cardiovascular disease and some cancers. As a systemic metabolic disorder, obesity affects
many organ systems and has a complex etiology. Mechanisms linking obesity to its
complications are poorly understood. The Janus kinase-signal transducers and activators
of transcription (JAK-STAT) pathway mediates the signal transduction of numerous
cytokines, growth factors and hormones that regulate energy homeostasis and metabolism
and may be important in the development of obesity and the metabolic syndrome. In this
work, we developed transgenic mouse models to investigate the in vivo metabolic role of
JAK2, an essential player in the JAK-STAT pathway, in the liver and adipose tissue under
both physiological and pathophysiological conditions. Specifically, in Chapter IV, we
deleted JAK2 in the adipose tissue and found that JAK2 deficiency resulted in increased
body weight gain and adiposity due to impaired lipolysis in visceral fat, leading to insulin
resistance and impaired glucose tolerance with aging. In Chapter V, we further explored
iii
the role of JAK2 in brown adipose tissue and show that JAK2 is required for cold- and
diet-induced uncoupling protein 1 (UCP1) expression and thermogenesis. As such, mice
lacking JAK2 in their adipocytes were cold sensitive, and were susceptible to high fat diet
(HFD)-induced obesity, insulin resistance and glucose intolerance. In Chapter VI, we
report that hepatocyte-specific deletion of JAK2 led to the development of spontaneous
lipid accumulation in the liver. Surprisingly, despite the profound hepatosteatosis, deletion
of JAK2 did not sensitize the liver to accelerated inflammatory injury on a HFD. This was
accompanied by complete protection against HFD-induced systemic insulin resistance and
glucose intolerance. Taken together, the results presented in this thesis reveal novel roles
of the JAK-STAT pathway in metabolism and may facilitate development of preventative
and therapeutic strategies for obesity and associated disorders.
iv
Acknowledgments
First and foremost, I would like to take this opportunity to say a big thank you to my
supervisor Dr. Minna Woo for all her advice, guidance and support throughout my studies.
Thank you for taking on a student with no previous research experience, and for always
having confidence in my abilities. Your guidance and encouragement has allowed me to
grow both professionally and personally. Your dedication and passion for research will
always be an inspiration. Thank you for everything!!
I would also like to thank members of my program advisory committee, Drs. Dwayne
Barber and Adria Giacca, for their tremendous help, insightful advice and constructive
criticism over the last five years. Thank you for all your time and patience!
This thesis project would not have been possible without the help of all our collaborators,
Drs. Adria Giacca, Daniel A. Winer, Robin E. Duncan, Khosrow Adeli, Richard P. Bazinet
and Kay-Uwe Wagner. I would also like to acknowledge the funding support from the
CIHR and CDA. My graduate work was supported by NSERC, CIHR, CDA, CLF, OGS
and BBDC. I would also like to acknowledge Rubén García Martin, who set the foundation
for the work presented in Chapter VI of this thesis. I am very grateful for his input.
To all past and present members of the Woo lab, Stephanie, Erica, Cynthia, Tara, Jara,
Shun-Yan, Wei, Diana and Lin, my great colleagues and true friends. Thank you for all the
support, encouragement and advice. You have made these years in the lab much more
memorable and exciting. Your friendship will be cherished forever.
v
To Grace, Sophia and Linda, thank you for your company throughout these years. I will
always remember all the laughter, tears and the wonderful moments we had together.
I would like to dedicate this thesis to my parents, who made a tremendous amount of
sacrifices to make sure I can have the best opportunities in life. I thank them for their
unconditional and unwavering love, support and encouragement throughout my life. I am
forever grateful for everything they have done for me.
Last but not least, to my husband and best friend Shicong. Meeting you was the best thing
that happened in my PhD years. Thank you for supporting all my decisions and for always
believing in me. You are the motivation behind all my work.
vi
Publications arising from this thesis work
1. Shi SY, Zhang W, Sivasubramaniyam T, Brunt JJ, Schroer SA, Wagner KU, and
Woo M. Janus kinase 2 (JAK2) promotes brown adipose function and is required for
diet- and cold-induced thermogenesis in mice. Under peer review in Diabetologia.
2. Shi SY, Luk CT, Brunt JJ, Sivasubramaniyam T, Lu SY, Schroer SA, and Woo M.
(2014) Adipocyte-specific deficiency of Janus kinase (JAK) 2 in mice impairs
lipolysis and increases body weight, and leads to insulin resistance with ageing.
Diabetologia. 57(5):1016-26.
3. Shi SY*, Martin RG*, Duncan RE, Choi D, Lu SY, Schroer SA, Cai EP, Luk CT,
Hopperton KE, Domenichiello AF, Tang C, Naples M, Dekker MJ, Giacca A, Adeli
K, Wagner KU, Bazinet RP, and Woo M. (2012) JAK2 deletion in liver leads to
profound steatosis without progression to steatohepatitis and protects against glucose
intolerance. J. Biol. Chem. 287(13):10277-88.
*Authors with equal contributions
vii
Other publications
1. Shi SY, Lu SY, Sivasubramaniyam T, Cai EP, Luk CT, Schroer SA, Kim RH, Mak
TW and Woo M. DJ-1 links muscle ROS production with metabolic reprogramming
and systemic energy homeostasis in mice. Accepted at Nat. Commun.
2. Revelo XS, Ghazarian M, Chng MHY, Shi SY, Luck H, Tsai S, Lei H, Kenkel J, Liu
CL, Tangsombatvisit S, Tsui H, Sima C, Lewis GF, Shen L, Woo M, Utz PJ, Glogauer
M, Engleman E, Winer S, and Winer DA. Nucleic acid targeting pathways promote
inflammation in obesity related insulin resistance. Under peer review in Nat.
Commun.
3. Luck H, Tsai S, Chung J, Clemente-Casares X, Ghazarian M, Revelo XS, Lei H, Luk
CT, Shi SY, Surendra A, Copeland JK, Ahn J, Prescott D, Rasmussen BA, Chng
MHY, Engleman EG, Girardin SE, Lam TKT, Croitoru K, Dunn S, Philpott DJ,
Guttman DS, Woo M, Winer S, and Winer DA. (2015) Regulation of obesity-related
insulin resistance with gut anti-inflammatory agents. Cell. Metab. 21(4):527-42.
4. Wang L, Luk CT, Cai EP, Schroer SA, Allister EM, Shi SY, Wheeler MB, Gaisano
HY, and Woo M. (2015) PTEN deletion in pancreatic α cells protects against high
fat diet-induced hyperglucagonemia and insulin resistance. Diabetes. 64(1):147-57.
viii
5. Revelo XS, Tsai S, Lei H, Luck H, Ghazarian M, Tsui H, Shi SY, Schroer S, Luk C,
Lin GHY, Mak TW, Woo M, Winer S, and Winer D. (2015) Perforin is a novel
immune regulator of obesity related insulin resistance. Diabetes. 64(1):90-103.
6. Cai EP, Luk CT, Wu X, Schroer SA, Shi SY, Sivasubramaniyam T, Brunt JJ,
Zacksenhaus E, and Woo M. (2014) Rb and p107 are required for alpha cell survival,
beta cell cycle control and glucagon-like peptide-1 action. Diabetologia.
57(12):2555-65.
7. Brunt JJ, Shi SY, Schroer SA, Sivasubramaniyam T, Cai EP, and Woo M. (2014)
Overexpression of HIF-2α in pancreatic beta cells does not alter glucose homeostasis.
Islets. 6(5-6):e1006075.
8. Luk CT, Shi SY, Choi D, Cai EP, Schroer SA, and Woo M. (2013) In vivo
knockdown of adipocyte erythropoietin receptor does not alter glucose or energy
homeostasis. Endocrinology. 154(10):3652-9.
9. Cai EP, Casimir M, Schroer SA, Luk CT, Shi SY, Choi D, Dai XQ, Hajmrle C,
Spigelman AF, Zhu D, Gaisano HY, MacDonald PE, and Woo M. (2012) In vivo role
of focal adhesion kinase in regulating pancreatic β-cell mass and function through
insulin signalling, actin dynamics and granule trafficking. Diabetes. 61(7):1708-18.
ix
Table of Contents
ACKNOWLEDGMENTS ................................................................................................................... IV
PUBLICATIONS ARISING FROM THIS THESIS WORK .................................................................... VI
OTHER PUBLICATIONS ................................................................................................................. VII
LIST OF TABLES ........................................................................................................................... XII
LIST OF FIGURES ........................................................................................................................ XIII
LIST OF ABBREVIATIONS ............................................................................................................. XV
CHAPTER I : INTRODUCTION ......................................................................................................... 1
I. 1. Obesity, Insulin Resistance, and the Metabolic Syndrome ......................................................... 2
I.1.1 Obesity and insulin resistance ...................................................................................................... 2
I.1.1.1 Obesity .................................................................................................................................. 2
I.1.1.2 The metabolic syndrome ....................................................................................................... 3
I.1.1.3 Insulin resistance ................................................................................................................... 4
I.1.2 White adipose tissue ..................................................................................................................... 6
I.1.2.1 Obesity and adipose tissue expansion ................................................................................... 6
I.1.2.2 Adipogenesis ......................................................................................................................... 8
I.1.2.3 Role of white adipose tissue in lipid metabolism .................................................................10
I.1.2.4 Adipokines ...........................................................................................................................11
I.1.2.4.1 Leptin ............................................................................................................................12
I.1.2.4.2 Adiponectin ...................................................................................................................13
I.1.2.4.3 Tumour necrosis factor alpha (TNF-α) .........................................................................15
I.1.2.4.4 Interleukin 6 (IL-6) ........................................................................................................15
I.1.2.4.5 Resistin ..........................................................................................................................16
I.1.2.4.6 Monocyte chemoattractant protein 1 (MCP-1) .............................................................17
I.1.3 Brown adipose tissue (BAT) .......................................................................................................18
I.1.3.1 BAT and non-shivering thermogenesis ................................................................................19
I.1.3.2 BAT and metabolic control ..................................................................................................21
I.1.4 Pathogenesis of obesity-induced insulin resistance and metabolic dysfunction .........................23
I.1.4.1 Initiating events ....................................................................................................................24
I.1.4.2 Alteration in immune cells ...................................................................................................28
I.1.4.3 Disrupted adipokine secretion ..............................................................................................29
I.1.4.4 Elevated FFA levels and lipotoxicity ...................................................................................30
I.1.4.5 Oxidative stress ....................................................................................................................32
I.1.4.6 Molecular mechanisms of insulin resistance ........................................................................33
I.1.4.6.1 JNK and IKKβ/NF-κB signalling ..................................................................................33
I.1.4.6.2 Protein kinase C (PKC) activation ................................................................................34
I.1.4.6.3 Induction of SOCS proteins ...........................................................................................35
I. 2. Non-Alcoholic Fatty Liver Disease (NAFLD) .............................................................................36
I.2.1 NAFLD .......................................................................................................................................36
I.2.2 Disease spectrum of NAFLD ......................................................................................................37
x
I.2.3 Role of the liver in metabolism ...................................................................................................38
I.2.3.1 Role of the liver in glucose metabolism ...............................................................................38
I.2.3.2 Role of the liver in lipid metabolism....................................................................................39
I.2.4 Pathogenesis of NAFLD .............................................................................................................40
I.2.4.1 Development of steatosis .....................................................................................................40
I.2.4.2 Progression to NASH ...........................................................................................................42
I. 3. Janus Kinase 2 (JAK2) .................................................................................................................47
I.3.1 JAK-STAT signalling .................................................................................................................47
I.3.2 JAK protein structure and regulatory mechanisms .....................................................................49
I.3.3 Crosstalk of JAK-STAT with other signalling pathways ............................................................52
I.3.4 In vivo function of JAK2 .............................................................................................................53
I.3.5 Role of JAK-STAT pathway in adipose physiology ...................................................................55
I.3.5.1 Role of JAK-STAT pathway in WAT .................................................................................55
I.3.5.2 Role of JAK-STAT pathway in BAT...................................................................................57
I.3.6 Role of JAK2-STAT signalling in the liver ................................................................................59
I.3.6.1 Role of JAK2-STAT signalling in hepatic lipid homeostasis ..............................................59
I.3.6.2 Role of JAK2-STAT signalling in hepatic inflammation and NAFLD progression ............61
CHAPTER II : THESIS OBJECTIVES AND HYPOTHESES .............................................................. 63
CHAPTER III : MATERIALS AND METHODS................................................................................ 68
III. 1 Mouse protocol ............................................................................................................................69
III. 2 DNA extraction ............................................................................................................................70
III. 3 Polymerase chain reaction (PCR) genotyping ..........................................................................71
III. 4 In vivo metabolic studies .............................................................................................................72
III. 5. Body temperature and cold exposure .......................................................................................73
III. 6 Body composition by nuclear magnetic resonance spectroscopy (Chapter IV) ......................73
III. 7 Ex vivo lipolysis (Chapter IV)......................................................................................................74
III. 8 Hyperinsulinemic-euglycemic clamp (Chapter VI) ...................................................................75
III. 9 Analyses of serum parameters ...................................................................................................76
III. 10 Hepatic lipid content and FA composition (Chapter VI) ........................................................76
III. 11 Histology, immunohistochemistry and immunofluorescence ................................................78
III. 12 RNA isolation and quantitative reverse transcription (RT)-PCR ........................................79
III. 13 Immunoblotting .........................................................................................................................81
III. 14 Statistical analysis .....................................................................................................................82
CHAPTER IV : ROLE OF ADIPOSE JAK2 IN WHITE ADIPOSE TISSUE BIOLOGY AND LIPID
METABOLISM ................................................................................................................................ 83
IV. 1 Introduction .................................................................................................................................84
IV. 2 Mouse Model and Experimental Design ....................................................................................86
IV. 3 Results ..........................................................................................................................................88
IV. 3-1 Disruption of adipocyte JAK2 increases body weight ........................................................88
IV. 3-2 Disruption of adipocyte JAK2 leads to increased adiposity ...............................................92
IV. 3-3 A-JAK2 KO mice have normal energy metabolism at 1 month of age, but display reduced
energy expenditure as they age .......................................................................................................94
xi
IV. 3-4 Adipose JAK2 deficiency leads to impaired lipolysis ........................................................96
IV. 3-5 A-JAK2 KO mice have disrupted adipokine secretion .......................................................99
IV. 3-6 A-JAK2 KO mice show impaired insulin sensitivity as they age .....................................101
IV. 4 Summary ....................................................................................................................................107
CHAPTER V : ROLE OF ADIPOSE JAK2 IN BAT FUNCTION AND THERMOGENESIS ............... 108
V. 1 Introduction .................................................................................................................................109
V. 2 Mouse Model and Experimental Design ...................................................................................111
V. 3 Results ..........................................................................................................................................113
V. 3-1 Adipocyte JAK2 expression and diet-induced thermogenesis ...........................................114
V. 3-2 JAK2 is required for diet-induced UCP1 expression and thermogenesis in BAT..............116
V. 3-3 Increased weight gain in HFD-fed A-JAK2 KO mice .......................................................121
V. 3-4 A-JAK2 KO mice develop HFD-induced insulin resistance and glucose intolerance .......121
V. 3-5 JAK2 is required for cold-induced UCP1 expression and thermogenesis in BAT .............123
V. 4 Summary .....................................................................................................................................125
CHAPTER VI : ROLE OF HEPATIC JAK2 IN METABOLISM AND INFLAMMATION ................... 127
VI. 1 Introduction ...............................................................................................................................128
VI. 2 Mouse Model and Experimental Design ..................................................................................130
VI. 3 Results ........................................................................................................................................134
VI. 3-1 L-JAK2 KO mice develop progressive hepatic steatosis ..................................................134
VI. 3-2 L-JAK2 KO mice do not progress to steatohepatitis on a high fat diet (HFD) .................138
VI. 3-3 L-JAK2 KO mice display impaired hepatic insulin signalling but normal systemic insulin
sensitivity ......................................................................................................................................139
VI. 3-4 L-JAK2 KO mice are protected from diet-induced glucose intolerance ...........................141
VI. 3-5 L-JAK2 KO mice exhibit impaired hepatic GH signalling ...............................................143
VI. 3-6 L-JAK2 KO mice display a reduction in adiposity and an increase in energy expenditure
.......................................................................................................................................................146
VI. 4 Summary ....................................................................................................................................148
CHAPTER VII : DISCUSSION AND FUTURE PERSPECTIVES ...................................................... 152
VII. 1 The role of adipocyte JAK2 in white adipocyte biology and lipid metabolism...................153
VII. 2 The role of adipocyte JAK2 in BAT function and thermogenesis .......................................155
VII. 3 The role of adipocyte JAK2 in whole-body metabolic regulation ........................................159
VII. 4 The role of hepatocyte JAK2 in hepatic lipid metabolism ...................................................160
VII. 5 The role of hepatocyte JAK2 in whole-body metabolic regulation and glucose homeostasis
..............................................................................................................................................................162
VII. 6 Concluding remarks and future direction .............................................................................165
CHAPTER VIII : REFERENCES ................................................................................................... 167
CHAPTER IX : PERMISSIONS ..................................................................................................... 194
xii
List of Tables
Table 1: Primer sequences for quantitative RT-PCR ................................................................... 80
xiii
List of Figures
Chapter I: Introduction
Figure I-1 Mechanism of obesity-induced adipose expansion and inflammation. ........................ 25
Figure I-2 Proposed mechanism of NAFLD pathogenesis. ........................................................... 43
Figure I-3 Canonical JAK-STAT signalling pathway. .................................................................. 48
Figure I-4 Domain structure of JAK kinases. ................................................................................ 50
Chapter IV: Role of adipose JAK2 in white adipose tissue biology and lipid
metabolism
Figure IV-1 Efficient and specific deletion of JAK2 in adipose tissue. ........................................ 90
Figure IV-2 Increased body weight in A-JAK2 KO mice. ............................................................ 91
Figure IV-3 Increased adiposity in A-JAK2 KO mice. ................................................................. 93
Figure IV-4 No change in energy balance in A-JAK2 KO mice at 1 month of age. ..................... 95
Figure IV-5 Reduced energy expenditure in A-JAK2 KO mice at 5 to 6 months of age. ............. 97
Figure IV-6 Dysregulated expression of lipid metabolism genes in white adipose tissue from A-
JAK2 KO mice. ............................................................................................................................. 98
Figure IV-7 Impaired lipolysis and disrupted lipid homeostasis in A-JAK2 KO mice. .............. 100
Figure IV-8 Disrupted adipokine profile in A-JAK2 KO mice. .................................................. 102
Figure IV-9 Normal glucose homeostasis in A-JAK2 KO mice at 2 months of age. ................. 103
Figure IV-10 Impaired glucose tolerance in A-JAK2 KO mice at 5 to 6 months of age. ........... 105
Figure IV-11 Whole-body insulin resistance in A-JAK2 KO mice at 5 to 6 months of age. ...... 106
Chapter V: Role of adipose JAK2 in BAT function and thermogenesis
Figure V-1 Adipocyte JAK2 expression and diet-induced thermogenesis. ................................. 115
Figure V-2 JAK2 is required for diet-induced UCP1 expression and energy expenditure in BAT.
..................................................................................................................................................... 117
Figure V-3 Impaired BAT function in A-JAK2 KO mice. .......................................................... 119
Figure V-4 Reduced STAT3 and 5 phosphorylation in BAT from A-JAK2 KO mice. .............. 120
Figure V-5 Development of diet-induced obesity in A-JAK2 KO mice. .................................... 122
Figure V-6 HFD-induced insulin resistance and glucose intolerance in A-JAK2 KO mice. ...... 124
Figure V-7 Increased sensitivity to cold exposure in HFD-fed A-JAK2 KO mice. .................... 126
xiv
Chapter VI: Role of hepatic JAK2 in metabolism and inflammation
Figure VI-1 Attenuated JAK2 expression in the liver of L-JAK2 KO mice. .............................. 131
Figure VI-2 Progressive hepatic steatosis in L-JAK2 KO mice. ................................................. 136
Figure VI-3 Hepatic expression of genes involved in lipid metabolism. .................................... 137
Figure VI-4 No progression to steatohepatitis on a HFD in L-JAK2 KO mice. ......................... 140
Figure VI-5 Attenuated hepatic insulin sensitivity but normal systemic insulin sensitivity in L-
JAK2 KO mice. ........................................................................................................................... 142
Figure VI-6 L-JAK2 KO mice are protected from glucose intolerance. ..................................... 144
Figure VI-7 L-JAK2 KO mice exhibit impaired hepatic GH signaling. ..................................... 145
Figure VI-8 L-JAK2 KO mice display a reduction in adiposity. ................................................ 147
Figure VI-9 L-JAK2 KO mice display an increase in energy expenditure. ................................ 149
Figure VI-10 Proposed model of the mechanism for the observed phenotype in L-JAK2 KO mice.
..................................................................................................................................................... 151
xv
List of Abbreviations
Akt/PKB v-akt murine thymoma viral oncogene homolog/protein kinase B
ALT Alanine aminotransferase
AMPK AMP-activated protein kinase
AP2 Adipocyte protein 2
AST Aspartate aminotransferase
ATGL Adipose triglyceride lipase
BAT Brown adipose tissue
BMI Body mass index
BSA Bovine serum albumin
cAMP Cyclic adenosine monophosphate
C/EBP CCAAT/enhancer-binding protein
CAP1 adenylyl cyclase-associated protein 1
CCR2 CC motif chemokine receptor 2
CNTF Ciliary neurotrophic factor
DAG Diacylglycerol
DEPC Diethylpyrocarbonate
DGAT Diacylglycerol acyltransferase
DNA Deoxyribonucleic acid
EDTA Ethylenediaminetetraacetic acid
ER Endoplasmic reticulum
FERM Band-4.1, ezrin, radixin, moesin
FFA Free fatty acid
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GH Growth hormone
GHR Growth hormone receptor
GLUT4 Glucose transporter 4
GSIS Glucose-stimulated insulin secretion
GTT Glucose tolerance test
H and E Hematoxylin and eosin
HDL High density lipoprotein
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HFD High fat diet
HPLC High-performance liquid chromatography
HSL Hormone sensitive lipase
IFNγ Interferon gamma
IGF-1 Insulin-like growth factor 1
IKK IκB kinase
IL-6 Interleukin-6
IRS Insulin receptor substrate
ITT Insulin tolerance test
JAK Janus kinase
JNK c-Jun N-terminal kinase
LDL Low density lipoprotein
LIF Leukemia inhibitory factor
LPS Lipopolysaccharide
xvi
MAPK Mitogen-activated protein kinase
MCP1/CCL2 Monocyte chemoattractant protein 1/chemokine (C-C motif) ligand 2
M-MLV Maloney murine leukemia virus
mRNA Messenger ribonucleic acid
mTOR Mammalian target of rapamycin
NAFLD Non-alcoholic fatty liver disease
NASH Non-alcoholic steatohepatitis
OSM Oncostatin M
PAGE polyacrylamide gel electrophoresis
PAI-1 plasminogen activator inhibitor-1
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PEPCK Phosphoenolpyruvate carboxykinase
PGC-1α Peroxisome proliferator-activated receptor γ coactivator 1-alpha
PI3K Phosphoinositide 3 kinase
PKA Protein kinase A
PKC Protein kinase C
PMSF Phenylmethanesulfonylfluoride
PPAR Peroxisome proliferator-activated receptor
RBP4 Retinol binding protein 4
RER Respiratory exchange ratio
ROS Reactive oxygen species
RT-PCR Reverse transcription polymerase chain reaction
SAT Subcutaneous adipose tissue
SCD1 Steaoryl CoA desaturase
SDS sodium dodecylsulfate
SDS Sodium dodecyl sulfate
SEM Standard error of the mean
SH2 Src homology 2
SOCS Suppressor of cytokine signalling
STAT Signal transducer and activator of transcription
TBST Tris-buffered saline with Tween 20
TGFβ Transforming growth factor beta
TLR Toll-like receptor
TNFR TNF receptor
TNF-α Tumour necrosis factor alpha
Tris Tris(hydroxymethyl)aminomethane
UCP Uncoupling protein
VAT Visceral adipose tissue
VCO2 Volume of carbon dioxide production
VLDL Very low density lipoprotein
VO2 Volume of oxygen consumption
1
Chapter I: Introduction
2
I. 1. Obesity, Insulin Resistance, and the Metabolic Syndrome
I.1.1 Obesity and insulin resistance
I.1.1.1 Obesity
Obesity is characterized by excessive accumulation of body fat in the adipose tissue, to the
extent that health may be impaired (WHO, 2000). In clinical and epidemiological settings,
overweight is defined as a body mass index (BMI) equal to or greater than 25 kg/m2, where
BMI is calculated as body weight divided by height squared. Obesity is defined as a BMI
equal to or greater than 30 kg/m2 (WHO, 2000).
Obesity is a fast expanding global epidemic. The World Health Organization estimated
that by 2008, as many as 1.46 billion adults globally were classified as overweight and
more than 500 million adults were obese (Finucane et al., 2011). Between 1980 and 2013,
the proportion of overweight adults worldwide increased from 28.8% to 36.9% in men, and
from 29.8% to 38.0% in women (Ng et al., 2014). Furthermore, within this timeframe,
global prevalence of obesity rose by 47.1% in children (Ng et al., 2014). Overall, an
estimated 170 million children worldwide were overweight or obese (Lobstein et al., 2004),
and this number is still increasing at an alarming rate (Ng et al., 2014).
The obesity epidemic is imposing an unprecedented health, economic and social burden
on the modern society due to its serious health consequences. A large body of evidence has
linked a high BMI to increased risk of type 2 diabetes, cardiovascular disease, non-
3
alcoholic fatty liver disease (NAFLD), osteoarthritis, cancer and other co-morbidities
(Berrington de Gonzalez et al., 2010; Flegal et al., 2007; Zheng et al., 2011), and obesity
increases the risk of all-cause mortality (Flegal et al., 2013). In 2010, overweight and
obesity together were estimated to account for 3.4 million deaths worldwide and 3.8% of
global disability-adjusted life-years (Lim et al., 2012).
I.1.1.2 The metabolic syndrome
The metabolic syndrome, also known as syndrome X or the insulin resistance syndrome,
is a common metabolic disorder closely associated with obesity (Alberti et al., 2005). It is
characterized by a constellation of metabolic abnormalities including central obesity,
glucose intolerance, insulin resistance, dyslipidemia and hypertension that together
increase the risk of cardiovascular disease (Alberti et al., 2005). By the current definition,
it is estimated to affect 20-25% of the world population (Eckel et al., 2005), and this
prevalence is expected to increase given the global obesity epidemic.
Individuals with the metabolic syndrome are at twice the risk of developing cardiovascular
disease (Isomaa et al., 2001; Lakka et al., 2002) and a five-fold increased risk of
developing type 2 diabetes (Hanson et al., 2002). This is not surprising, given that the
metabolic disorders that define the insulin resistance syndrome are established risk factors
for diabetes and cardiovascular disease (Despres and Lemieux, 2006). Obesity, especially
visceral obesity, is thought to be the common initiating event predisposing to development
of all the metabolic abnormalities (Despres and Lemieux, 2006). Accordingly, better
4
understanding of the regulation of energy balance and how obesity predisposes to its
complications is urgently needed for the development of effective measures to reverse the
obesity epidemic.
I.1.1.3 Insulin resistance
Insulin resistance, characterized by reduced responsiveness to the action of insulin at its
target tissues, is frequently associated with obesity and plays a central role in the
development of the metabolic syndrome (Eckel et al., 2005). Insulin, secreted from
pancreatic β cells following nutrient consumption, promotes glucose uptake in skeletal
muscle and adipose tissue via glucose transporter 4 (GLUT4) and inhibits glucose
production in the liver, serving as a critical regulator of blood glucose levels (Saltiel and
Kahn, 2001). When energy supply exceeds demand, insulin promotes the storage of
nutrients by stimulating synthesis of glycogen, protein and lipids in the liver, skeletal
muscle and adipose tissue, and inhibiting gluconeogenesis, glycogenolysis, protein
breakdown and lipolysis (Saltiel and Kahn, 2001). In addition, insulin promotes the
conversion of carbohydrate and protein to lipids, which serve as a more efficient way to
store calories (Plutzky, 2009).
Action of insulin is mediated via the insulin receptor, a tyrosine kinase that undergoes
autophosphorylation upon activation (Patti and Kahn, 1998). Activated insulin receptor
recruits and phosphorylates adaptors molecules such as the insulin receptor substrate (IRS)
family of proteins, which interact with various signalling partners through their Src
5
homology 2 (SH2) domains, resulting in the activation of diverse signalling pathways
(White, 1998). Among them, the phosphoinositide 3 kinase (PI3K) - v-akt murine
thymoma viral oncogene homolog (Akt; also known as protein kinase B (PKB)) pathway
plays a major role in mediating the metabolic action of insulin (Shepherd et al., 1995). The
mammalian target of rapamycin (mTOR) and downstream signalling molecules regulate
protein synthesis (Thomas and Hall, 1997), and both the PI3K-Akt and the Ras/mitogen-
activated protein kinase (MAPK) pathways are important for the growth and mitogenic
effects of insulin (Boulton et al., 1991). These signalling cascades act in a coordinated
manner to regulate enzyme activities, vesicle trafficking, protein synthesis and gene
expression which together regulate metabolism and other cellular functions (Saltiel and
Kahn, 2001).
At the molecular level, insulin resistance is characterized by reductions in the concentration
and kinase activity of the insulin receptor, the phosphorylation status of IRS proteins, PI3K
activity, and intracellular enzyme activities (Pessin and Saltiel, 2000). Of note, both the
insulin receptor and IRS proteins can be phosphorylated at specific serine sites, which
attenuate signal transduction by inhibiting tyrosine phosphorylation (Paz et al., 1997). In
addition, protein tyrosine phosphatases can negatively regulate insulin signalling by
catalyzing the rapid dephosphorylation of the insulin receptor and IRS proteins (Elchebly
et al., 1999). Furthermore, the suppressor of cytokine signalling (SOCS) family of proteins,
initially discovered as negative regulators of cytokine signalling, has also been implicated
6
in the modulation of insulin signal transduction (Howard and Flier, 2006), which will be
discussed in more detail in Section I.1.4.6.
Together, diminished response to insulin results in the reduced uptake of circulating
glucose by insulin-responsive tissues and increased hepatic glucose production, leading to
elevated blood glucose levels (Pessin and Saltiel, 2000). At early stages of disease,
pancreatic β cells will compensate by augmenting their secretion of insulin, resulting in
hyperinsulinemia (Kahn, 2003). However, progressive β cell dysfunction occurs during
this stage, and eventually insulin secretion can no longer compensate for the defects in
peripheral insulin action, culminating in overt hyperglycemia and diabetes (Kahn, 2003).
Both obesity and lipodystrophy (selective loss of body fat) lead to the development of
insulin resistance (Shimomura et al., 1998; Sims et al., 1973; Sovik et al., 1996),
suggesting that adipose tissue is involved in metabolic regulation. Indeed, adipose tissue
dysfunction is proposed to play a cardinal role in the development of obesity-associated
insulin resistance and other metabolic complications.
I.1.2 White adipose tissue
I.1.2.1 Obesity and adipose tissue expansion
The drastic increase in obesity prevalence over the last few decades is largely attributed to
a shift towards energy-dense diets, resulting in an upsurge in total caloric intake (Gross et
7
al., 2004; Wing, 1995), and a sedentary lifestyle accompanied by a general decline in
physical activity (Hu et al., 2003). Together this leads to energy imbalance where intake
of calories exceeds energy expenditure, and the resulting excess energy is stored as body
weight, primarily in the adipose tissue (Swinburn et al., 2011).
Adipose tissue was once thought to be an inert energy storage organ, but is emerging as a
crucial regulator of many physiological processes. In addition to regulating energy
homeostasis and nutrient metabolism, adipose tissue is involved in body temperature
control, regulation of blood pressure, the immune response, angiogenesis, bone mass,
hemostasis, and reproductive function (Rosen and Spiegelman, 2006).
In mammals, the predominant adipose tissue is white adipose tissue, which serves to store
energy in the form of neutral triglycerides in periods of fuel surplus (Rosen and Spiegelman,
2006). Triglycerides are stored as single or multiple droplets in the cytoplasm, which give
white adipocytes their characteristic round morphology. Storage of lipid in large amounts
and in a form that is not toxic to the body may be considered one of the most important
functions of adipocytes (Rosen and Spiegelman, 2006).
In addition to adipocytes, adipose tissue also contains preadipocytes, fibroblasts,
endothelial cells and a variety of immune cells, especially macrophages and T cells (Sun
et al., 2011). The presence of immune cells within the adipose tissue is highly regulated.
The dynamic interaction between these immune cells and adipocytes via cytokine and
chemokine signalling contributes to adipose tissue homeostasis and plays a critical role in
8
adipose remodelling and the subsequent pro-inflammatory response frequently observed
in the obese state (Sun et al., 2011).
It is important to note that not all adipose tissues are equal – there are critical depot-specific
differences in terms of cell size, vasculature, expansion capacity, response to hormonal
signals and potential role in metabolic diseases (Ibrahim, 2010; Krotkiewski et al., 1983).
For example, visceral adipose tissue (VAT) that surrounds internal organs contains cells
that are more metabolically active and more sensitive to lipolysis than subcutaneous
adipose tissue (SAT), which is located beneath the skin (Ibrahim, 2010). VAT is also
generally considered more pathogenic such that its expansion is associated with
development of insulin resistance (Gastaldelli et al., 2002), whereas increased SAT does
not predispose to metabolic dysfunction (Ibrahim, 2010).
I.1.2.2 Adipogenesis
Adipose tissue arises from multipotent fibroblasts in the embryonic mesoderm (Rosen and
MacDougald, 2006). These fibroblasts are capable of differentiating into preadipocytes,
cartilage, bone or muscle. In humans, differentiation of preadipocytes begins during the
late embryonic development stage and occurs most extensively after birth, although
preadipocytes retain the ability to differentiate throughout life (Burdi, 1985). On the other
hand, in rodents, the process of preadipocyte differentiation begins after birth (Ailhaud,
1992).
9
Study of the murine preadipocyte 3T3-L1 cell line has provided valuable insight into the
regulation of adipogenesis (Green and Kehinde, 1975). For practical purposes, adipocyte
differentiation is generally divided into two phases. During the first phase, known as
determination, a pluripotent stem cell is committed to the adipocyte lineage, which results
in the formation of a preadipocyte that can no longer differentiate into other cell types
(Rosen and MacDougald, 2006). The second phase, known as terminal differentiation,
involves the acquisition of the characteristics of mature adipocytes by the preadipocyte
(Rosen and MacDougald, 2006).
The master regulator of terminal white adipocyte differentiation is peroxisome proliferator-
activated receptor gamma (PPARγ), a member of the nuclear receptor superfamily
(Spiegelman, 1998). Activation of this receptor in fibroblasts is both necessary and
sufficient for adipogenesis, with induction of morphological changes, lipid accumulation
and expression of genes important for adipocyte function (Tontonoz et al., 1994). Another
transcription factor family with an essential role in adipogenesis is CCAAT/enhancer-
binding proteins (C/EBPs). C/EBPβ and C/EBPδ are induced early during adipocyte
differentiation and drive the expression of PPARγ (Tanaka et al., 1997; Tang et al., 2003).
On the other hand, C/EBPα, which is induced by C/EBPβ and C/EBPδ, maintains PPARγ
expression in the later stages of differentiation and can activate many adipocyte genes
directly (Rosen et al., 2002; Wu et al., 1999).
10
I.1.2.3 Role of white adipose tissue in lipid metabolism
Adipose tissue is an important regulator of whole-body lipid flux. During times of energy
shortage, activation of adrenergic receptors by catecholamines stimulates white adipocytes
to hydrolyze triglycerides in a process termed lipolysis (Emorine et al., 1989). This is
mediated through the action of lipases, mainly hormone sensitive lipase (HSL) and adipose
triglyceride lipase (ATGL) (Arner, 2005; Zimmermann et al., 2004). Briefly, activation of
adrenergic signalling in adipocytes leads to an increase in intracellular cyclic adenosine
monophosphate (cAMP) levels and subsequent activation of protein kinase A (PKA).
Activated PKA phosphorylates perilipin 1, thus promoting the release of comparative gene
identification 58 (CGI-58), which binds and stimulates ATGL (Lass et al., 2006).
Activated ATGL catalyzes the hydrolysis of triglycerides into diacylglycerols (DAGs)
(Zimmermann et al., 2004). In addition, phosphorylation of cytoplasmic HSL by PKA
leads to its activation and translocation to the surface of lipid droplets. Activated HSL binds
to phosphorylated perilipin 1, thereby gaining access to its DAG substrates and converting
them into monoacylglycerols (Zechner et al., 2012). Final hydrolysis of monoacylglycerols
is catalyzed by monoacylglycerol lipase (Zechner et al., 2012). The liberated glycerol and
free fatty acids (FFAs) are released into the circulation and transported to other peripheral
tissues for energy generation so carbohydrates are spared for use by neurons (Arner, 2005).
Glycerol is used as a gluconeogenic substrate in the liver, whereas FFAs are taken up by
most cell types and oxidized in the mitochondria (Arner, 2005).
11
In the fed state, lipolysis in adipocytes is suppressed by insulin through its inhibitory action
on HSL (Frayn et al., 1994). At the same time, insulin promotes glucose uptake and
metabolism as well as de novo lipogenesis in adipose tissue (Frayn et al., 1994). Glucose
metabolism leads to the generation of acetyl-CoA, which is used by acetyl-CoA
carboxylase and fatty acid synthase to produce palmitate during de novo lipogenesis.
Palmitate is then modified by elongase and desaturase enzymes to generate other fatty acid
species (Hellerstein, 2001).
Nevertheless, most fatty acids in the adipose tissue come from dietary sources. Lipids
absorbed in the intestine are packaged into chylomicrons that enter the systemic circulation
via the lymphatic system (Brown et al., 1981). These chylomicrons deliver lipids to
peripheral organs including the adipose tissue, which expresses lipoprotein lipase that
hydrolyzes triglycerides in the chylomicrons (Goldberg, 1996). The released fatty acids are
then taken up into adipocytes. Together with lipids from de novo lipogenesis, these fatty
acids are esterified to triglycerides and stored.
I.1.2.4 Adipokines
In addition to lipid storage, adipocytes synthesize and secrete numerous soluble factors and
cytokines collectively referred to as adipokines (Ouchi et al., 2011). Different adipose
depots secrete distinct profiles of adipokines, and adipokine production can be modified
by changes in the structure and cellular composition of the tissue under both physiological
and pathological conditions (Samaras et al., 2010). These adipokines act locally in a
12
paracrine fashion to regulate adipose tissue biology and signal systemically to various
organs to regulate a myriad of physiological functions (Ouchi et al., 2011). Some of the
more well-studied adipokines are discussed below.
I.1.2.4.1 Leptin
Leptin, the first adipokine identified to play a role in body weight regulation (Halaas et al.,
1995), was cloned as the product of the obese gene in ob/ob mice (Zhang et al., 1994).
These mice exhibit hyperphagia (abnormally increased appetite for food) and develop
marked obesity and insulin resistance, which can be reversed by exogenous leptin
treatment (Pelleymounter et al., 1995). Secreted mostly by the adipose tissue in proportion
to extent of adiposity, leptin acts on the central nervous system to repress food intake
(Friedman and Halaas, 1998). This action of leptin is mediated by OB-R leptin receptors,
which are structurally similar to class I cytokine receptors and activate the Janus kinase 2
(JAK2)-signal transducer and activator of transcription 3 (STAT3) pathway (Tartaglia et
al., 1995). The mediobasal hypothalamus expresses high levels of the leptin receptor, and
activation of leptin signalling in this region induces anorexigenic pathways such as those
involving pro-opionmelanocortin, POMC, and cocaine and amphetamine-regulated
transcript, CART, and suppresses orexigenic pathways including those involving
neuropeptide Y and agouti-related peptide, AgRP (Schwartz et al., 1996).
In addition to regulating food intake and energy balance, leptin plays a direct role in
glucose homeostasis through actions on peripheral metabolic tissues including skeletal
13
muscle and the liver (Kamohara et al., 1997; Minokoshi et al., 2002). Administration of
leptin to ob/ob mice corrects hyperglycemia before any significant effect on body weight
(Pelleymounter et al., 1995). In addition, leptin improves insulin resistance and glucose
homeostasis in lipodystrophic mice and in humans with lipodystrophy or congenital leptin
deficiency (Oral et al., 2002; Shimomura et al., 1999).
Leptin is thought to have pro-inflammatory properties by stimulating the production of
TNF-α, IL-6 and reactive oxygen species (ROS) in monocytes and chemokine ligands in
macrophages (Kiguchi et al., 2009). In T cells, leptin induces the production of the Th1-
type cytokines, IFNγ and IL-2, and suppresses the Th2-type cytokine IL-4, thus favoring
polarization of T cells towards a Th1 phenotype (Lord et al., 1998).
I.1.2.4.2 Adiponectin
Adiponectin is produced almost exclusively by adipocytes and is present at high
concentrations in the plasma (Arita et al., 1999). Unlike most other adipokines, adiponectin
is released at a level inversely proportional to body weight and adiposity (Arita et al., 1999).
The adiponectin receptor comprises two structurally-similar transmembrane proteins with
homology to G protein-coupled receptors (AdipoR1 and AdipoR2) (Yamauchi et al., 2003).
Another protein, T-cadherin, lacks a transmembrane domain and is thought to act as a co-
receptor for the hexameric and high-molecular-weight form of adiponectin (Hug et al.,
2004).
14
Treatment of obese mice with adiponectin increases fatty acid oxidation in the liver and
skeletal muscle by activating AMP-activated protein kinase (AMPK) (Tomas et al., 2002;
Yamauchi et al., 2002). In diabetic mice, adiponectin enhances insulin action and reduces
hyperglycemia (Berg and Scherer, 2005). Accordingly, lack of adiponectin was shown to
predispose mice to diet-induced insulin resistance (Maeda et al., 2002; Nawrocki et al.,
2006). These actions of adiponectin are mediated by AdipoR1 and AdipoR2, as disruption
of these receptors results in reduced AMPK activation, increased glucose production and
impaired insulin sensitivity (Yamauchi et al., 2007). In addition, adiponectin has been
shown to regulate peroxisome proliferator-activated receptor γ coactivator 1-alpha (PGC-
1α) and intracellular Ca2+ levels in the skeletal muscle through AdipoR1, which together
increase mitochondrial content and improve insulin sensitivity (Iwabu et al., 2010).
The metabolically beneficial role of adiponectin can be partly attributed to its anti-
inflammatory properties. Elevating adiponectin levels by recombinant protein treatment
(Xu et al., 2003a) or transgenic overexpression (Kim et al., 2007) in ob/ob mice suppressed
TNF-α production, whereas adiponectin deficiency was associated with increased TNF-α
expression in adipose tissue and in the circulation (Maeda et al., 2002). In line with this,
adiponectin has been shown to abolish LPS-stimulated TNF-α production in macrophages
in vitro (Yokota et al., 2000). Conversely, adiponectin stimulates the production of the
anti-inflammatory cytokine IL-10 in human macrophages (Kumada et al., 2004) and
promotes macrophage polarization towards an anti-inflammatory M2 state (Ohashi et al.,
2010).
15
I.1.2.4.3 Tumour necrosis factor alpha (TNF-α)
TNF-α is a pro-inflammatory cytokine produced mainly by macrophages and plays a
central role in the inflammatory response. In 1993, TNF-α became the first cytokine shown
to be expressed by the adipose tissue and to have a direct role in obesity-associated insulin
resistance (Hotamisligil et al., 1993). Mechanistically, TNF-α signalling via its cognate
membrane receptors TNFR1 and TNFR2 impairs insulin-stimulated tyrosine
phosphorylation of the insulin receptor and IRS1 (Hotamisligil et al., 1994b).
Consequently, administration of TNF-α attenuates insulin action and glucose uptake both
in vitro and in vivo, whereas its neutralization in obese mice restores insulin sensitivity in
skeletal muscle and adipose tissue (Hotamisligil et al., 1994a; Hotamisligil et al., 1993;
Uysal et al., 1997).
I.1.2.4.4 Interleukin 6 (IL-6)
IL-6 is a pro-inflammatory cytokine produced by both immune cells and adipocytes.
Indeed, adipose tissue has been estimated to contribute approximately one-third of total
circulating IL-6 (Fried et al., 1998). IL-6 signals through a receptor complex comprised of
IL-6Rα and gp130, a shared signal transducer among the IL-6 family of cytokines, to
activate the JAK2-STAT3 pathway (Heinrich et al., 1998; Taga et al., 1989). Unlike TNF-
α, the role of IL-6 in glucose homeostasis has been controversial. Some studies demonstrate
that IL-6 suppresses insulin action in the liver in part by inducing expression of SOCS3
(Kim et al., 2004a; Senn et al., 2003), while other studies suggest a metabolically beneficial
16
role of IL-6 such that its deficiency leads to mature-onset obesity (Wallenius et al., 2002)
and predisposes to HFD-induced hepatic insulin resistance and inflammation (Matthews et
al., 2010; Wunderlich et al., 2010). Of note, exercise, a known insulin sensitizer, leads to
the reversible synthesis and release of IL-6 from skeletal muscle (Steensberg et al., 2000),
which stimulates the production of anti-inflammatory cytokines and suppresses TNF-α
production (Petersen and Pedersen, 2005). Therefore, the divergent role of IL-6 in
metabolism may be related to the source of the cytokine, duration of release and/or the site
of action.
I.1.2.4.5 Resistin
Resistin, a member of the cysteine-rich resistin-like molecule (RELM) family (Steppan et
al., 2001b), was identified as an adipokine whose secretion was repressed by
thiazolidinedione drugs, which act as PPARγ agonists (Steppan et al., 2001a). In mice,
resistin expression is restricted to adipocytes (Steppan et al., 2001a). On the other hand,
human resistin is mainly produced by macrophages and peripheral blood mononuclear cells,
and is not detectable in adipocytes (Savage et al., 2001).
In mouse models, resistin has been shown to increase hepatic glucose output and induce
insulin resistance (Banerjee et al., 2004) in part by activating SOCS3 (Steppan et al., 2005).
In line with this, loss of resistin in ob/ob mice improved glucose tolerance and insulin
sensitivity (Qi et al., 2006). However, evidence for the metabolic effect of resistin in
humans remains inconclusive (Heilbronn et al., 2004; Lee et al., 2003). In addition, the
17
bona fide receptor that mediates the biological actions of resistin is still controversial. Very
recently, the receptor for human resistin has been identified. It was shown that resistin
binds directly to adenylyl cyclase-associated protein 1 (CAP1) in human monocytes and
activates cAMP and PKA-dependent signalling (Lee et al., 2014c).
In mouse adipose tissue, resistin expression is inhibited by PPARγ agonists (Steppan et al.,
2001a), whereas in human peripheral blood mononuclear cells, resistin expression is up-
regulated by pro-inflammatory cytokines including IL-1, IL-6 and TNF-α (Kaser et al.,
2003), suggesting a pro-inflammatory role of this adipokine. Consistent with this, resistin
has been shown to promote IL-6 and TNF-α expression in human mononuclear cells
(Bokarewa et al., 2005) and increase the expression of pro-inflammatory adhesion
molecules in vascular endothelial cells (Verma et al., 2003). Furthermore, transgenic
expression of human resistin in mouse macrophages leads to the development of adipose
tissue inflammation and HFD-induced insulin resistance (Qatanani et al., 2009).
I.1.2.4.6 Monocyte chemoattractant protein 1 (MCP-1)
MCP-1 or chemokine (C-C motif) ligand 2 (CCL2) is a chemokine that regulates
trafficking and infiltration of monocytes and macrophages (Deshmane et al., 2009). White
adipose tissue is a major source of MCP-1, which has been shown to act as a paracrine to
impair insulin-stimulated glucose uptake and expression of lipogenic genes in vitro
(Sartipy and Loskutoff, 2003). In addition, MCP-1 released into the circulation induces
macrophage infiltration into adipose tissue and leads to subsequent inflammation (Kanda
18
et al., 2006). As such, MCP-1 attenuates insulin sensitivity and promotes glucose
intolerance, and MCP-1 knockout mice are protected from HFD-induced adipose
inflammation and metabolic dysfunction (Kanda et al., 2006).
I.1.3 Brown adipose tissue (BAT)
Another important type of adipose tissue in mammals is BAT. Morphologically distinct
from white adipocytes, brown adipocytes are multilocular and rich in mitochondria
(Cannon and Nedergaard, 2004). They are located in dedicated depots and express, under
basal conditions, high levels of uncoupling protein 1 (UCP1), which dissipates the proton
gradient across the inner mitochondrial membrane and uncouples the electron transport
chain (Golozoubova et al., 2006). This leads to the generation of heat at the expense of
ATP production. Thus, brown adipose tissue plays an important role in non-shivering
thermogenesis and the maintenance of body temperature (Rothwell and Stock, 1979).
Another distinct type of heat-producing adipocytes develop in white adipose tissue,
particularly the inguinal depot (a SAT depot), in response to various stimuli (Wu et al.,
2012). These adipocytes are named beige, brite (brown in white), or inducible BAT.
Morphologically similar to brown adipocytes, beige adipocytes contain multilocular lipid
droplets and are rich in mitochondria (Wu et al., 2012). However, unlike brown adipocytes,
19
they express UCP1 and other BAT-specific genes only in response to activators such as β
adrenergic stimulation or PPARγ agonists (Wu et al., 2013).
I.1.3.1 BAT and non-shivering thermogenesis
Non-shivering thermogenesis in brown and beige adipocytes is activated upon cold
exposure as an important mechanism to maintain body temperature and protect against
hypothermia. Consequently, mice lacking BAT function are cold intolerant (Enerback et
al., 1997). BAT is also activated following excessive caloric intake to preserve energy
balance and prevent weight gain (Rothwell and Stock, 1979). This cold- and diet-induced
thermogenesis is mainly controlled by the sympathetic nervous system via β3 adrenergic
receptors expressed on the surface of adipocytes (Morrison et al., 2012). Recently,
alternatively activated macrophages in the adipose tissue have been shown to produce
catecholamines in response to cold challenge and thus play a role in the regulation of
thermogenesis (Nguyen et al., 2011; Qiu et al., 2014).
Upon binding to its receptor in adipocytes, norepinephrine rapidly induces lipolysis and
release of fatty acids from lipid droplets (Collins and Surwit, 2001). The FFAs are oxidized
by mitochondria to generate a proton gradient across the inner mitochondrial membrane.
Subsequent proton leak and heat production through UCP1 is activated by long-chain fatty
acids released from the inner mitochondrial membrane through the action of phospholipase
20
A2 (Fedorenko et al., 2012). In addition, increased sympathetic outflow drives
transcription of thermogenic genes including Ucp1 through the activity of PGC-1α
(Puigserver et al., 1998).
With prolonged cold exposure, proliferation and differentiation of brown adipocyte
precursors lead to expansion of BAT mass and enhancement of thermogenic capacity
(Bukowiecki et al., 1982). Similarly, in murine white adipose tissue, cold stimulates
sympathetic nerve fiber branching and promotes beige adipocyte development (Murano et
al., 2009). Indeed, treatment with the β3 adrenergic agonist CL 316,243 in mice mimics
the effect of cold exposure and markedly remodels white adipose tissue with beige
adipocyte differentiation and increased thermogenesis (Himms-Hagen et al., 2000; Vitali
et al., 2012)
In addition to the sympathetic nervous system, several other factors and hormones have
recently been identified to regulate thermogenesis in the adipose tissue. For example,
thyroid hormone directly activates thermogenic gene expression in BAT (de Jesus et al.,
2001). Bone morphogenetic protein 8b is produced by mature brown adipocytes, and
augments the response of BAT to adrenergic stimulation (Whittle et al., 2012). In addition,
when administered centrally, bone morphogenetic protein 8b increases sympathetic
outflow to BAT (Whittle et al., 2012). Fibroblast growth factor 21, a circulating hormone
secreted mostly from the liver, activates the thermogenic machinery in BAT
(Chartoumpekis et al., 2011) and enhances PGC-1α expression to drive beige adipocyte
21
development in white adipose tissue (Fisher et al., 2012; Lee et al., 2014a). Natriuretic
peptides, produced by the heart in response to pressure overload, are recently shown to act
directly on adipocytes through activation of cyclic GMP-dependent protein kinase,
enhancing browning of white adipose tissue and thermogenic gene expression in BAT
(Bordicchia et al., 2012). Of note, beige adipocyte development can be activated without
any increase in BAT activity. For example, irisin, a newly-identified hormone secreted
from myocytes, stimulates browning of white adipose tissue and enhances energy
expenditure by selective actions on beige preadipocytes in both mice (Bostrom et al., 2012)
and humans (Lee et al., 2014a). Taken together, these factors and pathways could be
targeted for therapeutic effects and hold great promise for the treatment of obesity and
related complications, as discussed below.
I.1.3.2 BAT and metabolic control
The observation that genetic ablation of BAT in mice leads to development of obesity
indicate that the activity of BAT contributes to regulation of energy balance (Lowell et al.,
1993). In line with this, UCP1 deficient mice housed at thermoneutrality have impaired
BAT function and develop spontaneous obesity (Feldmann et al., 2009). However, another
study examining UCP1 knockout mice reported no change in body weight when mice were
maintained at various temperatures (Anunciado-Koza et al., 2011). Furthermore, BAT
activity did not seem to have a significant contribution to diet-induced thermogenesis in
rats maintained at thermoneutrality (Ma et al., 1988). Thus, the physiological role of BAT
22
in body weight regulation under basal conditions remains unclear. In fact, without
activation, UCP1 does not seem to contribute to basal mitochondrial uncoupling (Jastroch
et al., 2012; Shabalina et al., 2010).
Nevertheless, in various animal models, enhancing brown and/or beige adipocyte activity
through genetic, pharmacological or surgical manipulation correlates with obesity
resistance (Kopecky et al., 1995; Seale et al., 2011; Stanford et al., 2013). Increased brown
or beige adipocyte function also improves systemic metabolism, characterized by enhanced
glucose tolerance and increased insulin sensitivity (Bostrom et al., 2012; Kopecky et al.,
1995; Stanford et al., 2013). This has spurred great research interest to develop brown or
beige adipocyte activators for the treatment of obesity and metabolic diseases. However,
for many years, it was thought that human adults have no appreciable amount of BAT that
can influence body weight.
A few years ago, imaging studies identified the presence of active BAT in adult humans
(Cypess et al., 2009; Saito et al., 2009; van Marken Lichtenbelt et al., 2009; Virtanen et
al., 2009). These BAT depots increase energy expenditure in response to cold stimulation
(Cypess et al., 2012; Ouellet et al., 2012), and lead to enhanced whole-body glucose
disposal and insulin sensitivity (Chondronikola et al., 2014; Lee et al., 2014b). Importantly,
their activity was found to be inversely correlated with the severity of the metabolic
syndrome (Cypess et al., 2009; Saito et al., 2009), implicating a role for BAT in metabolic
regulation in humans. Given that UCP1 does not increase cellular energy expenditure under
23
basal conditions (Jastroch et al., 2012; Shabalina et al., 2010), therapeutic strategies should
aim to augment brown or beige adipocyte activation in addition to promoting tissue
expansion.
Brown and beige adipocytes counteract body weight gain by promoting fuel utilization and
thus enhancing energy expenditure. Consistent with this notion, it has been shown that
increased BAT activity following short-term cold exposure leads to significant triglyceride
uptake and accelerated plasma triglyceride clearance, which corrected hyperlipidemia and
conferred metabolic benefits in mice (Bartelt et al., 2011). However, the extent of body
weight modulation following brown or beige adipocyte activation often seems modest
compared to the degree of improvement in glucose homeostasis (Bostrom et al., 2012;
Seale et al., 2011), suggesting that brown and beige adipocytes may confer metabolic
benefits through non-thermogenic mechanisms. Indeed, a recent report suggests that BAT-
derived IL-6 is required for the metabolically beneficial effects of BAT transplantation in
mice (Stanford et al., 2013). Further work is needed to delineate the exact molecular
mechanisms by which BAT regulates metabolism.
I.1.4 Pathogenesis of obesity-induced insulin resistance and metabolic dysfunction
The current paradigm for obesity-related insulin resistance and metabolic dysfunction
suggests that chronic lipid or energy overload associated with a positive energy balance
24
induces cellular stress, which activates pro-inflammatory and oxidative stress signalling
cascades that perpetuate themselves and create a feed-forward loop, leading to impairment
in insulin signalling and disruption of metabolic homeostasis (Iyer et al., 2010) (Figure I-
1). Obesity-associated inflammatory response is characterized by chronic and systemic
low-grade inflammation, accompanied by presence of oxidative stress, disrupted adipokine
secretion, increased synthesis of acute-phase reactants, and recruitment of leukocytes to
inflamed tissues (Hotamisligil, 2006).
Evidence supporting the link between obesity and chronic inflammation comes from
clinical observations that obesity is associated with elevated levels of pro-inflammatory
proteins such as C-reactive protein (CRP), IL-6 and plasminogen activator inhibitor-1
(PAI-1) in the circulation (Esposito et al., 2003; Visser et al., 1999). Increased levels of
pro-inflammatory biomarkers such as CRP and IL-6 predict the development of obesity
complications including type 2 diabetes (Freeman et al., 2002; Pradhan et al., 2001).
Furthermore, treatment with anti-inflammatory agents such as salicylates and non-steroidal
anti-inflammatory drugs has been shown to improve metabolic function (Larsen et al.,
2007; Yuan et al., 2001).
I.1.4.1 Initiating events
Under physiological conditions, adipose tissue responds rapidly to alterations in nutrient
availability in a dynamic manner. To accommodate a surplus of energy, adipose tissue can
expand either by the proliferation and differentiation of precursor cells (hyperplasia) or by
25
Figure I-1 Mechanism of obesity-induced adipose expansion and inflammation.
Adipose tissue from lean individuals contains Treg, Th2 CD4+ T cells and M2
macrophages which secrete the anti-inflammatory cytokine IL-10. Chronic lipid overload
and adipocyte hypertrophy leads to cellular stress, accompanied by tissue hypoxia,
extracellular matrix expansion, secretion of chemokines, and adipocyte death. This alters
the immune cell composition within the adipose tissue, leading to accumulation of CD8+
T cells, Th1 CD4+ T cells and M1 macrophages. Together these immune cells and
adipocytes secrete pro-inflammatory mediators that activate inflammatory and oxidative
signalling cascades that perpetuate themselves in a feed-forward loop. Dysfunctional
adipocytes also release increased levels of FFA. Together with pro-inflammatory factors,
they lead to impairment in insulin signalling and disruption of metabolic homeostasis.
26
increasing the size of pre-existing adipocytes (hypertrophy) or both (Park et al., 2008). A
study using 14C tracer methods suggests that adipocyte number is relatively stable in adults,
with differentiation of preadipocytes balanced by adipocyte death (Spalding et al., 2008).
At early stages of excess energy intake, adipocyte size expansion is accompanied by
increased expression of lipogenic enzymes, additional triglyceride storage and near normal
rates of lipolysis (Sun et al., 2011). Healthy adipose tissue expansion also requires proper
recruitment of other stromal cells and adequate angiogenesis and vascularization, with
minimal activation of the extracellular matrix and no induction of the inflammatory
response (Sun et al., 2011). This adipose tissue remodelling is accelerated in the obese
state, and in some instances, may exceed the expansion capacity of adipose tissue or
compromise adipocyte function, leading to a variety of effects including hypoxia, fibrosis,
adipocyte death and chemokine secretion.
Hypertrophy of adipocytes without adequate blood supply creates a local hypoxic milieu,
evidenced by observations in obese individuals that suggest presence of poorly oxygenated
adipose tissue (Kabon et al., 2004). Recently, uncoupled adipocyte respiration and
increased oxygen consumption in response to energy excess has also been implicated in
development of local hypoxia in the adipose tissue (Lee et al., 2014d). Hypoxia activates
hypoxia-inducible factor 1 alpha (HIF-1α), a master regulator of the cellular response to
hypoxia, which up-regulates pro-inflammatory mediators in adipose tissue such as IL-6,
PAI-1, vascular endothelial growth factor and down-regulate anti-inflammatory cytokines
27
including adiponectin (Hosogai et al., 2007). Adipocyte-specific activation of (HIF-1α)
enhanced the fibrotic response, suggesting that local hypoxia in the adipose tissue induces
fibrosis, which may subsequently stimulate the inflammatory response (Halberg et al.,
2009).
Aberrant adipose tissue expansion that occurs during obesity leads to adipocyte cell death
(Strissel et al., 2007). It has been proposed that this adipocyte death is a strong phagocytic
stimulus for macrophages. In line with this, macrophages have been observed to form
crown-like structures surrounding necrotic adipocytes to phagocytose the residual lipid
(Cinti et al., 2005), and the number of macrophages increases with the number of dead
adipocytes as obesity progresses (Strissel et al., 2007). In a model of inducible adipocyte
death, extensive adipocyte apoptosis stimulated significant macrophage accumulation
within the adipose tissue (Pajvani et al., 2005).
Macrophage recruitment and accumulation depends on the release of chemotactic signals.
In particular, high levels of MCP-1 released by adipocytes are sufficient to induce
macrophage recruitment to the adipose tissue (Kanda et al., 2006). As such, deletion of
Ccl2 or its receptor CC motif chemokine receptor 2 (CCR2) in mice confers protection
from macrophage accumulation and adipose tissue inflammation associated with HFD
feeding (Kanda et al., 2006; Weisberg et al., 2006). In addition to MCP-1, increased
expression levels of other chemokines such as chemokine (C-C motif) ligand 5 (CCL5),
chemokine (C-X-C motif) ligand 14 (CXCL14), macrophage inflammatory protein 1 alpha
28
(MIP-1α), MCP-2 and MCP-3 have also been observed in adipose tissue of obese mice
(Nara et al., 2007; Xu et al., 2003b).
I.1.4.2 Alteration in immune cells
In lean individuals, the majority of resident T cells in the adipose tissue are Treg and Th2-
polarized CD4+ cells (Feuerer et al., 2009). Together with resident M2-activated
macrophages, they secrete the anti-inflammatory cytokine IL-10 and promote tissue repair
(Lumeng et al., 2007a). Early during the development of obesity, alterations in both the
number and type of T cells occur, with a reduction in the number of Treg cells and the
appearance of CD8+ effector T cells (Nishimura et al., 2009; Winer et al., 2009). In addition,
the number of Th1-polarized CD4+ T cells increases, which secrete interferon gamma
(IFN-γ) (Nishimura et al., 2009; Winer et al., 2009). Together with MCP-1 and other
chemotactic signals secreted by adipocytes (Kanda et al., 2006), this leads to the infiltration
of more macrophages, characterized by M1 activation and expression of pro-inflammatory
mediators including TNF-α, IL-6 and reactive oxygen species (ROS) (Duffaut et al., 2009;
Lumeng et al., 2007b; Weisberg et al., 2003). Resident adipose tissue macrophages also
switch their phenotype to an M1 state, with expression and secretion of pro-inflammatory
factors (Lumeng et al., 2007a; Patsouris et al., 2008). These cytokines and adhesion
molecules further stimulate the production of more pro-inflammatory effectors and the
recruitment of additional immune cells via a paracrine manner, creating a vicious cycle
that ultimately results in adipocyte dysfunction and systemic metabolic manifestation. In
29
addition to T cells and macrophages, eosinophils, B cells, NK cells, NKT cells and mast
cells have also been implicated in obesity-associated inflammation (Liu et al., 2009;
O'Rourke et al., 2009; Ohmura et al., 2010; Winer et al., 2011; Wu et al., 2011a).
Nevertheless, the specific contribution of individual immune cell types to systemic
metabolic dysfunction remains to be elucidated.
I.1.4.3 Disrupted adipokine secretion
Alteration in adipocyte function under obese conditions leads to an imbalance in the
synthesis and release of pro- and anti-inflammatory adipokines. Most adipokines are up-
regulated with the development of obesity. For example, obese individuals often exhibit
elevated leptin levels in the blood but without the expected anorexic response, suggesting
the presence of leptin resistance (Friedman and Halaas, 1998). In addition, studies in
animal models of obesity and type 2 diabetes indicate elevated expression and secretion of
TNF-α (Hotamisligil et al., 1993), IL-6 (Boucher et al., 2005), resistin (Steppan et al.,
2001a), and MCP-1 (Sartipy and Loskutoff, 2003), and these observations have been
extended to humans (Fried et al., 1998; Kern et al., 1995). Importantly, weight loss is often
accompanied by reductions in pro-inflammatory adipokine levels (Esposito et al., 2003;
Ziccardi et al., 2002), suggesting that these disruptions are dependent on adipose mass and
are reversible.
In contrast to pro-inflammatory cytokines, the production and release of adiponectin is
suppressed in the obese state, and plasma adiponectin levels are negatively associated with
30
visceral adiposity (Yatagai et al., 2003). Consistent with this, adiponectin expression is
inhibited by the pro-inflammatory mediators TNF-α, IL-6 and oxidative stress (Hosogai et
al., 2007).
Together, adipokines with pro-inflammatory properties can promote insulin resistance by
enhancing the synthesis and release of other pro-inflammatory mediators (as in the case of
leptin, resistin, and MCP-1), activating the c-Jun N-terminal kinase (JNK) and IκB kinase
(IKKβ)/nuclear factor kappa B (NF-κB) pathways (in the case of TNF-α), inducing
expression of SOCS3 (such as by resistin and IL-6) or by promoting production of ROS
(by TNF-α) (Rosen and Spiegelman, 2006). Increased pro-inflammatory adipokines also
act on adipocytes in a feed-forward loop to further compromise adipocyte function by
suppressing insulin action, thereby inhibiting lipogenesis and promoting lipolysis (Hu et
al., 1996; Langin and Arner, 2006).
I.1.4.4 Elevated FFA levels and lipotoxicity
FFAs are released into the circulation primarily during fasting as a result of increased
lipolysis. Acutely, circulating FFAs promote hepatic glucose production, reduce glucose
uptake by adipose tissue and skeletal muscle and induce insulin secretion from pancreatic
β cells (Roden et al., 1996). Under chronic pathological conditions such as obesity or
lipodystrophy, elevated levels of pro-inflammatory cytokines enhance lipolysis and lead to
release of excessive FFAs into the bloodstream. As such, circulating FFA levels have been
shown to positively correlate with the degree of obesity in humans (Boden, 1997; Kelley
31
et al., 1993). Elevated plasma FFA levels induce peripheral insulin resistance (Boden, 1997;
Kelley et al., 1993). In the setting of insulin resistance, insulin can no longer suppress
lipolysis, resulting in the release of more FFAs and creating a vicious cycle that ultimately
impairs glucose homeostasis.
Excessive FFAs accumulate in ectopic sites such as the heart, pancreas, liver and skeletal
muscle. These tissues are not designed to store large amounts of fat and are susceptible to
the toxic effects of excess lipids (lipotoxicity). For example, in the pancreas, FFAs,
especially saturated fatty acids, induce β-cell apoptosis and reduce insulin secretion
(Bollheimer et al., 1998). In contrast, in the liver and skeletal muscle, saturated fatty acids
attenuate insulin signalling (Kim et al., 2001) and decrease insulin-stimulated glucose
uptake by impairing GLUT4 translocation (Dresner et al., 1999). Lipid over-accumulation
in the liver, also known as fatty liver disease, will be discussed in more detail in Section
I.2.
In addition to FFAs, other bioactive lipid metabolites have also been shown to exacerbate
obesity-associated insulin resistance. These include DAG, produced by the action of
phospholipase C or by the triglyceride synthesis pathway (Yu et al., 2002), and the
sphingolipid ceramide, whose biosynthesis depends on the availability of saturated fatty
acids (Hannun, 1994). These lipid metabolites function as second messengers in key
signalling pathways where DAG activates members of the protein kinase C (PKC) family
(Yu et al., 2002), and ceramide inhibits insulin-induced Akt activation (Holland et al.,
32
2007). Accordingly, inhibition of their biosynthesis confers protection from HFD-induced
insulin resistance in mice (Choi et al., 2007; Holland et al., 2007).
Potential molecular mechanisms that mediate lipotoxicity include activation of PKC
isoforms (Griffin et al., 1999; Schmitz-Peiffer et al., 1997), oxidative stress (Paolisso et
al., 1996), endoplasmic reticulum (ER) stress (Ozcan et al., 2004), and induction of innate
immunity through toll-like receptor (TLR) isoforms, particularly TLR2 (Senn, 2006) and
TLR4 (Shi et al., 2006b). These pathways likely do not function independently, but work
together in a concerted manner to coordinate the cellular response to systemic cytokine or
nutrient signals.
I.1.4.5 Oxidative stress
Reactive oxygen species (ROS) are produced at a low level as by-products of normal
cellular metabolism and are scavenged by endogenous antioxidant systems (Bashan et al.,
2009). Overproduction of ROS or failure of the antioxidant defense network leads to redox
imbalance and oxidative stress (Houstis et al., 2006). Extensive evidence in the literature
suggests the presence of oxidative stress under obese conditions (Abdul-Ghani et al., 2009;
Dandona et al., 1996), and studies in animal models have established a causal contribution
of oxidative stress to obesity-associated insulin resistance (Anderson et al., 2009;
Furukawa et al., 2004; Houstis et al., 2006).
33
Activation of the innate immune system during expansion of the adipose tissue leads to
release of ROS, particularly from macrophages. In addition, with energy surplus, increased
supply of nutrients and elevated substrate oxidation leads to the overproduction of ROS
from increased mitochondrial respiration in metabolic tissues (Dandona et al., 1996;
Furukawa et al., 2004). ROS contribute to cell injury directly by oxidative damage of
macromolecules, ultimately inducing apoptosis or senescence (Dandona et al., 1996).
Oxidative stress also causes mitochondrial alteration and promote mitochondrial
dysfunction (Bonnard et al., 2008), further reducing the efficiency of the respiratory chain.
Indeed, oxidative stress disrupts pancreatic β-cell mitochondrial homeostasis, thereby
impairing insulin secretion and causing β cell apoptosis (Maechler et al., 1999). In addition,
ROS activate cellular stress-sensitive and pro-inflammatory signaling pathways (Kyriakis
and Avruch, 2001; Tak and Firestein, 2001). Inflammatory signaling in turn promotes
generation of more ROS, particularly from the membrane-bound enzyme complex
NAD(P)H oxidase, thus creating a positive-feedback loop that leads to cellular damage and
metabolic dysfunction (Evans et al., 2002).
I.1.4.6 Molecular mechanisms of insulin resistance
I.1.4.6.1 JNK and IKKβ/NF-κB signalling
Many of the pro-inflammatory mediators discussed above activate the JNK and IKKβ/NF-
κB pathways. Pro-inflammatory cytokines including TNF-α and IL-1β activate JNK and
IKKβ/NF-κB through receptor-mediated mechanisms via their cognate receptors (Liu et
34
al., 1996). FFAs, especially saturated fatty acids, bind to and activate TLR4, one of the
pattern recognition receptors that recognize foreign molecules (Lee et al., 2001), which
also leads to the activation of JNK and IKKβ/NF-κB. Other activators of the JNK and
IKKβ/NF-κB pathways include cellular stress such as oxidative and ER stress, ceramides
and certain PKC isoforms (Shoelson et al., 2006).
JNK attenuates insulin signalling through serine phosphorylation of IRS-1, which inhibits
tyrosine phosphorylation and consequently insulin signal transduction (Aguirre et al.,
2002). In contrast, activation of IKKβ targets the NF-κB inhibitor alpha (IκBα) for
proteasomal degradation, which frees NF-κB for translocation into the nucleus to modulate
transcription of target genes. Numerous target genes of the IKKβ/NF-κB pathway induce
insulin resistance including TNF-α, IFNγ, resistin and IL-1β, which further activate JNK
and IKKβ/NF-κB signalling in a self-perpetuating cycle. Accordingly, genetic or
pharmacological attenuation of JNK or IKKβ signalling improves insulin signalling and
confer protection from HFD-induced insulin resistance by reducing obesity-associated
inflammation (Hirosumi et al., 2002; Yuan et al., 2001)
I.1.4.6.2 Protein kinase C (PKC) activation
PKC proteins belong to a family of AGC protein kinases that catalyze the phosphorylation
of serine/threonine residues on their respective substrates (Nishizuka, 1984). Depending
on the specific isoform, activation of PKC enzymes may require both Ca2+ and DAG
(conventional PKCs), DAG alone (novel PKCs) or neither (atypical PKCs) (Newton, 1995).
35
Activation of novel PKC isoforms including PKCθ, ε and δ by DAG has been linked to
induction of insulin resistance. Accordingly, mice lacking PKCθ are protected from lipid-
induced insulin resistance in skeletal muscle (Kim et al., 2004b), whereas deficiency of
PKCε or δ improves insulin sensitivity and glucose tolerance in the liver (Bezy et al., 2011;
Samuel et al., 2007). Novel PKCs have been suggested to impair insulin signalling by
interfering with insulin receptor activation (Samuel et al., 2007), and putative PKC
phosphorylation sites on the insulin receptor have been identified (Lewis et al., 1990). In
addition, PKCθ has been shown to phosphorylate Ser1101 on IRS-1, thereby inhibiting
insulin-stimulated tyrosine phosphorylation and consequently insulin signal transduction
(Li et al., 2004).
I.1.4.6.3 Induction of SOCS proteins
In addition to activating JNK or IKKβ pathways, pro-inflammatory cytokines such as IFNγ,
TNF-α and IL-6 induce insulin resistance by activating SOCS expression, particularly
SOCS1 and SOCS3 (Howard and Flier, 2006). SOCS proteins suppress insulin signalling
by inhibiting the kinase activity of the insulin receptor (Mooney et al., 2001; Ueki et al.,
2004a), competing with IRS proteins for binding to the insulin receptor (Ueki et al., 2004a),
and/or inducing proteasomal degradation of the IRS proteins (Rui et al., 2002). Consistent
with a role of SOCS in insulin resistance, SOCS1 deficiency in mice increased IRS2
expression and tyrosine phosphorylation and enhanced hepatic insulin sensitivity
(Jamieson et al., 2005), whereas constitutive expression of either SOCS1 or SOCS3 in
mouse livers led to glucose intolerance and insulin resistance associated with a significant
36
reduction in IRS protein levels (Rui et al., 2002; Ueki et al., 2004b). In the adipose tissue
and the muscle, SOCS3 deficiency resulted in increased insulin-stimulated IRS
phosphorylation and glucose uptake (Jorgensen et al., 2013; Palanivel et al., 2012; Shi et
al., 2004). Conversely, transgenic overexpression of SOCS3 in adipocytes or muscle
reduced insulin-stimulated IRS phosphorylation, leading to diminished glucose uptake (Shi
et al., 2006a; Yang et al., 2012).
I. 2. Non-Alcoholic Fatty Liver Disease (NAFLD)
I.2.1 NAFLD
Non-alcoholic fatty liver disease (NAFLD) occurs when lipid is deposited in the liver in
the absence of excessive alcohol intake (generally defined as <20 g per day for women and
<30 g per day for men) (Angulo, 2002). The prevalence of NAFLD is rapidly increasing
in parallel with the unprecedented worldwide epidemic of obesity and type 2 diabetes, and
is now considered to be the leading cause of chronic liver disease (Tiniakos et al., 2010).
A study in US adults showed that NAFLD accounts for the majority (69%) of cases of
elevated transaminase levels (Clark et al., 2003).
Estimates of the prevalence of NAFLD are influenced by the method used to diagnose
steatosis and the approach used to assess alcohol intake (Bellentani et al., 2010). Using the
37
highly sensitive technique of magnetic resonance spectroscopy, the prevalence of NAFLD
was estimated to be 32% in a population study of US individuals (Browning et al., 2004).
Using ultrasonography, the prevalence of NAFLD has been estimated to range from 13%
to 25% in population studies from China, Japan and Italy (Bedogni et al., 2005; Fan et al.,
2005; Jimba et al., 2005). Particularly alarming are the data showing that NAFLD has
become the most common cause of liver disease in the pediatric population (Schwimmer
et al., 2006). Therefore, a better understanding of the mechanisms underlying the etiology
and pathogenesis of NAFLD and associated metabolic derangements is of great importance
for the development of effective preventive and therapeutic strategies.
I.2.2 Disease spectrum of NAFLD
NAFLD comprises a disease spectrum, spanning from simple steatosis to more advanced
stages of non-alcoholic steatohepatitis (NASH) and varying degrees of fibrosis, and finally
to cirrhosis, end-stage liver failure and in some cases, hepatocellular carcinoma (Angulo,
2002). Steatosis, characterized by the accumulation of triglyceride-rich lipid droplets in the
cytoplasm of hepatocytes, is defined as hepatic triglyceride level exceeding 55 mg per gram
of liver tissue, or by the presence of triglyceride droplets in more than 5% of hepatocytes
from histological analysis (Szczepaniak et al., 2005). Simple steatosis is generally thought
to be benign and reversible with a non-progressive clinical course; however, in about 20-
30% of individuals, steatosis can progress to NASH, which constitutes hepatocellular
injury, activation of the inflammatory response and collagen deposition (Farrell and Larter,
38
2006). NASH is a more aggressive disorder with the potential to progress to cirrhosis and
other advanced complications (Argo and Caldwell, 2009; Starley et al., 2010). Whether
steatosis always precedes NASH or whether the two represent distinct disease entities
remains controversial, and factors responsible for the switch from steatosis to
steatohepatitis in individuals with progressive disease have not been clearly defined.
I.2.3 Role of the liver in metabolism
I.2.3.1 Role of the liver in glucose metabolism
The liver is a vital organ that plays an indispensable role in nutrient metabolism. In addition
to contributing to post-prandial glucose uptake, the liver synthesizes glycogen as an energy
storage form (Hers et al., 1970). Glycogen synthesis is stimulated by insulin through
activation of the enzyme glycogen synthase (Cross et al., 1995). In the fasting state,
glycogen is broken down in the process of glycogenolysis to release glucose into the
bloodstream. In addition, non-carbohydrate substrates such as pyruvate, lactate, glycerol
and some amino acids are converted to glucose in the process of gluconeogenesis. Both
glycogenolysis and gluconeogenesis serve to maintain fasting blood glucose levels and are
inhibited by insulin in the fed state (Dinneen et al., 1992).
39
I.2.3.2 Role of the liver in lipid metabolism
With respect to lipid metabolism, in the fed state, the liver synthesizes and releases
triglyceride-rich very low density lipoprotein (VLDL) to supply triglycerides to peripheral
tissues (Tall, 1990). The fatty acids used for hepatic triglyceride synthesis are derived from
three different sources, diet, de novo lipogenesis and the adipose tissue. Dietary lipids are
transported to the liver via chylomicron remnants after uptake of the majority of lipids in
chylomicrons by peripheral tissues (Tall, 1990). Under conditions of energy surplus,
particularly with carbohydrate feeding, citrate, an intermediate in the citric acid cycle,
accumulates in the mitochondria and enters the cytosol where it is converted to acetyl CoA,
a precursor for fatty acids synthesis (Hellerstein et al., 1996). Similar to the adipose tissue,
de novo lipogenesis in the liver is up-regulated by insulin (Saltiel and Kahn, 2001). Two
transcription factors, sterol regulatory element binding protein 1c (SREBP-1c) and
carbohydrate response element binding protein (ChREBP), drive de novo lipogenesis, and
are activated by insulin and glucose, respectively (Dentin et al., 2005). SREBP-1c and
ChREBP work synergistically to induce expression of acetyl CoA carboxylase and fatty
acid synthase, as well as elongase and desaturase enzymes that catalyze elongation and
desaturation steps (Horton et al., 2003; Iizuka et al., 2004). Additionally, lipolysis of the
adipose tissue releases FFAs into the circulation, mostly bound to albumin, and the liver
takes up these FFAs via simple diffusion or facilitated transport mediated by fatty acid
transport proteins such as CD36 (Hajri et al., 2002). FFAs in the liver can be channeled
through three major pathways (Musso et al., 2009). They can be coupled to a glycerol
40
backbone via ester bonds to form triglycerides and subsequently stored in lipid droplets.
Alternatively, triglycerides can be assembled with apolipoproteins and secreted as a
component of VLDL. In the fasting state, FFAs are oxidized in the mitochondria to produce
energy and ketone bodies, which are exported as fuel for other tissues.
I.2.4 Pathogenesis of NAFLD
I.2.4.1 Development of steatosis
Steatosis occurs when the rate of influx or de novo synthesis of lipids exceeds the rate of
export or catabolism in the liver. Studies of single-gene mutations resulting in profound
fatty liver have shed light on both normal hepatic lipid metabolism and the pathogenesis
of hepatic steatosis in humans. For instance, familial lipodystrophy causes severe fatty liver
as a consequence of partitioning of triglycerides from adipose tissue to the liver (Caux et
al., 2003), whereas citrin deficiency and glycogen storage disease type 1 are associated
with increased hepatic de novo lipogenesis, leading to steatosis (Bandsma et al., 2008;
Komatsu et al., 2008). Hepatic steatosis may also arise from an impairment in fatty acid β-
oxidation (e.g., deficiency in acyl-CoA dehydrogenase genes), or from disturbances in
triglyceride export, such as in the case of abetalipoproteinemia (caused by mutations in the
microsomal triglyceride transfer protein (MTTP) gene that assembles triglycerides with
lipoproteins to form VLDL) (Avigan et al., 1984) and familial hypobetalipoproteinemia
41
(caused by mutations in the structural protein apolipoprotein B (APOB) gene) (Whitfield
et al., 2005).
However, in the majority of individuals with NAFLD, steatosis does not result from
inheritable genetic mutations. Rather, the dramatic increase in the prevalence of NAFLD
in recent decades is closely associated with the current obesity epidemic (Cohen et al.,
2011). Obesity-related conditions of insulin resistance plays a key pathogenic role in the
development of steatosis. Using the hyperinsulinemic euglycemic clamp, insulin resistance
was a universal finding in individuals with NAFLD (Sanyal et al., 2001). Indeed, NAFLD
is now regarded as the hepatic manifestation of the metabolic syndrome.
In the setting of insulin resistance, the rate of peripheral adipose lipolysis is increased due
to inadequate suppression of HSL, leading to enhanced FFA flux to the liver and
subsequent esterification into triglycerides (Lewis et al., 2002). Hyperinsulinemia and
hyperglycemia associated with insulin resistance activate the two lipogenic transcription
factors, SREBP-1c and ChREBP, respectively (Dentin et al., 2005), which induce
expression of acetyl-CoA carboxylase. Accumulation of malonyl-CoA, the product of
acetyl-CoA carboxylase (Wakil et al., 1983), impairs fatty acid β-oxidation by inhibiting
liver carnitine palmitoyltransferase I, which regulates the transport of fatty acyl-CoAs from
the cytosol into the mitochondria (McGarry et al., 1977). In obese humans with NAFLD,
lipid export in the form of VLDL is also insufficiently low relative to the accumulation of
lipid in the liver (Fabbrini et al., 2008). Using a stable isotope approach, Donnelly et al.
42
(Donnelly et al., 2005) quantified the relative contribution of different sources of fatty
acids to hepatic triglycerides in individuals with NAFLD. An estimated 59% of hepatic fat
is derived from circulating FFA released from the adipose tissue, whereas 26% is derived
from de novo lipogenesis and the remaining 15% from the diet (Donnelly et al., 2005).
Buildup of FFA and its metabolites in the liver can in turn exacerbate hepatic insulin
resistance via activation of PKC, JNK and NF-κB pathways, thus creating a positive
feedback cycle (Cai et al., 2005).
I.2.4.2 Progression to NASH
In the late 1990s, Day and James proposed a model to explain how simple steatosis
progresses to NASH in only a subset of individuals. In this model, the development of the
full spectrum of NAFLD occurs by a “two-hit” process where steatosis provides the first
“hit”, which leads to metabolic and molecular alterations that sensitize the liver to a
secondary insult from factors such as oxidative stress, mitochondrial dysfunction, ER stress
and pro-inflammatory cytokines, culminating in inflammatory damage and liver injury
(Day and James, 1998) (Figure I-2). However, accumulating evidence indicates that
hepatic over-storage of triglycerides per se is not a requirement for development of
inflammation and may even be hepatoprotective (Yamaguchi et al., 2007). For example,
transgenic overexpression of diacylglycerol acyltransferase (Dgat) in murine hepatocytes,
an enzyme catalyzing the final step in triglyceride synthesis, did not lead to activation of
the inflammatory response or insulin resistance despite triglyceride accumulation
43
Figure I-2 Proposed mechanism of NAFLD pathogenesis.
Obesity-associated insulin resistance increases rate of lipolysis in the adipose tissue and
the influx of FFA to the liver. In addition, insulin resistance up-regulates lipogenic
transcription factors SREBP1c and ChREBP, which promotes de novo lipogenesis.
Together with reduced fatty acid oxidation, VLDL export or sometimes genetic
predisposition, this leads to lipid accumulation in the liver. Steatosis is thought to sensitize
the liver to a secondary insult. Adipose tissue inflammation contributes to NASH
development by promoting the release of pro-inflammatory mediators, which induce
oxidative stress, mitochondrial dysfunction and ER stress, leading to a pro-inflammatory
and pro-fibrogenic response in hepatocytes. Increased LPS concentration during obesity
also contributes to inflammatory signalling, culminating in hepatocellular damage, fibrosis
and liver injury.
44
(Monetti et al., 2007). Conversely, inhibiting triglyceride synthesis by DGAT2 antisense
oligonucleotide treatment decreased hepatic steatosis but aggravated liver injury in a
mouse model of steatohepatitis induced by a methionine choline deficient diet (Yamaguchi
et al., 2007). Using the same dietary model to induce steatohepatitis, Li et al. (Li et al.,
2009) showed that mice deficient in stearoyl-CoA desaturase 1 (SCD1) had elevated levels
of saturated fatty acids in their livers and were more prone to hepatocellular apoptosis and
liver injury despite less triglyceride accumulation. In addition, free palmitic acid (16:0)-
induced apoptosis in vitro could be rescued by supplementation with oleic acid (18:1),
which favors esterification into triglycerides (Listenberger et al., 2003). Therefore,
partitioning lipid into the inert triglyceride form may represent a compensatory effort of
the liver to shunt excess lipids into a storage pathway to minimize lipotoxicity.
As discussed above in Section I.1.4.4, a surplus of FFA, if not shuttled to storage, may
enter deleterious pathways leading to cell injury and death via FFA metabolites such as
DAG and ceramides. FFA may predispose hepatocytes to apoptotic cell death by up-
regulating death receptors such as Fas and TRAIL receptor 5 (Feldstein et al., 2003; Malhi
et al., 2007), or by activating the pro-apoptotic proteins Bim and Bax in a JNK-dependent
manner (Malhi et al., 2006). FFA could also induce mitochondrial membrane
permeabilization and increase ROS production (Feldstein et al., 2004). In addition to
activating pro-inflammatory pathways, ROS can contribute to the production of fibrogenic
mediators by hepatic resident macrophages and hepatic stellate cells, predisposing to the
development of hepatic fibrosis (Albano et al., 2005).
45
Development and progression of NAFLD also involve the interplay of the liver and other
organs including the gastrointestinal tract and the adipose tissue. Recently, several lines of
evidence have implicated a role of the intestinal microbiota in NAFLD development
(Dumas et al., 2006; Henao-Mejia et al., 2012; Tremaroli and Backhed, 2012), in part by
adversely influencing risk factors for steatosis such as obesity and insulin resistance. For
example, development of obesity is associated with a change in the composition of the gut
flora in both mice (Ridaura et al., 2013; Turnbaugh et al., 2006) and humans (Ley et al.,
2006; Zhang et al., 2009). Inoculation of germ-free mice with gut microbiota from obese
ob/ob mice resulted in more efficient calorie extraction and increased weight gain than
mice inoculated with microbiota from lean animals (Turnbaugh et al., 2006), suggesting
that the gut microbiota can determine energy absorption from the diet and, thereby,
influence body weight. Furthermore, HFD feeding promoted the growth of
lipopolysaccharide (LPS)-containing microbiota (Cani et al., 2007) and was associated
with more efficient transport of LPS from gut lumen into the portal blood (Amar et al.,
2008). Administration of LPS, a component of the bacterial endotoxin, induces an insulin
resistant state in mice reminiscent of that induced by HFD feeding (Cani et al., 2007). The
molecular pathway mediating the effects of LPS is thought to involve binding of LPS to
LPS-binding protein and subsequent interaction of this complex with CD14 on
macrophages. TLR4 then associates with CD14, triggering an intracellular inflammatory
cascade to stimulate secretion of pro-inflammatory cytokines such as TNF-α, IL-1 and IL-
46
6 (Beutler et al., 2003). These cytokines induce insulin resistance and promote
inflammatory progression of steatosis to NASH.
Visceral adiposity plays a cardinal role in the development of NASH (Gastaldelli et al.,
2009). Indeed, the amount of visceral fat has been shown to correlate with the degree of
hepatic inflammation and fibrosis in individuals with NAFLD independent of insulin
resistance and hepatic steatosis (van der Poorten et al., 2008). Pro-inflammatory cytokines
and adipokines secreted in association with expansion of the visceral adipose tissue are
transported directly to the liver via the portal vein and induce inflammatory injury,
ultimately leading to NASH (Marra et al., 2008). For instance, TNF-α signalling in
hepatocytes leads to activation of caspases and the apoptotic pathway (Schwabe and
Brenner, 2006). Consequently, mice genetically deficient in TNFR1 were resistant to liver
injury induced by a methionine choline deficient diet (Tomita et al., 2006). Furthermore,
both hepatic expression and serum levels of IL-6 were elevated in NASH (Cai et al., 2005;
Wieckowska et al., 2008). However, the exact role of IL-6 in NASH pathogenesis is
debated and may depend on the duration of exposure (Jin et al., 2006). Given the central
role of cytokines in pro-inflammatory signalling, pathways that mediate signal transduction
of these cytokines, such as the JAK-STAT pathway, may be important in the pathogenesis
of obesity-associated insulin resistance and the progression of simple steatosis to NASH.
47
I. 3. Janus Kinase 2 (JAK2)
I.3.1 JAK-STAT signalling
The Janus kinase-signal transducers and activators of transcription (JAK-STAT) signalling
pathway, activated by a wide variety of cytokines and growth factors, plays a critical role
in cellular development, differentiation and host defense (Rane and Reddy, 2000). The four
members of the mammalian Janus kinase family, JAK1, JAK2, JAK3 and TYK2, are non-
receptor protein tyrosine kinases that associate with the intracellular domain of cytokine
receptors (Ghoreschi et al., 2009). Binding of the ligand to the receptor activates the JAK
kinases, which phosphorylate specific tyrosine residues within itself and the associated
receptor, forming high-affinity docking sites for subsequent recruitment of other signalling
molecules. These signalling proteins include the SH2 domain-containing STAT family of
transcription factors, IRS proteins and the adaptor protein Shc. To date, seven STAT
proteins (STAT1-4, 5a, 5b and 6) have been identified. Once recruited, STATs are
phosphorylated by JAK kinases, homo- or hetero-dimerize and translocate to the nucleus
where they bind to response elements on DNA and modulate transcription of downstream
target genes (Darnell et al., 1994) (Figure I-3). Each cytokine receptor activates a
characteristic set of JAK and STAT proteins. The mechanisms by which a limited number
of JAK kinases and STAT proteins transduce specific downstream signalling events from
a large number of cytokines are not well understood.
48
Figure I-3 Canonical JAK-STAT signalling pathway.
Cytokine binding and subsequent receptor dimerization allows transphosphorylation and
activation of JAK kinases. JAK kinases then phosphorylate specific tyrosine residues on
the associated receptor, forming high-affinity docking sites for subsequent recruitment of
the Src homology 2 (SH2) domain-containing STAT proteins. Subsequently, the recruited
STATs are phosphorylated by JAK kinases, dimerize and translocate to the nucleus where
they bind to response elements on DNA and modulate transcription of downstream target
genes.
Adapted with permission from Macmillan Publishers Ltd: Levy DE and Darnell JE. STATs:
transcriptional control and biological impact. Nature Reviews Molecular Cell Biology.
3(9):651-62. © (2002)
49
I.3.2 JAK protein structure and regulatory mechanisms
JAK kinases are large proteins containing more than a thousand amino acids with unique
structures that distinguish them from other members of the protein tyrosine kinase
superfamily (O'Shea et al., 2002) (Figure I-4). The carboxyl terminus is the catalytically
active kinase domain (Feng et al., 1997). Immediately adjacent to it is the pseudokinase
domain, which was presumed to lack intrinsic kinase activity (Wilks et al., 1991). The
pseudokinase domain is a unique feature of the JAK kinases in the protein tyrosine kinase
superfamily and plays an essential regulatory function (Saharinen and Silvennoinen, 2002).
Mutations in the pseudokinase domain have been shown to positively and negatively
regulate JAK kinase activity (Saharinen et al., 2000). Recently, it was shown that the
pseudokinase domain of JAK2 is a dual-specificity protein kinase that phosphorylates two
negative regulatory sites on JAK2 to repress its activity (Ungureanu et al., 2011). The
amino terminus of JAK kinases contains an SH2-like domain and a Band-4.1, ezrin, radixin,
moesin (FERM) homology domain. The role of the SH2 domain has not yet been
confirmed, but it has been suggested to play a structural role in receptor interaction (Radtke
et al., 2005). On the other hand, the FERM domain has been shown to mediate interaction
of JAKs with their cognate receptors and to regulate kinase activity (Chen et al., 1997b;
Zhou et al., 2001).
Negative regulation of JAK-STAT signalling is partly mediated by tyrosine phosphatases
such as CD45, SH2-domain containing phosphatase 1 (SHP-1), protein-tyrosine
50
Figure I-4 Domain structure of JAK kinases.
JAK kinases have four functional domains. The amino terminus is the FERM domain,
which regulates catalytic activity and the interaction of JAK kinases with their cognate
receptors. Adjacent to the FERM domain is the SH2-like domain, which may mediate
receptor interaction. The pseudokinase domain regulates kinase activity, and the
catalytically active kinase domain is located at the carboxyl terminus. Upon activation, two
tyrosine residues in the kinase domain are transphosphorylated.
51
phosphatase 1B (PTP1B) and T-cell protein tyrosine phosphatase, which dephosphorylate
and consequently inactivate JAK kinases (Irie-Sasaki et al., 2001; Myers et al., 2001).
Activity of STAT proteins in the nucleus is also regulated by protein inhibitors of activated
STAT (PIAS), which act as transcriptional repressors and block DNA binding by STAT
proteins (Shuai, 2006).
Another negative regulatory mechanism of JAK signalling is mediated by a family of eight
intracellular proteins including the suppressor of cytokine signalling (SOCS) 1 to 7 and
cytokine-inducible SH2 domain (CIS) (Hilton et al., 1998). Expressions of these SOCS
proteins are generally induced by cytokine-mediated JAK-STAT signalling, thus forming
a classic negative feedback loop (Greenhalgh and Hilton, 2001). SOCS proteins are
thought to down-regulate JAK-STAT signalling by targeting the cytokine receptor, JAK
kinases or STAT proteins for degradation via the ubiquitin-proteasome pathway through
interaction with a ubiquitin E3 ligase complex (Verdier et al., 1998; Zhang et al., 1999).
In addition, SOCS1 binds via its SH2 domain to phosphorylated JAKs, resulting in
inhibition of kinase activity (Endo et al., 1997). On the other hand, SOCS3 has been shown
to bind to the activated receptor to repress signalling (Nicholson et al., 1999; Sasaki et al.,
2000). In contrast, CIS does not affect JAK activity, but rather competes with STATs for
receptor docking sites to inhibit STAT activation (Yoshimura, 1998).
52
I.3.3 Crosstalk of JAK-STAT with other signalling pathways
In addition to the canonical JAK/STAT pathway, JAKs can activate the
MAPK/extracellular signal-related kinase (ERK) pathway via a Ras-dependent mechanism
(Winston and Hunter, 1995). Furthermore, JAK kinases mediate the activation of IRS
proteins in response to a number of cytokines including IL-2, IL-4, IL-7, IL-9, IL-15,
leukemia inhibitory factor (LIF), type I interferons and growth hormone (GH) (Argetsinger
et al., 1995; Burfoot et al., 1997; Johnston et al., 1995). Phosphorylation of IRS and
subsequent activation of the downstream PI3K-Akt pathway are thought to account for the
insulin-like effects of acute GH stimulation, including stimulation of glucose transport,
lipogenesis and protein synthesis (Davidson, 1987). However, chronic GH treatment and
various pro-inflammatory cytokines such as IFNγ, TNF-α and IL-6 also attenuate insulin
signalling mediated by JAK-induced SOCS expression, particularly SOCS1 and SOCS3
(Fasshauer et al., 2004; McGillicuddy et al., 2009), as discussed above in Section I.1.4.6.
Accumulating evidence suggests that insulin also regulates JAK-STAT signalling. For
example, insulin and insulin-like growth factor 1 (IGF-1) could induce tyrosine
phosphorylation and activation of JAK1 and JAK2 in cells overexpressing the insulin
receptor or the IGF-1 receptor (Gual et al., 1998). In another study, JAK2 was shown to
associate with the insulin receptor and IRS-1 following stimulation with physiological
concentrations of insulin, and was rapidly phosphorylated and activated in insulin-sensitive
tissues of the rat (Saad et al., 1996). A study using siRNA to knock down JAK2 in L6
53
myotubes demonstrated that JAK2 is critical in mediating the mitogenic effects of insulin
by activating the MAPK/Erk pathway, but does not seem to be required for insulin-induced
GLUT4 translocation and glucose uptake, which is mediated by the PI3K/Akt pathway
(Thirone et al., 2006). In response to insulin, STAT5 can be directly phosphorylated by the
insulin receptor independent of JAK2 (Chen et al., 1997a), and participates in the
transcriptional regulation of insulin target genes (Sawka-Verhelle et al., 2000). Reciprocal
regulation of the insulin and JAK-STAT signalling pathways suggests that JAK-STATs
may participate in mediating the effects of insulin and contribute to metabolic regulation
under both physiological and pathophysiological conditions.
I.3.4 In vivo function of JAK2
JAK2 is ubiquitously expressed and mediates signalling by single chain hormone receptors
(including receptors for GH, prolactin, erythropoietin and thrombopoietin), receptors that
share the common β chain (such as receptors for IL-3, IL-5 and granulocyte macrophage
colony stimulating factor), receptors that share the gp130 subunit (including receptors for
IL-6, ciliary neurotrophic factor (CNTF), oncostatin M (OSM) and LIF), and some class II
cytokine receptors (such as receptors for IFNγ) (Parganas et al., 1998). The essential
function of JAK2 was revealed by the generation of Jak2 knockout mice that die at
embryonic day E12.5 due to an impairment in definitive erythropoiesis (Neubauer et al.,
1998; Parganas et al., 1998). Disruption of erythropoietin signal transduction seems to be
54
primarily responsible for the embryonic lethality in these knockout mice (Neubauer et al.,
1998).
In 2005, several independent groups identified an activating mutation in the pseudokinase
domain of the JAK2 gene (V617F) to be present in a high proportion of individuals with
myeloproliferative disorders, a group of hematological malignancies including primary
polycythemia vera, essential thrombocythemia and primary myelofibrosis characterized by
expansion of one or more myeloid lineages (Baxter et al., 2005; James et al., 2005;
Kralovics et al., 2005; Levine et al., 2005). The mutated kinase autophosphorylates and
becomes spontaneously active, allowing for the growth and survival of hematopoietic cells
in the absence of exogenous cytokine stimulation (James et al., 2005). Subsequently,
mutations in JAK2 were also identified in a subset of individuals with acute leukemia
(Bousquet et al., 2005; Murati et al., 2005). As such, there is a growing research interest
in the development of small molecule inhibitors for the treatment of JAK2-mediated
hematological diseases. One such inhibitor, ruxolitinib, has gained regulatory approval for
the treatment of myelofibrosis, and several others are currently being tested in clinical trials
(Quintas-Cardama et al., 2011).
Associations between common polymorphisms in the JAK2 gene and risk factors of
metabolic syndrome have been reported in humans (Ge et al., 2008; Penas-Steinhardt et
al., 2011), suggesting that JAK2 may play a role in the regulation of metabolic homeostasis.
55
This is not surprising, given that a number of JAK2-activating cytokines and hormones
have well-known regulatory roles in energy metabolism in metabolic tissues.
Of note, GH, also known as somatotropin, activates its cognate receptor and the JAK2-
STAT5 pathway to regulate linear growth and a myriad of other physiological functions.
In the liver, pulsatile GH secretion stimulates production and secretion of IGF-1 and other
target genes such as SOCS proteins. Secreted IGF-1, which mediates the anabolic effects
of GH, subsequently inhibits GH release from the anterior pituitary via a negative feedback
loop (Sjogren et al., 1999). As such, mice lacking GH receptor (GHR) are dwarf with low
circulating levels of IGF-1 and increased GH (List et al., 2011). GH antagonizes insulin
action by increasing hepatic glucose production, reducing peripheral insulin sensitivity and
stimulating lipolysis in the adipose tissue such that GHR null mice are obese but extremely
insulin sensitive (Vijayakumar et al., 2010). Other metabolic effects of GH include
promoting lipid oxidation, increasing muscle mass, regulating pancreatic β cell growth and
enhancing insulin secretion (Berryman et al., 2013).
I.3.5 Role of JAK-STAT pathway in adipose physiology
I.3.5.1 Role of JAK-STAT pathway in WAT
Protein expression of STAT1, 3, 5A and 5B is modulated during adipogenesis (Harp et al.,
2001; Stephens et al., 1996), implicating a role for these STATs in fat cell development.
56
PPARγ has been identified as a target gene of STAT1 (Hogan and Stephens, 2001), which
may mediate the suppressive effects of IFNγ on adipogenesis (Keay and Grossberg, 1980).
Conversely, the JAK2-STAT3 pathway is activated early during the proliferative phases
of 3T3-L1 adipogenesis (Deng et al., 2000) and regulates expression of the key adipogenic
transcription factor C/EBPβ (Zhang et al., 2011). Whether STAT3 plays a role in
regulating adipogenesis in vivo remains elusive. On the other hand, a role for STAT5 in
adipogenesis is strongly supported by evidence both in vitro and in vivo. Activation of
STAT5 occurs early during adipogenesis (Floyd and Stephens, 2003) and induces
expression of its potential target gene PPARγ (Kawai et al., 2007). Whole-body knockout
of STAT5 in mice resulted in fat pads one-fifth of the normal size (Teglund et al., 1998),
likely due to blunted adipogenesis during development. In addition, STAT5 has been
shown to mediate the adipogenic action of GH early during adipogenesis such that STAT5
antisense oligonucleotides attenuated GH-dependent differentiation of 3T3-F442A
preadipocytes (Yarwood et al., 1999).
In mature adipocytes, STAT proteins play distinct roles in adipocyte function and fuel
metabolism. In 3T3-F442A adipocytes, inhibition of lipoprotein lipase activity and
stimulation of lipolysis by IFNγ is likely mediated via transcriptional regulation by STAT1
(Doerrler et al., 1994; Hogan and Stephens, 2003). On the other hand, the STAT3-
activating factors leptin (Chen et al., 1996) and IL-6 (van Hall et al., 2003) induce lipolysis
in white adipose tissue. Furthermore, leptin and LIF inhibit fatty acid synthesis in white
adipose tissue by inhibiting the expression of lipogenic enzymes (Hogan and Stephens,
57
2005a; Zvonic et al., 2003). As such, adipocyte-specific knockout of STAT3 and
knockdown of leptin receptor in mice both led to profound adiposity, predominantly as a
result of adipocyte hypertrophy (Cernkovich et al., 2008; Huan et al., 2003). While
knockout of STAT3 in adipocytes did not affect glucose homeostasis up to 20 weeks of
age (Cernkovich et al., 2008), mice with decreased adipose leptin signalling displayed
glucose intolerance early in life (Huan et al., 2003). Interestingly, while STAT5 promotes
adipogenesis, it represses the expression of fatty acid synthase (Hogan and Stephens,
2005b) and the lipid-binding protein adipocyte protein 2 (AP2) (Richter et al., 2003). In
line with this, STAT5-activating hormones including GH and prolactin exert anti-lipogenic
and lipolytic actions in the adipose tissue (Fain et al., 1999; Ling et al., 2003). GH has
been shown to promote HSL activity (Richelsen et al., 2000), and GH treatment up-
regulated expression of the lipid hydrolase patatin-like phospholipase domain-containing
protein 3 (PNPLA3) in humans with GH deficiency (Zhao et al., 2011). Consistent with
this, mice lacking the GHR are obese with fat accumulation predominantly in the
subcutaneous adipose tissue (List et al., 2011). Similarly, disruption of GHR specifically
in adipocytes leads to progressive obesity as a result of increased adipose tissue mass, but
with no change in glucose homeostasis up to 5 months of age (List et al., 2013).
I.3.5.2 Role of JAK-STAT pathway in BAT
Over the last few years, emerging evidence has linked JAK-STAT signalling to brown and
beige adipocyte biology. Tyk2, one of the JAK family members, was recently shown to
58
regulate BAT differentiation through STAT3, which enhances protein stability of PR
domain containing 16 (PRDM16), a master regulator of brown and beige adipocyte
differentiation. Accordingly, knockout of Tyk2 resulted in impaired BAT function, and
development of obesity and glucose intolerance that could be restored by expression of a
constitutively active form of STAT3 (Derecka et al., 2012). STAT6, activated by IL-4, is
essential for activation of alternative macrophages in adipose tissue, which secrete
catecholamines to sustain cold-induced thermogenesis (Nguyen et al., 2011; Qiu et al.,
2014). Very recently, JAK inhibitors were identified by a small molecule screening
platform to promote “browning” of human adipocytes (Moisan et al., 2015). This
metabolic conversion was thought to be due to inhibition of interferon signalling and
activation of hedgehog signalling (Moisan et al., 2015).
A number of JAK2-activating cytokines and growth factors are known to regulate brown
and beige adipocyte biology. CNTF, first characterized as a growth and survival factor for
neurons, activates JAK2 and has been shown to potentiate induction of UCP1 in BAT by
β3 adrenergic agonists (Ott et al., 2002). Similarly, peripheral intravenous administration
of leptin in mice increased mRNA expression of thermogenic genes (Commins et al., 1999;
Sarmiento et al., 1997) and glucose utilization in BAT (Siegrist-Kaiser et al., 1997).
Furthermore, treatment with human GH for 10 days up-regulated UCP1 mRNA levels in
BAT from KK-Ay obese mice (Hioki et al., 2004). On the other hand, the lactogenic
hormones prolactin and placental lactogen were shown to regulate BAT differentiation
such that neonatal mice lacking the prolactin receptor have smaller BAT depots, reduced
59
expression of BAT-specific genes, and were more sensitive to cold exposure
(Viengchareun et al., 2008).
I.3.6 Role of JAK2-STAT signalling in the liver
I.3.6.1 Role of JAK2-STAT signalling in hepatic lipid homeostasis
In the liver, JAK2 is activated by several cytokines and growth factors including IFN-γ,
IL-4, IL-6, IL-13, GH and leptin (Gao, 2005). Mice with hepatocyte-specific deletion of
the entire leptin receptor did not exhibit any changes in body weight, body composition, or
blood glucose and insulin levels in the fed state (Cohen et al., 2001). Similarly, hepatocyte-
specific ablation of the leptin receptor signalling domain did not have an apparent effect
on energy balance or glucose metabolism in the basal state, but resulted in a small but
significant increase in hepatic triglyceride content (Huynh et al., 2010). Surprisingly, the
knockout mice were protected from diet- and age-induced glucose intolerance, partly due
to increased hepatic insulin sensitivity and enhanced glucose-stimulated insulin secretion
(Huynh et al., 2010). Mice with hepatocyte-specific deletion of the IL-6 receptor did not
have aberrant lipid accumulation in the liver but exhibited glucose intolerance and systemic
insulin resistance accompanied by increased hepatic and systemic inflammation
(Wunderlich et al., 2010). On the other hand, whole-body IL-6 deficiency leads to marked
steatosis, hepatic inflammation and systemic insulin resistance (Matthews et al., 2010),
60
whereas IL-6 treatment for 10 days was shown to alleviate steatosis in leptin deficient
ob/ob mice, ethanol-fed or HFD-fed mice (Hong et al., 2004). Genetic deletion of STAT3
specifically in hepatocytes up-regulated hepatic expression of gluconeogenic and lipogenic
genes, leading to both hepatic and systemic insulin resistance and triglyceride
accumulation in the liver (Inoue et al., 2004). Similarly, another study using hepatocyte-
specific STAT3 knockout mice showed elevated hepatic expression of lipogenic genes
including SREBP-1c in ethanol-fed mutant mice, leading to aggravated hepatic steatosis
(Horiguchi et al., 2008). However, STAT3 deficiency in this model did not lead to altered
expression of gluconeogenic genes or baseline serum glucose and insulin levels (Horiguchi
et al., 2008).
Another JAK2-activating factor important in regulating hepatic lipid homeostasis is GH,
evidenced by the observation that untreated adults with GH deficiency frequently present
with NAFLD, and GH therapy in these individuals reduces hepatic lipid content
(Nishizawa et al., 2012). In line with this, both hepatic GHR- and STAT5-deficient mice
exhibited marked steatosis (Barclay et al., 2011; Cui et al., 2007; Fan et al., 2009; List et
al., 2014). In addition, mice with hepatic deletion of GHR, STAT5 and IGF-1 all developed
insulin resistance and glucose intolerance (Cui et al., 2007; Fan et al., 2009; Yakar et al.,
2004). Increased hepatic lipid accumulation in these models was proposed to be secondary
to elevated serum GH levels resulting from loss of feedback inhibition by IGF-1. Aberrant
GH levels stimulated peripheral adipose lipolysis, and the released FFA was taken up by
the liver. The critical mediator of hepatic lipid accumulation in models of disrupted hepatic
61
GH signalling seems to be the scavenger receptor CD36 (also known as fatty acid
translocase). Indeed, Cd36 transcription can be regulated directly by STAT5 (Barclay et
al., 2011; Cheung et al., 2007), or indirectly by PPARγ, whose expression is repressed by
STAT5-mediated GH signalling (Chawla et al., 2001; Zhou and Waxman, 1999).
Recently, mice genetically deficient in JAK2 specificially in hepatocytes were shown to
develop spontaneous hepatic steatosis without impairment in whole-body insulin
sensitivity (Sos et al., 2011). The fatty liver phenotype was shown to be dependent on
excess GH signalling in peripheral tissues such that abolishment of aberrant GH secretion
by crossing the knockout mice with the GH-deficient little mice, which exhibit a point
mutation in the GH-releasing hormone receptor, completely normalized hepatic
triglyceride content (Sos et al., 2011). However, the role of JAK2 in the inflammatory
progression of NAFLD has not been fully elucidated.
I.3.6.2 Role of JAK2-STAT signalling in hepatic inflammation and NAFLD
progression
Consistent with the role of JAK2 in mediating inflammatory cytokine signalling, the JAK2
inhibitor AG490 has been shown to inhibit STAT1 and STAT3 phosphorylation, and
protect mouse livers from inflammation and apoptosis induced by ischemia and reperfusion
(Freitas et al., 2010). Furthermore, JAK2 expression and activity were shown to be
increased in fibrotic livers, especially in hepatic stellate cells (Granzow et al., 2014).
Pharmacological inhibition of JAK2 by AG490 attenuated liver fibrosis in mice, and this
62
was proposed to be due to the cell-intrinsic role of JAK2 in hepatic stellate cells (Granzow
et al., 2014). However, AG490 can also inhibit other tyrosine kinases and is therefore not
specific for JAK2 (Levitzki, 1990), rendering it difficult to interpret the results.
Activation of various STAT proteins can act as either pro- or anti-inflammatory signals in
the liver. Hepatocyte STAT1 activation by IFNγ during viral hepatitis is a pro-apoptotic
and pro-inflammatory signal that induces hepatocyte death and liver damage. As such,
STAT1 null mice are resistant to concanavalin A or LPS plus D-galactosamine-induced
liver inflammation and injury (Hong et al., 2002). Conversely, STAT3 activation acts
mostly as a survival and anti-inflammatory signal and protects against liver damage (Wang
et al., 2011). However, in some settings, STAT3 can be pro-inflammatory. For example,
STAT3 deficiency was shown to protect against inflammatory damage induced by chronic
ethanol feeding in mice (Horiguchi et al., 2008). The underlying mechanisms are unclear
but may be related to STAT3-mediated induction of pro-inflammatory cytokines and
chemokines (Horiguchi et al., 2008). Consistent with a role of STAT5 in hepatoprotection,
mice with hepatocyte-specific STAT5 deletion were found to be more susceptible to
carbon tetrachloride-induced liver fibrosis and cancer as a result of elevated STAT3
activation and transforming growth factor beta (TGFβ) stabilization (Hosui et al., 2009).
These mice also developed severe liver fibrosis in a model of cholestatic liver disease due
to the down-regulation of hepatoprotective genes (Blaas et al., 2010).
63
Chapter II: Thesis Objectives and Hypotheses
64
Obesity and associated metabolic syndrome significantly increase the risk of
cardiovascular disease (Isomaa et al., 2001) and type 2 diabetes (Hanson et al., 2002).
Additionally, recent large-scale epidemiological studies have identified obesity as an
independent risk factor for cancer (Calle et al., 2003; Moller et al., 1994; Wolk et al., 2001).
One potential unifying mechanism underlying the pathophysiology of the metabolic
syndrome and associated complications is the chronic low-grade inflammatory response
associated with obesity. Thus, a better understanding of how inflammation contributes to
the pathogenesis of obesity-associated metabolic disorders will facilitate development of
better therapeutic strategies for metabolic syndrome and long-term complications.
The proper interaction and communication between cells during the inflammatory response
relies on a complex network of cytokines and their receptors. Pathways that mediate the
signal transduction of cytokines may therefore be important in the development of obesity
and related metabolic disorders. The JAK-STAT pathway is activated by a wide variety of
cytokines, hormones and growth factors, and mediates cytokine-mediated inflammatory
response. JAK2, an essential player in the JAK-STAT pathway, is ubiquitously expressed
and is activated by single chain hormone receptors, receptors that share the common β
chain, receptors that share the gp130 subunit, and some class II cytokine receptors
(Parganas et al., 1998). Evidence linking JAK2 to metabolic regulation is derived from
studies suggesting that JAK2 can regulate pathways downstream of insulin signalling
(Burfoot et al., 1997; Johnston et al., 1995), and that insulin can induce tyrosine
phosphorylation and activation of JAK2 in cells overexpressing the insulin receptor and in
65
insulin-sensitive tissues of the rat (Gual et al., 1998; Saad et al., 1996). In addition,
associations between common polymorphisms in the JAK2 gene and risk factors of
metabolic syndrome have been reported in humans (Ge et al., 2008; Penas-Steinhardt et
al., 2011), suggesting that JAK2 may play a role in the regulation of metabolic homeostasis.
Disruption in adipocyte function is often thought to be one of the early driving forces in
the development of obesity-associated metabolic disturbances. In the adipose tissue, JAK2
mediates the signal transduction of numerous cytokines and hormones that regulate
adipocyte development and function. Several cytokines secreted by adipocytes also signal
through JAK2, illustrating its physiological importance in adipocyte biology. Recently,
adipocyte-specific deletion of JAK2 driven by the Adiponectin promoter has been shown
to result in reduced lipolysis and increased body fat (Nordstrom et al., 2013). However,
the molecular mechanisms underlying this phenotype and its metabolic consequences are
not clear.
The first objective of this thesis was to investigate the in vivo role of adipocyte JAK2 in
white adipocyte biology and fuel metabolism. The work described in Chapter IV of this
thesis examines the metabolic consequences of adipose JAK2 deficiency. We took an in
vivo genetic approach to disrupt Jak2 specifically in adipocytes using the Ap2 promoter-
driven Cre-loxP recombination system. We hypothesized that adipocyte JAK2 is involved
in the regulation of adipogenesis, lipogenesis and adipocyte function, and its deficiency
66
will alter adipocyte biology, leading to disruption in whole-body energy balance and
glucose homeostasis.
The second objective of this thesis was to examine the role of adipose JAK2 in BAT
function and metabolic control. Using the adipocyte-specific JAK2 knockout mice we
generated in Chapter IV, we asked whether JAK2 plays a role in adaptive thermogenesis.
We hypothesized that JAK2 regulates UCP1 expression in BAT and its disruption will
impair the dynamic response of BAT to stress, leading to cold intolerance and diet-induced
obesity and diabetes.
In addition to the adipose tissue, obesity is also frequently associated with dysfunction of
other metabolic organs. In the liver, obesity-related insulin resistance promotes the
development of NAFLD and long-term complications including cirrhosis, liver failure and
hepatocellular carcinoma (Smith and Adams, 2011). Recent studies in the literature
implicate a critical role of the JAK2-STAT pathway in the regulation of hepatic lipid
metabolism such that disruption of JAK2-STAT signalling often leads to steatosis and
impaired glucose homeostasis. In particular, it was shown that deletion of JAK2 in
hepatocytes resulted in spontaneous steatosis (Sos et al., 2011). Nevertheless, the exact
role of JAK2 in the inflammatory progression of NAFLD has not been fully elucidated.
The final objective of this thesis was to investigate the metabolic and inflammatory role
of hepatic JAK2. To this end, in Chapter VI, we generated and characterized mice with
Jak2 deletion specifically in hepatocytes driven by the Albumin promoter. We also placed
67
these mice on a high fat diet to examine the effects of JAK2 ablation in response to
metabolic stress. We hypothesized that JAK2 plays a critical role in hepatic lipid
metabolism and its deficiency will promote development of steatosis, leading to alteration
in whole-body metabolic homeostasis.
68
Chapter III: Materials and Methods
69
III. 1 Mouse protocol
All mice were housed in a pathogen-free facility at the Toronto Medical Discovery Tower
(Toronto, ON, Canada) with a 12-hr light-dark cycle and free access to water and standard
irradiated rodent chow (5% fat; Harlan Teklad, Indianapolis, IN, USA). All animal
experimental protocols were approved by the Toronto General Research Institute Animal
Care Committee.
Chapter IV - Adipocyte-specific Jak2 knockout mice were generated by breeding mice
with the Jak2 gene flanked by loxP sites (Jak2fl/fl) (Krempler et al., 2004; Wagner et al.,
2004) (kindly provided by Kay-Uwe Wagner, University of Nebraska Medical Center,
Omaha, NE, USA) with mice expressing Cre recombinase under the control of the Ap2
promoter (aP2Cre+; purchased from the Jackson Laboratory). The resulting
aP2Cre+Jak2+/fl mice were intercrossed to generate aP2Cre+Jak2+/+, aP2Cre+Jak2+/fl and
aP2Cre+Jak2fl/fl (herein referred to as A-JAK2 KO) mice. Genotyping for Cre and Jak2
was performed by polymerase chain reaction (PCR) using tail DNA as described in Section
III. 2 and III. 3. Mice were maintained on a mixed 129Sv and C57BL/6 background. Both
male and female mice were used.
Chapter V – A-JAK2 KO mice generated in Chapter IV were used and Ap2Cre+Jak2+/+
littermates served as controls. Starting at 8 weeks of age, a cohort of mice were fed a HFD
(60% fat, 24% carbohydrates and 16% protein based on caloric content; F3282; Bio-Serv,
Flemington, NJ, USA) for 8-10 weeks.
70
Chapter VI – Mice with hepatocyte-specific JAK2 deficiency were generated by breeding
mice with the Jak2 gene flanked by loxP sites (Jak2fl/fl) (Krempler et al., 2004; Wagner et
al., 2004) to mice that harbored the Cre transgene under the control of the Albumin
promoter (AlbCre+; purchased from the Jackson Laboratory, Bar Harbor, ME, USA). The
resulting AlbCre+Jak2+/fl mice were intercrossed to generate AlbCre+Jak2flfl (L-JAK2 KO)
and AlbCre+Jak2+/+ (Control) mice. Mice used in this study were maintained on a mixed
C57BL/6 and 129Sv background. Both male and female mice were used. Some mice were
fed a HFD (60% fat, 24% carbohydrates and 16% protein based on caloric content; F3282;
Bio-Serv, Flemington, New Jersey, USA) for 8-10 weeks starting at 2 months of age.
III. 2 DNA extraction
Tail samples obtained from 10- to 14-day-old mice were digested at 55 °C overnight in
700 μL buffer (25 mM Tris pH 7.5, 50 mM EDTA, 1% SDS) plus 5 μL proteinase K (0.5
mg/mL; EMD Chemicals, Inc., Gibbstown, NJ, USA). Thereafter, 700 μL
phenol:chloroform:isoamyl alcohol (25:24:1) (USB Corporation, Cleveland, OH, USA)
was added to each digested sample. Samples were vortexed vigorously and centrifuged at
14,000 rpm for 5 min. The upper aqueous phase (~600 μL) was then transferred to a new
eppendorf tube and 900 μL of 100% ethanol was added to precipitate DNA. Samples were
washed once with 70% ethanol, air dried, and resuspended in 70 μL of autoclaved double
distilled water.
71
III. 3 Polymerase chain reaction (PCR) genotyping
Genotyping of Cre was performed using the following primers: 5'-GGC AGT AAA AAC
TAT CCA GCA A-3' and 5'- GTT ATA AGC AAT CCC CAG AAA TG-3'. For the PCR
amplification protocol, the melting temperature was 95°C for 30 seconds, the annealing
temperature was 64°C for 30 seconds, and the primer extension phase was 72°C for 30
seconds, for 40 cycles. The final PCR product was 250 bp.
Genotyping of Jak2 was performed using the following primer sequences: 5’- ATT CTG
AGA TTC AGG TCT GAG C-3’ and 5’-CTC ACA ACC ATC TGT ATC TCA C-3’. For
the PCR programme, the melting temperature was 95°C for 30 seconds, the annealing
temperature was 57°C for 30 seconds, and the primer extension phase was 72°C for 45
seconds, for 38 cycles. The final PCR product was 230 bp for the wild-type allele and ~310
bp for the floxed allele.
All primers were synthesized by Eurofins MWG Operon (Huntsville, AL, USA). PCR
products were separated on 1% agarose gels, stained with 0.3 μg/mL ethidium bromide
and visualized by UV light.
72
III. 4 In vivo metabolic studies
All overnight fasts were carried out between 5:00 PM and 9:00 AM. Glucose tolerance test
(GTT) was performed on overnight-fasted mice with i.p. glucose injection at a dose of 1
g/kg body weight. Insulin tolerance test (ITT) was performed on animals fasted for
overnight (for L-JAK2 KO mice) or 4 hr (for A-JAK2 KO mice) using human regular
insulin (Humulin R, Eli Lilly & Co, Indianapolis, IN, USA) at an i.p. injection dose of 1.5
U/kg (for L-JAK2 KO mice) or 1.0 U/kg (for A-JAK2 KO mice). For both GTT and ITT,
blood glucose levels were measured from the tail vein at 0, 15, 30, 45, 60 and 120 min after
injection using a glucometer (Contour, Bayer HealthCare, Mishawaka, IN, USA). Glucose
stimulated insulin secretion (GSIS) was performed on mice fasted overnight with an i.p.
glucose injection at a dose of 3 g/kg body weight. Blood was collected from the saphenous
vein (for L-JAK2 KO mice) or the tail vein (for A-JAK2 KO mice) at 0, 2, 10 and 30 min
after glucose injection and serum was prepared by centrifuging blood at 5,000 rpm for 10
min. Serum samples were assayed for insulin by a mouse insulin ELISA kit according to
the manufacturer’s protocol (Crystal Chem, Downers Grove, IL, USA). For insulin
signalling experiments, mice fasted overnight were injected i.p. with human regular insulin
(5 U/kg) or PBS. Tissues were harvested 10 min later, snap frozen in liquid nitrogen and
later processed for western blotting.
To measure energy expenditure, mice were individually housed in a Comprehensive
Laboratory Animal Monitoring System (Columbus Instruments, Columbus, OH, USA)
73
with free access to food and water. After 24-hr acclimatization to the apparatus, data for
24 hr were collected. Energy expenditure was measured by volume of oxygen consumption
(VO2). Respiratory exchange ratio (RER) was calculated as the ratio between the volume
of carbon dioxide production (VCO2) to VO2. Physical activity was determined by infra-
red beam breaks. Food consumption and water intake were determined by weighing the
food and measuring the volume of drinking water, respectively, before and after the
measurement.
III. 5. Body temperature and cold exposure
Body temperature was measured in fed mice between 10:00 and 11:00 A.M. using a rectal
temperature probe. For the cold exposure experiment in Chapter V, mice were housed
individually and transferred to a cold room with an ambient temperature of 4 °C for 6 hours.
Body temperature was measured at indicated time points.
III. 6 Body composition by nuclear magnetic resonance spectroscopy
(Chapter IV)
Body composition of 5-month-old chow-fed male A-JAK2 KO mice and control
littermates was assessed by nuclear magnetic resonance spectroscopy at the Spatio-
74
Temporal Targeting and Amplification of Radiation Response (STTARR) program in
Toronto Medical Discovery Tower (Toronto, ON, Canada). Images were acquired on a 7
Tesla Bruker Biospec 70/30 system (Bruker Corporation, Ettlingen, Germany), using the
B-GA12 gradient coil insert and 7.2 cm inner diameter cylindrical RF volume coil. Mice
were oriented in prone position on a dedicated murine slider bed, with isoflurane
administered at 1.8% to the nose cone. The SAII physiologic monitoring and gating
system provided a respiratory trace (SAII, Stonybrook, NY, USA). Magnetic resonance
images with bright fat signal were acquired using a respiratory-gated T2-weighted RARE
(Rapid Acceleration Relaxation Enhancement) pulse sequence, as a stack of 2D coronal
slices encompassing the volume of the mouse (echo time 30 ms; echo train length 8;
repetition time determined by respiratory interval, 360 × 160 matrix over 9 × 4 cm field-
of-view for 0.25 × 0.25 mm in-plane resolution, 22 slices, 1 mm slice thickness). Total fat
volumes were quantified using a combination of semi-automated and manual segmentation
tools in MIPAV software (Version 7.0.1; National Institute of Health, Bethesda, MD,
USA).
III. 7 Ex vivo lipolysis (Chapter IV)
Perigonadal fat pads were surgically removed from 6-month-old chow-fed A-JAK2 KO
mice and control littermates and kept in warm PBS. After drying on a piece of gauze, the
fat pads were cut into 50-mg pieces and incubated in 1 mL Krebs-Ringer bicarbonate buffer
75
plus 5 mM HEPES containing 2% fatty acid-free BSA. After a preincubation period of 1
hr at 37 °C, isoproterenol (10 μM; Sigma, St. Louis, MO, USA), recombinant murine leptin
(0.1 and 1.0 nM; PeproTech, Rocky Hill, NJ, USA) or recombinant mouse GH (500 and
5000 μg/L; National Hormone and Peptide Program, Torrance, CA, USA) was added
directly to the incubation medium. After 2 hr of incubation, aliquots of the media were
saved and stored at -80 °C until analysis. Glycerol release into the medium was determined
using the Free Glycerol Reagent according to the manufacturer’s protocol (Sigma, St.
Louis, MO, USA).
III. 8 Hyperinsulinemic-euglycemic clamp (Chapter VI)
Hyperinsulinemic-euglycemic clamp was performed as previously described (Duez et al.,
2009) on 4-month-old chow-fed L-JAK2 KO mice and control littermates. Briefly,
following a 5-hr fast, [3-3H] glucose (Perkin-Elmer, Waltham, MA, USA) infusion (2.8 µ
Ci bolus, 0.052 µCi/min) was initiated for a 120-min equilibration period. During the last
30 min, three sequential blood samples were taken at 10-min interval for determination of
glucose-specific activity. At time 0, a continuous infusion of human insulin (Humulin R;
5mU/kg/min) was initiated. Blood glucose was measured every 10 min and a 30% glucose
solution was infused at a variable rate to maintain euglycemia. Steady state was achieved
when the glucose infusion rate to maintain blood glucose was constant for 30 min.
76
III. 9 Analyses of serum parameters
Mice were anesthetized and blood was collected by cardiac puncture. Serum was prepared
by centrifuging blood at 5,000 rpm for 10 min. Serum alanine aminotransferase (ALT) and
aspartate aminotransferase (AST) levels in L-JAK2 KO mice were measured by IDEXX
Ltd. (Markham, ON, Canada). Serum insulin levels were measured by a mouse insulin
ELISA kit (Crystal Chem Inc.). Serum GH and IGF-1 levels were determined by
radioimmunoassay, and serum adiponectin, leptin, TNF-α and IL-6 levels by the Luminex
100 System (Luminex, Austin, TX, USA) at the Mouse Metabolic Phenotyping Centre
(Vanderbilt University, Nashville, TN, USA). In Chapter V, serum cytokine levels were
determined by the Milliplex mouse serum adipokine kit (Millipore, Billerica, MA, USA).
Serum total cholesterol, triglyceride, HDL-cholesterol and FFA were assayed at the Mouse
Metabolic Phenotyping Centre (Vanderbilt University). LDL and VLDL cholesterol levels
were calculated indirectly using the following formulas: VLDL = triglyceride/5, and LDL
= total cholesterol – HDL – triglyceride/5.
III. 10 Hepatic lipid content and FA composition (Chapter VI)
Total lipid from liver tissues was extracted with a 2:1 chloroform-methanol mixture. The
upper aqueous phase was removed and the combined solvent layer was allowed to
77
evaporate. The dried lipids were resuspended in 100% ethanol, and total triglyceride and
cholesterol concentrations were determined using commercially available kits from
Randox according to the manufacturer’s instructions (Mississauga, ON, Canada). Fatty
acid composition of hepatic triglyceride was analyzed as previously described (Chen et al.,
2008). Briefly, total lipid was extracted from frozen livers by the Folch technique (Folch
et al., 1957) and separated by thin-layer chromatography. Fatty acids were hydrolyzed and
converted to fatty acid methyl esters using 14% boron trifluoride-methanol, then quantified
using a Varian-430 gas chromatograph (Varian, Lake Forest, CA, USA). The concentration
of each fatty acid at baseline was calculated via comparison to the internal control
heptadecanoic acid (17:0) made at known concentrations. For ceramide analysis, samples
were analyzed by Liquid Chromatography/Mass Spectrometry/Mass Spectrometry
(LC/MS/MS). Biological extracts were injected onto a reverse phase C18 HPLC Column
to separate and resolve the various sphingolipids that were eluted from the column and
analyzed on a triple quadruple mass spectrometer Sciex API 4000. Data acquisition was
performed in a targeted MRM (MS/MS) mode using sphingolipid specific precursor ion to
product ion (or parent to daughter ion) mass transitions. The resulting data were processed
using Applied Biosystems Analyst 1.4.2 software (AB Sciex, Framingham, MA, USA).
78
III. 11 Histology, immunohistochemistry and immunofluorescence
Liver, pancreas and adipose tissue were harvested, fixed in 4% paraformaldehyde in 0.1 M
PBS (pH 7.4) and processed to paraffin blocks. Slides were cut in 7-m sections with 150
m separation on three levels. Adipose tissue sections were stained with hematoxylin and
eosin (H and E), and adipocyte size was measured using the cellSens software (Olympus,
Tokyo, Japan). Adipocyte number per fat pad was calculated from the ratio of total fat pad
volume to average adipocyte volume using the method developed by Lemonnier
(Lemonnier, 1972). Immunostaining for UCP1 was performed on BAT sections using a
rabbit anti-mouse UCP1 antibody (Abcam, Cambridge, UK). Immunohistochemistry was
performed on pancreatic sections using anti-insulin antibody (Dako, Carpinteria, CA,
USA). Scanned sections were analyzed with ImageScope version 11.0.2.716 software
(Aperio Technologies, Vista, CA, USA). Liver sections were stained with H and E and
Masson’s trichrome stain. Immunofluorescent staining in liver sections was performed
with anti-F4/80 antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) and
visualized using a Zeiss inverted fluorescent microscope. For Oil-Red-O staining, liver
tissue was embedded in Tissue-Tek OCT compound (Sakura Finetek, Alphen aan den Rijn,
Netherlands) for frozen block preparation. Slides were cut in 10-μm sections with 150 m
separation on three levels. Sections were fixed in 4% paraformaldehyde in 0.1 M PBS (pH
7.4) and stained with Oil-Red-O for lipid detection.
79
III. 12 RNA isolation and quantitative reverse transcription (RT)-PCR
Total RNA from liver tissue was isolated with the RNeasy Mini Kit according to the
manufacturer’s protocol (Qiagen, Germantown, MD, USA). Total RNA from adipose
tissue was isolated using the Trizol reagent (Invitrogen, Carlsbad, CA, USA). Briefly,
adipose tissue was homogenized in 1 mL Trizol and centrifuged at 12,000 g for 10 min at
4 °C. The clear homogenate was transferred to a new eppendorf tube, and 200 μL
chloroform was added. Samples were then shaken vigorously and centrifuged at 11,900 g
for 15 min at 4 °C. Thereafter, the upper aqueous phase was transferred to a new tube, and
500 μL isopropanol was added to precipitate the RNA. The RNA pellet was washed twice
with 75% ethanol, air dried, dissolved in diethylpyrocarbonate (DEPC)-treated water, and
treated with DNase I. 1 g of RNA was used as a template for first strand cDNA synthesis
with random primers using the Maloney murine leukemia virus (M-MLV) reverse
transcriptase enzyme (Invitrogen). Quantitative PCR was performed using specific primers
and SYBR Green master mix (Applied Biosystems, Carlsbad, CA, USA) on a 7900HT
Fast-Real Time PCR System (Applied Biosystems). The following PCR cycling
parameters were used: initial denaturation stage at 50°C for 120 seconds and at95°C for
600 seconds, amplification stage at 95°C for 15 seconds and 60°C for 60 seconds for 40
cycles, and the final dissociation stage at 95°C for 15 seconds and 60°C for 15 seconds. Each
sample was run in triplicate. The relative mRNA abundance of each gene was normalized
to the expression levels of the housekeeping gene 18S or Gapdh. Primer sequences are
listed in Table 1.
80
Table 1: Primer sequences for quantitative RT-PCR
Gene Forward (5'-3') Reverse (5'-3')
18s AGTCCCTGCCCTTTGTACACA CGATCCGAGGGCCTCACTA
Acadm GCAGGAGCCCGGATTAGG CGGGCAGTTGCTTGAAACTC
Acads GGAGTTATCATGAGCGTCAACA CTGTGCGGATCCAAACTTCAG
Acadvl AGTGGCCCGGTTCTTT GTGTCGTCCTCCACCTTCTC
Acaca CTCCAGGACAGCACAGATCA TGACTGCCGAAACATCTCTG
Acox1 CAGGAAGAGCAAGGAAGTGG CCTTTCTGGCTGATCCCATA
Adipoq GGAACTTGTGCAGGTTGGAT GCTTCTCCAGGCTCTCCTTT
Apob GCCATGTCCAGGTACGAACT TGGTACGGTTCCCTTTCTTG
Cd36 GGAACTGTGGGCTCATTGC CATGAGAATGCCTCCAAACAC
Cebpa AAGAACAGCAACGAGTACCGG CATTGTCACTGGTCAGCTCCA
Cpt-1 GCAGAGCACGGCAAAATGA CTTTCGACCCGAGAAGACCTT
Emr1 CTTTGGCTATGGGCTCCAGTC GCAAGGAGGACAGAGTTTATCGTG
Fabp4 GACGACAGGAAGGTGAAGAG ACATTCCACCACCAGCTTGT
Fasn TGGGTTCTAGCCAGCAGAGT ACCACCAGAGACCGTTATGC
G6pc TCTGTCCCGGATCTACCTTG GTAGAATCCAAGCGCGAAAC
Hmgcr TGGAGATCATGTGCTGCTTC GCGACTATGAGCGTGAACAA
Ifng ACTGGCAAAAGGATGGTGAC GCTGATGGCCTGATTGTCTT
Igf1 GGCATTGTGGATGAGTGTTG TCTCCTTTGCAGCTTCGTTT
Il1b GCCCATCCTCTGTGACTCAT AGGCCACAGGTATTTTGTCG
Il6 CTCTGGGAAATCGTGGAAATG AAGTGCATCATCGTTGTTCATACA
Irs1 GGTGCTGCAGCTGATGAATA CGAGATCTCCGAGTCAGTCC
Lep TTCACACACGCAGTCGGTAT GCTGGTGAGGACCTGTTGAT
Lipe GCTGGAGGAGTGTTTTTTTGC AGTTGAACCAAGCAGGTCACA
Mttp CACTCAGGCAATTCGAGACA TCTGGCTGAGGTGGGAATAC
Pck1 GTGAGGAAGTTCGTGGAAGG TCTGCTCTTGGGTGATGATG
Pdk4 GAGGATTACTGACCGCCTCTTTAG TTCCGGGAATTGTCCATCAC
Pnpla2 TGTGGCCTCATTCCTCCTAC TCGTGGATGTTGGTGGAGCT
Ppara CAGGGTACCACTACCGAGTTCAC CCGAATAGTTCGCCGAAAGA
Pparg GCCCTTTGGTGACTTTATGG CAGCAGGTTGTCTTGGATGT
Ppargc1a ATGTGTCGCCTTCTTGCTCT CGGTGTCTGTAGTGGCTTGA
Prdm16 CAGCACGGTGAAGCCATTC GCGTGCATCCGCTTGTG
Scd1 GCGATACACTCTGGTGCTCA CCCAGGGAAACCAGGATATT
Slc2a4 TCATTGTCGGCATGGGTTT GGCAAATAGAAGGAAGACGTAAGG
Srebf1 GATCAAAGAGGAGCCAGTGC TAGATGGTGGCTGCTGAGTG
Socs3 GCCCCTTTGTAGACTTCACG GGAAACTTGCTGTGGGTGAC
Tnf GAACTGGCAGAAGAGGCACT AGGGTCTGGGCCATAGAACT
Ucp1 GTGAAGGTCAGAATGCAAGC AGGGCCCCCTTCATGAGGTC
Ucp2 TCCACGCAGCCTCTACAAT GACCTTTACCACATCTGTAGGC
Ucp3 CAGAGGGACTATGGATGCCTAC AGGTGAGACTCCAGCAACTTCT
81
III. 13 Immunoblotting
Tissues were mechanically homogenized in ice-cold lysis buffer (50 mM Tris-HCl, pH7.5,
20 mM EDTA, 1% Triton X-100, 0.5 mM PMSF, 1 mM sodium orthovanadate, 10 μg/mL
leupeptin and 10 μg/mL aprotinin) and lysates were cleared by centrifugation at 14,000
rpm for 10 min. Protein concentration was determined by the Bradford method. Thereafter,
30-40 μg of protein was boiled in Laemmli sample buffer and resolved by sodium
dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with 10%
polyacrylamide gels. Proteins were then transferred onto polyvinylidene difluoride (PVDF)
membranes (GE Healthcare Bio-Sciences, Piscataway, NJ, USA), blocked with 5% BSA
in Tris-buffered saline with 0.1% Tween 20 (TBST) for 1 hr at room temperature and
incubated with primary antibodies at 4 °C overnight. The blots were then washed three
times with TBST and incubated with horseradish peroxidase-conjugated secondary
antibodies (Santa Cruz Biotechnology) at a dilution of 1:3000 for 1 hr at room temperature.
Thereafter, the blots were further washed three times with TBST and visualized by an
enhanced chemiluminescence system (GE Healthcare Bio-Sciences).
The following primary antibodies were used: UCP1 (Santa Cruz Biotechnology), phospho-
Akt (S473), total Akt, GAPDH, total JAK2, phospho-STAT3 (Y705), total STAT3,
phospho-STAT5 (Y694) and total STAT5 (Cell Signaling Technology, Danvers, MA,
USA). Protein band intensity was quantified by ImageJ software (National Institutes of
Health, Bethesda, MD, USA) and normalized to the respective control groups.
82
III. 14 Statistical analysis
Data are presented as mean ± standard error of the mean (SEM). Values were analyzed by
two-tailed independent-sample Student’s t-test or one-way ANOVA, as appropriate, using
GraphPad Prism version 5 (GraphPad Software, La Jolla, CA, USA). p-values < 0.05 were
considered as statistically significant. *p< 0.05; **p< 0.01; ***p< 0.001.
83
Chapter IV: Role of adipose JAK2 in white adipose tissue
biology and lipid metabolism
Sally Yu Shi, Cynthia T. Luk, Jara J. Brunt, Tharini Sivasubramaniyam, Shun-Yan Lu,
Stephanie A. Schroer, Minna Woo
Reproduced in part from Diabetologia. (2014) 57(5):1016-26, with kind permission from
Springer Science and Business Media
Contributions:
S.Y.S. designed experiments, generated and analyzed research data, and prepared the
manuscript. C.T.L. isolated RNA for quantitative RT-PCR analysis and performed GTT
and ITT experiments. J.J.B. performed insulin immunostaining and serum insulin analysis.
T.S. helped with genotyping and performed GTT and ITT experiments. S.-Y.L. isolated
RNA for quantitative RT-PCR analysis and helped with Western blot experiments. S.A.S.
helped with genotyping experiments. M.W. designed experiments, contributed to
discussion and interpretation of the data, and critically edited the manuscript.
84
IV. 1 Introduction
Adipose tissue mass is maintained by the balance between lipid synthesis and catabolism.
Disruption in this equilibrium has been implicated in the pathophysiology of various
metabolic disorders, particularly obesity and type 2 diabetes (Guilherme et al., 2008; Kahn
and Flier, 2000; Sun et al., 2011). A better understanding of the regulatory mechanisms
governing adipocyte biology and homeostasis is therefore crucial, given the growing
worldwide epidemic of obesity (Swinburn et al., 2011).
The Janus kinase (JAK)–signal transducer and activator of transcription (STAT) pathway
mediates the signal transduction of numerous cytokines, growth factors and hormones that
regulate adipocyte development and function (Richard and Stephens, 2011). Several
cytokines secreted by adipocytes also use this signalling pathway, illustrating the
physiological importance of JAK–STATs in adipocyte biology. We and others have
recently shown that hepatocyte-specific deletion of JAK2, a ubiquitously expressed
member of the JAK kinase family, results in profound lipid accumulation in liver tissue,
suggesting a role for JAK2 in lipid metabolism (Shi et al., 2012; Sos et al., 2011). JAK2
is present in pre-adipocytes and mature adipocytes (Stewart et al., 1999), as well as in
adipose tissue (Hellgren et al., 2001). Its mRNA abundance has been shown to be
downregulated in human omental adipose tissue under obese conditions (Gomez-Ambrosi
et al., 2004), suggesting a potential role in the regulation of adipose tissue physiology.
85
During adipogenesis, JAK2 is activated within 2 hrs of adipogenic induction and has been
shown to act upstream of STAT3 activation (Zhang et al., 2011). Inhibition of JAK2 with
a small-molecule inhibitor or small interfering RNA attenuated the differentiation of 3T3-
L1 adipocytes (Zhang et al., 2011). JAK2 has also been shown to be required for growth
hormone (GH)-dependent differentiation of pre-adipocytes via activation of STAT5
(Yarwood et al., 1999), a critical regulator of adipocyte development (Floyd and Stephens,
2003; Nanbu-Wakao et al., 2002; Shang and Waters, 2003).
In mature adipocytes, JAK2 can be activated by several cytokines and hormones, most
notably leptin, GH, prolactin, IL-6, LIF, OSM, ciliary neurotrophic factor (CNTF) and
IFN-γ. These cytokines and hormones regulate many aspects of adipose tissue biology. For
example, leptin (Siegrist-Kaiser et al., 1997), IL-6 (Trujillo et al., 2004; van Hall et al.,
2003), IFN-γ (Memon et al., 1992), GH (Goodman, 1968) and prolactin (Fielder and
Talamantes, 1987) have all been shown to exert lipolytic effects on isolated adipocytes and
adipose tissue. Furthermore, leptin, CNTF and LIF can inhibit fatty acid synthesis in white
adipose tissue either via a central mechanism (Buettner et al., 2008) or by inhibiting the
expression of lipogenic enzymes (Hogan and Stephens, 2005a; Zvonic et al., 2003). In
addition to regulating adipose expansion, CNTF enhances the expression of uncoupling
protein 1 induced by β3-adrenergic stimulation in brown adipose tissue (Ott et al., 2002).
OSM, a member of the IL-6 family of cytokines, suppresses adiponectin expression and
induces dedifferentiation of adipocytes (Song et al., 2007). Whether all these effects are
86
mediated by JAK2 and to what extent JAK2 activation is required for them to occur has
not been established.
At the cellular level, JAK2 functions primarily by transducing signals from cytokines and
activating downstream STAT proteins. There is also evidence of STAT-independent
functions of JAK2 in adipocytes. It has been shown that fatty acid binding protein 4/AP2,
a highly-expressed lipid-binding protein in adipocytes, associated with the
unphosphorylated form of JAK2 and attenuated its signalling (Thompson et al., 2009).
Nevertheless, the cell-specific functions of adipocyte JAK2 are not well understood.
Recently, adipocyte-specific deletion of JAK2 driven by the Adiponectin promoter has
been shown to result in reduced lipolysis and increased body fat (Nordstrom et al., 2013).
The molecular mechanisms behind this and the metabolic consequences are not clear. We
sought to investigate the metabolic effects of adipose JAK2 deficiency. We found that mice
with impaired adipose JAK2 signalling driven by the Ap2 (also known as Fabp4) promoter
developed profound adiposity when on a regular chow diet, and that this was associated
with reduced energy expenditure. Thus, while glucose metabolism in young mice was
normal, these mice developed whole-body insulin resistance with aging.
IV. 2 Mouse Model and Experimental Design
87
Whole-body JAK2 disruption leads to embryonic lethality due to defective erythropoiesis
(Parganas et al., 1998). To gain insight into the in vivo role of JAK2 in adipose tissue
biology, we took a conditional knockout approach to disrupt Jak2 specifically in adipocytes
using the Ap2 promoter-driven Cre-loxP recombination system. Specific deletion of Jak2
in adipocytes was confirmed by Western blotting in tissue lysates from A-JAK2 KO mice
and control littermates.
To examine the role of adipose JAK2 in body weight regulation, we kept A-JAK2 KO mice
and control littermates on a standard chow diet and weighed them monthly. Body
composition was determined by nuclear magnetic resonance spectroscopy at 5 months of
age. We also isolated and weighed major subcutaneous, visceral and brown fat pads at time
of sacrifice to examine whether adipose JAK2 deficiency leads to any changes in adiposity.
General morphology and size distribution of adipocytes were analyzed on H and E-stained
adipose sections. In order to assess the energy balance status in A-JAK2 KO mice, we
measured their rectal temperature and evaluated their food intake, energy expenditure and
physical activity by indirect calorimetry at 1 and 5 months of age.
To elucidate molecular changes resulting from JAK2 deficiency, we analyzed the
expression of genes involved in lipid and glucose metabolism in the perigonadal adipose
tissue by quantitative RT-PCR. Due to the well-known lipolytic effects of JAK2-activating
cytokines, we examined lipolysis ex vivo in perigonadal adipose tissue explants by
measuring glycerol release into the incubation medium in response to leptin and GH.
88
Effects of adipose JAK2 disruption on adipocyte function were assessed by measuring
circulating levels of lipids including total triglycerides, total cholesterol, FFA and
cholesterol lipoproteins. mRNA and circulating levels of adipokines including leptin,
adiponectin, TNF-α and IL-6 were also determined.
In order to determine whole-body metabolic consequences of adipose JAK2 deficiency,
glucose homeostasis in A-JAK2 KO mice was assessed at 1 and 5 months of age by
measuring random and fasting blood glucose levels and fasting serum insulin levels, as
well as performing GTT, ITT and GSIS. Tissue-specific insulin sensitivity was evaluated
by measuring protein levels of phosphorylated Akt in the perigonadal adipose tissue, liver
and skeletal muscle after insulin stimulation.
IV. 3 Results
IV. 3-1 Disruption of adipocyte JAK2 increases body weight
A-JAK2 KO mice were viable and fertile with no gross abnormalities compared with
littermate controls. Quantitative RT-PCR and western blot analyses showed a significant
reduction of Jak2 mRNA and protein abundance in the inguinal, perigonadal and brown
adipose tissue (Figure IV-1A and B). JAK2 abundance in other tissues, including liver,
89
skeletal muscle, brain and macrophages was not affected (Figure IV-1C). Selective
deficiency of JAK2 in adipose tissue did not affect circulating levels of GH (which requires
JAK2 for signal transduction) and its downstream target IGF-1 (Figure IV-1D and E).
To study the role of adipocyte JAK2 in body weight regulation, we followed A-JAK2 KO
mice and littermate controls on a standard chow diet and monitored their body weight
monthly. As shown in Figure IV-2A and B, starting from 3 months of age for males and 2
months of age for females, A-JAK2 KO mice progressively gained more body weight than
aP2Cre+Jak2+/+ and aP2Cre+Jak2+/fl littermate controls. This was particularly evident in
female mice (Figure IV-2C). Interestingly, heterozygous aP2Cre+Jak2+/fl mice exhibited a
similar growth curve to aP2Cre+Jak2+/+ mice, suggesting that gene dosage had no effect
on body weight. For subsequent analyses, we combined data from aP2Cre+Jak2+/+ and
aP2Cre+Jak2+/fl mice, collectively referring to them as controls. By 6 months of age, male
and female A-JAK2 KO mice weighed approximately 40.3% and 65.8% more than their
control littermates, respectively (Figure IV-2D and E). Body length was slightly greater
(Figure IV-2F and G), while BMI was significantly higher in A-JAK2 KO mice (Figure
IV-2H and I).
90
Figure IV-1 Efficient and specific deletion of JAK2 in adipose tissue.
(A) mRNA expression of Jak2 in inguinal (Ing.), perigonadal (Peri.), and interscapular
brown adipose tissue (BAT) from aP2Cre+Jak2+/+ and A-JAK2 KO mice at 5 to 6 months
of age (n≥3). Values are expressed as fold changes relative to the aP2Cre+Jak2+/+ group.
(B) Lysates from visceral (VAT) and BAT were prepared and processed for
immunoblotting for JAK2. Protein band intensity was quantified by ImageJ software and
normalized to the aP2Cre+Jak2+/+ group (n=4-6). (C) Tissue lysates from 5 to 6-month-
old mice were prepared and processed for immunoblotting for JAK2. MΦ, macrophages.
(D-E) Serum levels of (D) GH and (E) IGF-1 from overnight fasted mice at 5 to 6 months
of age (n≥4). Results are mean ± SEM. *, p<0.05; and ***, p<0.001.
91
Figure IV-2 Increased body weight in A-JAK2 KO mice.
(A-B) Growth curves of (A) male and (B) female aP2Cre+Jak2+/+, aP2Cre+Jak2+/- and
A-JAK2 KO mice (n≥8). (C) A representative photograph of female aP2Cre+Jak2+/+ and
A-JAK2 KO littermates at 6 months of age. (D-I) Body weight, body length measured from
snout to anus, and BMI at 5 to 6 months of age in (D, F, H) male (n≥10) and (E, G, I)
female (n≥7) control and A-JAK2 KO mice. Results are mean ± SEM. **, p<0.01; and ***,
p<0.001.
92
IV. 3-2 Disruption of adipocyte JAK2 leads to increased adiposity
To determine the underlying basis for the increased body weight, we measured body
composition by nuclear magnetic resonance spectroscopy. Lean body mass was similar in
A-JAK2 KO mice and control littermates (Figure IV-3A and B). However, fat mass and
body fat content were significantly increased in A-JAK2 KO mice at 5 months of age
(Figure IV-3A to C). Similarly, when we isolated and weighed fat pads from mice at 5 to
6 months of age, all fat pads examined from A-JAK2 KO mice weighed more than those
examined from control littermates. The differences reached statistical significance for
absolute fat pad weight (Figure IV-3D and G) and per cent total body weight (Figure IV-
3E and H). Notably, greater differences between genotypes were observed in both sexes
for the inguinal depot compared with the perigonadal depot. On the other hand, the absolute
weight of other organs was comparable between the genotype groups, with the exception
of the liver, which weighed more in female A-JAK2 KO mice (Figure IV-3F and I).
Together, these results suggest that adipocyte JAK2 deficiency leads to higher body weight
due to increased adiposity.
H and E staining revealed the presence of enlarged adipocytes in inguinal, perigonadal and
interscapular brown adipose tissue in A-JAK2 KO mice (Figure IV-3J). Analysis of
adipocyte size, distribution and number suggested a threefold increase in the average size
of perigonadal adipocytes, with no change in adipocyte number (Figure IV-3K to M).
Similar changes were observed for adipocytes from the inguinal depot (data not shown).
93
Figure IV-3 Increased adiposity in A-JAK2 KO mice.
(A-C) Body composition measured by nuclear magnetic resonance spectroscopy of male
mice at 5 months of age (n=5). (D-H) Weight of inguinal (Ing.), perigonadal (Peri.),
retroperitoneal (Retro.), mesenteric (Mes.) and BAT fat pads from 5 to 6-month-old male
(n≥11) and female (n≥10) mice. Results are expressed as (D and G) absolute fat pad weight
or (E and H) per cent total body weight. (H and I) Absolute weight of liver, pancreas,
spleen, heart and kidneys from 5 to 6-month-old male (n≥10) and female (n≥6) mice. (J)
Representative micrographs of H and E staining from 5 to 6-month-old female mice. Scale
bar, 40 µm. (K-M) Quantification of (K) adipocyte size distribution, (L) average adipocyte
size; and (M) cell number in perigonadal fat pads from tissue sections described in (J) (n=3).
Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
94
These results indicate that the adipose tissue expansion observed in A-JAK2 KO mice is
due to adipocyte hypertrophy, not to an increase in cell number.
IV. 3-3 A-JAK2 KO mice have normal energy metabolism at 1 month of age,
but display reduced energy expenditure as they age
To delineate the physiological mechanisms that would account for the apparent positive
energy balance in A-JAK2 KO mice, we measured their food intake and energy
expenditure by indirect calorimetry. At 1 month of age when A-JAK2 KO mice had a
similar body weight to control littermates, there were no significant differences in absolute
food or water intake, VO2, RER, physical activity or body temperature between the
genotype groups in both sexes (Figure IV-4A to L). These data suggest that adipose JAK2
deficiency had no direct effect on energy balance.
By 5 to 6 months of age, A-JAK2 KO mice still had normal absolute daily food and water
intake, suggesting no change in energy intake (Figure IV-5A to D). A-JAK2 KO mice were
also comparable to control littermates in terms of the energy source utilised, as indicated
by a similar RER (Figure IV-5E and F). On the other hand, VO2 was significantly lower in
A-JAK2 KO mice of both sexes (Figure IV-5G and H), consistent with their reduced
energy expenditure. This was associated with significantly reduced physical activity in
female A-JAK2 KO mice (Figure IV-5J). Male A-JAK2 KO mice also showed a non-
95
Figure IV-4 No change in energy balance in A-JAK2 KO mice at 1 month of age.
(A-J) One-month-old male (n≥6) and female (n≥3) mice were housed individually in
metabolic chambers with free access to food and water and energy balance data were
collected for 24 hours. (A-D) Daily food intake and water intake were determined by
weighing the chow and measuring volume of drinking water, respectively, before and after
the measurement; (E and F) Oxygen consumption (VO2); (G and H) Respiratory exchange
ratio (RER), calculated as the ratio between volume of CO2 production and O2
consumption (VCO2/VO2); and (I and J) physical activity, expressed as average number of
infra-red beam breaks during one measurement interval. (K and L) Rectal temperature of
mice at 1 month of age (n≥3). Results are mean ± SEM.
96
significant decrease in physical activity compared with control littermates (Figure IV-5I).
In contrast, body temperature was not altered by adipocyte JAK2 deficiency (Figure IV-
5K and L). Together, these results suggest that the progressive increase in body weight in
A-JAK2 KO mice may be due, at least in part, to decreased energy expenditure.
IV. 3-4 Adipose JAK2 deficiency leads to impaired lipolysis
To elucidate molecular changes in adipose tissue that could account for the observed
phenotype in A-JAK2 KO mice, we analysed the expression of genes involved in lipid and
glucose metabolism in perigonadal adipose tissue. At 1 month of age, gene expression was
not altered by JAK2 deficiency (Figure IV-6A and B). The genes studied included known
STAT target genes, e.g. Fabp4, fatty acid synthase (Fas, also known as Fasn), acyl-CoA
oxidase 1 (Acox1) and pyruvate dehydrogenase kinase (Pdk4). By 5 to 6 months of age,
genes implicated in lipid accumulation became differentially regulated. An overall
upregulation of genes implicated in adipogenesis was observed (Figure IV-6C). On the
other hand, enzymes regulating fatty acid synthesis showed decreased expression. mRNA
levels of hormone sensitive lipase (Lipe) were significantly increased, whereas expression
of adipose triglyceride lipase (Pnpla2) was reduced in A-JAK2 KO mice (Figure IV-6C).
In addition, the mRNA abundance of genes involved in β-oxidation was elevated,
suggesting a disruption in adipose lipid homeostasis. In contrast, the expression of genes
regulating glucose metabolism was not altered by JAK2 deficiency (Figure IV-6D).
97
Figure IV-5 Reduced energy expenditure in A-JAK2 KO mice at 5 to 6 months of age.
(A-J) 5 to 6-month-old male (n=6) and female (n≥6) mice were housed individually in
metabolic chambers with free access to food and water and energy balance data were
collected for 24 hours. (A-D) Daily food intake and water intake were determined by
weighing the chow and measuring volume of drinking water, respectively, before and after
the measurement; (E and F) Respiratory exchange ratio (RER), calculated as VCO2/VO2;
(G and H) Oxygen consumption (VO2); and (I and J) physical activity, expressed as
average number of infra-red beam breaks during one measurement interval. (K and L)
Rectal temperature of mice at 5 to 6 months of age (n≥3). Results are mean ± SEM. *,
p<0.05; **, p<0.01; and ***, p<0.001.
98
Figure IV-6 Dysregulated expression of lipid metabolism genes in white adipose tissue
from A-JAK2 KO mice.
(A and C) mRNA expression of genes involved in lipid metabolism in perigonadal adipose
tissue from (A) 1-month-old (n≥5); and (C) 5 to 6-month-old (n≥6) mice. Values are
expressed as fold changes relative to the control group. Cebpa, CCAAT/enhancer binding
protein, alpha; Srebf1, sterol regulatory element-binding protein 1c; Fabp4, fatty acid
binding protein 4; Pparg, peroxisome proliferator-activated receptor gamma; Acc, acetyl-
CoA carboxylase; Fas, fatty acid synthase; Lipe, hormone sensitive lipase; Pnpla2, adipose
triglyceride lipase; Cpt-1, carnitine palmitoyltransferase 1; Acox1, acyl-CoA oxidase 1,
palmitoyl. (B and D) mRNA abundance of genes implicated in glucose metabolism in
perigonadal adipose tissue from (B) 1-month-old (n≥5); and (D) 5 to 6-month-old (n≥6)
mice. Irs1, insulin receptor substrate 1; Slc2a4, solute carrier family 2 (facilitated glucose
transporter); Pdk4, pyruvate dehydrogenase kinase isozyme 4. Results are mean ± SEM. *,
p<0.05; **, p<0.01; and †, p=0.06.
99
Next, given the well-known lipolytic effects of JAK2-activating cytokines and hormones,
we measured ex vivo lipolysis in adipose explants from 5- to 6-month-old mice. As shown
in Figure IV-7A, baseline glycerol release was not affected by adipose JAK2 deficiency.
On the other hand, while isoproterenol induced a robust lipolytic response in controls, this
effect was significantly attenuated in A-JAK2 KO mice. Furthermore, glycerol release in
response to leptin and GH was completely abolished in A-JAK2 KO adipose tissue,
indicating impaired lipolysis.
Consistent with disrupted lipid homeostasis in adipose tissue, A-JAK2 KO mice showed
higher FFA levels in the circulation at 5 to 6 months of age (Figure IV-7B), whereas levels
of triglyceride (Figure IV-7C), total cholesterol (Figure IV-7D) and cholesterol
lipoproteins (Figure IV-7E) were not changed. Finally, despite the presence of massive
adiposity and increased circulating FFA concentration, liver tissue from A-JAK2 KO mice
did not accumulate a significant amount of lipid, as shown by histological staining (Figure
IV-7F). Together, these results suggest that adipose JAK2 deficiency results in defective
lipolysis, leading to a disruption of whole-body lipid homeostasis.
IV. 3-5 A-JAK2 KO mice have disrupted adipokine secretion
To investigate the effects of JAK2 deficiency on adipose function, we also examined
expression patterns of adipokines. At 1 month of age, mRNA levels of leptin, adiponectin
and Tnfa (also known as Tnf) were similar, whereas expression of Il6 was downregulated
100
Figure IV-7 Impaired lipolysis and disrupted lipid homeostasis in A-JAK2 KO mice.
(A) Glycerol release from perigonadal fat explants of 6-month-old mice stimulated with
isoproterenol, recombinant leptin or growth hormone. Results are from triplicate samples
repeated three times. (B-E) Serum levels of (B) FFA; (C) triglyceride; (D) total cholesterol;
and (E) cholesterol lipoproteins from overnight fasted mice at 5 to 6 months of age (n≥4).
(F) Representative micrographs of H and E staining of liver sections from 5 to 6-month-
old female mice. Scale bar, 80 µm. Results are mean ± SEM. *, p<0.05; **, p<0.01.
101
in perigonadal adipose tissue from A-JAK2 KO mice (Figure IV-8A). As A-JAK2 KO
mice accumulated more adipose mass with age, their perigonadal adipose tissue
upregulated the mRNA transcription of leptin and Tnfa (Figure IV-8B). Consistent with
this, levels of these adipokines were also elevated in the circulation (Figure IV-8C and E).
In addition, while gene expression of adiponectin was not changed (Figure IV-8B),
circulating adiponectin levels were significantly reduced in A-JAK2 KO mice (Figure IV-
8D).
IV. 3-6 A-JAK2 KO mice show impaired insulin sensitivity as they age
To determine the metabolic consequences of adipocyte JAK2 disruption, we assessed
glucose metabolism in A-JAK2 KO mice. At 2 months of age, A-JAK2 KO mice displayed
no changes in random or fasting blood glucose levels (Figure IV-9A to D). Responses of
blood glucose to exogenous glucose and insulin administration were also similar in A-
JAK2 KO compared with control mice (Figure IV-9E to H). This normal glucose
metabolism was present despite the significant increase in adiposity in female A-JAK2 KO
mice.
By 5 to 6 months of age, male and female A-JAK2 KO mice maintained normal levels of
random and fasting blood glucose (Figure IV-10A to D). An i.p. GTT suggested the
presence of glucose intolerance, especially in female A-JAK2 KO mice (Figure IV-10E
and F). However, when we performed an OGTT using a fixed dose of glucose (50 mg) to
102
Figure IV-8 Disrupted adipokine profile in A-JAK2 KO mice.
(A-B) mRNA expression of genes encoding adipokines in perigonadal adipose tissue from
(A) 1-month-old (n≥5); and (B) 5 to 6-month-old (n≥8) mice. Values are expressed as fold
changes relative to the control group. Lep, leptin; Adipoq, adiponection. (C-F) Serum levels
of adipokines from overnight fasted mice at 5 to 6 months of age (n≥4). Results are mean
± SEM. *, p<0.05; **, p<0.01; ***, p<0.001; and †, p=0.07.
103
Figure IV-9 Normal glucose homeostasis in A-JAK2 KO mice at 2 months of age.
(A and B) Random blood glucose; (C and D) fasting blood glucose; (E and F) i.p. glucose
tolerance test (1 g/kg); and (G and H) i.p. insulin tolerance test (1.0 U/kg) at 2 months of
age in male (n≥6) and female (n≥5) mice. Results are mean ± SEM.
104
eliminate the difference in dosing between genotype groups, glucose tolerance in A-JAK2
KO mice was comparable to that in control littermates (Figure IV-10G and H), suggesting
that A-JAK2 KO mice may be able to maintain glucose homeostasis at this age.
Nevertheless, while male A-JAK2 KO mice showed no significant change in insulin
sensitivity (Figure IV-11A and C), female A-JAK2 KO mice showed impaired insulin
sensitivity during an ITT (Figure IV-11B) and higher fasting serum insulin levels (Figure
IV-11D). Next, to assess organ-specific insulin sensitivity, female A-JAK2 KO mice and
control littermates were challenged with insulin, and tissues removed and processed for
analysis of insulin signalling by western blotting. As shown in Figure IV-11E, insulin-
stimulated Akt phosphorylation was significantly attenuated in perigonadal adipose tissue,
liver and skeletal muscle of A-JAK2 KO mice, suggesting the presence of whole-body
insulin resistance. This was associated with increased beta cell area, probably as a
compensatory response to increased insulin demand (Figure IV-11F and G). However,
glucose-stimulated insulin secretion was normal in A-JAK2 KO mice (Figure IV-11H). In
summary, selective JAK2 deficiency in adipocytes results in whole-body insulin resistance
in association with disrupted lipid homeostasis and adipokine secretion.
105
Figure IV-10 Impaired glucose tolerance in A-JAK2 KO mice at 5 to 6 months of age.
(A and B) Random blood glucose; (C and D) fasting blood glucose; (E and F) i.p. glucose
tolerance test (1 g/kg); and (G and H) oral glucose tolerance test (50 mg) in male (n≥5) and
female (n≥5) mice at 5 to 6 months of age. Results are mean ± SEM. *, p<0.05; and **,
p<0.01.
106
Figure IV-11 Whole-body insulin resistance in A-JAK2 KO mice at 5 to 6 months of
age.
(A and B) i.p. ITT (1.0 U/kg); and (C and D) fasting serum insulin levels in 5 to 6-month
old male and female mice (n≥5). (E) Tissue lysates were prepared from 6-month-old female
mice injected with insulin (5 U/kg) and immunoblotted for phospho-Akt (S473). Protein
band intensity was normalized to PBS-injected control group (n=3). (F) Representative
micrographs of pancreatic sections from 5 to 6-month-old female mice stained with anti-
insulin antibody (original magnification ×10). Arrowheads point to pancreatic islets. (G)
Quantification of β-cell area from pancreatic sections described in (F) (n=3). (H) Serum
insulin levels in response to an i.p. injection of glucose in mice at 5 months of age (n=6).
Results are mean ± SEM. *, p<0.05; and **, p<0.01.
107
IV. 4 Summary
In this chapter, we investigated the role of JAK2, a key mediator of cytokine signalling, in
adipose tissue biology and whole-body metabolism. Using mice lacking Jak2 in adipocytes,
we show that JAK2 plays an essential role in maintaining adipose mass, such that its
deficiency resulted in extensive adipose tissue expansion even on a regular chow diet. This
was associated with reduced energy expenditure in A-JAK2 KO mice. In perigonadal
adipose tissue, the expression of numerous genes involved in lipid metabolism was
differentially regulated. In addition, adipose tissue from A-JAK2 KO mice displayed
impaired lipolysis in response to isoproterenol, growth hormone and leptin stimulation,
suggesting that adipose JAK2 directly modulates the lipolytic program. Impaired lipid
homeostasis was also associated with disrupted adipokine secretion. Accordingly, while
glucose metabolism was normal at 2 months of age, by 5 to 6 months of age, A-JAK2 KO
mice exhibited whole-body insulin resistance. Taken together, our results highlight the
critical role of adipocyte JAK2 in the regulation of adipocyte biology, energy homeostasis,
and whole-body metabolism.
108
Chapter V: Role of adipose JAK2 in BAT function and
thermogenesis
Sally Yu Shi, Wei Zhang, Tharini Sivasubramaniyam, Jara J. Brunt, Stephanie A.
Schroer, Kay-Uwe Wagner and Minna Woo
Status: Under peer review in Diabetologia
Contributions:
S.Y.S. designed experiments, generated and analyzed research data, and prepared the
manuscript. W.Z. helped with Western blotting and quantitative RT-PCR experiments. T.S.
helped with GTT and ITT experiments and measured serum cytokine levels. J.J.B. helped
with quantitative RT-PCR experiments. S.A.S. helped with serum cytokine measurements
and mouse genotyping. K.-U.W. generated the Jak2fl/fl mice. M.W. designed experiments,
contributed to discussion and interpretation of the data, and critically edited the manuscript.
109
V. 1 Introduction
The fast expanding obesity epidemic worldwide necessitates better understanding of its
underlying pathogenic mechanisms as well as development of novel treatment strategies.
Obesity is driven by an imbalance in caloric intake and energy expenditure, with the excess
nutrients stored as fat (Spiegelman and Flier, 2001). While adipose tissue is best known
for its function in energy storage, specialized adipocytes can promote energy expenditure
and suppress weight gain by way of non-shivering thermogenesis (Cannon and Nedergaard,
2004; Harms and Seale, 2013). Brown adipocytes, located in dedicated depots, express
constitutively high levels of uncoupling protein 1 (UCP1) that uncouples the electron
transport chain, leading to the generation of heat at the expense of ATP production
(Golozoubova et al., 2006). In contrast, inducible beige adipocytes, which also express
UCP1, develop in white adipose tissue in response to thermogenic activators (Vitali et al.,
2012). Studies in humans indicate that brown and beige adipocytes are a crucial player in
the regulation of energy expenditure. Importantly, their activity is inversely correlated with
the severity of the metabolic syndrome (Cypess et al., 2009; Saito et al., 2009; Virtanen et
al., 2009). Thus, strategies to enhance brown or beige adipocyte function represent an
appealing approach to combat obesity.
Thermogenesis in brown adipose tissue (BAT) is activated by excessive caloric intake or
following cold exposure to counteract energy surplus or to maintain body temperature,
110
respectively (Ouellet et al., 2012; Rothwell and Stock, 1979). Cold- and diet-induced
thermogenesis is mediated by the sympathetic nervous system through stimulation of β3
adrenergic receptors on BAT to activate UCP1 activity and/or expression (Bachman et al.,
2002; Young et al., 1982). In addition, cold also activates beige adipocyte development
and function (Vitali et al., 2012). Better understanding of the molecular mechanisms
regulating this adaptive thermogenesis will facilitate development of brown or beige
adipocyte activators for the treatment of metabolic diseases.
The Janus kinase (JAK) – signal transducer and activator of transcription (STAT) pathway
is activated by a variety of cytokines, hormones and growth factors and plays an important
role in many cellular functions (O'Shea et al., 2002). Over the past few years, emerging
evidence has linked JAK-STAT signalling to brown and beige adipocyte biology (Derecka
et al., 2012; Moisan et al., 2015; Nguyen et al., 2011). Tyk2, one of the JAK family
members, was recently shown to regulate BAT differentiation by enhancing protein
stability of PR domain containing 16 (PRDM16), a master regulator of brown and beige
adipocyte differentiation (Derecka et al., 2012). STAT6, through stimulation by IL-4, is
essential for activation of alternative macrophages in BAT, which secrete catecholamines
to sustain cold-induced thermogenesis (Nguyen et al., 2011). Nevertheless, the direct role
of JAK2, a ubiquitously expressed JAK family member, has not been addressed.
JAK2 is activated in response to a number of cytokines and hormones that regulate brown
and beige adipocyte development and function such as growth hormone (GH) (Hioki et al.,
111
2004; Li et al., 2003), prolactin (Viengchareun et al., 2008), leptin (Sarmiento et al., 1997;
Siegrist-Kaiser et al., 1997), IL-6 (Li et al., 2002; Wernstedt et al., 2006) and ciliary
neurotrophic factor (CNTF) (Ott et al., 2002). In this chapter, we investigated the role of
JAK2 in thermogenesis, particularly in response to metabolic and thermal stress. We show
that JAK2 is required for diet- and cold-induced thermogenesis and UCP1 expression in
BAT. Accordingly, A-JAK2 KO mice were unable to maintain body temperature in
response to cold exposure and had exacerbated obesity, insulin resistance and glucose
intolerance after a high fat diet (HFD).
V. 2 Mouse Model and Experimental Design
To gain insight into the molecular regulation of diet-induced thermogenesis, we employed
a widely used dietary obesity model where mice were fed a HFD for 8-10 weeks starting
at 2 months of age. Prolonged feeding of a HFD in which the majority of caloric intake is
from fat induces obesity, insulin resistance, glucose intolerance and hepatic steatosis (West
et al., 1992).
We first examined diet-induced thermogenesis in different adipose depots by comparing
mRNA expression of Ucp1 in wild-type mice after feeding with HFD for 8-10 weeks.
Regulation of adipose Jak2 expression in response to HFD was also assessed by
quantitative RT-PCR.
112
Next, to investigate the causal relationship between JAK2 and regulation of UCP1
expression in response to energy excess, we used A-JAK2 KO mice generated in Chapter
IV and fed them a HFD for 8-10 weeks. To verify the extent of caloric excess with HFD
feeding, daily energy intake was estimated by measuring food consumption, and fuel
utilization was assessed by calculating RER using VO2 and VCO2 measured via indirect
calorimetry. Subsequently, expression levels of Ucp1 and Jak2 was measured in different
adipose depots in HFD-fed mice and their chow-fed counterparts. VO2 measured by
indirect calorimetry was used as a surrogate marker for energy expenditure to evaluate the
degree of diet-induced thermogenesis.
To further study the role of JAK2 in BAT function, we examined brown adipocyte
morphology by H and E staining in chow-fed A-JAK2 KO mice and control littermates at
1 and 5 months of age. In addition, expression of BAT-specific genes and genes involved
in brown adipocyte differentiation was measured by quantitative RT-PCR. UCP1 protein
abundance was also evaluated by immunohistochemical staining. Activation of the JAK-
STAT pathway in various adipose depots was assessed by phosphorylation of different
STAT proteins by Western blotting to explore potential molecular mechanisms by which
JAK2 regulates thermogenesis in fat.
Next, to delineate the consequence of changes in thermogenic capacity, we analyzed
energy balance in HFD-fed A-JAK2 KO mice and control littermates by indirect
calorimetry. Body weight was monitored monthly after the start of the HFD, and BMI was
113
calculated. We also isolated and weighed major subcutaneous and visceral fat pads at time
of sacrifice to evaluate changes in adiposity. Adipocyte size distribution was analyzed on
H and E-stained adipose sections, and adipokine levels were measured in serum.
We then asked whether JAK2-mediated regulation of adaptive thermogenesis plays any
role in metabolic control. To this end, glucose homeostasis was assessed in HFD-fed A-
JAK2 KO mice and control littermates by measurement of random and fasting blood
glucose levels as well as performing GTT. Whole-body insulin sensitivity was evaluated
by measuring fasting serum insulin levels and conducting ITT experiments. Tissue-specific
insulin sensitivity was assessed by quantifying Akt phosphorylation in various metabolic
tissues after insulin stimulation by Western blotting.
We also studied the involvement of JAK2 in cold-induced thermogenesis by individually
housing HFD-fed A-JAK2 KO mice and control littermates at 4 °C and measuring their
rectal temperature hourly for 6 hours. Changes to Jak2 and Ucp1 mRNA expression in
response to cold stimulation was measured by quantitative RT-PCR in white and BAT.
V. 3 Results
114
V. 3-1 Adipocyte JAK2 expression and diet-induced thermogenesis
To better understand the molecular mechanisms that regulate energy expenditure in the
adipose tissue, we first investigated the thermogenic program of different fat depots in
response to caloric excess. Feeding mice a HFD for 8-10 weeks increased daily energy
intake by approximately 20% (Figure V-1A). As expected, this disruption in energy
balance significantly up-regulated Ucp1 mRNA expression in BAT (Figure V-1B).
Furthermore, HFD also induced Ucp1 in white adipose tissue, particularly in the
subcutaneous depot (SAT) (Figure V-1B), which is abundant in beige adipocyte precursors
(Vitali et al., 2012). Of note, expression levels of Ucp1 in SAT and visceral adipose tissue
(VAT) were 2 to 3 orders of magnitude lower than in BAT. Consistent with UCP1 up-
regulation, HFD significantly elevated Prdm16 expression in BAT and SAT (Figure V-
1C), suggesting enhanced differentiation of brown and beige adipocytes.
We next examined JAK2 expression in different fat depots. Interestingly, Jak2 was more
abundantly expressed in BAT than white adipose tissue (Figure V-1D), implicating a role
in BAT biology. Of note, along with Ucp1 induction, we observed an increase in Jak2
mRNA abundance in all three fat depots examined in response to HFD (Figure V-1E).
Similar to Ucp1 and Prdm16, the extent of Jak2 induction was greater in BAT and SAT
than VAT. Taken together, these results suggest that JAK2 may play a role in diet-induced
thermogenesis.
115
Figure V-1 Adipocyte JAK2 expression and diet-induced thermogenesis.
(A) Daily energy intake in wild-type mice fed a standard chow or HFD for 8-10 weeks
(n≥9). (B-C) mRNA expression of (B) Ucp1 and (C) Prdm16 in wild-type mice (n≥5).
Values were normalized to 18S mRNA levels. (D) mRNA expression of Jak2 in different
adipose depots (n≥3). Values were normalized to 18S mRNA levels. (E) mRNA expression
of Jak2 in wild-type mice (n≥5). Values are expressed as fold change relative to the
respective chow group. Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
116
V. 3-2 JAK2 is required for diet-induced UCP1 expression and thermogenesis
in BAT
To test whether energy excess-stimulated Ucp1 expression in adipose tissue is casually
related to Jak2 induction, we utilized mice with adipocyte-specific JAK2 deficiency (A-
JAK2 KO) we have generated previously (Shi et al., 2014) and fed them a HFD for 8-10
weeks. As shown in Figure V-2A, the increase in daily energy intake following HFD
feeding is similar in A-JAK2 KO mice and control littermates. In addition, A-JAK2 KO
mice exhibited a comparable reduction in their RER as control littermates (Figure V-2B),
indicating preferential lipid utilization upon high fat feeding. In BAT, HFD up-regulated
UCP1 expression only in control, but not A-JAK2 KO mice (Figure V-2C and D), whereas
in white adipose depots, HFD induced Ucp1 equally in A-JAK2 KO mice and control
littermates (Figure V-2C), suggesting that JAK2 is required for diet-induced UCP1
expression in BAT, but not in SAT or VAT. Expression pattern of Prdm16 was not
significantly affected by JAK2 deficiency (Figure V-2E). Accordingly, while control mice
increased their VO2 and thus, energy expenditure in response to HFD feeding, A-JAK2
KO mice did not (Figure V-2F), revealing an essential role of adipose JAK2 in diet-induced
thermogenesis.
Indeed, consistent with impaired BAT function and abnormalities in energy expenditure,
in Chapter IV of this thesis, we observed extensive adipose expansion and development of
progressive obesity in A-JAK2 KO mice even on a chow diet (Shi et al., 2014). H and E
117
Figure V-2 JAK2 is required for diet-induced UCP1 expression and energy
expenditure in BAT.
(A) Daily energy intake (n≥5). (B) RER (n≥5). (C) mRNA expression of Ucp1 (n≥5).
Values are expressed as fold change relative to the respective chow control group. (D) BAT
lysates from chow and HFD-fed mice were prepared and immunoblotted for UCP1. Protein
band intensity was quantified by ImageJ software and normalized to actin (n=3). (E)
mRNA expression of Prdm16 (n≥5). Values are expressed as fold change relative to the
respective chow control group. (F) VO2 in chow and HFD-fed mice (n≥5). Results are
mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
118
staining of BAT sections indicated larger adipocytes with bigger fat droplets in one-month-
old A-JAK2 KO mice (Figure V-3A). This abnormality in brown adipocyte morphology
was more pronounced in older mice, with the appearance of large unilocular fat droplets
inside the fat cells (Figure V-3A). Consistent with impaired BAT function, chow-fed A-
JAK2 KO mice showed lower Ucp1 mRNA abundance in their BAT compared to control
littermates as early as 1 month of age (Figure V-3B). This correlated with reduced
expression of Ppargc1a, a transcriptional co-activator that co-ordinates expression of
UCP1 in response to adrenergic stimulation (Puigserver et al., 1998). However, mRNA
expression of Prdm16 was not affected. Similar trends were observed in older animals on
a chow diet (Figure V-3A and C).
To investigate the mechanism of impaired BAT function, we examined activation of the
JAK-STAT pathway in JAK2-deficient adipose tissue. Consistent with reduced JAK2-
mediated activation, STAT5 phosphorylation was significantly attenuated in both BAT and
white adipose tissue (Figure V-4). Levels of phospho-STAT3 were also reduced in BAT,
suggesting that JAK2 is required for STAT3 activation in brown adipocyte. In contrast,
STAT3 phosphorylation was significantly increased in SAT and VAT from A-JAK2 KO
mice, likely as a compensatory mechanism. Together, these data suggest that brown
adipocyte UCP1 expression and its STAT signaling are dependent on JAK2.
119
Figure V-3 Impaired BAT function in A-JAK2 KO mice.
(A) Representative micrographs of H and E and UCP1 staining of BAT sections from
chow-fed mice. Scale bar, 20 μm. (B-C) mRNA expression of genes in BAT from chow-
fed mice at (B) one (n≥5) and (C) five (n=3) months of age. Values are expressed as fold
change relative to the control group. Results are mean ± SEM. *, p<0.05; and **, p<0.01.
120
Figure V-4 Reduced STAT3 and 5 phosphorylation in BAT from A-JAK2 KO mice.
Adipose tissue lysates from HFD-fed mice were prepared and immunoblotted for JAK2,
p-STAT3 (Y705) and p-STAT5 (Y694). Protein band intensity was quantified by ImageJ
software and normalized to GAPDH, total STAT3 and total STAT5, respectively (n=3-5).
Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
121
V. 3-3 Increased weight gain in HFD-fed A-JAK2 KO mice
Accordingly, insufficient UCP1 induction upon HFD feeding resulted in lower energy
expenditure (Figure V-5A) with no significant difference in ambulatory activity (Figure V-
5B), leading to more body weight gain in A-JAK2 KO mice compared to control littermates
(Figure V-5C). After 2 months of HFD, A-JAK2 KO mice weighed approximately 40%
more than controls (Figure V-5C), with a higher BMI (Figure V-5D). Furthermore, analysis
of different fat depots indicated significant adipose tissue expansion in the SAT and VAT
depots (Figure V-5E and F), with an increase in adipocyte size (Figure V-5G to I).
Consistent with increased adiposity, A-JAK2 KO mice displayed significantly higher
leptin and resistin concentration in the circulation (Figure V-5J).
V. 3-4 A-JAK2 KO mice develop HFD-induced insulin resistance and glucose
intolerance
We next determined whether diet-induced obesity in A-JAK2 KO mice predisposed them
to metabolic defects. As shown in Figure V-6A and B, HFD-fed male A-JAK2 KO mice
had higher random blood glucose levels than control littermates. Furthermore, i.p. GTT
indicated presence of impaired glucose tolerance (Figure V-6C). Male A-JAK2 KO mice
also exhibited HFD-induced insulin resistance during an ITT compared to control
littermates (Figure V-6D). Similar trends were observed in HFD-fed female A-JAK2 KO
122
Figure V-5 Development of diet-induced obesity in A-JAK2 KO mice.
(A) VO2; and (B) physical activity (n≥6). (C) Body weight of male (n≥9) and female (n≥5)
mice. (D) BMI measured 8-10 weeks after start of HFD. (E-F) Weight of inguinal (Ing.),
perigonadal (Peri.), retroperitoneal (Retro.), mesenteric (Mes.) and BAT fat pads (n≥8),
expressed as (E) absolute fat pad weight or (F) percent total body weight. (G)
Representative micrographs of H and E staining of perigonadal adipose sections. Scale bar,
50 μm. (H-I) Quantification of (H) adipocyte size distribution and (I) average adipocyte
size from sections as in (G) (n=3). (J) Serum adipokine levels from overnight-fasted mice
(n=7). Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
123
mice, although the degree of metabolic impairment was less (Figure V-6E to H). Next, to
specifically assess insulin sensitivity in individual metabolic tissues, HFD-fed A-JAK2 KO
mice and control littermates were injected with insulin, and tissues were processed for
analysis of insulin signalling by Western blotting. As shown in Figure V-6I, HFD-fed A-
JAK2 KO mice exhibited a reduction in insulin-stimulated Akt phosphorylation in VAT,
liver and skeletal muscle, indicating the presence of whole-body insulin resistance.
Consistent with this notion, fasting serum insulin levels were significantly higher in A-
JAK2 KO mice (Figure V-6J). Taken together, our results suggest that impaired BAT
function in A-JAK2 KO mice predisposes to HFD-induced obesity and associated
metabolic disturbances.
V. 3-5 JAK2 is required for cold-induced UCP1 expression and thermogenesis
in BAT
In addition to excess energy intake, cold exposure is another strong stimulator of non-
shivering thermogenesis (Morrison et al., 2012). Therefore, we asked whether JAK2 also
regulates UCP1 in response to cold challenge. In contrast to metabolic stress, acute thermal
stress up-regulated Jak2 expression only in BAT, but not in SAT or VAT from wild-type
mice (Figure V-7A). In parallel with Jak2 expression, short-term cold challenge induced a
modest elevation in Ucp1 mRNA levels in BAT, but not in SAT or VAT (Figure V-7B).
Importantly, BAT Ucp1 levels paradoxically declined upon cold exposure in the absence
124
Figure V-6 HFD-induced insulin resistance and glucose intolerance in A-JAK2 KO
mice.
(A and E) Random blood glucose; (B and F) fasting blood glucose; (C and G) i.p. GTT (1
g/kg); and (D and H) i.p. ITT (1.0 U/kg) in HFD-fed male (n≥8) and female (n≥5) mice.
(I) Perigonadal adipose tissue, liver and skeletal muscle lysates were prepared from insulin-
stimulated (5 U/kg) HFD-fed mice and immunoblotted for phospho-Akt (S473). Protein
band intensity was quantified by ImageJ software and normalized to total Akt (n=3). (J)
Fasting serum insulin levels in HFD-fed mice (n≥5). Results are mean ± SEM. *, p<0.05;
and **, p<0.01.
125
of JAK2, indicating an essential involvement of JAK2 in the maintenance of UCP1 with
lower ambient temperature. Interestingly, cold challenge significantly up-regulated Ucp1
mRNA levels in SAT and VAT from A-JAK2 KO mice (Figure V-7B), possibly as a
compensatory mechanism to maintain core body temperature. Nevertheless, this induction
did not adequately activate thermogenesis. As a result, A-JAK2 KO mice were unable to
maintain their body temperature after 3 hours of cold exposure compared to control
littermates (Figure V-7C). Together, these data indicate that adipocyte JAK2 is essential
for cold-induced UCP1 expression and thermogenesis.
V. 4 Summary
In summary, our work described in this chapter uncovers a critical role of JAK2 in brown
adipocyte biology and metabolic control. We show that JAK2 expression in murine brown
adipose tissue (BAT) is up-regulated along with uncoupling protein 1 (UCP1) in response
to high fat diet (HFD) feeding and cold exposure. This UCP1 induction and adaptive
thermogenesis is dependent on JAK2 and is completely abolished in A-JAK2 KO mice.
Accordingly, HFD-fed A-JAK2 KO mice showed attenuated energy expenditure, greater
adiposity and increased weight gain, with exacerbated whole-body insulin resistance and
glucose intolerance. Furthermore, A-JAK2 KO mice were unable to maintain body
temperature upon cold challenge. Taken together, our results suggest that JAK2 regulates
UCP1 in BAT and contributes to diet- and cold-induced thermogenesis.
126
Figure V-7 Increased sensitivity to cold exposure in HFD-fed A-JAK2 KO mice.
HFD-fed mice were placed at 4 °C for 6 hours (n=3). (A) mRNA expression of Jak2 in
wild-type mice maintained at 20 °C and kept at 4 °C for 6 hours. Values are expressed as
fold change relative to the 20 °C group. (B) mRNA expression of Ucp1 from mice
maintained at 20 °C and mice kept at 4 °C for 6 hours. Values are expressed as fold change
relative to the 20 °C control group. (C) Body temperature measured at the indicated times.
Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
127
Chapter VI: Role of hepatic JAK2 in metabolism and
inflammation
Sally Yu Shi, Rubén García Martin, Robin E. Duncan, Diana Choi, Shun-Yan Lu,
Stephanie A. Schroer, Erica P. Cai, Cynthia T. Luk, Kathryn E. Hopperton, Anthony F.
Domenichiello, Christine Tang, Mark Naples, Mark J. Dekker, Adria Giacca, Khosrow
Adeli, Kay-Uwe Wagner, Richard P. Bazinet, and Minna Woo
This research was originally published in J. Biol. Chem. (2012) 287(13):10277-88. © the
American Society for Biochemistry and Molecular Biology.
Contributions:
S.Y.S. and R.G.M. designed experiments, generated and analyzed research data, and
prepared the manuscript. R.E.D. generated and analyzed research data, and prepared an
early version of the manuscript. D.C. helped with genotyping and performed GTT and ITT
experiments. S.-Y.L. helped with quantitative RT-PCR experiments. S.A.S. performed
F4/80 immunostaining and helped with GTT and ITT experiments. E.P.C. performed
insulin immunostaining and serum insulin analysis. C.T.L. helped with GTT and ITT
experiments. K.E.H. and A.F.D. analyzed hepatic and serum lipid levels. C.T. performed
euglycemic hyperinsulinemic clamp experiments. M.N. and M.J.D. analyzed cholesterol
and ceramide content. A.G., K.A., R.P.B. designed experiments and contributed to
discussion and interpretation of the data. K.-U.W. provided the Jak2fl/fl mice. M.W.
designed experiments, contributed to discussion and interpretation of the data, and
critically edited the manuscript.
128
VI. 1 Introduction
Nonalcoholic fatty liver disease (NAFLD) is increasingly recognized as the leading cause
of chronic liver disease, affecting about 20% to 30% of the population in Western countries
(Angulo, 2002; Szczepaniak et al., 2005). Due to its strong link with insulin resistance and
type 2 diabetes, NAFLD is now considered to be the hepatic manifestation of the metabolic
syndrome (Marchesini et al., 2001). NAFLD comprises a spectrum, where steatosis alone
is largely benign but can progress to steatohepatitis characterized by inflammation and
fibrosis, followed by cirrhosis, liver failure and in some cases hepatocellular carcinoma
(Matteoni et al., 1999; Younossi et al., 1998). The exact pathogenesis of NAFLD, however,
is not well understood. Insulin resistance is known to play a critical role in lipid over-
accumulation in the liver. The resulting steatosis can in turn further impair insulin
signalling and sensitize the liver to inflammatory injury induced by a variety of stimuli
(Day and James, 1998). However, accumulating data now indicate that hepatic over-
storage of triglyceride per se is not a requirement for deterioration of insulin signalling and
progression of inflammation and may even be protective against lipotoxicity (Matsuzawa
et al., 2007; Monetti et al., 2007; Shiri-Sverdlov et al., 2006; Yamaguchi et al., 2007).
Nonetheless, the role of steatosis per se in the development of insulin resistance and
diabetes remains elusive.
129
The Janus kinase-signal transducers and activators of transcription (JAK-STAT) pathway
is one of the major inflammatory pathways signalling downstream of cytokines. In the liver,
JAK2 is activated by several cytokines and growth factors including IFN-γ, IL-6, growth
hormone (GH) and leptin (Gao, 2005). Disruption of hepatic leptin signalling promoted
intrahepatic lipid accumulation but protected from diet- and age-induced glucose
intolerance (Huynh et al., 2010). On the other hand, hepatic STAT3 inactivation up-
regulated expression of gluconeogenic and lipogenic genes, leading to both hepatic and
systemic insulin resistance and triglyceride accumulation (Inoue et al., 2004). GH, which
signals through the GHR to activate the JAK2-STAT5 pathway, antagonizes insulin action
by raising blood glucose levels, reducing peripheral insulin sensitivity and stimulating
lipolysis of the adipose tissue (Vijayakumar et al., 2010). Mice with hepatic deletion of the
GHR, STAT5 and IGF-1 all developed insulin resistance and glucose intolerance (Cui et
al., 2007; Fan et al., 2009; Yakar et al., 2004). This phenotype was proposed to be
secondary to elevated serum GH levels resulting from loss of feedback inhibition by IGF-
1. In addition, both hepatic GH receptor- and STAT5-deficient mice exhibited marked
steatosis (Barclay et al., 2011; Cui et al., 2007; Fan et al., 2009). Recently, it was shown
that deletion of Jak2 in hepatocytes led to spontaneous steatosis, and this was dependent
on excess GH signalling such that abolishment of aberrant GH secretion completely
rescued the fatty liver phenotype (Sos et al., 2011).
In this chapter, we sought to invesigate the metabolic and inflammatory consequences of
hepatic Jak2 deletion in response to metabolic stress. To determine the role of hepatic
130
JAK2 in diet-induced insulin resistance, we fed a cohort of L-JAK2 KO mice and their
littermate controls a high fat diet (HFD). HFD feeding for a prolonged period of time
induces a chronic inflammatory state that is thought to underlie the accompanying
metabolic abnormalities including insulin resistance and hepatocellular damage (Iyer et al.,
2010). Surprisingly, the profound hepatosteatosis seen in L-JAK2 KO mice did not
predispose to development of HFD-induced steatohepatitis; and despite impaired signal
transduction through Akt in the liver, improved insulin signalling in the adipose tissue and
protection against systemic insulin resistance were observed in L-JAK2 KO mice.
Moreover, L-JAK2 KO mice were completely protected against development of diet-
induced glucose intolerance. This metabolically beneficial profile may be accounted for,
at least in part, by compensatory β cell proliferation and enhanced glucose-stimulated
insulin secretion.
VI. 2 Mouse Model and Experimental Design
In order to elucidate the role of hepatic JAK2 in vivo, we generated hepatocyte-specific
JAK2 knockout (L-JAK2 KO) mice using the Cre-loxP system with the Albumin promoter
driving Cre transgene expression. Specific deletion of Jak2 in hepatocytes was confirmed
by Western blotting in tissue lysates from L-JAK2 KO mice and control littermates (Figure
VI-1).
131
Figure VI-1 Attenuated JAK2 expression in the liver of L-JAK2 KO mice.
Tissue lysates were prepared from 6-month-old L-JAK2 KO mice and littermate controls
and resolved by LDS-PAGE. Lysates were immunoblotted with anti-JAK2 or anti-GAPDH
antibodies.
132
To study the hepatic effects of JAK2 ablation, we harvested liver tissue from L-JAK2 KO
mice and littermate controls at various ages and recorded their weight relative to total body
weight. General liver morphology and architecture was assessed on H and E-stained
sections. Frozen liver sections were also stained with Oil-Red-O to visualize lipid
accumulation. Concentration of individual lipid species including triglycerides, cholesterol,
as well as triglyceride metabolites including DAG, ceramide and FFA were measured in
liver tissue from 1- and 6-month-old mice. In addition, individual fatty acid species of the
hepatic triglyceride pool were separated by thin layer chromatography and analyzed in
mice at 6 months of age.
Next, to gain insight into the role of JAK2 in response to metabolic stress, a cohort of L-
JAK2 KO mice and littermate controls were placed on a HFD for 8-10 weeks starting at 2
months of age. Inflammatory changes and hepatocellular damage were examined in H and
E stained-liver sections from HFD-fed mice. Hepatocellular function was assessed by
measuring serum levels of ALT, AST, total bilirubin and albumin. Infiltration of
macrophages were assessed by immunofluorescent staining of F4/80 in liver sections and
quantitative RT-PCR analysis of hepatic expression of Emr1. Hepatic and serum levels of
inflammatory cytokines including TNF-α, IL-6, IL-1β and IFN-γ were also measured.
Finally, to monitor the extent of fibrosis, liver sections were stained with Masson’s
trichrome, which stains collagen fibers blue.
133
Changes to hepatic lipid content are often associated with alteration in insulin sensitivity
(Sanyal et al., 2001). Therefore, we measured the effects of hepatic JAK2 deletion on
hepatic and whole-body insulin sensitivity. Fasting serum insulin levels and ITTs were
assessed in both chow- and HFD-fed mice. Furthermore, we performed euglycemic
hyperinsulinemic clamps, the gold standard for assessing insulin sensitivity, in L-JAK2
KO mice and control littermates. Glucose infusion rate during the clamp was reflective of
whole-body insulin sensitivity. We also used radiolabelled glucose to calculate glucose
utilization and production in response to insulin as a measure of peripheral and hepatic
insulin sensitivity, respectively. In addition, insulin signal transduction in the liver and
peripheral tissues was evaluated by measuring phosphorylated Akt levels by Western
blotting. To study potential changes in hepatic gluconeogenesis, hepatic expression of key
gluconeogenic genes including Pck1 and G6pc were measured by quantitative RT-PCR.
Next, we examined the impact of hepatic JAK2 deletion on systemic glucose metabolism.
Fasting and random blood glucose, as well as GTTs were assessed in L-JAK2 KO mice
and littermate controls. Glucose-stimulated insulin secretion was performed in both chow-
and HFD-fed mice to delineate the underlying basis for changes in glucose tolerance. In
addition, pancreatic β-cell area was calculated based on immunohistochemical staining for
insulin in pancreatic sections.
JAK2 mediates the signal transduction of GH and is essential for GH action. We therefore
investigated the consequence of JAK2 disruption on hepatic GH signalling. This was
134
achieved by measuring expression levels of key GH target genes including Igf1 and Socs3.
Activation of signalling pathways downstream of JAK2 including STAT3 and 5 was
assessed by Western blotting. We also measured circulating levels of GH and IGF-1 in L-
JAK2 KO mice and control littermates.
Given the pivotal role of GH and IGF-1 in regulating body growth and metabolism, we
assessed the effect of JAK2 disruption on growth and energy homeostasis. To this end,
body weight, length and BMI were monitored in L-JAK2 KO mice and control littermates
over time. Body composition, particularly the relative weight of the different adipose
depots, was also analyzed. To evaluate energy balance in L-JAK2 KO mice, we measured
their rectal temperature and assessed their food intake and energy expenditure by indirect
calorimetry.
VI. 3 Results
VI. 3-1 L-JAK2 KO mice develop progressive hepatic steatosis
L-JAK2 KO mice developed striking hepatic steatosis spontaneously on chow diet, which
was grossly visible by the pale and glistening appearance of the liver at 2-3 months of age
(Figure VI-2A). Their liver weight expressed as a percentage of total body weight was
135
significantly higher than control littermates (Figure VI-2B). Using Oil-Red-O staining, we
observed intrahepatic lipid accumulation by as early as two weeks of age (Figure VI-2C).
Triglyceride was the predominant lipid species accounting for steatosis, which
progressively accumulated with age (Figure VI-2D). Analysis of the profile of fatty acids
esterified to triglycerides indicated elevated levels of all the long-chain saturated and
monounsaturated fatty acids in livers from L-JAK2 KO mice (Figure VI-2E). We next
analyzed for the presence of bioactive lipid metabolites implicated in insulin resistance.
Hepatic cholesterol levels were not significantly different between L-JAK2 KO mice and
control littermates (Figure VI-2F). Diacylglycerol (DAG) content was increased by about
50% in livers of L-JAK2 KO mice compared to control littermates at 6 months of age
(Figure VI-2G). Hepatic levels of ceramide, total FFA and free palmitate, however, were
similar between the two groups (Figure VI-2H to J).
We next investigated potential mechanisms underlying steatosis development in the setting
of hepatocyte JAK2 deficiency. Expression analysis of genes regulating hepatic lipid
metabolism showed no deficiency in lipoprotein synthesis, VLDL export or fatty acid β-
oxidation (Figure VI-3A and B). There was also no overt abnormality in de novo
lipogenesis (Figure VI-3C and D). On the other hand, there was a 4-fold elevation in
expression of fatty acid translocase (Cd36) in livers of L-JAK2 KO mice (Figure VI-3A),
indicating that the major contributor to lipid over-storage was increased uptake of
circulating FFA.
136
Figure VI-2 Progressive hepatic steatosis in L-JAK2 KO mice.
(A) Representative photographs of liver lobes harvested from 12-week-old mice. (B) Liver
weight normalized to total body weight (n≥6). (C) Representative micrographs of Oil-Red-
O staining of liver sections from overnight-fasted mice. Scale bar: 200 m. (D) Hepatic
TG content. Results are normalized to tissue weight. (n=3-8) (E) Extracted TG from livers
of 6-month-old mice was converted to fatty acid methyl esters and fatty acid composition
was analysed with a gas chromatography system (n=3-4). AA: arachidonic acid; EPA:
eicosapentaenoic acid; DHA: docosahexaenoic acid. (F) Hepatic cholesterol content
normalized to tissue weight (n=3-6). (G) Hepatic DAG content at 1 (n=8) and 6 (n=4)
months of age. (H) Hepatic ceramide content at 1 month of age (n=7). (I) Hepatic total
FFA content at 1 (n=8) and 6 (n=4) months of age. (J) Hepatic free palmitate content at 1
month of age (n=5), normalized to tissue weight. Results are mean ± SEM. *, p<0.05; **,
p<0.01; and ***, p<0.001.
137
Figure VI-3 Hepatic expression of genes involved in lipid metabolism.
(A-C) Quantitative RT-PCR analysis of mRNA expression in livers from 1-month-old
mice (n≥6). Values are expressed as fold change relative to the control group. (A) Genes
involved in lipid transport. Cd36, fatty acid translocase; Mttp, microsomal triglyceride
transfer protein; and Apob, apolipoprotein B. (B) Genes involved in fatty acid β-oxidation.
Ppara, peroxisome proliferator-activated receptor alpha; Acadm, medium chain acyl-CoA
dehydrogenase; Acads, small chain acyl-CoA dehydrogenase; Acadvl, very-long chain
acyl-CoA dehydrogenase; and Cpt-1, mitochondrial carnitine palmitoyl transferase 1. (C)
Genes involved in lipogenesis. Pparg, peroxisome proliferator-activated receptor gamma;
Srebf1, sterol regulatory element binding transcription factor 1c; Fas, fatty acid synthase;
Acc, acetyl-CoA carboxylase; Scd1, stearoyl-CoA desaturase; and Hmgcr, HMG
Coenzyme A reductase. (D) In vitro lipogenesis assay with 14C-acetate in livers from 1-
month-old mice (n=5). Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
138
VI. 3-2 L-JAK2 KO mice do not progress to steatohepatitis on a high fat diet
(HFD)
According to the “two-hit” model proposed by Day and James, steatosis sensitizes the liver
to inflammatory injury (Day and James, 1998). To examine whether the profound steatosis
seen in L-JAK2 KO mice predisposes to development of steatohepatitis, we fed the
knockout mice and their littermate controls a HFD for 8-10 weeks starting at 2 months of
age. As expected, control mice developed hepatic steatosis after prolonged HFD feeding,
and this was further exacerbated by abolishment of hepatic JAK2 signalling (Figure VI-
4A). Interestingly, histological analysis of liver sections using Masson’s trichrome stain
indicated that L-JAK2 KO mice did not exhibit increased inflammatory injury or
fibrogenesis (Figure VI-4B). This lack in progression of inflammation persisted up to 11
months of age in chow-fed L-JAK2 KO mice (Figure VI-4C). There was also no significant
increase in macrophage accumulation in livers of knockout mice as shown by
immunofluorescence staining and quantitative RT-PCR (Figure VI-4D and E). Serum
levels of ALT, reflective of the degree of hepatic steatosis, trended higher in chow-fed L-
JAK2 KO mice (Figure VI-4F). On the other hand, despite the profound steatosis,
circulating levels of AST, a hallmark of hepatocyte injury, was not elevated under both
chow- and HFD-fed conditions (Figure VI-4F). Circulating levels of total bilirubin and
albumin were similar (Figure VI-4G and H), suggesting that livers of L-JAK2 KO mice
were able to maintain their synthetic and secretory capacity. Furthermore, genes encoding
inflammatory cytokines including TNF-α, IL-1β and IFN-γ were not upregulated in HFD-
139
fed L-JAK2 KO mice (Figure VI-4I). In fact, hepatic expression of an inflammatory
cytokine, IL-6, was significantly lower. We also measured circulating levels of TNF-α and
IL-6 and found no significant difference in levels of either cytokine between L-JAK2 KO
mice and littermate controls under either chow- or HFD-fed conditions (Figure VI-4J).
VI. 3-3 L-JAK2 KO mice display impaired hepatic insulin signalling but
normal systemic insulin sensitivity
Fatty liver is commonly associated with insulin resistance and type 2 diabetes; therefore,
we examined the impact of hepatocyte-specific Jak2 deletion on both hepatic and systemic
insulin signalling. Fasting serum insulin levels were not significantly different between the
two genotypes on either chow or HFD (Figure VI-5A), suggesting absence of whole-body
insulin resistance. Moreover, despite the profound hepatosteatosis in HFD-fed L-JAK2 KO
mice, they did not display whole body insulin resistance as evidenced by similar glucose
lowering by exogenous insulin during an i.p. ITT (Figure VI-5B). Next, to specifically
examine insulin sensitivity in individual metabolic tissues, L-JAK2 KO mice and littermate
controls were injected with insulin i.p. and tissues were harvested 10 minutes later for
analysis of insulin signalling by Western blotting. As shown in Figure VI-5C, Akt
phosphorylation was significantly attenuated in the livers of L-JAK2 KO mice following
insulin stimulation, whereas in adipose tissue (Figure VI-5C) and skeletal muscle (data not
shown) this attenuation in insulin response was not present compared to littermate controls.
140
Figure VI-4 No progression to steatohepatitis on a HFD in L-JAK2 KO mice.
(A-B) Representative micrographs of (A) H and E, and (B) Masson’s trichrome staining of
liver sections from 4-month-old mice after 8-10 weeks on a standard chow or HFD
(original magnification ×25). (C) Representative micrographs of Masson’s trichrome
staining of liver sections from 11-month-old chow-fed mice (original magnification ×25).
(D) Immunofluorescent staining of macrophages (in red) in livers from 4-month-old chow-
fed mice using anti-F4/80 antibody (original magnification ×20). (E) mRNA expression of
hepatic Emr1 (n≥5). Values are expressed as fold change relative to the chow control group.
(F) Serum levels of ALT and AST (n≥5). Values are expressed as fold change over the
chow control group. (G-H) Serum levels of (G) total bilirubin, and (H) albumin (n≥3). (I)
Hepatic mRNA expression of genes encoding inflammatory markers (n≥8). Values are
expressed as fold change relative to the chow control group. Tnf, tumor necrosis factor
alpha; Il6, interleukin-6; Il1b, interleukin-1 beta; Ifng, interferon gamma. (J) Serum levels
of TNF-α and IL-6 (n≥5). Results are mean ± SEM. **, p<0.01; and †, p=0.06.
141
Consistent with attenuated insulin signalling in the liver, hyperinsulinemic-euglycemic
clamp studies showed impaired suppression of endogenous glucose production by insulin
in L-JAK2 KO mice. On the other hand, insulin-induced whole-body glucose utilization
was comparable between the two genotypes, in accordance with absence of systemic
insulin resistance in L-JAK2 KO mice (Figure VI-5D). To assess for potential changes in
hepatic gluconeogenic program, we measured hepatic expression of key gluconeogenic
enzymes including PEPCK and G6Pase in overnight fasted mice and found no significant
difference between L-JAK2 KO mice and control littermates (Figure VI-5E).
VI. 3-4 L-JAK2 KO mice are protected from diet-induced glucose intolerance
In agreement with normal peripheral glucose disposal but dysregulated hepatic glucose
production, fasting (Figure VI-6A), but not random (Figure VI-6B) blood glucose was
consistently elevated in L-JAK2 KO mice compared to littermate controls. Surprisingly,
L-JAK2 KO mice were found to be more glucose tolerant than littermate controls on a
chow diet. This difference was more pronounced on a HFD such that L-JAK2 KO mice
were completely protected against HFD-induced glucose intolerance (Figure VI-6C). To
delineate potential mechanisms underlying the improved glucose tolerance, we measured
serum insulin levels in response to glucose stimulation. As shown in Figure VI-6D, no
significant difference existed between L-JAK2 KO mice and littermate controls on a chow
diet. On the other hand, HFD-fed L-JAK2 KO mice secreted more insulin in response to
glucose challenge. This was associated with a significantly increased β cell area in L-JAK2
142
Figure VI-5 Attenuated hepatic insulin sensitivity but normal systemic insulin
sensitivity in L-JAK2 KO mice.
(A) Fasting serum insulin levels (n≥5). (B) i.p. ITT (1.5 U/kg) (n≥5). *, p<0.05 Control
Chow versus Control HFD; ##, p<0.01 Control HFD versus L-JAK2 KO HFD. (C) Liver
and SAT lysates were prepared from insulin-stimulated (5 U/kg) mice and immunoblotted
for phospho-Akt (S473). Protein band intensity was normalized to total Akt (n=3). (D)
Steady-state glucose infusion rate, suppression of hepatic glucose production and glucose
utilization measured during hyperinsulinemic-euglycemic clamps in 4-month-old chow-
fed mice (n=5). (E) mRNA expression of gluconeogenic genes in livers from overnight
fasted mice (n=7). Pck1, phosphoenolpyruvate carboxykinase; G6pc, glucose-6-
phosphatase. Results are mean ± SEM. *, p<0.05; and †, p=0.06.
143
KO mice on a HFD (Figure VI-6E and F). Together, these data suggest that despite the
profound hepatosteatosis and dysregulated hepatic glucose production, L-JAK2 KO mice
exhibit improved glucose homeostasis, which may be accounted for, at least in part, by
increased insulin secretion from an enhanced β cell mass.
VI. 3-5 L-JAK2 KO mice exhibit impaired hepatic GH signalling
In the liver, binding of GH to its receptor activates JAK2, which phosphorylates STAT5A
and B, leading to transcriptional activation of a host of target genes including insulin-like
growth factor 1 (Igf1) and suppressor of cytokine signalling 3 (Socs3). Similar to the
findings by Sos et al. (Sos et al., 2011), L-JAK2 KO mice had lower serum IGF-1 levels
(Figure VI-7A) but higher serum GH levels (Figure VI-7B), likely as a result of a release
of feedback inhibition in the hypothalamus. In agreement with impaired hepatic GH
signalling, phosphorylation of STAT5 was moderately reduced in livers from L-JAK2 KO
mice (Figure VI-7C). As expected, expression levels of STAT5 target genes were also
decreased (Figure VI-7D). Interestingly, phosphorylation of STAT3, another signalling
partner of JAK2 that responds to cytokines such as leptin and IL-6, was increased (Figure
VI-7C). Together, these data demonstrate that JAK2 is an essential mediator of GH
signalling within the liver.
144
Figure VI-6 L-JAK2 KO mice are protected from glucose intolerance.
(A) Fasting and (B) random blood glucose at 1 (n=17-21) and 6 (n=4-8) months of age. (C)
i.p. GTT (1 g/kg) (n≥8). *, p<0.05, ***, p<0.001 Control Chow versus L-JAK2 KO Chow;
#, p<0.05, ###, p<0.001 Control HFD versus L-JAK2 KO HFD; and †, p<0.05, ††, p<0.01,
†††, p<0.001 Control Chow versus Control HFD. (D) Serum insulin levels in response to
an i.p. injection of 3 g/kg glucose. Values are expressed as fold change over the control
group (n≥5). (E) Representative micrographs of pancreatic sections stained with anti-
insulin antibody (original magnification ×10). Arrowheads point to pancreatic islets. (F)
Quantification of β-cell area from pancreatic sections stained for insulin in (E), expressed
as per cent of total pancreatic area (n≥7). Results are mean ± SEM. *, p<0.05; **, p<0.01;
and ***, p<0.001.
145
Figure VI-7 L-JAK2 KO mice exhibit impaired hepatic GH signaling.
(A-B) Serum levels of (A) IGF-1 and (B) GH measured at 1 and 4 months of age (n≥5).
(C) Liver lysates were prepared from 1-month-old mice and immunoblotted with anti-
phospho-STAT5 and phospho-STAT3 antibodies. Protein band intensity was quantified by
ImageJ software, and levels of p-STAT5 (n=3) and p-STAT3 (n=7) are normalized to total
STAT5 and STAT3, respectively. (D) mRNA expression of two STAT5-target genes,
Socs3 (n=3) and Igf1 (n≥6), in livers from L-JAK2 KO mice and littermate controls at 1
month of age. Values are expressed as fold change relative to control. Socs3, suppressor of
cytokine signalling 3; Igf1, insulin-like growth factor 1. Results are mean ± SEM. *, p<0.05;
**, p<0.01; and †, p=0.06.
146
VI. 3-6 L-JAK2 KO mice display a reduction in adiposity and an increase in
energy expenditure
Given the pivotal role of GH in metabolism, we next investigated whether hepatic JAK2
deficiency affects energy homeostasis. L-JAK2 KO mice weighed significantly less and
were smaller in length compared to their control littermates by as early as one month of
age, with no appreciable differences in BMI (Figure VI-8A to C). In keeping with the
established effect of GH on lipolysis, L-JAK2 KO mice had decreased subcutaneous and
visceral fat depot mass, which was not apparent at 1 month of age but became statistically
significant at 6 months (Figure VI-8D). In line with absence of systemic insulin resistance,
circulating levels of total FFA as well as individual fatty acid species were not increased
in L-JAK2 KO mice despite the reduction in adipose tissue mass (Figure VI-8E and F).
Next, we assessed the impact of reduced fat mass on circulating levels of adipokines.
Serum adiponectin levels were not significantly different between control and knockout
mice (Figure VI-8G). On the other hand, L-JAK2 KO mice had higher circulating leptin
levels at 1 month of age (Figure VI-8H) when there was no change in adiposity. As the
mice aged, with diminishing fat depot mass, this difference in leptin levels was lost.
To assess energy balance in L-JAK2 KO mice, we placed them individually in metabolic
chambers. Compared to their littermate controls, L-JAK2 KO mice ingested more food
relative to their body weight on a chow diet (Figure VI-9A). Furthermore, L-JAK2 KO
mice exhibited a significantly greater RER, indicating the preferential oxidation of glucose
147
Figure VI-8 L-JAK2 KO mice display a reduction in adiposity.
(A) Body weight, (B) body length measured from snout to anus, and (C) BMI at 1 (n=6-
16) and 6 (n=6-13) months of age. (D) Visceral (perigonadal depot), subcutaneous
(inguinal depot) and BAT fat pads were harvested from 1- and 6-month-old mice and
weighed (n=7-10). Results are expressed relative to total body weight. (E) Serum total FFA
at 4 months of age (n≥3). (F) Serum levels of individual fatty acid species (n=3). (G-H)
Serum levels of (G) adiponectin and (H) leptin from mice at 1 and 4 months of age (n≥5).
Results are mean ± SEM. *, p<0.05; **, p<0.01; and ***, p<0.001.
148
as the fuel source (Figure VI-9B). Rates of O2 consumption and CO2 production were
higher in L-JAK2 KO mice, consistent with greater energy expenditure (Figure VI-9C and
D). This increase in energy expenditure was also observed in HFD-fed L-JAK2 KO mice
(data not shown). Locomotor activity was similar between the genotype groups (Figure VI-
9E), whereas L-JAK2 KO mice had a slightly but significantly elevated body temperature
(Figure VI-9F), indicating greater resting energy expenditure. Taken together, these results
suggest that increased energy expenditure may contribute to the improved metabolic
profile of L-JAK2 KO mice.
VI. 4 Summary
In summary, our study described in this chapter highlights the multiple roles of hepatic
JAK2 in the regulation of lipid and carbohydrate metabolism and inflammation. Mice
lacking JAK2 in hepatocytes presented with profound, spontaneous hepatic steatosis
associated with attenuated insulin-stimulated phosphorylation of Akt in the liver; however,
this overwhelming lipid accumulation did not progress to steatohepatitis or whole-body
insulin resistance on a HFD. In fact, the feedback increase in serum GH concentration as a
consequence of disrupted hepatic GH signalling likely induced the increase in resting
energy expenditure, contributing to the improved metabolic profile observed in chow-fed
L-JAK2 KO mice. Furthermore, both increased GH signalling and dampened hepatic
insulin signalling might mediate compensatory β cell proliferation in response to HFD
149
Figure VI-9 L-JAK2 KO mice display an increase in energy expenditure.
(A-E) Chow-fed mice at 5-6 months of age were housed individually in metabolic
chambers with free access to food and water and energy balance data were collected for 24
hours (n=9). (A) Daily food intake was determined by weighing the chow before and after
the 24-hour measurement. Results are expressed relative to total body weight; (B)
Respiratory exchange ratio (RER), calculated as VCO2/ VO2; (C) Oxygen consumption
(VO2); (D) Carbon dioxide production (VCO2); and (E) Physical activity, expressed as
average number of infra-red beam breaks during one measurement interval. (F) Rectal
temperature of chow-fed mice at 5-6 months of age. Results are mean ± SEM. *, p<0.05;
and **, p<0.01.
150
feeding, rendering L-JAK2 KO mice resistant to development of diet-induced glucose
intolerance (Figure VI-10). Taken together, our findings indicate a key role of hepatic
JAK2 in metabolism such that its absence arrests steatohepatitis development and confers
protection against diet-induced systemic insulin resistance and glucose intolerance.
151
Figure VI-10 Proposed model of the mechanism for the observed phenotype in L-
JAK2 KO mice.
Deletion of JAK2 specifically in hepatocytes attenuates hepatic GH signaling, leading to
lipid over-accumulation in the liver as a result of increased uptake of circulating free fatty
acids. Impaired hepatic insulin signaling triggers compensatory β-cell proliferation in the
pancreatic islets, leading to increased β-cell mass. Elevated GH levels may also promote
compensatory β-cell proliferation in response to HFD, thereby protecting against HFD-
induced glucose intolerance. Furthermore, GH may stimulate resting energy expenditure,
leading to an improved metabolic profile compared to their control littermates. On the other
hand, as an essential mediator of inflammatory signaling, deletion of JAK2 arrests the
progression of steatosis to steatohepatitis.
152
Chapter VII: Discussion and Future Perspectives
Reproduced in part from Diabetologia. 57(5):1016-26 with kind permission from
Springer Science and Business Media,
and J. Biol. Chem. 287(13):10277-88. © the American Society for Biochemistry and
Molecular Biology.
153
VII. 1 The role of adipocyte JAK2 in white adipocyte biology and lipid
metabolism
In Chapter IV, we show that JAK2 plays an essential role in maintaining adipose mass such
that its deficiency resulted in extensive adipose tissue expansion even on a regular chow
diet. Notably, the phenotypic differences between A-JAK2 KO mice and control
littermates were more profound in females. The mechanisms underlying this sex-related
difference are not clear, but may reflect sexual dimorphic actions of JAK2-activating
cytokines or compensatory pathways activated in response to JAK2 deficiency in male
mice.
To disrupt JAK2 specifically in adipocytes, we used Ap2-Cre transgenic mice, a widely
used model to study the adipocyte-specific function of genes of interest (Bluher et al., 2002;
He et al., 2003). However, the Ap2 promoter/enhancer has been shown to drive transgene
expression during embryonic development (Urs et al., 2006). Therefore, we cannot rule
out a contribution of JAK2 deficiency in other tissues to the observed phenotype of A-
JAK2 KO mice. Nevertheless, our results are in agreement with a recent report
characterising mice with adipose-specific Jak2 deletion driven by the Adiponectin
promoter (Nordstrom et al., 2013). Similarly to our mice, male knockout mice in this model
had normal body weight, but significantly increased body fat at 8 to 10 weeks of age.
The marked adiposity observed with adipocyte JAK2 deficiency is consistent with previous
studies in which various components of the JAK2–STAT pathway were disrupted in
154
adipocytes. In particular, disruption of the GH receptor (GHR) (List et al., 2013) and
STAT3 (Cernkovich et al., 2008) using the Ap2 promoter, and knockdown of the leptin
receptor using antisense RNA (Huan et al., 2003) all resulted in increased body weight and
adiposity. Of all the models, A-JAK2 KO mice had the most striking increase in body
weight. This is probably due to the combined disruption of signalling from multiple
cytokines as a consequence of JAK2 deficiency. Interestingly, the perigonadal fat depot
had the smallest increase in mass, especially in male A-JAK2 KO mice. This is in line with
observations in adipocyte-specific Ghr knockout mice (List et al., 2013) and may be due
to different responses of various fat depots to the action of GH (List et al., 2009).
Previous studies in vitro have suggested a critical role of JAK2 in adipogenesis (Yarwood
et al., 1999; Zhang et al., 2011). Although direct in vivo evidence is lacking for JAK2,
studies in different mouse models support the importance of its downstream protein,
STAT5, in adipocyte differentiation (Stewart et al., 2011; Teglund et al., 1998). Therefore,
JAK2 deficiency may have an impact on adipocyte development in our model. However,
A-JAK2 KO mice probably did not have impaired adipogenesis because they maintained
a similar number of adipocytes compared with control littermates. This lack of an effect
on adipogenesis may be due to the late deletion of JAK2 induced by the Ap2 promoter, as
AP2 is commonly regarded as a marker of terminal adipocyte differentiation (Hunt et al.,
1986).
155
With no change in adipogenesis and no direct effect on energy balance, adipocyte-specific
JAK2 deficiency might alter body composition by modulating lipid turnover in the adipose
tissue. Indeed, a number of JAK2-activating cytokines and hormones including leptin
(Siegrist-Kaiser et al., 1997), IL-6 (Trujillo et al., 2004; van Hall et al., 2003), IFN-γ
(Memon et al., 1992), GH (Goodman, 1968) and prolactin (Fielder and Talamantes, 1987)
have well-documented lipolytic effects. In agreement with this, Adiponectin promoter-
driven JAK2 deletion resulted in impaired lipolysis in white adipose tissue (Nordstrom et
al., 2013). In this work, we further showed that adipocyte JAK2 is required for leptin- and
GH-stimulated lipolysis. Our results are consistent with previous work showing defective
leptin- and GH-stimulated lipolysis in adipocytes from mice lacking STAT3, and STAT5A
and STAT5B, respectively (Cernkovich et al., 2008; Fain et al., 1999). However, in
contrast to these models, adipose JAK2 deficiency also significantly attenuated
catecholamine-induced lipolysis, albeit to a lesser degree, indicating that adipose JAK2
directly modulates the lipolytic program. Together, our results demonstrate that JAK2 in
adipocytes is required for body weight homeostasis and prevents excessive lipid
accumulation in adipose tissue.
VII. 2 The role of adipocyte JAK2 in BAT function and thermogenesis
In Chapter V, we show JAK2 expression in BAT is necessary for UCP1 induction in
response to excess caloric intake and cold challenge. Consequently, mice with adipose-
156
specific JAK2 disruption were not able to activate thermogenesis in response to energy
surplus and cold exposure. Our observation that JAK2 expression is regulated by diet
points to the possibility of pharmacological or dietary interventions to improve BAT
function to treat obesity. While HFD concomitantly induced JAK2 and UCP1 expression
in all three fat depots examined, only BAT JAK2 appears to be essential for UCP1
induction, whereas white adipose tissue up-regulates their UCP1 via a JAK2-independent
mechanism. This notion is further supported by results from the cold exposure experiment,
where A-JAK2 KO mice placed at 4 °C for 6 hours were unable to up-regulate UCP1 in
BAT but significantly increased Ucp1 transcription in SAT and VAT.
Our results suggest that JAK2 plays an important role in regulating UCP1 expression in
BAT, as A-JAK2 KO mice exhibit reduced UCP1 levels by as early as one month of age.
Indeed, A-JAK2 KO mice were phenotypically similar to UCP1-/- mice, which are cold
sensitive (Enerback et al., 1997) and, when maintained at thermoneutrality, develop
spontaneous obesity and show abolished diet-induced thermogenesis (Feldmann et al.,
2009). Of note, A-JAK2 KO mice were obese even when maintained at room temperature.
This difference compared to UCP1-/- mice is likely attributable to suppression of lipolysis
in the white adipose tissue as a result of JAK2 deficiency, as we and others have shown
previously (Nordstrom et al., 2013; Shi et al., 2014).
Several hormones and growth factors could account for the effects of adipose JAK2 on
BAT function. Ciliary neurotrophic factor (CNTF), first characterized as a growth and
157
survival factor for neurons, activates JAK2 and has been shown to potentiate induction of
UCP1 in BAT by β3 adrenergic agonists (Ott et al., 2002). Similarly, peripheral
intravenous administration of leptin in mice increased mRNA expression of thermogenic
genes (Commins et al., 1999; Sarmiento et al., 1997) and glucose utilization of BAT
(Siegrist-Kaiser et al., 1997). Furthermore, treatment with human GH for 10 days up-
regulated UCP1 mRNA levels in BAT from KK-Ay obese mice (Hioki et al., 2004).
Therefore, the observed reduction in UCP1 expression in JAK2 deficient BAT could be
due to the concerted action of all these hormones.
In addition to regulating mature brown adipocytes, JAK2-activating cytokines have also
been shown to play a role in BAT development. For example, the lactogenic hormones
prolactin and placental lactogen were shown to be essential for BAT differentiation such
that neonatal mice lacking the prolactin receptor have smaller BAT depots, reduced
expression of BAT-specific genes, and were more sensitive to cold exposure
(Viengchareun et al., 2008). Nevertheless, whether JAK2 also contributes to BAT
differentiation is less clear. In our animal model, the late deletion of Jak2 using the Ap2
promoter precludes definitive conclusion about the role of JAK2 in brown adipocyte
development, as AP2 is only expressed upon adipocyte differentiation (Hunt et al., 1986).
Interestingly, expression of Prdm16 was not affected by JAK2 disruption under either
chow or HFD conditions, suggesting that JAK2 likely does not play a critical role in BAT
differentiation.
158
Actions of JAK2-activating cytokines are mediated mostly by STAT3 and STAT5 in
metabolic tissues. In line with a disruption of upstream signal transduction,
phosphorylation of both STAT3 and STAT5 is significantly attenuated in JAK2-deficient
BAT. While the exact role of STAT5 in BAT remains to be elucidated, STAT3 has recently
been implicated in BAT differentiation by binding to and enhancing protein stability of
PRDM16 (Derecka et al., 2012). Interestingly, in tissue-specific models of JAK2
disruption, STAT3 phosphorylation is frequently up-regulated (Shi et al., 2012), likely by
other protein tyrosine kinases such as members of the Src family (Turkson et al., 1998).
Indeed, we observed higher levels of phospho-STAT3 in white adipose depots from A-
JAK2 KO mice compared to control littermates. On the other hand, STAT3
phosphorylation was significantly attenuated in JAK2-deficient BAT, suggesting that
JAK2 is necessary for STAT3 activation in this tissue.
In addition to the canonical signalling pathway, some reports indicate that the JAK-STAT
pathway can be activated by G protein coupled receptors such as the angiotensin II type 1
receptor (Marrero et al., 1995), and the chemokine receptor CCR2 (Mellado et al., 1998)
and CXCR4 (Vila-Coro et al., 1999). Therefore, it is possible that the β3 adrenergic
receptor transduces signals through the JAK-STAT pathway, and the observed phenotype
in A-JAK2 KO mice results from impaired adrenergic signal transduction in the BAT.
Indeed, findings from this and our previous work (Shi et al., 2014) indicate that actions of
adipose JAK2 mimic those of the sympathetic nervous system, with activation of lipolysis
in white adipose tissue and adaptive thermogenesis in BAT (Collins and Surwit, 2001).
159
Nevertheless, whether crosstalk between the adrenergic receptor and JAK2 exists and, if it
does, to what extent it contributes to sympathetic activation of adaptive thermogenesis
warrants further investigation.
VII. 3 The role of adipocyte JAK2 in whole-body metabolic regulation
In Chapters IV and V, we show that the increased adiposity in A-JAK2 KO mice led to
insulin resistance and glucose intolerance with age or extended HFD feeding. We postulate
that whole-body metabolic changes later in life or in response to a HFD in A-JAK2 KO
mice are likely to be secondary to increased adiposity and the ensuing insulin resistance,
as A-JAK2 KO mice were metabolically normal at a younger age despite profound obesity.
Specifically, with blunted insulin action, insulin-stimulated expression of lipogenic genes
including acetyl-CoA carboxylase (Acc, also known as Acaca) and Fas would be
diminished (Girard et al., 1994). The inhibition of lipolysis via suppression of Lipe would
also be attenuated (Saltiel and Kahn, 2001).
In line with insulin resistance resulting from disrupted adipose tissue homeostasis, we
observed higher circulating levels of leptin and TNF-α, and lower levels of adiponectin,
which could all contribute to the metabolic disturbances in older A-JAK2 KO mice. While
histological analysis of the liver did not suggest excessive lipid deposition, it is possible
that with age and more severe insulin resistance, fatty liver may eventually develop in A-
160
JAK2 KO mice. Importantly, our knockout animals were phenotypically distinct in terms
of whole-body metabolism compared with other models of disrupted JAK–STAT
signalling. The disruption of GHR in adipocytes did not affect glucose homeostasis or
hepatic lipid content up to 20 weeks of age (List et al., 2013), whereas mice with
diminished adipose leptin signalling displayed glucose intolerance by as early as 6 to 7
weeks of age, and liver steatosis by 19 to 20 weeks (Huan et al., 2003). In contrast, although
glucose homeostasis was relatively normal in mice with adipose-specific STAT3
deficiency, fatty liver was present by 20 weeks of age (Cernkovich et al., 2008). These
differences in whole-body metabolism are present despite the same primary defect in body
weight homeostasis, demonstrating the complexity of metabolic regulation and the diverse
functions of the JAK–STAT pathway in adipose physiology and metabolism.
VII. 4 The role of hepatocyte JAK2 in hepatic lipid metabolism
In Chapter V, we investigated the role of JAK2, a key mediator of cytokine signalling, in
hepatic lipid metabolism and NAFLD development. We show that mice lacking JAK2 in
hepatocytes developed profound fatty liver spontaneously. This inhibitory role of hepatic
JAK2 on lipid accumulation is in line with previous reports. For example, hepatocyte-
specific deletion of the leptin receptor, GHR, STAT3 and STAT5 all resulted in varying
degrees of lipid deposition in the liver (Barclay et al., 2011; Cui et al., 2007; Fan et al.,
2009; Huynh et al., 2010; Inoue et al., 2004). By far the most profound steatosis among all
161
these mouse models is observed with deletion of hepatic Jak2. Nevertheless, despite the
steatosis, L-JAK2 KO mice did not progress to steatohepatitis on a HFD. A recent study
by Sos et al. also examined the role of JAK2 in hepatic lipid metabolism. Using the same
Cre-mediated recombination driven by the albumin promoter, the investigators
demonstrated that deletion of Jak2 in hepatocytes led to spontaneous steatosis, and this
was dependent on excess GH signalling in peripheral tissues such that abolishment of
aberrant GH secretion completely rescued the fatty liver phenotype (Sos et al., 2011).
However, in contrast to our model, hepatocyte JAK2 disruption in these mice resulted in
mild lobular inflammation and fibrosis at 20 weeks of age (Sos et al., 2011).
We postulate that hepatic lipid accumulation in L-JAK2 KO mice was due, at least in part,
to increased fatty acid uptake resulting from an up-regulation of CD36. This elevation in
CD36 levels was seen in all mouse models of disrupted hepatic GH signalling (Barclay et
al., 2011; Cui et al., 2007; Fan et al., 2009; Sos et al., 2011). Indeed, Cd36 transcription
can be regulated directly by STAT5 (Barclay et al., 2011; Cheung et al., 2007), or
indirectly by PPARγ, whose expression is repressed by STAT5-mediated GH signalling
(Chawla et al., 2001; Zhou and Waxman, 1999).
162
VII. 5 The role of hepatocyte JAK2 in whole-body metabolic regulation
and glucose homeostasis
In Chapter V, we show that L-JAK2 KO mice were protected from HFD-induced insulin
resistance and glucose intolerance despite profound hepatosteatosis. In contrast to our
mouse model, both hepatic STAT5 (Cui et al., 2007) and GHR (Fan et al., 2009) knockout
mice developed glucose intolerance and whole-body insulin resistance. Hepatocyte-
specific deletion of the intracellular signalling domain of the leptin receptor, on the other
hand, improved hepatic insulin sensitivity, resulting in protection against age- and diet-
related glucose intolerance (Huynh et al., 2010). Phenotypic differences in these mouse
models could be attributed to the impact of Jak2 deletion on multiple other signalling
pathways such as the IL-6 pathway. In addition, compared to the knockout mice described
by Sos et al. (Sos et al., 2011), while we also found disrupted hepatic GH signalling and a
reduction in subcutaneous and visceral adipose tissue depot in our L-JAK2 KO mice, the
feedback increase in circulating GH levels was not associated with an expected decline in
insulin sensitivity and glucose tolerance. Indeed, L-JAK2 KO mice were more glucose
tolerant than their control littermates. The phenotypic disparities between the two mouse
models may be partly due to inherent strain differences.
Insulin resistance is a common finding in individuals with fatty liver and animal models of
NAFLD (Farrell and Larter, 2006; Marchesini et al., 1999; Seppala-Lindroos et al., 2002),
but the causal relationship between hepatic steatosis and insulin resistance is unclear.
163
Hyperinsulinemia resulting from systemic insulin resistance can activate the transcription
of genes regulating fatty acid synthesis and triglyceride esterification through sterol
regulatory element binding protein 1c (SREBP-1c) (Matsumoto et al., 2003). Alternatively,
others have proposed that accumulation of bioactive lipid metabolites such as FFA, DAG
and ceramide can negatively regulate hepatic insulin signalling (Kim et al., 2001; Ruddock
et al., 2008; Ussher et al., 2010). On the other hand, emerging data suggest that steatosis
and insulin resistance may be two separate manifestations of the metabolic disturbances in
response to nutritional overload (Arkan et al., 2005). Specifically, an increase in circulating
pro-inflammatory adipokines such as TNF-α, IL-6 and resistin in the context of visceral
obesity leads to activation of inflammatory pathways that impair insulin signal transduction
in the liver (Shoelson et al., 2006). Here we show that impairment in hepatic insulin
signalling mediated by Jak2 deletion, possibly as a consequence of accumulation of fatty
acid metabolites, can occur independently of changes in whole-body insulin sensitivity and
in the absence of systemic inflammation.
Despite the presence of profound fatty liver and dysregulated hepatic glucose production,
L-JAK2 KO mice showed a remarkable protection against HFD-induced glucose tolerance.
This metabolically beneficial profile was also apparent in chow-fed animals and could be
due to several reasons. First, elevated levels of circulating leptin in L-JAK2 KO mice may
improve their metabolic profile by central regulation of energy homeostasis (Gautron and
Elmquist, 2011). Consistent with the role of leptin in the control of energy balance, L-
JAK2 KO mice displayed elevated energy expenditure compared to control littermates.
164
Alternatively, the feedback increase in circulating GH concentration in L-JAK2 KO mice
may also favor an increase in basal metabolic rate. Several lines of evidence suggest that
high concentrations of GH stimulate resting energy expenditure independent of changes in
lean body mass (Bray, 1969; Wolthers et al., 1996), although the underlying mechanisms
are not fully elucidated.
The protection against diet-induced glucose intolerance, on the other hand, may be
explained by the compensatory increase in β-cell mass and the enhancement in glucose-
stimulated insulin secretion in response to blunted insulin signalling in the liver in L-JAK2
KO mice. The effects of impaired hepatic insulin signalling on β cell mass have been well
documented. For instance, hepatocyte-specific deletion of the insulin receptor has be
shown to lead to β cell hyperplasia and hyperinsulinemia (Michael et al., 2000). In this
model, IGF-1 was thought to act as a liver-derived growth factor to drive compensatory β
cell hyperplasia through insulin receptor A isoform (Escribano et al., 2009). Alternatively,
hepatic activation of ERK signalling, which is enhanced in the setting of obesity-induced
insulin resistance, has been proposed to stimulate β cell proliferation through a neuronal-
mediated relay of metabolic signals to the pancreas (Imai et al., 2008). In addition to
impaired hepatic insulin signalling, our L-JAK2 KO mice display impaired hepatic GH
signalling and a significant reduction in IGF-1 production, leading to a compensatory
increase in circulating GH levels. GH signalling in β cells has recently been shown to be
required for glucose-stimulated insulin secretion and compensatory β cell proliferation
under the stress of a HFD (Wu et al., 2011b). Therefore, attenuated hepatic insulin
165
signalling together with increased GH may contribute to the β-cell proliferation observed
in L-JAK2 KO mice. Taken together, our results highlight the multiple important roles of
hepatic JAK2 in metabolic regulation and glucose homeostasis.
VII. 6 Concluding remarks and future direction
The results presented in this thesis suggest that JAK2 acts to keep lipid content in check in
metabolic tissues with high lipid turnover. In the liver, JAK2 prevents development of
hepatic steatosis by inhibiting lipid uptake whereas in fat, JAK2 promotes efficient
lipolysis in white adipose tissue and enhances thermogenesis by regulating UCP1
expression in BAT. We propose that disruption of this important regulator leads to
excessive lipid accumulation locally. This promotes neutral lipid storage and prevents
spillover into the circulation and other organs. Consequently, despite massive liver
steatosis, hepatocyte-specific Jak2 knockout mice did not develop inflammatory liver
damage and were in fact protected from high-fat diet-induced obesity and glucose
intolerance. In the case of adipocyte JAK2 deficiency, lipolysis in white adipose tissue as
well as thermogenesis in BAT is impaired, resulting in energy storage in the form of lipid
droplets in adipocytes. This lipid accumulation was initially benign with no adverse effects
on metabolic variables. However, the progressive deposition of lipid eventually exceeded
the storage capacity of existing adipocytes, leading to the release of FFA into the
166
circulation and the ensuing metabolic consequences as mice grew older or when challenged
with metabolic stress.
In summary, our work has identified novel roles of the JAK-STAT pathway in metabolism
and shed light on the pathophysiology of obesity and the metabolic syndrome. We show
that JAK2 has critical and distinct functions in different metabolic tissues that together
regulate lipid and glucose metabolism and contribute to the maintenance of overall energy
homeostasis. Future work includes delineating the underlying molecular mechanisms and
the specific STAT proteins that mediate the metabolic effects of JAK2. In addition, the
impact of JAK2 deficiency on long-term obesity complications including cardiovascular
disease and liver cancer warrants further investigation. Given the pleiotropic role of JAK2
in metabolic homeostasis, as JAK2 inhibitors are becoming available for the treatment of
myeloproliferative disorders, it will be imperative to examine the safety profile of these
inhibitors with respect to their impact on metabolism. Taken together, better understanding
of the role of JAK-STAT in metabolism and energy homeostasis will provide important
insight into the pathogenesis of the metabolic syndrome and facilitate development of
novel treatment strategies for obesity and associated complications.
167
Chapter VIII: References
168
Abdul-Ghani, M.A., Jani, R., Chavez, A., Molina-Carrion, M., Tripathy, D., and Defronzo, R.A. (2009).
Mitochondrial reactive oxygen species generation in obese non-diabetic and type 2 diabetic participants.
Diabetologia 52, 574-582.
Aguirre, V., Werner, E.D., Giraud, J., Lee, Y.H., Shoelson, S.E., and White, M.F. (2002). Phosphorylation
of Ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin
action. J Biol Chem 277, 1531-1537.
Albano, E., Mottaran, E., Occhino, G., Reale, E., and Vidali, M. (2005). Review article: role of oxidative
stress in the progression of non-alcoholic steatosis. Aliment Pharmacol Ther 22 Suppl 2, 71-73.
Alberti, K.G., Zimmet, P., Shaw, J., and Group, I.D.F.E.T.F.C. (2005). The metabolic syndrome--a new
worldwide definition. Lancet 366, 1059-1062.
Amar, J., Burcelin, R., Ruidavets, J.B., Cani, P.D., Fauvel, J., Alessi, M.C., Chamontin, B., and Ferrieres, J.
(2008). Energy intake is associated with endotoxemia in apparently healthy men. Am J Clin Nutr 87, 1219-
1223.
Anderson, E.J., Lustig, M.E., Boyle, K.E., Woodlief, T.L., Kane, D.A., Lin, C.T., Price, J.W., 3rd, Kang, L.,
Rabinovitch, P.S., Szeto, H.H., et al. (2009). Mitochondrial H2O2 emission and cellular redox state link
excess fat intake to insulin resistance in both rodents and humans. J Clin Invest 119, 573-581.
Angulo, P. (2002). Nonalcoholic fatty liver disease. N Engl J Med 346, 1221-1231.
Anunciado-Koza, R.P., Zhang, J., Ukropec, J., Bajpeyi, S., Koza, R.A., Rogers, R.C., Cefalu, W.T., Mynatt,
R.L., and Kozak, L.P. (2011). Inactivation of the mitochondrial carrier SLC25A25 (ATP-Mg2+/Pi
transporter) reduces physical endurance and metabolic efficiency in mice. J Biol Chem 286, 11659-11671.
Argetsinger, L.S., Hsu, G.W., Myers, M.G., Jr., Billestrup, N., White, M.F., and Carter-Su, C. (1995). Growth
hormone, interferon-gamma, and leukemia inhibitory factor promoted tyrosyl phosphorylation of insulin
receptor substrate-1. J Biol Chem 270, 14685-14692.
Argo, C.K., and Caldwell, S.H. (2009). Epidemiology and natural history of non-alcoholic steatohepatitis.
Clin Liver Dis 13, 511-531.
Arita, Y., Kihara, S., Ouchi, N., Takahashi, M., Maeda, K., Miyagawa, J., Hotta, K., Shimomura, I.,
Nakamura, T., Miyaoka, K., et al. (1999). Paradoxical decrease of an adipose-specific protein, adiponectin,
in obesity. Biochem Biophys Res Commun 257, 79-83.
Arkan, M.C., Hevener, A.L., Greten, F.R., Maeda, S., Li, Z.W., Long, J.M., Wynshaw-Boris, A., Poli, G.,
Olefsky, J., and Karin, M. (2005). IKK-beta links inflammation to obesity-induced insulin resistance. Nat
Med 11, 191-198.
Arner, P. (2005). Human fat cell lipolysis: biochemistry, regulation and clinical role. Best Pract Res Clin
Endocrinol Metab 19, 471-482.
Avigan, M.I., Ishak, K.G., Gregg, R.E., and Hoofnagle, J.H. (1984). Morphologic features of the liver in
abetalipoproteinemia. Hepatology 4, 1223-1226.
Bachman, E.S., Dhillon, H., Zhang, C.Y., Cinti, S., Bianco, A.C., Kobilka, B.K., and Lowell, B.B. (2002).
betaAR signaling required for diet-induced thermogenesis and obesity resistance. Science 297, 843-845.
Bandsma, R.H., Prinsen, B.H., van Der Velden Mde, S., Rake, J.P., Boer, T., Smit, G.P., Reijngoud, D.J.,
and Kuipers, F. (2008). Increased de novo lipogenesis and delayed conversion of large VLDL into
intermediate density lipoprotein particles contribute to hyperlipidemia in glycogen storage disease type 1a.
Pediatr Res 63, 702-707.
Banerjee, R.R., Rangwala, S.M., Shapiro, J.S., Rich, A.S., Rhoades, B., Qi, Y., Wang, J., Rajala, M.W.,
Pocai, A., Scherer, P.E., et al. (2004). Regulation of fasted blood glucose by resistin. Science 303, 1195-
1198.
Barclay, J.L., Nelson, C.N., Ishikawa, M., Murray, L.A., Kerr, L.M., McPhee, T.R., Powell, E.E., and Waters,
M.J. (2011). GH-dependent STAT5 signaling plays an important role in hepatic lipid metabolism.
Endocrinology 152, 181-192.
Bartelt, A., Bruns, O.T., Reimer, R., Hohenberg, H., Ittrich, H., Peldschus, K., Kaul, M.G., Tromsdorf, U.I.,
Weller, H., Waurisch, C., et al. (2011). Brown adipose tissue activity controls triglyceride clearance. Nat
Med 17, 200-205.
169
Bashan, N., Kovsan, J., Kachko, I., Ovadia, H., and Rudich, A. (2009). Positive and negative regulation of
insulin signaling by reactive oxygen and nitrogen species. Physiol Rev 89, 27-71.
Baxter, E.J., Scott, L.M., Campbell, P.J., East, C., Fourouclas, N., Swanton, S., Vassiliou, G.S., Bench, A.J.,
Boyd, E.M., Curtin, N., et al. (2005). Acquired mutation of the tyrosine kinase JAK2 in human
myeloproliferative disorders. Lancet 365, 1054-1061.
Bedogni, G., Miglioli, L., Masutti, F., Tiribelli, C., Marchesini, G., and Bellentani, S. (2005). Prevalence of
and risk factors for nonalcoholic fatty liver disease: the Dionysos nutrition and liver study. Hepatology 42,
44-52.
Bellentani, S., Scaglioni, F., Marino, M., and Bedogni, G. (2010). Epidemiology of non-alcoholic fatty liver
disease. Dig Dis 28, 155-161.
Berg, A.H., and Scherer, P.E. (2005). Adipose tissue, inflammation, and cardiovascular disease. Circ Res 96,
939-949.
Berrington de Gonzalez, A., Hartge, P., Cerhan, J.R., Flint, A.J., Hannan, L., MacInnis, R.J., Moore, S.C.,
Tobias, G.S., Anton-Culver, H., Freeman, L.B., et al. (2010). Body-mass index and mortality among 1.46
million white adults. N Engl J Med 363, 2211-2219.
Berryman, D.E., Glad, C.A., List, E.O., and Johannsson, G. (2013). The GH/IGF-1 axis in obesity:
pathophysiology and therapeutic considerations. Nat Rev Endocrinol 9, 346-356.
Beutler, B., Hoebe, K., Du, X., and Ulevitch, R.J. (2003). How we detect microbes and respond to them: the
Toll-like receptors and their transducers. J Leukoc Biol 74, 479-485.
Bezy, O., Tran, T.T., Pihlajamaki, J., Suzuki, R., Emanuelli, B., Winnay, J., Mori, M.A., Haas, J., Biddinger,
S.B., Leitges, M., et al. (2011). PKCdelta regulates hepatic insulin sensitivity and hepatosteatosis in mice
and humans. J Clin Invest 121, 2504-2517.
Blaas, L., Kornfeld, J.W., Schramek, D., Musteanu, M., Zollner, G., Gumhold, J., van Zijl, F., Schneller, D.,
Esterbauer, H., Egger, G., et al. (2010). Disruption of the growth hormone--signal transducer and activator
of transcription 5--insulinlike growth factor 1 axis severely aggravates liver fibrosis in a mouse model of
cholestasis. Hepatology 51, 1319-1326.
Bluher, M., Michael, M.D., Peroni, O.D., Ueki, K., Carter, N., Kahn, B.B., and Kahn, C.R. (2002). Adipose
tissue selective insulin receptor knockout protects against obesity and obesity-related glucose intolerance.
Dev Cell 3, 25-38.
Boden, G. (1997). Role of fatty acids in the pathogenesis of insulin resistance and NIDDM. Diabetes 46, 3-
10.
Bokarewa, M., Nagaev, I., Dahlberg, L., Smith, U., and Tarkowski, A. (2005). Resistin, an adipokine with
potent proinflammatory properties. J Immunol 174, 5789-5795.
Bollheimer, L.C., Skelly, R.H., Chester, M.W., McGarry, J.D., and Rhodes, C.J. (1998). Chronic exposure
to free fatty acid reduces pancreatic beta cell insulin content by increasing basal insulin secretion that is not
compensated for by a corresponding increase in proinsulin biosynthesis translation. J Clin Invest 101, 1094-
1101.
Bonnard, C., Durand, A., Peyrol, S., Chanseaume, E., Chauvin, M.A., Morio, B., Vidal, H., and Rieusset, J.
(2008). Mitochondrial dysfunction results from oxidative stress in the skeletal muscle of diet-induced insulin-
resistant mice. J Clin Invest 118, 789-800.
Bordicchia, M., Liu, D., Amri, E.Z., Ailhaud, G., Dessi-Fulgheri, P., Zhang, C., Takahashi, N., Sarzani, R.,
and Collins, S. (2012). Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic
program in mouse and human adipocytes. J Clin Invest 122, 1022-1036.
Bostrom, P., Wu, J., Jedrychowski, M.P., Korde, A., Ye, L., Lo, J.C., Rasbach, K.A., Bostrom, E.A., Choi,
J.H., Long, J.Z., et al. (2012). A PGC1-alpha-dependent myokine that drives brown-fat-like development of
white fat and thermogenesis. Nature 481, 463-468.
Boucher, J., Castan-Laurell, I., Daviaud, D., Guigne, C., Buleon, M., Carpene, C., Saulnier-Blache, J.S., and
Valet, P. (2005). Adipokine expression profile in adipocytes of different mouse models of obesity. Horm
Metab Res 37, 761-767.
170
Boulton, T.G., Nye, S.H., Robbins, D.J., Ip, N.Y., Radziejewska, E., Morgenbesser, S.D., DePinho, R.A.,
Panayotatos, N., Cobb, M.H., and Yancopoulos, G.D. (1991). ERKs: a family of protein-serine/threonine
kinases that are activated and tyrosine phosphorylated in response to insulin and NGF. Cell 65, 663-675.
Bousquet, M., Quelen, C., De Mas, V., Duchayne, E., Roquefeuil, B., Delsol, G., Laurent, G., Dastugue, N.,
and Brousset, P. (2005). The t(8;9)(p22;p24) translocation in atypical chronic myeloid leukaemia yields a
new PCM1-JAK2 fusion gene. Oncogene 24, 7248-7252.
Bray, G.A. (1969). Calorigenic effect of human growth hormone in obesity. J Clin Endocrinol Metab 29,
119-122.
Brown, M.S., Kovanen, P.T., and Goldstein, J.L. (1981). Regulation of plasma cholesterol by lipoprotein
receptors. Science 212, 628-635.
Browning, J.D., Szczepaniak, L.S., Dobbins, R., Nuremberg, P., Horton, J.D., Cohen, J.C., Grundy, S.M.,
and Hobbs, H.H. (2004). Prevalence of hepatic steatosis in an urban population in the United States: impact
of ethnicity. Hepatology 40, 1387-1395.
Buettner, C., Muse, E.D., Cheng, A., Chen, L., Scherer, T., Pocai, A., Su, K., Cheng, B., Li, X., Harvey-
White, J., et al. (2008). Leptin controls adipose tissue lipogenesis via central, STAT3-independent
mechanisms. Nat Med 14, 667-675.
Bukowiecki, L., Collet, A.J., Follea, N., Guay, G., and Jahjah, L. (1982). Brown adipose tissue hyperplasia:
a fundamental mechanism of adaptation to cold and hyperphagia. Am J Physiol 242, E353-359.
Burfoot, M.S., Rogers, N.C., Watling, D., Smith, J.M., Pons, S., Paonessaw, G., Pellegrini, S., White, M.F.,
and Kerr, I.M. (1997). Janus kinase-dependent activation of insulin receptor substrate 1 in response to
interleukin-4, oncostatin M, and the interferons. J Biol Chem 272, 24183-24190.
Cai, D., Yuan, M., Frantz, D.F., Melendez, P.A., Hansen, L., Lee, J., and Shoelson, S.E. (2005). Local and
systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat Med 11, 183-
190.
Calle, E.E., Rodriguez, C., Walker-Thurmond, K., and Thun, M.J. (2003). Overweight, obesity, and mortality
from cancer in a prospectively studied cohort of U.S. adults. N Engl J Med 348, 1625-1638.
Cani, P.D., Amar, J., Iglesias, M.A., Poggi, M., Knauf, C., Bastelica, D., Neyrinck, A.M., Fava, F., Tuohy,
K.M., Chabo, C., et al. (2007). Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes 56,
1761-1772.
Cannon, B., and Nedergaard, J. (2004). Brown adipose tissue: function and physiological significance.
Physiol Rev 84, 277-359.
Caux, F., Dubosclard, E., Lascols, O., Buendia, B., Chazouilleres, O., Cohen, A., Courvalin, J.C., Laroche,
L., Capeau, J., Vigouroux, C., et al. (2003). A new clinical condition linked to a novel mutation in lamins A
and C with generalized lipoatrophy, insulin-resistant diabetes, disseminated leukomelanodermic papules,
liver steatosis, and cardiomyopathy. J Clin Endocrinol Metab 88, 1006-1013.
Cernkovich, E.R., Deng, J., Bond, M.C., Combs, T.P., and Harp, J.B. (2008). Adipose-specific disruption of
signal transducer and activator of transcription 3 increases body weight and adiposity. Endocrinology 149,
1581-1590.
Chartoumpekis, D.V., Habeos, I.G., Ziros, P.G., Psyrogiannis, A.I., Kyriazopoulou, V.E., and Papavassiliou,
A.G. (2011). Brown adipose tissue responds to cold and adrenergic stimulation by induction of FGF21. Mol
Med 17, 736-740.
Chawla, A., Barak, Y., Nagy, L., Liao, D., Tontonoz, P., and Evans, R.M. (2001). PPAR-gamma dependent
and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat Med 7,
48-52.
Chen, C.T., Ma, D.W., Kim, J.H., Mount, H.T., and Bazinet, R.P. (2008). The low density lipoprotein
receptor is not necessary for maintaining mouse brain polyunsaturated fatty acid concentrations. J Lipid Res
49, 147-152.
Chen, G., Koyama, K., Yuan, X., Lee, Y., Zhou, Y.T., O'Doherty, R., Newgard, C.B., and Unger, R.H. (1996).
Disappearance of body fat in normal rats induced by adenovirus-mediated leptin gene therapy. Proc Natl
Acad Sci U S A 93, 14795-14799.
171
Chen, J., Sadowski, H.B., Kohanski, R.A., and Wang, L.H. (1997a). Stat5 is a physiological substrate of the
insulin receptor. Proc Natl Acad Sci U S A 94, 2295-2300.
Chen, M., Cheng, A., Chen, Y.Q., Hymel, A., Hanson, E.P., Kimmel, L., Minami, Y., Taniguchi, T.,
Changelian, P.S., and O'Shea, J.J. (1997b). The amino terminus of JAK3 is necessary and sufficient for
binding to the common gamma chain and confers the ability to transmit interleukin 2-mediated signals. Proc
Natl Acad Sci U S A 94, 6910-6915.
Cheung, L., Andersen, M., Gustavsson, C., Odeberg, J., Fernandez-Perez, L., Norstedt, G., and Tollet-Egnell,
P. (2007). Hormonal and nutritional regulation of alternative CD36 transcripts in rat liver--a role for growth
hormone in alternative exon usage. BMC Mol Biol 8, 60.
Choi, C.S., Savage, D.B., Kulkarni, A., Yu, X.X., Liu, Z.X., Morino, K., Kim, S., Distefano, A., Samuel,
V.T., Neschen, S., et al. (2007). Suppression of diacylglycerol acyltransferase-2 (DGAT2), but not DGAT1,
with antisense oligonucleotides reverses diet-induced hepatic steatosis and insulin resistance. J Biol Chem
282, 22678-22688.
Chondronikola, M., Volpi, E., Borsheim, E., Porter, C., Annamalai, P., Enerback, S., Lidell, M.E., Saraf,
M.K., Labbe, S.M., Hurren, N.M., et al. (2014). Brown adipose tissue improves whole-body glucose
homeostasis and insulin sensitivity in humans. Diabetes 63, 4089-4099.
Cinti, S., Mitchell, G., Barbatelli, G., Murano, I., Ceresi, E., Faloia, E., Wang, S., Fortier, M., Greenberg,
A.S., and Obin, M.S. (2005). Adipocyte death defines macrophage localization and function in adipose tissue
of obese mice and humans. J Lipid Res 46, 2347-2355.
Clark, J.M., Brancati, F.L., and Diehl, A.M. (2003). The prevalence and etiology of elevated
aminotransferase levels in the United States. Am J Gastroenterol 98, 960-967.
Cohen, J.C., Horton, J.D., and Hobbs, H.H. (2011). Human fatty liver disease: old questions and new insights.
Science 332, 1519-1523.
Cohen, P., Zhao, C., Cai, X., Montez, J.M., Rohani, S.C., Feinstein, P., Mombaerts, P., and Friedman, J.M.
(2001). Selective deletion of leptin receptor in neurons leads to obesity. J Clin Invest 108, 1113-1121.
Collins, S., and Surwit, R.S. (2001). The beta-adrenergic receptors and the control of adipose tissue
metabolism and thermogenesis. Recent Prog Horm Res 56, 309-328.
Commins, S.P., Watson, P.M., Padgett, M.A., Dudley, A., Argyropoulos, G., and Gettys, T.W. (1999).
Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140,
292-300.
Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M., and Hemmings, B.A. (1995). Inhibition of glycogen
synthase kinase-3 by insulin mediated by protein kinase B. Nature 378, 785-789.
Cui, Y., Hosui, A., Sun, R., Shen, K., Gavrilova, O., Chen, W., Cam, M.C., Gao, B., Robinson, G.W., and
Hennighausen, L. (2007). Loss of signal transducer and activator of transcription 5 leads to hepatosteatosis
and impaired liver regeneration. Hepatology 46, 504-513.
Cypess, A.M., Chen, Y.C., Sze, C., Wang, K., English, J., Chan, O., Holman, A.R., Tal, I., Palmer, M.R.,
Kolodny, G.M., et al. (2012). Cold but not sympathomimetics activates human brown adipose tissue in vivo.
Proc Natl Acad Sci U S A 109, 10001-10005.
Cypess, A.M., Lehman, S., Williams, G., Tal, I., Rodman, D., Goldfine, A.B., Kuo, F.C., Palmer, E.L., Tseng,
Y.H., Doria, A., et al. (2009). Identification and importance of brown adipose tissue in adult humans. N Engl
J Med 360, 1509-1517.
Dandona, P., Thusu, K., Cook, S., Snyder, B., Makowski, J., Armstrong, D., and Nicotera, T. (1996).
Oxidative damage to DNA in diabetes mellitus. Lancet 347, 444-445.
Darnell, J.E., Jr., Kerr, I.M., and Stark, G.R. (1994). Jak-STAT pathways and transcriptional activation in
response to IFNs and other extracellular signaling proteins. Science 264, 1415-1421.
Davidson, M.B. (1987). Effect of growth hormone on carbohydrate and lipid metabolism. Endocr Rev 8,
115-131.
Day, C.P., and James, O.F. (1998). Steatohepatitis: a tale of two "hits"? Gastroenterology 114, 842-845.
172
de Jesus, L.A., Carvalho, S.D., Ribeiro, M.O., Schneider, M., Kim, S.W., Harney, J.W., Larsen, P.R., and
Bianco, A.C. (2001). The type 2 iodothyronine deiodinase is essential for adaptive thermogenesis in brown
adipose tissue. J Clin Invest 108, 1379-1385.
Deng, J., Hua, K., Lesser, S.S., and Harp, J.B. (2000). Activation of signal transducer and activator of
transcription-3 during proliferative phases of 3T3-L1 adipogenesis. Endocrinology 141, 2370-2376.
Dentin, R., Girard, J., and Postic, C. (2005). Carbohydrate responsive element binding protein (ChREBP)
and sterol regulatory element binding protein-1c (SREBP-1c): two key regulators of glucose metabolism and
lipid synthesis in liver. Biochimie 87, 81-86.
Derecka, M., Gornicka, A., Koralov, S.B., Szczepanek, K., Morgan, M., Raje, V., Sisler, J., Zhang, Q., Otero,
D., Cichy, J., et al. (2012). Tyk2 and Stat3 regulate brown adipose tissue differentiation and obesity. Cell
Metab 16, 814-824.
Deshmane, S.L., Kremlev, S., Amini, S., and Sawaya, B.E. (2009). Monocyte chemoattractant protein-1
(MCP-1): an overview. J Interferon Cytokine Res 29, 313-326.
Despres, J.P., and Lemieux, I. (2006). Abdominal obesity and metabolic syndrome. Nature 444, 881-887.
Dinneen, S., Gerich, J., and Rizza, R. (1992). Carbohydrate metabolism in non-insulin-dependent diabetes
mellitus. N Engl J Med 327, 707-713.
Doerrler, W., Feingold, K.R., and Grunfeld, C. (1994). Cytokines induce catabolic effects in cultured
adipocytes by multiple mechanisms. Cytokine 6, 478-484.
Donnelly, K.L., Smith, C.I., Schwarzenberg, S.J., Jessurun, J., Boldt, M.D., and Parks, E.J. (2005). Sources
of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J
Clin Invest 115, 1343-1351.
Dresner, A., Laurent, D., Marcucci, M., Griffin, M.E., Dufour, S., Cline, G.W., Slezak, L.A., Andersen, D.K.,
Hundal, R.S., Rothman, D.L., et al. (1999). Effects of free fatty acids on glucose transport and IRS-1-
associated phosphatidylinositol 3-kinase activity. J Clin Invest 103, 253-259.
Duez, H., Smith, A.C., Xiao, C., Giacca, A., Szeto, L., Drucker, D.J., and Lewis, G.F. (2009). Acute
dipeptidyl peptidase-4 inhibition rapidly enhances insulin-mediated suppression of endogenous glucose
production in mice. Endocrinology 150, 56-62.
Duffaut, C., Galitzky, J., Lafontan, M., and Bouloumie, A. (2009). Unexpected trafficking of immune cells
within the adipose tissue during the onset of obesity. Biochem Biophys Res Commun 384, 482-485.
Dumas, M.E., Barton, R.H., Toye, A., Cloarec, O., Blancher, C., Rothwell, A., Fearnside, J., Tatoud, R.,
Blanc, V., Lindon, J.C., et al. (2006). Metabolic profiling reveals a contribution of gut microbiota to fatty
liver phenotype in insulin-resistant mice. Proc Natl Acad Sci U S A 103, 12511-12516.
Eckel, R.H., Grundy, S.M., and Zimmet, P.Z. (2005). The metabolic syndrome. Lancet 365, 1415-1428.
Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A.L., Normandin, D., Cheng, A.,
Himms-Hagen, J., Chan, C.C., et al. (1999). Increased insulin sensitivity and obesity resistance in mice
lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544-1548.
Emorine, L.J., Marullo, S., Briend-Sutren, M.M., Patey, G., Tate, K., Delavier-Klutchko, C., and Strosberg,
A.D. (1989). Molecular characterization of the human beta 3-adrenergic receptor. Science 245, 1118-1121.
Endo, T.A., Masuhara, M., Yokouchi, M., Suzuki, R., Sakamoto, H., Mitsui, K., Matsumoto, A., Tanimura,
S., Ohtsubo, M., Misawa, H., et al. (1997). A new protein containing an SH2 domain that inhibits JAK
kinases. Nature 387, 921-924.
Enerback, S., Jacobsson, A., Simpson, E.M., Guerra, C., Yamashita, H., Harper, M.E., and Kozak, L.P.
(1997). Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387, 90-94.
Escribano, O., Guillen, C., Nevado, C., Gomez-Hernandez, A., Kahn, C.R., and Benito, M. (2009). Beta-Cell
hyperplasia induced by hepatic insulin resistance: role of a liver-pancreas endocrine axis through insulin
receptor A isoform. Diabetes 58, 820-828.
Esposito, K., Pontillo, A., Di Palo, C., Giugliano, G., Masella, M., Marfella, R., and Giugliano, D. (2003).
Effect of weight loss and lifestyle changes on vascular inflammatory markers in obese women: a randomized
trial. JAMA 289, 1799-1804.
173
Evans, J.L., Goldfine, I.D., Maddux, B.A., and Grodsky, G.M. (2002). Oxidative stress and stress-activated
signaling pathways: a unifying hypothesis of type 2 diabetes. Endocr Rev 23, 599-622.
Fabbrini, E., Mohammed, B.S., Magkos, F., Korenblat, K.M., Patterson, B.W., and Klein, S. (2008).
Alterations in adipose tissue and hepatic lipid kinetics in obese men and women with nonalcoholic fatty liver
disease. Gastroenterology 134, 424-431.
Fain, J.N., Ihle, J.H., and Bahouth, S.W. (1999). Stimulation of lipolysis but not of leptin release by growth
hormone is abolished in adipose tissue from Stat5a and b knockout mice. Biochem Biophys Res Commun
263, 201-205.
Fan, J.G., Zhu, J., Li, X.J., Chen, L., Li, L., Dai, F., Li, F., and Chen, S.Y. (2005). Prevalence of and risk
factors for fatty liver in a general population of Shanghai, China. J Hepatol 43, 508-514.
Fan, Y., Menon, R.K., Cohen, P., Hwang, D., Clemens, T., DiGirolamo, D.J., Kopchick, J.J., Le Roith, D.,
Trucco, M., and Sperling, M.A. (2009). Liver-specific deletion of the growth hormone receptor reveals
essential role of growth hormone signaling in hepatic lipid metabolism. J Biol Chem 284, 19937-19944.
Farrell, G.C., and Larter, C.Z. (2006). Nonalcoholic fatty liver disease: from steatosis to cirrhosis.
Hepatology 43, S99-S112.
Fasshauer, M., Kralisch, S., Klier, M., Lossner, U., Bluher, M., Klein, J., and Paschke, R. (2004). Insulin
resistance-inducing cytokines differentially regulate SOCS mRNA expression via growth factor- and
Jak/Stat-signaling pathways in 3T3-L1 adipocytes. J Endocrinol 181, 129-138.
Fedorenko, A., Lishko, P.V., and Kirichok, Y. (2012). Mechanism of fatty-acid-dependent UCP1 uncoupling
in brown fat mitochondria. Cell 151, 400-413.
Feldmann, H.M., Golozoubova, V., Cannon, B., and Nedergaard, J. (2009). UCP1 ablation induces obesity
and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality.
Cell Metab 9, 203-209.
Feldstein, A.E., Canbay, A., Guicciardi, M.E., Higuchi, H., Bronk, S.F., and Gores, G.J. (2003). Diet
associated hepatic steatosis sensitizes to Fas mediated liver injury in mice. J Hepatol 39, 978-983.
Feldstein, A.E., Werneburg, N.W., Canbay, A., Guicciardi, M.E., Bronk, S.F., Rydzewski, R., Burgart, L.J.,
and Gores, G.J. (2004). Free fatty acids promote hepatic lipotoxicity by stimulating TNF-alpha expression
via a lysosomal pathway. Hepatology 40, 185-194.
Feng, J., Witthuhn, B.A., Matsuda, T., Kohlhuber, F., Kerr, I.M., and Ihle, J.N. (1997). Activation of Jak2
catalytic activity requires phosphorylation of Y1007 in the kinase activation loop. Mol Cell Biol 17, 2497-
2501.
Feuerer, M., Herrero, L., Cipolletta, D., Naaz, A., Wong, J., Nayer, A., Lee, J., Goldfine, A.B., Benoist, C.,
Shoelson, S., et al. (2009). Lean, but not obese, fat is enriched for a unique population of regulatory T cells
that affect metabolic parameters. Nat Med 15, 930-939.
Fielder, P.J., and Talamantes, F. (1987). The lipolytic effects of mouse placental lactogen II, mouse prolactin,
and mouse growth hormone on adipose tissue from virgin and pregnant mice. Endocrinology 121, 493-497.
Finucane, M.M., Stevens, G.A., Cowan, M.J., Danaei, G., Lin, J.K., Paciorek, C.J., Singh, G.M., Gutierrez,
H.R., Lu, Y., Bahalim, A.N., et al. (2011). National, regional, and global trends in body-mass index since
1980: systematic analysis of health examination surveys and epidemiological studies with 960 country-years
and 9.1 million participants. Lancet 377, 557-567.
Fisher, F.M., Kleiner, S., Douris, N., Fox, E.C., Mepani, R.J., Verdeguer, F., Wu, J., Kharitonenkov, A.,
Flier, J.S., Maratos-Flier, E., et al. (2012). FGF21 regulates PGC-1alpha and browning of white adipose
tissues in adaptive thermogenesis. Genes Dev 26, 271-281.
Flegal, K.M., Graubard, B.I., Williamson, D.F., and Gail, M.H. (2007). Cause-specific excess deaths
associated with underweight, overweight, and obesity. JAMA 298, 2028-2037.
Flegal, K.M., Kit, B.K., Orpana, H., and Graubard, B.I. (2013). Association of all-cause mortality with
overweight and obesity using standard body mass index categories: a systematic review and meta-analysis.
JAMA 309, 71-82.
Floyd, Z.E., and Stephens, J.M. (2003). STAT5A promotes adipogenesis in nonprecursor cells and associates
with the glucocorticoid receptor during adipocyte differentiation. Diabetes 52, 308-314.
174
Folch, J., Lees, M., and Sloane Stanley, G.H. (1957). A simple method for the isolation and purification of
total lipides from animal tissues. J Biol Chem 226, 497-509.
Frayn, K.N., Shadid, S., Hamlani, R., Humphreys, S.M., Clark, M.L., Fielding, B.A., Boland, O., and
Coppack, S.W. (1994). Regulation of fatty acid movement in human adipose tissue in the postabsorptive-to-
postprandial transition. Am J Physiol 266, E308-317.
Freeman, D.J., Norrie, J., Caslake, M.J., Gaw, A., Ford, I., Lowe, G.D., O'Reilly, D.S., Packard, C.J., Sattar,
N., and West of Scotland Coronary Prevention, S. (2002). C-reactive protein is an independent predictor of
risk for the development of diabetes in the West of Scotland Coronary Prevention Study. Diabetes 51, 1596-
1600.
Freitas, M.C., Uchida, Y., Zhao, D., Ke, B., Busuttil, R.W., and Kupiec-Weglinski, J.W. (2010). Blockade
of Janus kinase-2 signaling ameliorates mouse liver damage due to ischemia and reperfusion. Liver Transpl
16, 600-610.
Fried, S.K., Bunkin, D.A., and Greenberg, A.S. (1998). Omental and subcutaneous adipose tissues of obese
subjects release interleukin-6: depot difference and regulation by glucocorticoid. J Clin Endocrinol Metab
83, 847-850.
Friedman, J.M., and Halaas, J.L. (1998). Leptin and the regulation of body weight in mammals. Nature 395,
763-770.
Furukawa, S., Fujita, T., Shimabukuro, M., Iwaki, M., Yamada, Y., Nakajima, Y., Nakayama, O., Makishima,
M., Matsuda, M., and Shimomura, I. (2004). Increased oxidative stress in obesity and its impact on metabolic
syndrome. J Clin Invest 114, 1752-1761.
Gao, B. (2005). Cytokines, STATs and liver disease. Cell Mol Immunol 2, 92-100.
Gastaldelli, A., Harrison, S.A., Belfort-Aguilar, R., Hardies, L.J., Balas, B., Schenker, S., and Cusi, K. (2009).
Importance of changes in adipose tissue insulin resistance to histological response during thiazolidinedione
treatment of patients with nonalcoholic steatohepatitis. Hepatology 50, 1087-1093.
Gastaldelli, A., Miyazaki, Y., Pettiti, M., Matsuda, M., Mahankali, S., Santini, E., DeFronzo, R.A., and
Ferrannini, E. (2002). Metabolic effects of visceral fat accumulation in type 2 diabetes. J Clin Endocrinol
Metab 87, 5098-5103.
Gautron, L., and Elmquist, J.K. (2011). Sixteen years and counting: an update on leptin in energy balance. J
Clin Invest 121, 2087-2093.
Ge, D., Gooljar, S.B., Kyriakou, T., Collins, L.J., Swaminathan, R., Snieder, H., Spector, T.D., and O'Dell,
S.D. (2008). Association of common JAK2 variants with body fat, insulin sensitivity and lipid profile.
Obesity (Silver Spring) 16, 492-496.
Ghoreschi, K., Laurence, A., and O'Shea, J.J. (2009). Janus kinases in immune cell signaling. Immunol Rev
228, 273-287.
Girard, J., Perdereau, D., Foufelle, F., Prip-Buus, C., and Ferre, P. (1994). Regulation of lipogenic enzyme
gene expression by nutrients and hormones. Faseb J 8, 36-42.
Goldberg, I.J. (1996). Lipoprotein lipase and lipolysis: central roles in lipoprotein metabolism and
atherogenesis. J Lipid Res 37, 693-707.
Golozoubova, V., Cannon, B., and Nedergaard, J. (2006). UCP1 is essential for adaptive adrenergic
nonshivering thermogenesis. Am J Physiol Endocrinol Metab 291, E350-357.
Gomez-Ambrosi, J., Catalan, V., Diez-Caballero, A., Martinez-Cruz, L.A., Gil, M.J., Garcia-Foncillas, J.,
Cienfuegos, J.A., Salvador, J., Mato, J.M., and Fruhbeck, G. (2004). Gene expression profile of omental
adipose tissue in human obesity. Faseb J 18, 215-217.
Goodman, H.M. (1968). Multiple effects of growth hormone on lipolysis. Endocrinology 83, 300-308.
Granzow, M., Schierwagen, R., Klein, S., Kowallick, B., Huss, S., Linhart, M., Mazar, I.G., Gortzen, J., Vogt,
A., Schildberg, F.A., et al. (2014). Angiotensin-II type 1 receptor-mediated Janus kinase 2 activation induces
liver fibrosis. Hepatology 60, 334-348.
Green, H., and Kehinde, O. (1975). An established preadipose cell line and its differentiation in culture. II.
Factors affecting the adipose conversion. Cell 5, 19-27.
175
Greenhalgh, C.J., and Hilton, D.J. (2001). Negative regulation of cytokine signaling. J Leukoc Biol 70, 348-
356.
Griffin, M.E., Marcucci, M.J., Cline, G.W., Bell, K., Barucci, N., Lee, D., Goodyear, L.J., Kraegen, E.W.,
White, M.F., and Shulman, G.I. (1999). Free fatty acid-induced insulin resistance is associated with
activation of protein kinase C theta and alterations in the insulin signaling cascade. Diabetes 48, 1270-1274.
Gross, L.S., Li, L., Ford, E.S., and Liu, S. (2004). Increased consumption of refined carbohydrates and the
epidemic of type 2 diabetes in the United States: an ecologic assessment. Am J Clin Nutr 79, 774-779.
Gual, P., Baron, V., Lequoy, V., and Van Obberghen, E. (1998). Interaction of Janus kinases JAK-1 and
JAK-2 with the insulin receptor and the insulin-like growth factor-1 receptor. Endocrinology 139, 884-893.
Guilherme, A., Virbasius, J.V., Puri, V., and Czech, M.P. (2008). Adipocyte dysfunctions linking obesity to
insulin resistance and type 2 diabetes. Nat Rev Mol Cell Biol 9, 367-377.
Hajri, T., Han, X.X., Bonen, A., and Abumrad, N.A. (2002). Defective fatty acid uptake modulates insulin
responsiveness and metabolic responses to diet in CD36-null mice. J Clin Invest 109, 1381-1389.
Halaas, J.L., Gajiwala, K.S., Maffei, M., Cohen, S.L., Chait, B.T., Rabinowitz, D., Lallone, R.L., Burley,
S.K., and Friedman, J.M. (1995). Weight-reducing effects of the plasma protein encoded by the obese gene.
Science 269, 543-546.
Halberg, N., Khan, T., Trujillo, M.E., Wernstedt-Asterholm, I., Attie, A.D., Sherwani, S., Wang, Z.V.,
Landskroner-Eiger, S., Dineen, S., Magalang, U.J., et al. (2009). Hypoxia-inducible factor 1alpha induces
fibrosis and insulin resistance in white adipose tissue. Mol Cell Biol 29, 4467-4483.
Hannun, Y.A. (1994). The sphingomyelin cycle and the second messenger function of ceramide. J Biol Chem
269, 3125-3128.
Hanson, R.L., Imperatore, G., Bennett, P.H., and Knowler, W.C. (2002). Components of the "metabolic
syndrome" and incidence of type 2 diabetes. Diabetes 51, 3120-3127.
Harms, M., and Seale, P. (2013). Brown and beige fat: development, function and therapeutic potential. Nat
Med 19, 1252-1263.
Harp, J.B., Franklin, D., Vanderpuije, A.A., and Gimble, J.M. (2001). Differential expression of signal
transducers and activators of transcription during human adipogenesis. Biochem Biophys Res Commun 281,
907-912.
He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., Nelson, M., Ong, E., Olefsky, J.M., and Evans,
R.M. (2003). Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin
resistance in fat and liver but not in muscle. Proc Natl Acad Sci U S A 100, 15712-15717.
Heilbronn, L.K., Rood, J., Janderova, L., Albu, J.B., Kelley, D.E., Ravussin, E., and Smith, S.R. (2004).
Relationship between serum resistin concentrations and insulin resistance in nonobese, obese, and obese
diabetic subjects. J Clin Endocrinol Metab 89, 1844-1848.
Heinrich, P.C., Behrmann, I., Muller-Newen, G., Schaper, F., and Graeve, L. (1998). Interleukin-6-type
cytokine signalling through the gp130/Jak/STAT pathway. Biochem J 334 ( Pt 2), 297-314.
Hellerstein, M.K. (2001). No common energy currency: de novo lipogenesis as the road less traveled. Am J
Clin Nutr 74, 707-708.
Hellerstein, M.K., Schwarz, J.M., and Neese, R.A. (1996). Regulation of hepatic de novo lipogenesis in
humans. Annu Rev Nutr 16, 523-557.
Hellgren, G., Albertsson-Wikland, K., Billig, H., Carlsson, L.M., and Carlsson, B. (2001). Growth hormone
receptor interaction with Jak proteins differs between tissues. J Interferon Cytokine Res 21, 75-83.
Henao-Mejia, J., Elinav, E., Jin, C., Hao, L., Mehal, W.Z., Strowig, T., Thaiss, C.A., Kau, A.L., Eisenbarth,
S.C., Jurczak, M.J., et al. (2012). Inflammasome-mediated dysbiosis regulates progression of NAFLD and
obesity. Nature 482, 179-185.
Hers, H.G., De Wulf, H., Stalmans, W., and van den Berghe, G. (1970). The control of glycogen synthesis
in the liver. Adv Enzyme Regul 8, 171-190.
Hilton, D.J., Richardson, R.T., Alexander, W.S., Viney, E.M., Willson, T.A., Sprigg, N.S., Starr, R.,
Nicholson, S.E., Metcalf, D., and Nicola, N.A. (1998). Twenty proteins containing a C-terminal SOCS box
form five structural classes. Proc Natl Acad Sci U S A 95, 114-119.
176
Himms-Hagen, J., Melnyk, A., Zingaretti, M.C., Ceresi, E., Barbatelli, G., and Cinti, S. (2000). Multilocular
fat cells in WAT of CL-316243-treated rats derive directly from white adipocytes. Am J Physiol Cell Physiol
279, C670-681.
Hioki, C., Yoshida, T., Kogure, A., Takakura, Y., Umekawa, T., Yoshioka, K., Shimatsu, A., and Yoshikawa,
T. (2004). Effects of growth hormone (GH) on mRNA levels of uncoupling proteins 1, 2, and 3 in brown and
white adipose tissues and skeletal muscle in obese mice. Horm Metab Res 36, 607-613.
Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C.Z., Uysal, K.T., Maeda, K., Karin, M., and Hotamisligil,
G.S. (2002). A central role for JNK in obesity and insulin resistance. Nature 420, 333-336.
Hogan, J.C., and Stephens, J.M. (2001). The identification and characterization of a STAT 1 binding site in
the PPARgamma2 promoter. Biochem Biophys Res Commun 287, 484-492.
Hogan, J.C., and Stephens, J.M. (2003). STAT 1 binds to the LPL promoter in vitro. Biochem Biophys Res
Commun 307, 350-354.
Hogan, J.C., and Stephens, J.M. (2005a). Effects of leukemia inhibitory factor on 3T3-L1 adipocytes. J
Endocrinol 185, 485-496.
Hogan, J.C., and Stephens, J.M. (2005b). The regulation of fatty acid synthase by STAT5A. Diabetes 54,
1968-1975.
Holland, W.L., Brozinick, J.T., Wang, L.P., Hawkins, E.D., Sargent, K.M., Liu, Y., Narra, K., Hoehn, K.L.,
Knotts, T.A., Siesky, A., et al. (2007). Inhibition of ceramide synthesis ameliorates glucocorticoid-,
saturated-fat-, and obesity-induced insulin resistance. Cell Metab 5, 167-179.
Hong, F., Jaruga, B., Kim, W.H., Radaeva, S., El-Assal, O.N., Tian, Z., Nguyen, V.A., and Gao, B. (2002).
Opposing roles of STAT1 and STAT3 in T cell-mediated hepatitis: regulation by SOCS. J Clin Invest 110,
1503-1513.
Hong, F., Radaeva, S., Pan, H.N., Tian, Z., Veech, R., and Gao, B. (2004). Interleukin 6 alleviates hepatic
steatosis and ischemia/reperfusion injury in mice with fatty liver disease. Hepatology 40, 933-941.
Horiguchi, N., Wang, L., Mukhopadhyay, P., Park, O., Jeong, W.I., Lafdil, F., Osei-Hyiaman, D., Moh, A.,
Fu, X.Y., Pacher, P., et al. (2008). Cell type-dependent pro- and anti-inflammatory role of signal transducer
and activator of transcription 3 in alcoholic liver injury. Gastroenterology 134, 1148-1158.
Horton, J.D., Shah, N.A., Warrington, J.A., Anderson, N.N., Park, S.W., Brown, M.S., and Goldstein, J.L.
(2003). Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies
direct SREBP target genes. Proc Natl Acad Sci U S A 100, 12027-12032.
Hosogai, N., Fukuhara, A., Oshima, K., Miyata, Y., Tanaka, S., Segawa, K., Furukawa, S., Tochino, Y.,
Komuro, R., Matsuda, M., et al. (2007). Adipose tissue hypoxia in obesity and its impact on adipocytokine
dysregulation. Diabetes 56, 901-911.
Hosui, A., Kimura, A., Yamaji, D., Zhu, B.M., Na, R., and Hennighausen, L. (2009). Loss of STAT5 causes
liver fibrosis and cancer development through increased TGF-{beta} and STAT3 activation. J Exp Med 206,
819-831.
Hotamisligil, G.S. (2006). Inflammation and metabolic disorders. Nature 444, 860-867.
Hotamisligil, G.S., Budavari, A., Murray, D., and Spiegelman, B.M. (1994a). Reduced tyrosine kinase
activity of the insulin receptor in obesity-diabetes. Central role of tumor necrosis factor-alpha. J Clin Invest
94, 1543-1549.
Hotamisligil, G.S., Murray, D.L., Choy, L.N., and Spiegelman, B.M. (1994b). Tumor necrosis factor alpha
inhibits signaling from the insulin receptor. Proc Natl Acad Sci U S A 91, 4854-4858.
Hotamisligil, G.S., Shargill, N.S., and Spiegelman, B.M. (1993). Adipose expression of tumor necrosis
factor-alpha: direct role in obesity-linked insulin resistance. Science 259, 87-91.
Houstis, N., Rosen, E.D., and Lander, E.S. (2006). Reactive oxygen species have a causal role in multiple
forms of insulin resistance. Nature 440, 944-948.
Howard, J.K., and Flier, J.S. (2006). Attenuation of leptin and insulin signaling by SOCS proteins. Trends
Endocrinol Metab 17, 365-371.
Hu, E., Kim, J.B., Sarraf, P., and Spiegelman, B.M. (1996). Inhibition of adipogenesis through MAP kinase-
mediated phosphorylation of PPARgamma. Science 274, 2100-2103.
177
Hu, F.B., Li, T.Y., Colditz, G.A., Willett, W.C., and Manson, J.E. (2003). Television watching and other
sedentary behaviors in relation to risk of obesity and type 2 diabetes mellitus in women. JAMA 289, 1785-
1791.
Huan, J.N., Li, J., Han, Y., Chen, K., Wu, N., and Zhao, A.Z. (2003). Adipocyte-selective reduction of the
leptin receptors induced by antisense RNA leads to increased adiposity, dyslipidemia, and insulin resistance.
J Biol Chem 278, 45638-45650.
Hug, C., Wang, J., Ahmad, N.S., Bogan, J.S., Tsao, T.S., and Lodish, H.F. (2004). T-cadherin is a receptor
for hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc Natl Acad Sci U S A 101,
10308-10313.
Hunt, C.R., Ro, J.H., Dobson, D.E., Min, H.Y., and Spiegelman, B.M. (1986). Adipocyte P2 gene:
developmental expression and homology of 5'-flanking sequences among fat cell-specific genes. Proc Natl
Acad Sci U S A 83, 3786-3790.
Huynh, F.K., Levi, J., Denroche, H.C., Gray, S.L., Voshol, P.J., Neumann, U.H., Speck, M., Chua, S.C.,
Covey, S.D., and Kieffer, T.J. (2010). Disruption of hepatic leptin signaling protects mice from age- and
diet-related glucose intolerance. Diabetes 59, 3032-3040.
Ibrahim, M.M. (2010). Subcutaneous and visceral adipose tissue: structural and functional differences. Obes
Rev 11, 11-18.
Iizuka, K., Bruick, R.K., Liang, G., Horton, J.D., and Uyeda, K. (2004). Deficiency of carbohydrate response
element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis. Proc Natl Acad Sci U S A 101,
7281-7286.
Imai, J., Katagiri, H., Yamada, T., Ishigaki, Y., Suzuki, T., Kudo, H., Uno, K., Hasegawa, Y., Gao, J., Kaneko,
K., et al. (2008). Regulation of pancreatic beta cell mass by neuronal signals from the liver. Science 322,
1250-1254.
Inoue, H., Ogawa, W., Ozaki, M., Haga, S., Matsumoto, M., Furukawa, K., Hashimoto, N., Kido, Y., Mori,
T., Sakaue, H., et al. (2004). Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate
metabolism in vivo. Nat Med 10, 168-174.
Irie-Sasaki, J., Sasaki, T., Matsumoto, W., Opavsky, A., Cheng, M., Welstead, G., Griffiths, E., Krawczyk,
C., Richardson, C.D., Aitken, K., et al. (2001). CD45 is a JAK phosphatase and negatively regulates cytokine
receptor signalling. Nature 409, 349-354.
Isomaa, B., Almgren, P., Tuomi, T., Forsen, B., Lahti, K., Nissen, M., Taskinen, M.R., and Groop, L. (2001).
Cardiovascular morbidity and mortality associated with the metabolic syndrome. Diabetes Care 24, 683-689.
Iwabu, M., Yamauchi, T., Okada-Iwabu, M., Sato, K., Nakagawa, T., Funata, M., Yamaguchi, M., Namiki,
S., Nakayama, R., Tabata, M., et al. (2010). Adiponectin and AdipoR1 regulate PGC-1alpha and
mitochondria by Ca(2+) and AMPK/SIRT1. Nature 464, 1313-1319.
Iyer, A., Fairlie, D.P., Prins, J.B., Hammock, B.D., and Brown, L. (2010). Inflammatory lipid mediators in
adipocyte function and obesity. Nat Rev Endocrinol 6, 71-82.
James, C., Ugo, V., Le Couedic, J.P., Staerk, J., Delhommeau, F., Lacout, C., Garcon, L., Raslova, H., Berger,
R., Bennaceur-Griscelli, A., et al. (2005). A unique clonal JAK2 mutation leading to constitutive signalling
causes polycythaemia vera. Nature 434, 1144-1148.
Jamieson, E., Chong, M.M., Steinberg, G.R., Jovanovska, V., Fam, B.C., Bullen, D.V., Chen, Y., Kemp,
B.E., Proietto, J., Kay, T.W., et al. (2005). Socs1 deficiency enhances hepatic insulin signaling. J Biol Chem
280, 31516-31521.
Jastroch, M., Hirschberg, V., and Klingenspor, M. (2012). Functional characterization of UCP1 in
mammalian HEK293 cells excludes mitochondrial uncoupling artefacts and reveals no contribution to basal
proton leak. Biochim Biophys Acta 1817, 1660-1670.
Jimba, S., Nakagami, T., Takahashi, M., Wakamatsu, T., Hirota, Y., Iwamoto, Y., and Wasada, T. (2005).
Prevalence of non-alcoholic fatty liver disease and its association with impaired glucose metabolism in
Japanese adults. Diabet Med 22, 1141-1145.
Jin, X., Zimmers, T.A., Perez, E.A., Pierce, R.H., Zhang, Z., and Koniaris, L.G. (2006). Paradoxical effects
of short- and long-term interleukin-6 exposure on liver injury and repair. Hepatology 43, 474-484.
178
Johnston, J.A., Wang, L.M., Hanson, E.P., Sun, X.J., White, M.F., Oakes, S.A., Pierce, J.H., and O'Shea, J.J.
(1995). Interleukins 2, 4, 7, and 15 stimulate tyrosine phosphorylation of insulin receptor substrates 1 and 2
in T cells. Potential role of JAK kinases. J Biol Chem 270, 28527-28530.
Jorgensen, S.B., O'Neill, H.M., Sylow, L., Honeyman, J., Hewitt, K.A., Palanivel, R., Fullerton, M.D., Oberg,
L., Balendran, A., Galic, S., et al. (2013). Deletion of Skeletal Muscle SOCS3 Prevents Insulin Resistance in
Obesity. Diabetes 62, 56-64.
Kabon, B., Nagele, A., Reddy, D., Eagon, C., Fleshman, J.W., Sessler, D.I., and Kurz, A. (2004). Obesity
decreases perioperative tissue oxygenation. Anesthesiology 100, 274-280.
Kahn, B.B., and Flier, J.S. (2000). Obesity and insulin resistance. J Clin Invest 106, 473-481.
Kahn, S.E. (2003). The relative contributions of insulin resistance and beta-cell dysfunction to the
pathophysiology of Type 2 diabetes. Diabetologia 46, 3-19.
Kamohara, S., Burcelin, R., Halaas, J.L., Friedman, J.M., and Charron, M.J. (1997). Acute stimulation of
glucose metabolism in mice by leptin treatment. Nature 389, 374-377.
Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K., Kitazawa, R., Kitazawa, S., Miyachi, H., Maeda,
S., Egashira, K., et al. (2006). MCP-1 contributes to macrophage infiltration into adipose tissue, insulin
resistance, and hepatic steatosis in obesity. J Clin Invest 116, 1494-1505.
Kaser, S., Kaser, A., Sandhofer, A., Ebenbichler, C.F., Tilg, H., and Patsch, J.R. (2003). Resistin messenger-
RNA expression is increased by proinflammatory cytokines in vitro. Biochem Biophys Res Commun 309,
286-290.
Kawai, M., Namba, N., Mushiake, S., Etani, Y., Nishimura, R., Makishima, M., and Ozono, K. (2007).
Growth hormone stimulates adipogenesis of 3T3-L1 cells through activation of the Stat5A/5B-PPARgamma
pathway. J Mol Endocrinol 38, 19-34.
Keay, S., and Grossberg, S.E. (1980). Interferon inhibits the conversion of 3T3-L1 mouse fibroblasts into
adipocytes. Proc Natl Acad Sci U S A 77, 4099-4103.
Kelley, D.E., Mokan, M., Simoneau, J.A., and Mandarino, L.J. (1993). Interaction between glucose and free
fatty acid metabolism in human skeletal muscle. J Clin Invest 92, 91-98.
Kern, P.A., Saghizadeh, M., Ong, J.M., Bosch, R.J., Deem, R., and Simsolo, R.B. (1995). The expression of
tumor necrosis factor in human adipose tissue. Regulation by obesity, weight loss, and relationship to
lipoprotein lipase. J Clin Invest 95, 2111-2119.
Kiguchi, N., Maeda, T., Kobayashi, Y., Fukazawa, Y., and Kishioka, S. (2009). Leptin enhances CC-
chemokine ligand expression in cultured murine macrophage. Biochem Biophys Res Commun 384, 311-315.
Kim, H.J., Higashimori, T., Park, S.Y., Choi, H., Dong, J., Kim, Y.J., Noh, H.L., Cho, Y.R., Cline, G., Kim,
Y.B., et al. (2004a). Differential effects of interleukin-6 and -10 on skeletal muscle and liver insulin action
in vivo. Diabetes 53, 1060-1067.
Kim, J.K., Fillmore, J.J., Chen, Y., Yu, C., Moore, I.K., Pypaert, M., Lutz, E.P., Kako, Y., Velez-Carrasco,
W., Goldberg, I.J., et al. (2001). Tissue-specific overexpression of lipoprotein lipase causes tissue-specific
insulin resistance. Proc Natl Acad Sci U S A 98, 7522-7527.
Kim, J.K., Fillmore, J.J., Sunshine, M.J., Albrecht, B., Higashimori, T., Kim, D.W., Liu, Z.X., Soos, T.J.,
Cline, G.W., O'Brien, W.R., et al. (2004b). PKC-theta knockout mice are protected from fat-induced insulin
resistance. J Clin Invest 114, 823-827.
Kim, J.Y., van de Wall, E., Laplante, M., Azzara, A., Trujillo, M.E., Hofmann, S.M., Schraw, T., Durand,
J.L., Li, H., Li, G., et al. (2007). Obesity-associated improvements in metabolic profile through expansion of
adipose tissue. J Clin Invest 117, 2621-2637.
Komatsu, M., Yazaki, M., Tanaka, N., Sano, K., Hashimoto, E., Takei, Y., Song, Y.Z., Tanaka, E., Kiyosawa,
K., Saheki, T., et al. (2008). Citrin deficiency as a cause of chronic liver disorder mimicking non-alcoholic
fatty liver disease. J Hepatol 49, 810-820.
Kopecky, J., Clarke, G., Enerback, S., Spiegelman, B., and Kozak, L.P. (1995). Expression of the
mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J Clin Invest
96, 2914-2923.
179
Kralovics, R., Passamonti, F., Buser, A.S., Teo, S.S., Tiedt, R., Passweg, J.R., Tichelli, A., Cazzola, M., and
Skoda, R.C. (2005). A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med
352, 1779-1790.
Krempler, A., Qi, Y., Triplett, A.A., Zhu, J., Rui, H., and Wagner, K.U. (2004). Generation of a conditional
knockout allele for the Janus kinase 2 (Jak2) gene in mice. Genesis 40, 52-57.
Krotkiewski, M., Bjorntorp, P., Sjostrom, L., and Smith, U. (1983). Impact of obesity on metabolism in men
and women. Importance of regional adipose tissue distribution. J Clin Invest 72, 1150-1162.
Kumada, M., Kihara, S., Ouchi, N., Kobayashi, H., Okamoto, Y., Ohashi, K., Maeda, K., Nagaretani, H.,
Kishida, K., Maeda, N., et al. (2004). Adiponectin specifically increased tissue inhibitor of
metalloproteinase-1 through interleukin-10 expression in human macrophages. Circulation 109, 2046-2049.
Kyriakis, J.M., and Avruch, J. (2001). Mammalian mitogen-activated protein kinase signal transduction
pathways activated by stress and inflammation. Physiol Rev 81, 807-869.
Lakka, H.M., Laaksonen, D.E., Lakka, T.A., Niskanen, L.K., Kumpusalo, E., Tuomilehto, J., and Salonen,
J.T. (2002). The metabolic syndrome and total and cardiovascular disease mortality in middle-aged men.
JAMA 288, 2709-2716.
Langin, D., and Arner, P. (2006). Importance of TNFalpha and neutral lipases in human adipose tissue
lipolysis. Trends Endocrinol Metab 17, 314-320.
Larsen, C.M., Faulenbach, M., Vaag, A., Volund, A., Ehses, J.A., Seifert, B., Mandrup-Poulsen, T., and
Donath, M.Y. (2007). Interleukin-1-receptor antagonist in type 2 diabetes mellitus. N Engl J Med 356, 1517-
1526.
Lass, A., Zimmermann, R., Haemmerle, G., Riederer, M., Schoiswohl, G., Schweiger, M., Kienesberger, P.,
Strauss, J.G., Gorkiewicz, G., and Zechner, R. (2006). Adipose triglyceride lipase-mediated lipolysis of
cellular fat stores is activated by CGI-58 and defective in Chanarin-Dorfman Syndrome. Cell Metab 3, 309-
319.
Lee, J.H., Chan, J.L., Yiannakouris, N., Kontogianni, M., Estrada, E., Seip, R., Orlova, C., and Mantzoros,
C.S. (2003). Circulating resistin levels are not associated with obesity or insulin resistance in humans and
are not regulated by fasting or leptin administration: cross-sectional and interventional studies in normal,
insulin-resistant, and diabetic subjects. J Clin Endocrinol Metab 88, 4848-4856.
Lee, J.Y., Sohn, K.H., Rhee, S.H., and Hwang, D. (2001). Saturated fatty acids, but not unsaturated fatty
acids, induce the expression of cyclooxygenase-2 mediated through Toll-like receptor 4. J Biol Chem 276,
16683-16689.
Lee, P., Linderman, J.D., Smith, S., Brychta, R.J., Wang, J., Idelson, C., Perron, R.M., Werner, C.D., Phan,
G.Q., Kammula, U.S., et al. (2014a). Irisin and FGF21 are cold-induced endocrine activators of brown fat
function in humans. Cell Metab 19, 302-309.
Lee, P., Smith, S., Linderman, J., Courville, A.B., Brychta, R.J., Dieckmann, W., Werner, C.D., Chen, K.Y.,
and Celi, F.S. (2014b). Temperature-acclimated brown adipose tissue modulates insulin sensitivity in humans.
Diabetes 63, 3686-3698.
Lee, S., Lee, H.C., Kwon, Y.W., Lee, S.E., Cho, Y., Kim, J., Lee, S., Kim, J.Y., Lee, J., Yang, H.M., et al.
(2014c). Adenylyl cyclase-associated protein 1 is a receptor for human resistin and mediates inflammatory
actions of human monocytes. Cell Metab 19, 484-497.
Lee, Y.S., Kim, J.W., Osborne, O., Oh, D.Y., Sasik, R., Schenk, S., Chen, A., Chung, H., Murphy, A.,
Watkins, S.M., et al. (2014d). Increased Adipocyte O-2 Consumption Triggers HIF-1 alpha, Causing
Inflammation and Insulin Resistance in Obesity. Cell 157, 1339-1352.
Lemonnier, D. (1972). Effect of age, sex, and sites on the cellularity of the adipose tissue in mice and rats
rendered obese by a high-fat diet. J Clin Invest 51, 2907-2915.
Levine, R.L., Wadleigh, M., Cools, J., Ebert, B.L., Wernig, G., Huntly, B.J., Boggon, T.J., Wlodarska, I.,
Clark, J.J., Moore, S., et al. (2005). Activating mutation in the tyrosine kinase JAK2 in polycythemia vera,
essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 7, 387-397.
Levitzki, A. (1990). Tyrphostins--potential antiproliferative agents and novel molecular tools. Biochem
Pharmacol 40, 913-918.
180
Lewis, G.F., Carpentier, A., Adeli, K., and Giacca, A. (2002). Disordered fat storage and mobilization in the
pathogenesis of insulin resistance and type 2 diabetes. Endocr Rev 23, 201-229.
Lewis, R.E., Cao, L., Perregaux, D., and Czech, M.P. (1990). Threonine 1336 of the human insulin receptor
is a major target for phosphorylation by protein kinase C. Biochemistry 29, 1807-1813.
Ley, R.E., Turnbaugh, P.J., Klein, S., and Gordon, J.I. (2006). Microbial ecology: human gut microbes
associated with obesity. Nature 444, 1022-1023.
Li, G., Klein, R.L., Matheny, M., King, M.A., Meyer, E.M., and Scarpace, P.J. (2002). Induction of
uncoupling protein 1 by central interleukin-6 gene delivery is dependent on sympathetic innervation of brown
adipose tissue and underlies one mechanism of body weight reduction in rats. Neuroscience 115, 879-889.
Li, Y., Knapp, J.R., and Kopchick, J.J. (2003). Enlargement of interscapular brown adipose tissue in growth
hormone antagonist transgenic and in growth hormone receptor gene-disrupted dwarf mice. Exp Biol Med
(Maywood) 228, 207-215.
Li, Y., Soos, T.J., Li, X., Wu, J., Degennaro, M., Sun, X., Littman, D.R., Birnbaum, M.J., and Polakiewicz,
R.D. (2004). Protein kinase C Theta inhibits insulin signaling by phosphorylating IRS1 at Ser(1101). J Biol
Chem 279, 45304-45307.
Li, Z.Z., Berk, M., McIntyre, T.M., and Feldstein, A.E. (2009). Hepatic lipid partitioning and liver damage
in nonalcoholic fatty liver disease: role of stearoyl-CoA desaturase. J Biol Chem 284, 5637-5644.
Lim, S.S., Vos, T., Flaxman, A.D., Danaei, G., Shibuya, K., Adair-Rohani, H., Amann, M., Anderson, H.R.,
Andrews, K.G., Aryee, M., et al. (2012). A comparative risk assessment of burden of disease and injury
attributable to 67 risk factors and risk factor clusters in 21 regions, 1990-2010: a systematic analysis for the
Global Burden of Disease Study 2010. Lancet 380, 2224-2260.
Ling, C., Svensson, L., Oden, B., Weijdegard, B., Eden, B., Eden, S., and Billig, H. (2003). Identification of
functional prolactin (PRL) receptor gene expression: PRL inhibits lipoprotein lipase activity in human white
adipose tissue. J Clin Endocrinol Metab 88, 1804-1808.
List, E.O., Berryman, D.E., Funk, K., Gosney, E.S., Jara, A., Kelder, B., Wang, X., Kutz, L., Troike, K.,
Lozier, N., et al. (2013). The role of GH in adipose tissue: lessons from adipose-specific GH receptor gene-
disrupted mice. Mol Endocrinol 27, 524-535.
List, E.O., Berryman, D.E., Funk, K., Jara, A., Kelder, B., Wang, F., Stout, M.B., Zhi, X., Sun, L., White,
T.A., et al. (2014). Liver-specific GH receptor gene-disrupted (LiGHRKO) mice have decreased endocrine
IGF-I, increased local IGF-I, and altered body size, body composition, and adipokine profiles. Endocrinology
155, 1793-1805.
List, E.O., Palmer, A.J., Berryman, D.E., Bower, B., Kelder, B., and Kopchick, J.J. (2009). Growth hormone
improves body composition, fasting blood glucose, glucose tolerance and liver triacylglycerol in a mouse
model of diet-induced obesity and type 2 diabetes. Diabetologia 52, 1647-1655.
List, E.O., Sackmann-Sala, L., Berryman, D.E., Funk, K., Kelder, B., Gosney, E.S., Okada, S., Ding, J., Cruz-
Topete, D., and Kopchick, J.J. (2011). Endocrine parameters and phenotypes of the growth hormone receptor
gene disrupted (GHR-/-) mouse. Endocr Rev 32, 356-386.
Listenberger, L.L., Han, X., Lewis, S.E., Cases, S., Farese, R.V., Jr., Ory, D.S., and Schaffer, J.E. (2003).
Triglyceride accumulation protects against fatty acid-induced lipotoxicity. Proc Natl Acad Sci U S A 100,
3077-3082.
Liu, J., Divoux, A., Sun, J., Zhang, J., Clement, K., Glickman, J.N., Sukhova, G.K., Wolters, P.J., Du, J.,
Gorgun, C.Z., et al. (2009). Genetic deficiency and pharmacological stabilization of mast cells reduce diet-
induced obesity and diabetes in mice. Nat Med 15, 940-945.
Liu, Z.G., Hsu, H., Goeddel, D.V., and Karin, M. (1996). Dissection of TNF receptor 1 effector functions:
JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell 87, 565-576.
Lobstein, T., Baur, L., Uauy, R., and TaskForce, I.I.O. (2004). Obesity in children and young people: a crisis
in public health. Obes Rev 5 Suppl 1, 4-104.
Lord, G.M., Matarese, G., Howard, J.K., Baker, R.J., Bloom, S.R., and Lechler, R.I. (1998). Leptin modulates
the T-cell immune response and reverses starvation-induced immunosuppression. Nature 394, 897-901.
181
Lowell, B.B., V, S.S., Hamann, A., Lawitts, J.A., Himms-Hagen, J., Boyer, B.B., Kozak, L.P., and Flier, J.S.
(1993). Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature
366, 740-742.
Lumeng, C.N., Bodzin, J.L., and Saltiel, A.R. (2007a). Obesity induces a phenotypic switch in adipose tissue
macrophage polarization. J Clin Invest 117, 175-184.
Lumeng, C.N., Deyoung, S.M., Bodzin, J.L., and Saltiel, A.R. (2007b). Increased inflammatory properties
of adipose tissue macrophages recruited during diet-induced obesity. Diabetes 56, 16-23.
Ma, S.W., Foster, D.O., Nadeau, B.E., and Triandafillou, J. (1988). Absence of increased oxygen
consumption in brown adipose tissue of rats exhibiting "cafeteria" diet-induced thermogenesis. Can J Physiol
Pharmacol 66, 1347-1354.
Maechler, P., Jornot, L., and Wollheim, C.B. (1999). Hydrogen peroxide alters mitochondrial activation and
insulin secretion in pancreatic beta cells. J Biol Chem 274, 27905-27913.
Maeda, N., Shimomura, I., Kishida, K., Nishizawa, H., Matsuda, M., Nagaretani, H., Furuyama, N., Kondo,
H., Takahashi, M., Arita, Y., et al. (2002). Diet-induced insulin resistance in mice lacking
adiponectin/ACRP30. Nat Med 8, 731-737.
Malhi, H., Barreyro, F.J., Isomoto, H., Bronk, S.F., and Gores, G.J. (2007). Free fatty acids sensitise
hepatocytes to TRAIL mediated cytotoxicity. Gut 56, 1124-1131.
Malhi, H., Bronk, S.F., Werneburg, N.W., and Gores, G.J. (2006). Free fatty acids induce JNK-dependent
hepatocyte lipoapoptosis. J Biol Chem 281, 12093-12101.
Marchesini, G., Brizi, M., Bianchi, G., Tomassetti, S., Bugianesi, E., Lenzi, M., McCullough, A.J., Natale,
S., Forlani, G., and Melchionda, N. (2001). Nonalcoholic fatty liver disease: a feature of the metabolic
syndrome. Diabetes 50, 1844-1850.
Marchesini, G., Brizi, M., Morselli-Labate, A.M., Bianchi, G., Bugianesi, E., McCullough, A.J., Forlani, G.,
and Melchionda, N. (1999). Association of nonalcoholic fatty liver disease with insulin resistance. Am J Med
107, 450-455.
Marra, F., Gastaldelli, A., Svegliati Baroni, G., Tell, G., and Tiribelli, C. (2008). Molecular basis and
mechanisms of progression of non-alcoholic steatohepatitis. Trends Mol Med 14, 72-81.
Marrero, M.B., Schieffer, B., Paxton, W.G., Heerdt, L., Berk, B.C., Delafontaine, P., and Bernstein, K.E.
(1995). Direct stimulation of Jak/STAT pathway by the angiotensin II AT1 receptor. Nature 375, 247-250.
Matsumoto, M., Ogawa, W., Akimoto, K., Inoue, H., Miyake, K., Furukawa, K., Hayashi, Y., Iguchi, H.,
Matsuki, Y., Hiramatsu, R., et al. (2003). PKClambda in liver mediates insulin-induced SREBP-1c
expression and determines both hepatic lipid content and overall insulin sensitivity. J Clin Invest 112, 935-
944.
Matsuzawa, N., Takamura, T., Kurita, S., Misu, H., Ota, T., Ando, H., Yokoyama, M., Honda, M., Zen, Y.,
Nakanuma, Y., et al. (2007). Lipid-induced oxidative stress causes steatohepatitis in mice fed an atherogenic
diet. Hepatology 46, 1392-1403.
Matteoni, C.A., Younossi, Z.M., Gramlich, T., Boparai, N., Liu, Y.C., and McCullough, A.J. (1999).
Nonalcoholic fatty liver disease: a spectrum of clinical and pathological severity. Gastroenterology 116,
1413-1419.
Matthews, V.B., Allen, T.L., Risis, S., Chan, M.H., Henstridge, D.C., Watson, N., Zaffino, L.A., Babb, J.R.,
Boon, J., Meikle, P.J., et al. (2010). Interleukin-6-deficient mice develop hepatic inflammation and systemic
insulin resistance. Diabetologia 53, 2431-2441.
McGarry, J.D., Mannaerts, G.P., and Foster, D.W. (1977). A possible role for malonyl-CoA in the regulation
of hepatic fatty acid oxidation and ketogenesis. J Clin Invest 60, 265-270.
McGillicuddy, F.C., Chiquoine, E.H., Hinkle, C.C., Kim, R.J., Shah, R., Roche, H.M., Smyth, E.M., and
Reilly, M.P. (2009). Interferon gamma attenuates insulin signaling, lipid storage, and differentiation in
human adipocytes via activation of the JAK/STAT pathway. J Biol Chem 284, 31936-31944.
Mellado, M., Rodriguez-Frade, J.M., Aragay, A., del Real, G., Martin, A.M., Vila-Coro, A.J., Serrano, A.,
Mayor, F., Jr., and Martinez, A.C. (1998). The chemokine monocyte chemotactic protein 1 triggers Janus
kinase 2 activation and tyrosine phosphorylation of the CCR2B receptor. J Immunol 161, 805-813.
182
Memon, R.A., Feingold, K.R., Moser, A.H., Doerrler, W., and Grunfeld, C. (1992). In vivo effects of
interferon-alpha and interferon-gamma on lipolysis and ketogenesis. Endocrinology 131, 1695-1702.
Michael, M.D., Kulkarni, R.N., Postic, C., Previs, S.F., Shulman, G.I., Magnuson, M.A., and Kahn, C.R.
(2000). Loss of insulin signaling in hepatocytes leads to severe insulin resistance and progressive hepatic
dysfunction. Mol Cell 6, 87-97.
Minokoshi, Y., Kim, Y.B., Peroni, O.D., Fryer, L.G., Muller, C., Carling, D., and Kahn, B.B. (2002). Leptin
stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415, 339-343.
Moisan, A., Lee, Y.K., Zhang, J.D., Hudak, C.S., Meyer, C.A., Prummer, M., Zoffmann, S., Truong, H.H.,
Ebeling, M., Kiialainen, A., et al. (2015). White-to-brown metabolic conversion of human adipocytes by
JAK inhibition. Nat Cell Biol 17, 57-67.
Moller, H., Mellemgaard, A., Lindvig, K., and Olsen, J.H. (1994). Obesity and cancer risk: a Danish record-
linkage study. Eur J Cancer 30A, 344-350.
Monetti, M., Levin, M.C., Watt, M.J., Sajan, M.P., Marmor, S., Hubbard, B.K., Stevens, R.D., Bain, J.R.,
Newgard, C.B., Farese, R.V., Sr., et al. (2007). Dissociation of hepatic steatosis and insulin resistance in
mice overexpressing DGAT in the liver. Cell Metab 6, 69-78.
Mooney, R.A., Senn, J., Cameron, S., Inamdar, N., Boivin, L.M., Shang, Y., and Furlanetto, R.W. (2001).
Suppressors of cytokine signaling-1 and -6 associate with and inhibit the insulin receptor. A potential
mechanism for cytokine-mediated insulin resistance. J Biol Chem 276, 25889-25893.
Morrison, S.F., Madden, C.J., and Tupone, D. (2012). Central control of brown adipose tissue thermogenesis.
Front Endocrinol (Lausanne) 3.
Murano, I., Barbatelli, G., Giordano, A., and Cinti, S. (2009). Noradrenergic parenchymal nerve fiber
branching after cold acclimatisation correlates with brown adipocyte density in mouse adipose organ. J Anat
214, 171-178.
Murati, A., Gelsi-Boyer, V., Adelaide, J., Perot, C., Talmant, P., Giraudier, S., Lode, L., Letessier, A.,
Delaval, B., Brunel, V., et al. (2005). PCM1-JAK2 fusion in myeloproliferative disorders and acute erythroid
leukemia with t(8;9) translocation. Leukemia 19, 1692-1696.
Musso, G., Gambino, R., and Cassader, M. (2009). Recent insights into hepatic lipid metabolism in non-
alcoholic fatty liver disease (NAFLD). Prog Lipid Res 48, 1-26.
Myers, M.P., Andersen, J.N., Cheng, A., Tremblay, M.L., Horvath, C.M., Parisien, J.P., Salmeen, A., Barford,
D., and Tonks, N.K. (2001). TYK2 and JAK2 are substrates of protein-tyrosine phosphatase 1B. J Biol Chem
276, 47771-47774.
Nanbu-Wakao, R., Morikawa, Y., Matsumura, I., Masuho, Y., Muramatsu, M.A., Senba, E., and Wakao, H.
(2002). Stimulation of 3T3-L1 adipogenesis by signal transducer and activator of transcription 5. Mol
Endocrinol 16, 1565-1576.
Nara, N., Nakayama, Y., Okamoto, S., Tamura, H., Kiyono, M., Muraoka, M., Tanaka, K., Taya, C., Shitara,
H., Ishii, R., et al. (2007). Disruption of CXC motif chemokine ligand-14 in mice ameliorates obesity-induced
insulin resistance. J Biol Chem 282, 30794-30803.
Nawrocki, A.R., Rajala, M.W., Tomas, E., Pajvani, U.B., Saha, A.K., Trumbauer, M.E., Pang, Z., Chen, A.S.,
Ruderman, N.B., Chen, H., et al. (2006). Mice lacking adiponectin show decreased hepatic insulin sensitivity
and reduced responsiveness to peroxisome proliferator-activated receptor gamma agonists. J Biol Chem 281,
2654-2660.
Neubauer, H., Cumano, A., Muller, M., Wu, H., Huffstadt, U., and Pfeffer, K. (1998). Jak2 deficiency defines
an essential developmental checkpoint in definitive hematopoiesis. Cell 93, 397-409.
Newton, A.C. (1995). Protein kinase C: structure, function, and regulation. J Biol Chem 270, 28495-28498.
Ng, M., Fleming, T., Robinson, M., Thomson, B., Graetz, N., Margono, C., Mullany, E.C., Biryukov, S.,
Abbafati, C., Abera, S.F., et al. (2014). Global, regional, and national prevalence of overweight and obesity
in children and adults during 1980-2013: a systematic analysis for the Global Burden of Disease Study 2013.
Lancet.
183
Nguyen, K.D., Qiu, Y., Cui, X., Goh, Y.P., Mwangi, J., David, T., Mukundan, L., Brombacher, F., Locksley,
R.M., and Chawla, A. (2011). Alternatively activated macrophages produce catecholamines to sustain
adaptive thermogenesis. Nature 480, 104-108.
Nicholson, S.E., Willson, T.A., Farley, A., Starr, R., Zhang, J.G., Baca, M., Alexander, W.S., Metcalf, D.,
Hilton, D.J., and Nicola, N.A. (1999). Mutational analyses of the SOCS proteins suggest a dual domain
requirement but distinct mechanisms for inhibition of LIF and IL-6 signal transduction. Embo J 18, 375-385.
Nishimura, S., Manabe, I., Nagasaki, M., Eto, K., Yamashita, H., Ohsugi, M., Otsu, M., Hara, K., Ueki, K.,
Sugiura, S., et al. (2009). CD8+ effector T cells contribute to macrophage recruitment and adipose tissue
inflammation in obesity. Nat Med 15, 914-920.
Nishizawa, H., Iguchi, G., Murawaki, A., Fukuoka, H., Hayashi, Y., Kaji, H., Yamamoto, M., Suda, K.,
Takahashi, M., Seo, Y., et al. (2012). Nonalcoholic fatty liver disease in adult hypopituitary patients with
GH deficiency and the impact of GH replacement therapy. Eur J Endocrinol 167, 67-74.
Nishizuka, Y. (1984). The role of protein kinase C in cell surface signal transduction and tumour promotion.
Nature 308, 693-698.
Nordstrom, S.M., Tran, J.L., Sos, B.C., Wagner, K.U., and Weiss, E.J. (2013). Disruption of JAK2 in
adipocytes impairs lipolysis and improves fatty liver in mice with elevated GH. Mol Endocrinol 27, 1333-
1342.
O'Rourke, R.W., Metcalf, M.D., White, A.E., Madala, A., Winters, B.R., Maizlin, II, Jobe, B.A., Roberts,
C.T., Jr., Slifka, M.K., and Marks, D.L. (2009). Depot-specific differences in inflammatory mediators and a
role for NK cells and IFN-gamma in inflammation in human adipose tissue. Int J Obes (Lond) 33, 978-990.
O'Shea, J.J., Gadina, M., and Schreiber, R.D. (2002). Cytokine signaling in 2002: new surprises in the
Jak/Stat pathway. Cell 109 Suppl, S121-131.
Ohashi, K., Parker, J.L., Ouchi, N., Higuchi, A., Vita, J.A., Gokce, N., Pedersen, A.A., Kalthoff, C., Tullin,
S., Sams, A., et al. (2010). Adiponectin promotes macrophage polarization toward an anti-inflammatory
phenotype. J Biol Chem 285, 6153-6160.
Ohmura, K., Ishimori, N., Ohmura, Y., Tokuhara, S., Nozawa, A., Horii, S., Andoh, Y., Fujii, S., Iwabuchi,
K., Onoe, K., et al. (2010). Natural killer T cells are involved in adipose tissues inflammation and glucose
intolerance in diet-induced obese mice. Arterioscler Thromb Vasc Biol 30, 193-199.
Oral, E.A., Simha, V., Ruiz, E., Andewelt, A., Premkumar, A., Snell, P., Wagner, A.J., DePaoli, A.M.,
Reitman, M.L., Taylor, S.I., et al. (2002). Leptin-replacement therapy for lipodystrophy. N Engl J Med 346,
570-578.
Ott, V., Fasshauer, M., Dalski, A., Klein, H.H., and Klein, J. (2002). Direct effects of ciliary neurotrophic
factor on brown adipocytes: evidence for a role in peripheral regulation of energy homeostasis. J Endocrinol
173, R1-8.
Ouchi, N., Parker, J.L., Lugus, J.J., and Walsh, K. (2011). Adipokines in inflammation and metabolic disease.
Nat Rev Immunol 11, 85-97.
Ouellet, V., Labbe, S.M., Blondin, D.P., Phoenix, S., Guerin, B., Haman, F., Turcotte, E.E., Richard, D., and
Carpentier, A.C. (2012). Brown adipose tissue oxidative metabolism contributes to energy expenditure
during acute cold exposure in humans. J Clin Invest 122, 545-552.
Ozcan, U., Cao, Q., Yilmaz, E., Lee, A.H., Iwakoshi, N.N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher,
L.H., and Hotamisligil, G.S. (2004). Endoplasmic reticulum stress links obesity, insulin action, and type 2
diabetes. Science 306, 457-461.
Pajvani, U.B., Trujillo, M.E., Combs, T.P., Iyengar, P., Jelicks, L., Roth, K.A., Kitsis, R.N., and Scherer,
P.E. (2005). Fat apoptosis through targeted activation of caspase 8: a new mouse model of inducible and
reversible lipoatrophy. Nat Med 11, 797-803.
Palanivel, R., Fullerton, M.D., Galic, S., Honeyman, J., Hewitt, K.A., Jorgensen, S.B., and Steinberg, G.R.
(2012). Reduced Socs3 expression in adipose tissue protects female mice against obesity-induced insulin
resistance. Diabetologia 55, 3083-3093.
184
Paolisso, G., Gambardella, A., Tagliamonte, M.R., Saccomanno, F., Salvatore, T., Gualdiero, P., D'Onofrio,
M.V., and Howard, B.V. (1996). Does free fatty acid infusion impair insulin action also through an increase
in oxidative stress? J Clin Endocrinol Metab 81, 4244-4248.
Parganas, E., Wang, D., Stravopodis, D., Topham, D.J., Marine, J.C., Teglund, S., Vanin, E.F., Bodner, S.,
Colamonici, O.R., van Deursen, J.M., et al. (1998). Jak2 is essential for signaling through a variety of
cytokine receptors. Cell 93, 385-395.
Park, K.W., Halperin, D.S., and Tontonoz, P. (2008). Before they were fat: adipocyte progenitors. Cell Metab
8, 454-457.
Patsouris, D., Li, P.P., Thapar, D., Chapman, J., Olefsky, J.M., and Neels, J.G. (2008). Ablation of CD11c-
positive cells normalizes insulin sensitivity in obese insulin resistant animals. Cell Metab 8, 301-309.
Patti, M.E., and Kahn, C.R. (1998). The insulin receptor--a critical link in glucose homeostasis and insulin
action. J Basic Clin Physiol Pharmacol 9, 89-109.
Paz, K., Hemi, R., LeRoith, D., Karasik, A., Elhanany, E., Kanety, H., and Zick, Y. (1997). A molecular
basis for insulin resistance. Elevated serine/threonine phosphorylation of IRS-1 and IRS-2 inhibits their
binding to the juxtamembrane region of the insulin receptor and impairs their ability to undergo insulin-
induced tyrosine phosphorylation. J Biol Chem 272, 29911-29918.
Pelleymounter, M.A., Cullen, M.J., Baker, M.B., Hecht, R., Winters, D., Boone, T., and Collins, F. (1995).
Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269, 540-543.
Penas-Steinhardt, A., Tellechea, M.L., Gomez-Rosso, L., Brites, F., Frechtel, G.D., and Poskus, E. (2011).
Association of common variants in JAK2 gene with reduced risk of metabolic syndrome and related disorders.
BMC Med Genet 12, 166.
Pessin, J.E., and Saltiel, A.R. (2000). Signaling pathways in insulin action: molecular targets of insulin
resistance. J Clin Invest 106, 165-169.
Petersen, A.M., and Pedersen, B.K. (2005). The anti-inflammatory effect of exercise. J Appl Physiol (1985)
98, 1154-1162.
Plutzky, J. (2009). Expansion and contraction: the mighty, mighty fatty acid. Nat Med 15, 618-619.
Pradhan, A.D., Manson, J.E., Rifai, N., Buring, J.E., and Ridker, P.M. (2001). C-reactive protein, interleukin
6, and risk of developing type 2 diabetes mellitus. JAMA 286, 327-334.
Puigserver, P., Wu, Z., Park, C.W., Graves, R., Wright, M., and Spiegelman, B.M. (1998). A cold-inducible
coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829-839.
Qatanani, M., Szwergold, N.R., Greaves, D.R., Ahima, R.S., and Lazar, M.A. (2009). Macrophage-derived
human resistin exacerbates adipose tissue inflammation and insulin resistance in mice. J Clin Invest 119,
531-539.
Qi, Y., Nie, Z., Lee, Y.S., Singhal, N.S., Scherer, P.E., Lazar, M.A., and Ahima, R.S. (2006). Loss of resistin
improves glucose homeostasis in leptin deficiency. Diabetes 55, 3083-3090.
Qiu, Y., Nguyen, K.D., Odegaard, J.I., Cui, X., Tian, X., Locksley, R.M., Palmiter, R.D., and Chawla, A.
(2014). Eosinophils and type 2 cytokine signaling in macrophages orchestrate development of functional
beige fat. Cell 157, 1292-1308.
Quintas-Cardama, A., Kantarjian, H., Cortes, J., and Verstovsek, S. (2011). Janus kinase inhibitors for the
treatment of myeloproliferative neoplasias and beyond. Nat Rev Drug Discov 10, 127-140.
Radtke, S., Haan, S., Jorissen, A., Hermanns, H.M., Diefenbach, S., Smyczek, T., Schmitz-Vandeleur, H.,
Heinrich, P.C., Behrmann, I., and Haan, C. (2005). The Jak1 SH2 domain does not fulfill a classical SH2
function in Jak/STAT signaling but plays a structural role for receptor interaction and up-regulation of
receptor surface expression. J Biol Chem 280, 25760-25768.
Rane, S.G., and Reddy, E.P. (2000). Janus kinases: components of multiple signaling pathways. Oncogene
19, 5662-5679.
Richard, A.J., and Stephens, J.M. (2011). Emerging roles of JAK-STAT signaling pathways in adipocytes.
Trends Endocrinol Metab 22, 325-332.
Richelsen, B., Pedersen, S.B., Kristensen, K., Borglum, J.D., Norrelund, H., Christiansen, J.S., and Jorgensen,
J.O. (2000). Regulation of lipoprotein lipase and hormone-sensitive lipase activity and gene expression in
185
adipose and muscle tissue by growth hormone treatment during weight loss in obese patients. Metabolism
49, 906-911.
Richter, H.E., Albrektsen, T., and Billestrup, N. (2003). The role of signal transducer and activator of
transcription 5 in the inhibitory effects of GH on adipocyte differentiation. J Mol Endocrinol 30, 139-150.
Ridaura, V.K., Faith, J.J., Rey, F.E., Cheng, J., Duncan, A.E., Kau, A.L., Griffin, N.W., Lombard, V.,
Henrissat, B., Bain, J.R., et al. (2013). Gut microbiota from twins discordant for obesity modulate metabolism
in mice. Science 341, 1241214.
Roden, M., Price, T.B., Perseghin, G., Petersen, K.F., Rothman, D.L., Cline, G.W., and Shulman, G.I. (1996).
Mechanism of free fatty acid-induced insulin resistance in humans. J Clin Invest 97, 2859-2865.
Rosen, E.D., Hsu, C.H., Wang, X., Sakai, S., Freeman, M.W., Gonzalez, F.J., and Spiegelman, B.M. (2002).
C/EBPalpha induces adipogenesis through PPARgamma: a unified pathway. Genes Dev 16, 22-26.
Rosen, E.D., and MacDougald, O.A. (2006). Adipocyte differentiation from the inside out. Nat Rev Mol Cell
Biol 7, 885-896.
Rosen, E.D., and Spiegelman, B.M. (2006). Adipocytes as regulators of energy balance and glucose
homeostasis. Nature 444, 847-853.
Rothwell, N.J., and Stock, M.J. (1979). A role for brown adipose tissue in diet-induced thermogenesis. Nature
281, 31-35.
Ruddock, M.W., Stein, A., Landaker, E., Park, J., Cooksey, R.C., McClain, D., and Patti, M.E. (2008).
Saturated fatty acids inhibit hepatic insulin action by modulating insulin receptor expression and post-
receptor signalling. J Biochem 144, 599-607.
Rui, L., Yuan, M., Frantz, D., Shoelson, S., and White, M.F. (2002). SOCS-1 and SOCS-3 block insulin
signaling by ubiquitin-mediated degradation of IRS1 and IRS2. J Biol Chem 277, 42394-42398.
Saad, M.J., Carvalho, C.R., Thirone, A.C., and Velloso, L.A. (1996). Insulin induces tyrosine
phosphorylation of JAK2 in insulin-sensitive tissues of the intact rat. J Biol Chem 271, 22100-22104.
Saharinen, P., and Silvennoinen, O. (2002). The pseudokinase domain is required for suppression of basal
activity of Jak2 and Jak3 tyrosine kinases and for cytokine-inducible activation of signal transduction. J Biol
Chem 277, 47954-47963.
Saharinen, P., Takaluoma, K., and Silvennoinen, O. (2000). Regulation of the Jak2 tyrosine kinase by its
pseudokinase domain. Mol Cell Biol 20, 3387-3395.
Saito, M., Okamatsu-Ogura, Y., Matsushita, M., Watanabe, K., Yoneshiro, T., Nio-Kobayashi, J., Iwanaga,
T., Miyagawa, M., Kameya, T., Nakada, K., et al. (2009). High incidence of metabolically active brown
adipose tissue in healthy adult humans: effects of cold exposure and adiposity. Diabetes 58, 1526-1531.
Saltiel, A.R., and Kahn, C.R. (2001). Insulin signalling and the regulation of glucose and lipid metabolism.
Nature 414, 799-806.
Samaras, K., Botelho, N.K., Chisholm, D.J., and Lord, R.V. (2010). Subcutaneous and visceral adipose tissue
gene expression of serum adipokines that predict type 2 diabetes. Obesity (Silver Spring) 18, 884-889.
Samuel, V.T., Liu, Z.X., Wang, A., Beddow, S.A., Geisler, J.G., Kahn, M., Zhang, X.M., Monia, B.P.,
Bhanot, S., and Shulman, G.I. (2007). Inhibition of protein kinase Cepsilon prevents hepatic insulin
resistance in nonalcoholic fatty liver disease. J Clin Invest 117, 739-745.
Sanyal, A.J., Campbell-Sargent, C., Mirshahi, F., Rizzo, W.B., Contos, M.J., Sterling, R.K., Luketic, V.A.,
Shiffman, M.L., and Clore, J.N. (2001). Nonalcoholic steatohepatitis: association of insulin resistance and
mitochondrial abnormalities. Gastroenterology 120, 1183-1192.
Sarmiento, U., Benson, B., Kaufman, S., Ross, L., Qi, M., Scully, S., and DiPalma, C. (1997). Morphologic
and molecular changes induced by recombinant human leptin in the white and brown adipose tissues of
C57BL/6 mice. Lab Invest 77, 243-256.
Sartipy, P., and Loskutoff, D.J. (2003). Monocyte chemoattractant protein 1 in obesity and insulin resistance.
Proc Natl Acad Sci U S A 100, 7265-7270.
Sasaki, A., Yasukawa, H., Shouda, T., Kitamura, T., Dikic, I., and Yoshimura, A. (2000). CIS3/SOCS-3
suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2. J Biol Chem 275, 29338-
29347.
186
Savage, D.B., Sewter, C.P., Klenk, E.S., Segal, D.G., Vidal-Puig, A., Considine, R.V., and O'Rahilly, S.
(2001). Resistin / Fizz3 expression in relation to obesity and peroxisome proliferator-activated receptor-
gamma action in humans. Diabetes 50, 2199-2202.
Sawka-Verhelle, D., Tartare-Deckert, S., Decaux, J.F., Girard, J., and Van Obberghen, E. (2000). Stat 5B,
activated by insulin in a Jak-independent fashion, plays a role in glucokinase gene transcription.
Endocrinology 141, 1977-1988.
Schmitz-Peiffer, C., Browne, C.L., Oakes, N.D., Watkinson, A., Chisholm, D.J., Kraegen, E.W., and Biden,
T.J. (1997). Alterations in the expression and cellular localization of protein kinase C isozymes epsilon and
theta are associated with insulin resistance in skeletal muscle of the high-fat-fed rat. Diabetes 46, 169-178.
Schwabe, R.F., and Brenner, D.A. (2006). Mechanisms of Liver Injury. I. TNF-alpha-induced liver injury:
role of IKK, JNK, and ROS pathways. Am J Physiol Gastrointest Liver Physiol 290, G583-589.
Schwartz, M.W., Seeley, R.J., Campfield, L.A., Burn, P., and Baskin, D.G. (1996). Identification of targets
of leptin action in rat hypothalamus. J Clin Invest 98, 1101-1106.
Schwimmer, J.B., Deutsch, R., Kahen, T., Lavine, J.E., Stanley, C., and Behling, C. (2006). Prevalence of
fatty liver in children and adolescents. Pediatrics 118, 1388-1393.
Seale, P., Conroe, H.M., Estall, J., Kajimura, S., Frontini, A., Ishibashi, J., Cohen, P., Cinti, S., and
Spiegelman, B.M. (2011). Prdm16 determines the thermogenic program of subcutaneous white adipose tissue
in mice. J Clin Invest 121, 96-105.
Senn, J.J. (2006). Toll-like receptor-2 is essential for the development of palmitate-induced insulin resistance
in myotubes. J Biol Chem 281, 26865-26875.
Senn, J.J., Klover, P.J., Nowak, I.A., Zimmers, T.A., Koniaris, L.G., Furlanetto, R.W., and Mooney, R.A.
(2003). Suppressor of cytokine signaling-3 (SOCS-3), a potential mediator of interleukin-6-dependent insulin
resistance in hepatocytes. J Biol Chem 278, 13740-13746.
Seppala-Lindroos, A., Vehkavaara, S., Hakkinen, A.M., Goto, T., Westerbacka, J., Sovijarvi, A., Halavaara,
J., and Yki-Jarvinen, H. (2002). Fat accumulation in the liver is associated with defects in insulin suppression
of glucose production and serum free fatty acids independent of obesity in normal men. J Clin Endocrinol
Metab 87, 3023-3028.
Shabalina, I.G., Ost, M., Petrovic, N., Vrbacky, M., Nedergaard, J., and Cannon, B. (2010). Uncoupling
protein-1 is not leaky. Biochim Biophys Acta 1797, 773-784.
Shang, C.A., and Waters, M.J. (2003). Constitutively active signal transducer and activator of transcription
5 can replace the requirement for growth hormone in adipogenesis of 3T3-F442A preadipocytes. Mol
Endocrinol 17, 2494-2508.
Shepherd, P.R., Nave, B.T., and Siddle, K. (1995). Insulin stimulation of glycogen synthesis and glycogen
synthase activity is blocked by wortmannin and rapamycin in 3T3-L1 adipocytes: evidence for the
involvement of phosphoinositide 3-kinase and p70 ribosomal protein-S6 kinase. Biochem J 305 ( Pt 1), 25-
28.
Shi, H., Cave, B., Inouye, K., Bjorbaek, C., and Flier, J.S. (2006a). Overexpression of suppressor of cytokine
signaling 3 in adipose tissue causes local but not systemic insulin resistance. Diabetes 55, 699-707.
Shi, H., Kokoeva, M.V., Inouye, K., Tzameli, I., Yin, H., and Flier, J.S. (2006b). TLR4 links innate immunity
and fatty acid-induced insulin resistance. J Clin Invest 116, 3015-3025.
Shi, H., Tzameli, I., Bjorbaek, C., and Flier, J.S. (2004). Suppressor of cytokine signaling 3 is a physiological
regulator of adipocyte insulin signaling. J Biol Chem 279, 34733-34740.
Shi, S.Y., Garcia Martin, R., Duncan, R.E., Choi, D., Lu, S.Y., Schroer, S.A., Cai, E.P., Luk, C.T., Hopperton,
K.E., Domenichiello, A.F., et al. (2012). Hepatocyte-specific deletion of Janus kinase 2 (JAK2) protects
against diet-induced steatohepatitis and glucose intolerance. J Biol Chem 287, 10277-10288.
Shi, S.Y., Luk, C.T., Brunt, J.J., Sivasubramaniyam, T., Lu, S.Y., Schroer, S.A., and Woo, M. (2014).
Adipocyte-specific deficiency of Janus kinase (JAK) 2 in mice impairs lipolysis and increases body weight,
and leads to insulin resistance with ageing. Diabetologia 57, 1016-1026.
Shimomura, I., Hammer, R.E., Ikemoto, S., Brown, M.S., and Goldstein, J.L. (1999). Leptin reverses insulin
resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 401, 73-76.
187
Shimomura, I., Hammer, R.E., Richardson, J.A., Ikemoto, S., Bashmakov, Y., Goldstein, J.L., and Brown,
M.S. (1998). Insulin resistance and diabetes mellitus in transgenic mice expressing nuclear SREBP-1c in
adipose tissue: model for congenital generalized lipodystrophy. Genes Dev 12, 3182-3194.
Shiri-Sverdlov, R., Wouters, K., van Gorp, P.J., Gijbels, M.J., Noel, B., Buffat, L., Staels, B., Maeda, N.,
van Bilsen, M., and Hofker, M.H. (2006). Early diet-induced non-alcoholic steatohepatitis in APOE2 knock-
in mice and its prevention by fibrates. J Hepatol 44, 732-741.
Shoelson, S.E., Lee, J., and Goldfine, A.B. (2006). Inflammation and insulin resistance. J Clin Invest 116,
1793-1801.
Shuai, K. (2006). Regulation of cytokine signaling pathways by PIAS proteins. Cell Research 16, 196-202.
Siegrist-Kaiser, C.A., Pauli, V., Juge-Aubry, C.E., Boss, O., Pernin, A., Chin, W.W., Cusin, I., Rohner-
Jeanrenaud, F., Burger, A.G., Zapf, J., et al. (1997). Direct effects of leptin on brown and white adipose
tissue. J Clin Invest 100, 2858-2864.
Sims, E.A., Danforth, E., Jr., Horton, E.S., Bray, G.A., Glennon, J.A., and Salans, L.B. (1973). Endocrine
and metabolic effects of experimental obesity in man. Recent Prog Horm Res 29, 457-496.
Sjogren, K., Liu, J.L., Blad, K., Skrtic, S., Vidal, O., Wallenius, V., LeRoith, D., Tornell, J., Isaksson, O.G.,
Jansson, J.O., et al. (1999). Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-
I in blood but is not required for postnatal body growth in mice. Proc Natl Acad Sci U S A 96, 7088-7092.
Smith, B.W., and Adams, L.A. (2011). Nonalcoholic fatty liver disease and diabetes mellitus: pathogenesis
and treatment. Nat Rev Endocrinol 7, 456-465.
Song, H.Y., Kim, M.R., Lee, M.J., Jeon, E.S., Bae, Y.C., Jung, J.S., and Kim, J.H. (2007). Oncostatin M
decreases adiponectin expression and induces dedifferentiation of adipocytes by JAK3- and MEK-dependent
pathways. Int J Biochem Cell Biol 39, 439-449.
Sos, B.C., Harris, C., Nordstrom, S.M., Tran, J.L., Balazs, M., Caplazi, P., Febbraio, M., Applegate, M.A.,
Wagner, K.U., and Weiss, E.J. (2011). Abrogation of growth hormone secretion rescues fatty liver in mice
with hepatocyte-specific deletion of JAK2. J Clin Invest 121, 1412-1423.
Sovik, O., Vestergaard, H., Trygstad, O., and Pedersen, O. (1996). Studies of insulin resistance in congenital
generalized lipodystrophy. Acta Paediatr Suppl 413, 29-37.
Spalding, K.L., Arner, E., Westermark, P.O., Bernard, S., Buchholz, B.A., Bergmann, O., Blomqvist, L.,
Hoffstedt, J., Naslund, E., Britton, T., et al. (2008). Dynamics of fat cell turnover in humans. Nature 453,
783-787.
Spiegelman, B.M. (1998). PPAR-gamma: adipogenic regulator and thiazolidinedione receptor. Diabetes 47,
507-514.
Spiegelman, B.M., and Flier, J.S. (2001). Obesity and the regulation of energy balance. Cell 104, 531-543.
Stanford, K.I., Middelbeek, R.J., Townsend, K.L., An, D., Nygaard, E.B., Hitchcox, K.M., Markan, K.R.,
Nakano, K., Hirshman, M.F., Tseng, Y.H., et al. (2013). Brown adipose tissue regulates glucose homeostasis
and insulin sensitivity. J Clin Invest 123, 215-223.
Starley, B.Q., Calcagno, C.J., and Harrison, S.A. (2010). Nonalcoholic fatty liver disease and hepatocellular
carcinoma: a weighty connection. Hepatology 51, 1820-1832.
Steensberg, A., van Hall, G., Osada, T., Sacchetti, M., Saltin, B., and Klarlund Pedersen, B. (2000).
Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced
increase in plasma interleukin-6. J Physiol 529 Pt 1, 237-242.
Stephens, J.M., Morrison, R.F., and Pilch, P.F. (1996). The expression and regulation of STATs during 3T3-
L1 adipocyte differentiation. J Biol Chem 271, 10441-10444.
Steppan, C.M., Bailey, S.T., Bhat, S., Brown, E.J., Banerjee, R.R., Wright, C.M., Patel, H.R., Ahima, R.S.,
and Lazar, M.A. (2001a). The hormone resistin links obesity to diabetes. Nature 409, 307-312.
Steppan, C.M., Brown, E.J., Wright, C.M., Bhat, S., Banerjee, R.R., Dai, C.Y., Enders, G.H., Silberg, D.G.,
Wen, X., Wu, G.D., et al. (2001b). A family of tissue-specific resistin-like molecules. Proc Natl Acad Sci U
S A 98, 502-506.
Steppan, C.M., Wang, J., Whiteman, E.L., Birnbaum, M.J., and Lazar, M.A. (2005). Activation of SOCS-3
by resistin. Mol Cell Biol 25, 1569-1575.
188
Stewart, W.C., Morrison, R.F., Young, S.L., and Stephens, J.M. (1999). Regulation of signal transducers and
activators of transcription (STATs) by effectors of adipogenesis: coordinate regulation of STATs 1, 5A, and
5B with peroxisome proliferator-activated receptor-gamma and C/AAAT enhancer binding protein-alpha.
Biochim Biophys Acta 1452, 188-196.
Stewart, W.C., Pearcy, L.A., Floyd, Z.E., and Stephens, J.M. (2011). STAT5A expression in Swiss 3T3 cells
promotes adipogenesis in vivo in an athymic mice model system. Obesity (Silver Spring) 19, 1731-1734.
Strissel, K.J., Stancheva, Z., Miyoshi, H., Perfield, J.W., 2nd, DeFuria, J., Jick, Z., Greenberg, A.S., and
Obin, M.S. (2007). Adipocyte death, adipose tissue remodeling, and obesity complications. Diabetes 56,
2910-2918.
Sun, K., Kusminski, C.M., and Scherer, P.E. (2011). Adipose tissue remodeling and obesity. J Clin Invest
121, 2094-2101.
Swinburn, B.A., Sacks, G., Hall, K.D., McPherson, K., Finegood, D.T., Moodie, M.L., and Gortmaker, S.L.
(2011). The global obesity pandemic: shaped by global drivers and local environments. Lancet 378, 804-814.
Szczepaniak, L.S., Nurenberg, P., Leonard, D., Browning, J.D., Reingold, J.S., Grundy, S., Hobbs, H.H., and
Dobbins, R.L. (2005). Magnetic resonance spectroscopy to measure hepatic triglyceride content: prevalence
of hepatic steatosis in the general population. Am J Physiol Endocrinol Metab 288, E462-468.
Taga, T., Hibi, M., Hirata, Y., Yamasaki, K., Yasukawa, K., Matsuda, T., Hirano, T., and Kishimoto, T.
(1989). Interleukin-6 triggers the association of its receptor with a possible signal transducer, gp130. Cell 58,
573-581.
Tak, P.P., and Firestein, G.S. (2001). NF-kappaB: a key role in inflammatory diseases. J Clin Invest 107, 7-
11.
Tall, A.R. (1990). Plasma high density lipoproteins. Metabolism and relationship to atherogenesis. J Clin
Invest 86, 379-384.
Tanaka, T., Yoshida, N., Kishimoto, T., and Akira, S. (1997). Defective adipocyte differentiation in mice
lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J 16, 7432-7443.
Tang, Q.Q., Otto, T.C., and Lane, M.D. (2003). Mitotic clonal expansion: a synchronous process required
for adipogenesis. Proc Natl Acad Sci U S A 100, 44-49.
Tartaglia, L.A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G.J., Campfield, L.A.,
Clark, F.T., Deeds, J., et al. (1995). Identification and expression cloning of a leptin receptor, OB-R. Cell 83,
1263-1271.
Teglund, S., McKay, C., Schuetz, E., van Deursen, J.M., Stravopodis, D., Wang, D., Brown, M., Bodner, S.,
Grosveld, G., and Ihle, J.N. (1998). Stat5a and Stat5b proteins have essential and nonessential, or redundant,
roles in cytokine responses. Cell 93, 841-850.
Thirone, A.C., JeBailey, L., Bilan, P.J., and Klip, A. (2006). Opposite effect of JAK2 on insulin-dependent
activation of mitogen-activated protein kinases and Akt in muscle cells: possible target to ameliorate insulin
resistance. Diabetes 55, 942-951.
Thomas, G., and Hall, M.N. (1997). TOR signalling and control of cell growth. Curr Opin Cell Biol 9, 782-
787.
Thompson, B.R., Mazurkiewicz-Munoz, A.M., Suttles, J., Carter-Su, C., and Bernlohr, D.A. (2009).
Interaction of adipocyte fatty acid-binding protein (AFABP) and JAK2: AFABP/aP2 as a regulator of JAK2
signaling. J Biol Chem 284, 13473-13480.
Tiniakos, D.G., Vos, M.B., and Brunt, E.M. (2010). Nonalcoholic fatty liver disease: pathology and
pathogenesis. Annu Rev Pathol 5, 145-171.
Tomas, E., Tsao, T.S., Saha, A.K., Murrey, H.E., Zhang Cc, C., Itani, S.I., Lodish, H.F., and Ruderman, N.B.
(2002). Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: acetyl-CoA
carboxylase inhibition and AMP-activated protein kinase activation. Proc Natl Acad Sci U S A 99, 16309-
16313.
Tomita, K., Tamiya, G., Ando, S., Ohsumi, K., Chiyo, T., Mizutani, A., Kitamura, N., Toda, K., Kaneko, T.,
Horie, Y., et al. (2006). Tumour necrosis factor alpha signalling through activation of Kupffer cells plays an
essential role in liver fibrosis of non-alcoholic steatohepatitis in mice. Gut 55, 415-424.
189
Tontonoz, P., Hu, E., and Spiegelman, B.M. (1994). Stimulation of adipogenesis in fibroblasts by PPAR
gamma 2, a lipid-activated transcription factor. Cell 79, 1147-1156.
Tremaroli, V., and Backhed, F. (2012). Functional interactions between the gut microbiota and host
metabolism. Nature 489, 242-249.
Trujillo, M.E., Sullivan, S., Harten, I., Schneider, S.H., Greenberg, A.S., and Fried, S.K. (2004). Interleukin-
6 regulates human adipose tissue lipid metabolism and leptin production in vitro. J Clin Endocrinol Metab
89, 5577-5582.
Turkson, J., Bowman, T., Garcia, R., Caldenhoven, E., De Groot, R.P., and Jove, R. (1998). Stat3 activation
by Src induces specific gene regulation and is required for cell transformation. Mol Cell Biol 18, 2545-2552.
Turnbaugh, P.J., Ley, R.E., Mahowald, M.A., Magrini, V., Mardis, E.R., and Gordon, J.I. (2006). An obesity-
associated gut microbiome with increased capacity for energy harvest. Nature 444, 1027-1031.
Ueki, K., Kondo, T., and Kahn, C.R. (2004a). Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3
cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins
by discrete mechanisms. Mol Cell Biol 24, 5434-5446.
Ueki, K., Kondo, T., Tseng, Y.H., and Kahn, C.R. (2004b). Central role of suppressors of cytokine signaling
proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc Natl Acad
Sci U S A 101, 10422-10427.
Ungureanu, D., Wu, J., Pekkala, T., Niranjan, Y., Young, C., Jensen, O.N., Xu, C.F., Neubert, T.A., Skoda,
R.C., Hubbard, S.R., et al. (2011). The pseudokinase domain of JAK2 is a dual-specificity protein kinase that
negatively regulates cytokine signaling. Nat Struct Mol Biol 18, 971-976.
Urs, S., Harrington, A., Liaw, L., and Small, D. (2006). Selective expression of an aP2/Fatty Acid Binding
Protein 4-Cre transgene in non-adipogenic tissues during embryonic development. Transgenic Res 15, 647-
653.
Ussher, J.R., Koves, T.R., Cadete, V.J., Zhang, L., Jaswal, J.S., Swyrd, S.J., Lopaschuk, D.G., Proctor, S.D.,
Keung, W., Muoio, D.M., et al. (2010). Inhibition of de novo ceramide synthesis reverses diet-induced insulin
resistance and enhances whole-body oxygen consumption. Diabetes 59, 2453-2464.
Uysal, K.T., Wiesbrock, S.M., Marino, M.W., and Hotamisligil, G.S. (1997). Protection from obesity-
induced insulin resistance in mice lacking TNF-alpha function. Nature 389, 610-614.
van der Poorten, D., Milner, K.L., Hui, J., Hodge, A., Trenell, M.I., Kench, J.G., London, R., Peduto, T.,
Chisholm, D.J., and George, J. (2008). Visceral fat: a key mediator of steatohepatitis in metabolic liver
disease. Hepatology 48, 449-457.
van Hall, G., Steensberg, A., Sacchetti, M., Fischer, C., Keller, C., Schjerling, P., Hiscock, N., Moller, K.,
Saltin, B., Febbraio, M.A., et al. (2003). Interleukin-6 stimulates lipolysis and fat oxidation in humans. J Clin
Endocrinol Metab 88, 3005-3010.
van Marken Lichtenbelt, W.D., Vanhommerig, J.W., Smulders, N.M., Drossaerts, J.M., Kemerink, G.J.,
Bouvy, N.D., Schrauwen, P., and Teule, G.J. (2009). Cold-activated brown adipose tissue in healthy men. N
Engl J Med 360, 1500-1508.
Verdier, F., Chretien, S., Muller, O., Varlet, P., Yoshimura, A., Gisselbrecht, S., Lacombe, C., and Mayeux,
P. (1998). Proteasomes regulate erythropoietin receptor and signal transducer and activator of transcription
5 (STAT5) activation. Possible involvement of the ubiquitinated Cis protein. J Biol Chem 273, 28185-28190.
Verma, S., Li, S.H., Wang, C.H., Fedak, P.W., Li, R.K., Weisel, R.D., and Mickle, D.A. (2003). Resistin
promotes endothelial cell activation: further evidence of adipokine-endothelial interaction. Circulation 108,
736-740.
Viengchareun, S., Servel, N., Feve, B., Freemark, M., Lombes, M., and Binart, N. (2008). Prolactin receptor
signaling is essential for perinatal brown adipocyte function: a role for insulin-like growth factor-2. PLoS
One 3, e1535.
Vijayakumar, A., Novosyadlyy, R., Wu, Y., Yakar, S., and LeRoith, D. (2010). Biological effects of growth
hormone on carbohydrate and lipid metabolism. Growth Horm IGF Res 20, 1-7.
190
Vila-Coro, A.J., Rodriguez-Frade, J.M., Martin De Ana, A., Moreno-Ortiz, M.C., Martinez, A.C., and
Mellado, M. (1999). The chemokine SDF-1alpha triggers CXCR4 receptor dimerization and activates the
JAK/STAT pathway. FASEB J 13, 1699-1710.
Virtanen, K.A., Lidell, M.E., Orava, J., Heglind, M., Westergren, R., Niemi, T., Taittonen, M., Laine, J.,
Savisto, N.J., Enerback, S., et al. (2009). Functional brown adipose tissue in healthy adults. N Engl J Med
360, 1518-1525.
Visser, M., Bouter, L.M., McQuillan, G.M., Wener, M.H., and Harris, T.B. (1999). Elevated C-reactive
protein levels in overweight and obese adults. JAMA 282, 2131-2135.
Vitali, A., Murano, I., Zingaretti, M.C., Frontini, A., Ricquier, D., and Cinti, S. (2012). The adipose organ of
obesity-prone C57BL/6J mice is composed of mixed white and brown adipocytes. J Lipid Res 53, 619-629.
Wagner, K.U., Krempler, A., Triplett, A.A., Qi, Y., George, N.M., Zhu, J., and Rui, H. (2004). Impaired
alveologenesis and maintenance of secretory mammary epithelial cells in Jak2 conditional knockout mice.
Mol Cell Biol 24, 5510-5520.
Wakil, S.J., Stoops, J.K., and Joshi, V.C. (1983). Fatty acid synthesis and its regulation. Annu Rev Biochem
52, 537-579.
Wallenius, V., Wallenius, K., Ahren, B., Rudling, M., Carlsten, H., Dickson, S.L., Ohlsson, C., and Jansson,
J.O. (2002). Interleukin-6-deficient mice develop mature-onset obesity. Nat Med 8, 75-79.
Wang, H., Lafdil, F., Wang, L., Park, O., Yin, S., Niu, J., Miller, A.M., Sun, Z., and Gao, B. (2011).
Hepatoprotective versus oncogenic functions of STAT3 in liver tumorigenesis. Am J Pathol 179, 714-724.
Weisberg, S.P., Hunter, D., Huber, R., Lemieux, J., Slaymaker, S., Vaddi, K., Charo, I., Leibel, R.L., and
Ferrante, A.W., Jr. (2006). CCR2 modulates inflammatory and metabolic effects of high-fat feeding. J Clin
Invest 116, 115-124.
Weisberg, S.P., McCann, D., Desai, M., Rosenbaum, M., Leibel, R.L., and Ferrante, A.W., Jr. (2003).
Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112, 1796-1808.
Wernstedt, I., Edgley, A., Berndtsson, A., Faldt, J., Bergstrom, G., Wallenius, V., and Jansson, J.O. (2006).
Reduced stress- and cold-induced increase in energy expenditure in interleukin-6-deficient mice. Am J
Physiol Regul Integr Comp Physiol 291, R551-557.
West, D.B., Boozer, C.N., Moody, D.L., and Atkinson, R.L. (1992). Dietary obesity in nine inbred mouse
strains. Am J Physiol 262, R1025-1032.
White, M.F. (1998). The IRS-signalling system: a network of docking proteins that mediate insulin action.
Mol Cell Biochem 182, 3-11.
Whitfield, A.J., Barrett, P.H., Robertson, K., Havlat, M.F., van Bockxmeer, F.M., and Burnett, J.R. (2005).
Liver dysfunction and steatosis in familial hypobetalipoproteinemia. Clin Chem 51, 266-269.
Whittle, A.J., Carobbio, S., Martins, L., Slawik, M., Hondares, E., Vazquez, M.J., Morgan, D., Csikasz, R.I.,
Gallego, R., Rodriguez-Cuenca, S., et al. (2012). BMP8B increases brown adipose tissue thermogenesis
through both central and peripheral actions. Cell 149, 871-885.
WHO (2000). Obesity: preventing and managing the global epidemic. Report of a WHO consultation. World
Health Organ Tech Rep Ser 894, i-xii, 1-253.
Wieckowska, A., Papouchado, B.G., Li, Z., Lopez, R., Zein, N.N., and Feldstein, A.E. (2008). Increased
hepatic and circulating interleukin-6 levels in human nonalcoholic steatohepatitis. Am J Gastroenterol 103,
1372-1379.
Wilks, A.F., Harpur, A.G., Kurban, R.R., Ralph, S.J., Zurcher, G., and Ziemiecki, A. (1991). Two novel
protein-tyrosine kinases, each with a second phosphotransferase-related catalytic domain, define a new class
of protein kinase. Mol Cell Biol 11, 2057-2065.
Winer, D.A., Winer, S., Shen, L., Wadia, P.P., Yantha, J., Paltser, G., Tsui, H., Wu, P., Davidson, M.G.,
Alonso, M.N., et al. (2011). B cells promote insulin resistance through modulation of T cells and production
of pathogenic IgG antibodies. Nat Med 17, 610-617.
Winer, S., Chan, Y., Paltser, G., Truong, D., Tsui, H., Bahrami, J., Dorfman, R., Wang, Y., Zielenski, J.,
Mastronardi, F., et al. (2009). Normalization of obesity-associated insulin resistance through immunotherapy.
Nat Med 15, 921-929.
191
Wing, R.R. (1995). Changing diet and exercise behaviors in individuals at risk for weight gain. Obes Res 3
Suppl 2, 277s-282s.
Winston, L.A., and Hunter, T. (1995). JAK2, Ras, and Raf are required for activation of extracellular signal-
regulated kinase/mitogen-activated protein kinase by growth hormone. J Biol Chem 270, 30837-30840.
Wolk, A., Gridley, G., Svensson, M., Nyren, O., McLaughlin, J.K., Fraumeni, J.F., and Adam, H.O. (2001).
A prospective study of obesity and cancer risk (Sweden). Cancer Causes Control 12, 13-21.
Wolthers, T., Groftne, T., Moller, N., Christiansen, J.S., Orskov, H., Weeke, J., and Jorgensen, J.O. (1996).
Calorigenic effects of growth hormone: the role of thyroid hormones. J Clin Endocrinol Metab 81, 1416-
1419.
Wu, D., Molofsky, A.B., Liang, H.E., Ricardo-Gonzalez, R.R., Jouihan, H.A., Bando, J.K., Chawla, A., and
Locksley, R.M. (2011a). Eosinophils sustain adipose alternatively activated macrophages associated with
glucose homeostasis. Science 332, 243-247.
Wu, J., Bostrom, P., Sparks, L.M., Ye, L., Choi, J.H., Giang, A.H., Khandekar, M., Virtanen, K.A., Nuutila,
P., Schaart, G., et al. (2012). Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human.
Cell 150, 366-376.
Wu, J., Cohen, P., and Spiegelman, B.M. (2013). Adaptive thermogenesis in adipocytes: is beige the new
brown? Genes Dev 27, 234-250.
Wu, Y., Liu, C., Sun, H., Vijayakumar, A., Giglou, P.R., Qiao, R., Oppenheimer, J., Yakar, S., and LeRoith,
D. (2011b). Growth hormone receptor regulates beta cell hyperplasia and glucose-stimulated insulin
secretion in obese mice. J Clin Invest 121, 2422-2426.
Wu, Z., Rosen, E.D., Brun, R., Hauser, S., Adelmant, G., Troy, A.E., McKeon, C., Darlington, G.J., and
Spiegelman, B.M. (1999). Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional
pathway of adipogenesis and insulin sensitivity. Mol Cell 3, 151-158.
Wunderlich, F.T., Strohle, P., Konner, A.C., Gruber, S., Tovar, S., Bronneke, H.S., Juntti-Berggren, L., Li,
L.S., van Rooijen, N., Libert, C., et al. (2010). Interleukin-6 signaling in liver-parenchymal cells suppresses
hepatic inflammation and improves systemic insulin action. Cell Metab 12, 237-249.
Xu, A., Wang, Y., Keshaw, H., Xu, L.Y., Lam, K.S., and Cooper, G.J. (2003a). The fat-derived hormone
adiponectin alleviates alcoholic and nonalcoholic fatty liver diseases in mice. J Clin Invest 112, 91-100.
Xu, H., Barnes, G.T., Yang, Q., Tan, G., Yang, D., Chou, C.J., Sole, J., Nichols, A., Ross, J.S., Tartaglia,
L.A., et al. (2003b). Chronic inflammation in fat plays a crucial role in the development of obesity-related
insulin resistance. J Clin Invest 112, 1821-1830.
Yakar, S., Setser, J., Zhao, H., Stannard, B., Haluzik, M., Glatt, V., Bouxsein, M.L., Kopchick, J.J., and
LeRoith, D. (2004). Inhibition of growth hormone action improves insulin sensitivity in liver IGF-1-deficient
mice. J Clin Invest 113, 96-105.
Yamaguchi, K., Yang, L., McCall, S., Huang, J., Yu, X.X., Pandey, S.K., Bhanot, S., Monia, B.P., Li, Y.X.,
and Diehl, A.M. (2007). Inhibiting triglyceride synthesis improves hepatic steatosis but exacerbates liver
damage and fibrosis in obese mice with nonalcoholic steatohepatitis. Hepatology 45, 1366-1374.
Yamauchi, T., Kamon, J., Ito, Y., Tsuchida, A., Yokomizo, T., Kita, S., Sugiyama, T., Miyagishi, M., Hara,
K., Tsunoda, M., et al. (2003). Cloning of adiponectin receptors that mediate antidiabetic metabolic effects.
Nature 423, 762-769.
Yamauchi, T., Kamon, J., Minokoshi, Y., Ito, Y., Waki, H., Uchida, S., Yamashita, S., Noda, M., Kita, S.,
Ueki, K., et al. (2002). Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating
AMP-activated protein kinase. Nat Med 8, 1288-1295.
Yamauchi, T., Nio, Y., Maki, T., Kobayashi, M., Takazawa, T., Iwabu, M., Okada-Iwabu, M., Kawamoto,
S., Kubota, N., Kubota, T., et al. (2007). Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of
adiponectin binding and metabolic actions. Nat Med 13, 332-339.
Yang, Z.G., Hulver, M., McMillan, R.P., Cai, L.Z., Kershaw, E.E., Yu, L.Q., Xue, B.Z., and Shi, H. (2012).
Regulation of Insulin and Leptin Signaling by Muscle Suppressor of Cytokine Signaling 3 (SOCS3). Plos
One 7.
192
Yarwood, S.J., Sale, E.M., Sale, G.J., Houslay, M.D., Kilgour, E., and Anderson, N.G. (1999). Growth
hormone-dependent differentiation of 3T3-F442A preadipocytes requires Janus kinase/signal transducer and
activator of transcription but not mitogen-activated protein kinase or p70 S6 kinase signaling. J Biol Chem
274, 8662-8668.
Yatagai, T., Nagasaka, S., Taniguchi, A., Fukushima, M., Nakamura, T., Kuroe, A., Nakai, Y., and Ishibashi,
S. (2003). Hypoadiponectinemia is associated with visceral fat accumulation and insulin resistance in
Japanese men with type 2 diabetes mellitus. Metabolism 52, 1274-1278.
Yokota, T., Oritani, K., Takahashi, I., Ishikawa, J., Matsuyama, A., Ouchi, N., Kihara, S., Funahashi, T.,
Tenner, A.J., Tomiyama, Y., et al. (2000). Adiponectin, a new member of the family of soluble defense
collagens, negatively regulates the growth of myelomonocytic progenitors and the functions of macrophages.
Blood 96, 1723-1732.
Yoshimura, A. (1998). The CIS family: negative regulators of JAK-STAT signaling. Cytokine Growth Factor
Rev 9, 197-204.
Young, J.B., Saville, E., Rothwell, N.J., Stock, M.J., and Landsberg, L. (1982). Effect of diet and cold
exposure on norepinephrine turnover in brown adipose tissue of the rat. J Clin Invest 69, 1061-1071.
Younossi, Z.M., Gramlich, T., Liu, Y.C., Matteoni, C., Petrelli, M., Goldblum, J., Rybicki, L., and
McCullough, A.J. (1998). Nonalcoholic fatty liver disease: assessment of variability in pathologic
interpretations. Mod Pathol 11, 560-565.
Yu, C., Chen, Y., Cline, G.W., Zhang, D., Zong, H., Wang, Y., Bergeron, R., Kim, J.K., Cushman, S.W.,
Cooney, G.J., et al. (2002). Mechanism by which fatty acids inhibit insulin activation of insulin receptor
substrate-1 (IRS-1)-associated phosphatidylinositol 3-kinase activity in muscle. J Biol Chem 277, 50230-
50236.
Yuan, M., Konstantopoulos, N., Lee, J., Hansen, L., Li, Z.W., Karin, M., and Shoelson, S.E. (2001). Reversal
of obesity- and diet-induced insulin resistance with salicylates or targeted disruption of Ikkbeta. Science 293,
1673-1677.
Zechner, R., Zimmermann, R., Eichmann, T.O., Kohlwein, S.D., Haemmerle, G., Lass, A., and Madeo, F.
(2012). FAT SIGNALS--lipases and lipolysis in lipid metabolism and signaling. Cell Metab 15, 279-291.
Zhang, J.G., Farley, A., Nicholson, S.E., Willson, T.A., Zugaro, L.M., Simpson, R.J., Moritz, R.L., Cary, D.,
Richardson, R., Hausmann, G., et al. (1999). The conserved SOCS box motif in suppressors of cytokine
signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation. Proc Natl
Acad Sci U S A 96, 2071-2076.
Zhang, K., Guo, W., Yang, Y., and Wu, J. (2011). JAK2/STAT3 pathway is involved in the early stage of
adipogenesis through regulating C/EBPbeta transcription. J Cell Biochem 112, 488-497.
Zhang, M., Zhang, M., Zhang, C., Du, H., Wei, G., Pang, X., Zhou, H., Liu, B., and Zhao, L. (2009). Pattern
extraction of structural responses of gut microbiota to rotavirus infection via multivariate statistical analysis
of clone library data. FEMS Microbiol Ecol 70, 21-29.
Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., and Friedman, J.M. (1994). Positional cloning
of the mouse obese gene and its human homologue. Nature 372, 425-432.
Zhao, J.T., Cowley, M.J., Lee, P., Birzniece, V., Kaplan, W., and Ho, K.K. (2011). Identification of novel
GH-regulated pathway of lipid metabolism in adipose tissue: a gene expression study in hypopituitary men.
J Clin Endocrinol Metab 96, E1188-1196.
Zheng, W., McLerran, D.F., Rolland, B., Zhang, X., Inoue, M., Matsuo, K., He, J., Gupta, P.C., Ramadas,
K., Tsugane, S., et al. (2011). Association between body-mass index and risk of death in more than 1 million
Asians. N Engl J Med 364, 719-729.
Zhou, Y.C., and Waxman, D.J. (1999). Cross-talk between janus kinase-signal transducer and activator of
transcription (JAK-STAT) and peroxisome proliferator-activated receptor-alpha (PPARalpha) signaling
pathways. Growth hormone inhibition of pparalpha transcriptional activity mediated by stat5b. J Biol Chem
274, 2672-2681.
193
Zhou, Y.J., Chen, M., Cusack, N.A., Kimmel, L.H., Magnuson, K.S., Boyd, J.G., Lin, W., Roberts, J.L.,
Lengi, A., Buckley, R.H., et al. (2001). Unexpected effects of FERM domain mutations on catalytic activity
of Jak3: structural implication for Janus kinases. Mol Cell 8, 959-969.
Ziccardi, P., Nappo, F., Giugliano, G., Esposito, K., Marfella, R., Cioffi, M., D'Andrea, F., Molinari, A.M.,
and Giugliano, D. (2002). Reduction of inflammatory cytokine concentrations and improvement of
endothelial functions in obese women after weight loss over one year. Circulation 105, 804-809.
Zimmermann, R., Strauss, J.G., Haemmerle, G., Schoiswohl, G., Birner-Gruenberger, R., Riederer, M., Lass,
A., Neuberger, G., Eisenhaber, F., Hermetter, A., et al. (2004). Fat mobilization in adipose tissue is promoted
by adipose triglyceride lipase. Science 306, 1383-1386.
Zvonic, S., Cornelius, P., Stewart, W.C., Mynatt, R.L., and Stephens, J.M. (2003). The regulation and
activation of ciliary neurotrophic factor signaling proteins in adipocytes. J Biol Chem 278, 2228-2235.
194
Chapter IX: Permissions