in vivo and in vitro studies of cytosolic phospholipase a...

INFECTION AND IMMUNITY,0019-9567/01/$04.0010 DOI: 10.1128/IAI.69.9.5857–5863.2001

Sept. 2001, p. 5857–5863 Vol. 69, No. 9

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

In Vivo and In Vitro Studies of Cytosolic Phospholipase A2 Expressionin Helicobacter pylori Infection

GERARDO NARDONE,1* EILEEN L. HOLICKY,2 JAMES R. UHL,3 LINA SABATINO,4 STEFANIA STAIBANO,5

ALBA ROCCO,1 VITTORIO COLANTUONI,4 BARBARA A. MANZO,6 MARCO ROMANO,6

GABRIELE BUDILLON,1 FRANKLIN R. COCKERILL III,3

AND LAURENCE J. MILLER2

Department of Clinical and Experimental Medicine,1 Department of Biochemistry and Biothecnologie,4 and Departmentof Biomorphological and Functional Science, Pathology Unit,5 “Federico II” University of Naples, and

Gastroenterology Unit, Second University of Naples,6 Naples, Italy, and Center for BasicResearch in Digestive Diseases2 and Department of Laboratory Medicine and

Microbiology,3 Mayo Clinic and Foundation, Rochester, Minnesota

Received 13 October 2000/Returned for modification 20 February 2001/Accepted 11 June 2001

Modifications of mucosal phospholipids have been detected in samples from patients with Helicobacterpylori-positive gastritis. These alterations appear secondary to increased phospholipase A2 activity (PLA2). Thecytosolic form of this enzyme (cPLA2), normally involved in cellular signaling and growth, has been implicatedin cancer pathogenesis. The aim of this study was to investigate cPLA2 expression and PLA2 activity in thegastric mucosae of patients with and without H. pylori infection. In gastric biopsies from 10 H. pylori-positivepatients, cPLA2 levels, levels of mRNA as determined by reverse transcriptase PCR, levels of protein asdetermined by immunohistochemistry, and total PLA2 activity were higher than in 10 H. pylori-negativegastritis patients. To clarify whether H. pylori had a direct effect on the cellular expression of cPLA2, we studiedcPLA2 expression in vitro with different human epithelial cell lines, one from a patient with larynx carcinoma(i.e., HEp-2 cells) and two from patients with gastric adenocarcinoma (i.e., AGS and MKN 28 cells), incubatedwith different H. pylori strains. The levels of cPLA2, mRNA, and protein expression were unchanged in Hep-2cells independently of cellular adhesion or invasion of the bacteria. Moreover, no change in cPLA2 proteinexpression was observed in AGS or MKN 28 cells treated with wild-type H. pylori. In conclusion, our studyshows increased cPLA2 expression and PLA2 activity in the gastric mucosae of patients with H. pylori infectionand no change in epithelial cell lines exposed to H. pylori.

Helicobacter pylori infection of the gastric mucosa is presentworldwide and may be associated with several pathologic al-terations, including gastric cancer (30). The relationship be-tween this organism and the development of gastric cancer hasbeen postulated mainly on the basis of epidemiological inves-tigations and animal models of H. pylori infection (13, 15, 17,21, 39, 40, 53). This relationship is further supported by thefinding that some patients with H. pylori infection show thegenetic abnormalities of dysplasia and metaplasia in mucosalareas before the development of carcinoma (35, 50). However,the molecular mechanisms underlying the multistep process ofgastric carcinogenesis related to H. pylori infection remain un-defined (57).

It has been shown that H. pylori damages the gastric barrierfunction and induces a dramatic change in mucosal phospho-lipid composition (34). This is likely due to a local increase inphospholipase A2 (PLA2) activity (4, 27). The cytosolic form(cPLA2), but not the secretory form, of this enzyme is involvedin cellular signaling and growth (2, 25, 26, 28, 31, 38, 51) andhas recently been implicated in the pathogenesis of malignanttransformation (11, 22, 32, 48, 49, 55, 56). Furthermore, manyhuman tumors have been reported to exhibit increased synthe-

sis of prostaglandins, the formation of which is dependent onan increase in cPLA2 activity (16, 18, 19, 29).

In this study, we analyzed cPLA2 expression in gastric-mu-cosal biopsies from patients with chronic gastritis, with or with-out H. pylori infection. We showed increases in gastric levels ofboth cPLA2 mRNA and protein expression and an increase inPLA2 activity in H. pylori-positive patients with respect to lev-els in H. pylori-negative patients. However, cPLA2 expressionin a number of epithelial cell lines exposed to a variety ofH. pylori strains remained unchanged.

MATERIALS AND METHODS

Patients. Ten H. pylori-positive patients with duodenal ulcers and 10 H. pylori-negative patients with chronic gastritis, with ages ranging between 20 and 65years, were recruited. Entry criteria were the absence of antisecretory or antibi-otic drug therapy in the previous month, the absence of anticoagulant drugtherapy in the previous week, and the absence of severe associated diseases (suchas hepatic, renal, or cardiovascular diseases). During upper gastrointestinal en-doscopy, each patient had 12 biopsies taken from the gastric antrum. Fourbiopsies were fixed immediately in buffered formalin for morphological andimmunohistochemical examinations, four were stored frozen at 220°C until thetime of detection of PLA2 activity, and four were stored frozen at 280°C untilRNA extraction. Serum samples of each patient were stored frozen until thedetection of anti-CagA antibody by commercial Western blotting (Helico Blot2.0; Genelabs Diagnostics, Singapore). H. pylori status was assessed by the con-cordance of the results of a breath test and Giemsa staining. Histopathologicaldiagnosis by hematoxylin and eosin staining was performed according to theupdated Sidney system (12).

Informed consent was obtained from all subjects, and the protocol was ap-proved by the local ethics committee (University of Naples School of Medicine).

* Corresponding author. Mailing address: Dipartimento di Medi-cina Clinica e Sperimentale, Cattedra di Gastroenterologia, Universitadegli Studi di Napoli Federico II, Via Pansini 5, 80131 Naples, Italy.Phone: 39 081 7464293. Fax: 39 081 7462751. E-mail: [email protected].

5857

on May 22, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Cell culture. HEp-2 cells from a patent with human larynx carcinoma wereobtained from the American Type Culture Collection (ATCC CCL 23) and weregrown on tissue culture plasticware in basal Eagle’s medium supplemented withHanks’ salts, 50 mM L-glutamine, 0.075% sodium bicarbonate, and 15% fetalbovine serum (FBS; Sigma Chemical Co., S. Louis, Mo.). The cells were incu-bated at 37°C in 5% CO2 and with 99% humidity, as described previously (54).

Gastric epithelial cells derived from a patient with a poorly differentiatedhuman gastric adenocarcinoma (i.e., AGS cell line) (3) or from a patient with awell-differentiated human gastric adenocarcinoma (i.e., MKN 28 cell line) (44,45) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Life Technol-ogies Inc., Rockville, Md.) supplemented with 10% FBS and 1% antibiotic–antimycotic solution (Gibco BRL Laboratories, Grand Island, N.Y.) at 37°C in ahumidified atmosphere of 5% CO2 in air.

Bacterial infection. HEp-2 cells were incubated for 3 h with three differentH. pylori strains designated ATCC 51652 (obtained from a patient of the MayoClinic with severe active chronic gastritis and a duodenal ulcer), MC199 (ob-tained from a patient of the Mayo Clinic with a large gastric ulcer secondary toa carcinoid tumor), and MC31 (quality-control strain used for diagnostic testingat the Mayo Clinic) (54). Cells were also incubated with one strain of Shigellaflexneri (SW1) (obtained from a patient with clinically invasive disease) and, as areference, a noninvasive Escherichia coli strain (ATCC 35218). AGS or MKN 28cells were incubated from 3 to 18 h with H. pylori (ATCC 51652). For cocoltureexperiments, all bacterial strains were grown in 5% CO2 with 99% humidity for48 h on sheep blood agar. Just before use, the bacteria were harvested from theagar plate, washed in Gey’s solution, and resuspended at 1.5 3 108 to 3 3 108

cells/ml in antibiotic-free DMEM supplemented with 10% FBS or Eagle’s me-dium supplemented with 15% FBS as appropriate.

PLA2 activity. Total PLA2 activity was calculated according to the release ofarachidonic acid in a reaction mixture containing [3H]arachidonate-labeledE. coli membranes (about 30,000 cpm), 40 mmol of Tris-HCl buffer (pH 7.5),5 mmol of CaCl2, and 20 mg of gastric-mucosa proteins. The reaction mixture wasincubated at 37°C in a shaking water bath for 3 h, and the reaction was stoppedby the addition of methanol-chloroform (2/1, vol/vol). Lipids were extractedaccording to the Bligh and Dyer procedure (6) and separated by thin-layerchromatography. Radiolabeled products were identified with a radioactivityscanner, scraped off, and counted with a liquid scintillation counter, and theirradioactivities are expressed as percentages of the total radioactivity.

Preliminary experiments with different amounts of proteins, labeled substrates,and incubation times were performed to set up optimal conditions (data not shown).

RT-PCR of human biopsies. The gastric biopsy specimens were homogenized,and total RNA was extracted using TRIzol reagent (Gibco BRL Laboratories).The quantity and quality of extracted total RNA were analyzed on denaturing1% agarose gel. Subsequently, first-strand complementary DNA was synthesizedusing 1 mg of RNA and 200 U of reverse transcriptase (RT) (SuperScript RT;Gibco BRL). The reaction profile was 37°C for 10 min, followed by 42°C for 60min. To control for contamination by genomic DNA, all RNA samples were runin duplicate with and without the addition of RT. Aliquots of the cDNAs werePCR coamplified simultaneously with the following specific primers for cPLA2

and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internalcontrol: for cPLA2, 59 CTCATGCCCAGACCTACGATT 39 (forward) and59 TAATACGACTCACTATAGGGCGTCAGGTTTGAC 39 (reverse), and forGAPDH, 59 CACCATCTTCCAGGAGCCAG 39 (forward) and 59 TCACGCCACAGTTTCCCGGA 39 (reverse).

PCR conditions were as follows: denaturation at 94°C for 1 min, annealing at53°C for 1 min, and extension at 72°C for 1 min. The reaction proceeded for 32cycles; the GAPDH primers were added to the reaction mixture after 10 cycles.At the end of the process, a 10-min extension step was included. The amplifica-tion conditions were established to obtain the linear reaction necessary forsemiquantitative analysis. The amplified products were quantified by densito-metric scanning, and the intensities of cPLA2 bands were related to that ofGAPDH in each sample.

Immunohistochemistry. For each sample, 4-mm-thick serial sections from par-affin blocks were cut, dewaxed, and rehydrated. The endogenous peroxidase wasinhibited by incubation with 3% H2O2 in methanol (20 min at room tempera-ture). To reduce nonspecific background staining, the slides were incubated with5% goat serum (15 min at room temperature). To enhance immunostaining,sections were treated with an antigen retrieval solution (10 mM citric acidmonohydrate [pH 6.0], adjusted with 2 N NaOH) and heated three times in amicrowave oven at high power for 5 min. Finally, the slides were incubatedovernight at 4°C in a moist chamber with a mouse anti-human cPLA2 monoclo-nal antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.; dilution, 1:100). Theavidin-biotin-peroxidase complex procedure (ABC standard; Vector Laborato-ries, Burlingame, Calif.) was then performed according to the method of Hsu

et al. (20). Peroxidase activity was detected with diaminobenzidine as the sub-strate. Finally, sections were weakly counterstained with Harris’ hematoxylin andmounted with a synthetic medium was used as a coverslip. Two independentapproaches were used to confirm the specificity of the immunohistochemicalsignal: (i) serial dilution of the primary antibody was carried out until the signaldisappeared and (ii) nonimmune mouse immunoglobulin G (IgG) was usedinstead of primary antibody, which failed to reveal relevant staining.

A case of colon adenocarcinoma was used as a positive control. Sections wereconsidered positively stained only when the relevant cytoplasmic staining forcPLA2 was unequivocal.

The degree of immunopositivity was evaluated semiquantitatively. A total of400 cells was counted in random fields from representative areas of the lesions,and the immunoreactive cells were roughly assessed, expressed as percentages,and scored as follows: when 0 to 5% of cells were reactive, they were considerednegative; when 5 to 25% of cells were reactive, they were considered to have lowpositivity; when 25 to 50% of cells were reactive, they were considered to havemoderate positivity; and when .50% of cells were reactive, they were consideredto have high positivity.

Northern blot analysis from cultured HEp-2 cells. Total RNA from eitheruntreated HEp-2 cells or HEp-2 cells treated for 3 h with three different strainsof H. pylori, one strain of S. flexneri, and one strain of E. coli was extracted usingTRIzol reagent. The amount and quality of RNA extracted were evaluated byethidium bromide staining after running a denaturing agarose gel. For eachsample, 20 mg of RNA was loaded onto a denaturing 1.2% agarose gel andsubsequently blotted onto a nylon membrane (Hybond; Amersham). After 4 h ofprehybridization, hybridization was carried out using the radioactively labeledPCR products corresponding to cPLA2. To normalize the amount of RNAloaded in each lane, the same filter was hybridized with a GAPDH probe,obtained by radioactive labeling of the 360-bp PCR product. The bands obtainedby autoradiography were densitometrically scanned, and the intensities of thecPLA2 bands were related to that of GAPDH.

Western blot analysis. HEp-2, AGS, or MKN 28 cells either not exposed orexposed to bacterial strains were lysed with a modified radioimmunoprecipita-tion assay buffer in the presence of protease inhibitors and freshly preparedphenylmethylsulfonyl fluoride. Protein concentration was determined by a mod-ified Bradford method (Biorad assay kit) using bovine serum albumin as thestandard. Equivalent amounts of protein (25 mg) were loaded in each lane andseparated by electrophoresis on sodium dodecyl sulfate–7.5% polyacrylamidegels. After electrophoresis for 150 min at 94 V, the proteins were electroblottedto a nitrocellulose membrane at 22 V.

The cPLA protein was identified using a specific mouse anti-human cPLA2

monoclonal antibody (diluted 1/1,000; Santa Cruz) as the primary antibody andan anti-mouse IgG antibody (diluted 1/5,000) as the secondary antibody. Visu-alization was obtained with an ECL kit (Amersham Pharmacia Biotechnology).

Acridine orange internalization assay. HEp-2 cells were trypsinized, washed inFBS, and counted. Approximately 106 cells were placed in each well of a Lab-TekPermanox chamber slide (Nunc, Inc., Naperville, Ill.) with 100 ml of BME andincubated overnight to allow cells to attach. One hundred-microliter aliquots ofthe bacterial suspension (1.5 3 108 to 3 3 108 cells/ml) were added to chamberwells of duplicate slides and incubated for 3 h. After incubation, the chambers weregently washed three times with Hanks’ balanced salt solution (HBSS) to remove anybacteria not adhering to the HEp-2 cells, and the chambers were thus removed.

Cells on the chamber slides were stained with 0.01% acridine orange in Gey’ssolution for 45 s at room temperature and washed with HBSS. The cells werethen stained with 0.05% crystal violet in 0.155 M NaCl for 45 s and washed withHBSS. Crystal violet does not penetrate the HEp-2 cells and cannot quenchinternalized acridine orange-stained bacteria. The slides were examined at amagnification of 31,000 with switching between fluorescent and phase-contrastoptics. In each well, 50 HEp-2 cells were examined to determine the number withvisible adherent and internalized bacteria.

Northern and Western analyses and an acridine orange internalization assaywere performed in triplicate for each bacterial isolate, and the means andstandard deviations were determined.

Statistical analysis. The unpaired t test was used to compare RT-PCR levelsof cPLA2 and PLA2 activities in H. pylori-positive and H. pylori-negative patients.The differences in the densitometric values of Northern and Western blot anal-yses were evaluated by a one-way analysis of variance test.

RESULTS

In vivo studies. The H. pylori-negative patients had non-active chronic gastritis; of these, four had mild or moderate

5858 NARDONE ET AL. INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

atrophy restricted to the antrum. The H. pylori-positive pa-tients had mild or moderate active gastritis associated withpeptic disease; 6 out of 10 showed mild-to-moderate atrophypredominantly restricted to the antrum. Positivity for anti-CagA antibody, detected by serum Western blot analysis, waspresent in 7 out of 10 H. pylori-positive patients.

The inflammatory infiltrate consisted of neutrophils and

lymphocytes in H. pylori-positive patients and lymphocytes inH. pylori-negative patients.

Semiquantitative RT-PCR was performed by coamplifyingcPLA2 with GAPDH as an internal control. The results of theanalysis of two bands of 360 and 570 bp, corresponding toGAPDH and cPLA2, respectively, are shown at the top of Fig.1. The intensities of the bands were quantified by densitomet-ric scanning, and the relative ratio of the intensity of the cPLA2

band to that of the GAPDH band was determined and isreported in the histogram at the bottom of Fig. 1. The bandscorresponding to cPLA2 in H. pylori-positive patients were two-or threefold more intense than those in H. pylori-negative sub-jects (P , 0.001).

The immunohistochemical expression of cPLA2 showed arelevant cytosolic positivity (in the Golgi and cytoplasmic pat-terns) that was restricted to epithelial cells only in the samplesfrom H. pylori-infected patients (Fig. 2); H. pylori-negative pa-tients showed only focal cPLA2 immunoreactivity in a Golgipattern (Fig. 3). No immunoreactivity for cPLA2 was observedwhen nonimmune mouse IgG was used as the primary anti-body (data not shown).

Total PLA2 activity, calculated as a percentage of arachi-donic acid released, was significantly higher in H. pylori-posi-tive than in H. pylori-negative patients (61.1% 6 7.9% versus32.9% 6 6.6% P , 0.001) (Fig. 4).

In vitro studies. To assess whether H. pylori directly affectedcPLA2 expression under conditions independent of systemicfactors, we used an in vitro system consisting of HEp-2 cellsexposed to different H. pylori strains. We also used S. flexeneriand E. coli to assess whether any effect on cPLA2 expressionwas specifically related to H. pylori. No significant difference inthe level of cPLA2 mRNA expression was found in cells

FIG. 1. Expression of cPLA2 determined by RT-PCR analysis invivo. Shown is a representative RT-PCR analysis of cPLA2 performedon gastric-mucosal specimens from patients with chronic gastritis whowere infected (n 5 5) and not infected (n 5 5) with H. pylori. GAPDHexpression was used as the internal control. The sizes of the amplifiedbands of 570 and 360 bp are indicated at the side. The histogram at thebottom reports the densitometric values of the cPLA2/GAPDH ratiosgrouped by H. pylori status (unpaired t test, P , 0.001).

FIG. 2. Immunohistochemical expression of cPLA2. Shown is a tissue section from a patient with H. pylori-positive chronic gastritis showingstrong, definite immunostaining for cPLA2 and Golgi and cytoplasmic patterns, with sporadic membrane reinforcement of the signal (ABCstandard; magnification, 3400).

VOL. 69, 2001 cPLA2 EXPRESSION AND H. PYLORI INFECTION 5859


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

treated with H. pylori or other bacterial strains with respect tothat in control, untreated cells (Fig. 5). To correlate the steady-state mRNA levels obtained with the levels of cPLA2 proteinexpression, Western blot analysis was performed. As shown inFig. 6, a band corresponding to a protein with an apparentmolecular mass of 110 kDa was detected. Similarly to theresults with mRNA previously shown, the intensity of this banddid not change, whatever the invasiveness of the bacteria in thecoculture system. To examine adherence and internalization ofthe bacterial strains, HEp-2 cells were studied both morpho-logically and by the acridine orange assay (54). Three hoursafter infection, the percentage of HEp-2 cells associated withor invaded by each of the bacterial strains was determined. Theresults are shown in Table 1 and indicate that two of theH. pylori strains (ATCC 51652 and MC199) demonstrated sub-stantial cellular invasion (98 and 12%, respectively) and asso-ciation (100 and 74%, respectively) of HEp-2 cells. H. pyloristrain MC31 and S. flexneri strain SW1 adhered to cells (34 and24% of cells, respectively) and invaded cells to a lesser degree(with both strains invading 6% of cells). No adherence orpenetration of HEp-2 cells was observed for the E. coli strainused (ATCC 35218).

To rule out cell line-specific abnormalities, we also studiedthe role of H. pylori in cPLA2 protein expression by Westernblot analysis of human gastric epithelial cells derived frompoorly differentiated (i.e., AGS cells) or well-differentiated(i.e., MKN 28 cells) gastric adenocarcinomas. The incubationof AGS or MKN 28 cells with wild-type H. pylori for up to 18h did not exert any significant effect on cPLA2 protein expres-sion compared with that in control untreated cells (Fig. 7).

DISCUSSION

PLA2 is an important enzyme and is expressed in severaltypes of human cells (1, 22, 24, 25, 28, 31, 37). This wide dis-

tribution has been correlated with the important role it plays inseveral metabolic pathways, particularly the transduction ofcell growth signals (2, 25, 26, 28, 31, 38, 46, 51). The expressionof cPLA2 in cells of the intestinal tract has been thoroughlyinvestigated (23, 36) and has also been correlated with thedevelopment of several inflammatory diseases (7, 41, 51, 52).Studies with cellular systems have shown that the increase incellular eicosanoid production, promoted by cytokines andagents causing cell damage, is at least in part due to the acti-

FIG. 3. Immunohistochemical expression of cPLA2. Shown is a tissue section from a patient with H. pylori-negative chronic gastritis showingonly a focal positivity for cPLA2 in glandular epithelial cells, with a Golgi distribution pattern (avidin-biotin-peroxidase complex standard;magnification, 3400).

FIG. 4. PLA2 activity. Total PLA2 activity was calculated as a per-centage of the amount of arachidonic acid released in H. pylori-positive(■, anti-CagA positive) and H. pylori-negative (h) patients (unpairedt test; P , 0.001).



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

vation of cPLA2 and the elevation of its cellular levels (18, 19,29). It has also been found that cPLA2 is a target of antiin-flammatory glucocorticoid drugs that attenuate eicosanoid syn-thesis in a number of different cell types (33). Substantialevidence thus indicates that cPLA2 may be an important com-ponent in the cascade of events leading to the production ofthe proinflammatory and injurious mediators of disease states(7, 52). Moreover, elevated eicosanoid production has beenobserved in a number of tumor cells and is likely to contributeto the altered growth conditions leading to cell transformation(18). In line with this evidence are the results of studies inwhich cPLA2 levels have been correlated with the activation ofRas, a protooncogene with well-established involvement intumorigenesis and metastasis in several animal and humanmodel systems (9, 14, 16). This study was undertaken to inves-tigate cPLA2 tissue levels and activity in gastric mucosa in-fected with H. pylori and to assess whether any such increasemight reflect the invasive nature of the organism. The resultsreported in this study show that in human gastric mucosalbiopsies the levels of mRNA and protein expression of cPLA2

were higher in H. pylori-positive patients than in H. pylori-negative patients (Fig. 1 to 3). Moreover, we found an increasein PLA2 enzymatic activity in H. pylori-infected gastric mucosacompared with that in noninfected mucosa (Fig. 4). This is inagreement with a recent report by Pomorski et al., who foundthat activation of cPLA2 was responsible for the increasedproduction of PGE2 and arachidonic acid in AGS cells ex-posed to H. pylori in vitro (42).

An increase in the expression of cPLA2 has been described

FIG. 5. cPLA2 mRNA expression in HEp-2 cells in vitro. Northernblot analysis was carried out on total RNA extracted from HEp-2 cellseither not infected or infected with the various bacterial strains indi-cated. The top panel shows a representative autoradiograph fromthree experiments, with the bands corresponding to cPLA2 mRNA (20mg of RNA was loaded in each lane). The histogram in the bottompanel reports the means 6 standard deviations of the densitometricvalues of the cPLA2/GAPDH ratios obtained from three independentexperiments. Hp-MC31, H. pylori quality-control strain used for diag-nostic testing at the Mayo Clinic; Hp-ATCC 51652, H. pylori strainobtained from a patient of the Mayo Clinic with severe active chronicgastritis and a duodenal ulcer; Hp-MC199, H. pylori strain obtainedfrom a patient of the Mayo Clinic with a large gastric ulcer secondaryto a carcinoid tumor; Shigella-SW1, strain obtained from a patient withclinically invasive disease; E. coli-ATCC 35218, a noninvasive bacte-rium.

FIG. 6. Expression of cPLA2 protein in HEp-2 cells in vitro. West-ern blot analysis was performed on cell lysates (25 mg) from HEp-2cells either mock infected (control) or infected with the bacterialstrains indicated. The top panel shows a representative autoradiographfrom three experiments; the band corresponds to cPLA2, and theprotein migrates with an apparent molecular mass of 110 kDa. Thehistogram at the bottom reports the mean 6 standard deviation ofdensitometric values for the cPLA2 bands obtained from three inde-pendent experiments. Hp-MC31, H. pylori quality-control strain usedfor diagnostic testing at the Mayo Clinic; Hp-ATCC 51652, H. pyloristrain obtained from a patient of the Mayo Clinic with severe activechronic gastritis and a duodenal ulcer; Hp-MC199, H. pylori strainobtained from a patient of the Mayo Clinic with a large gastric ulcersecondary to a carcinoid tumor; Shigella-SW1, strain obtained from apatient with clinically invasive disease; E. coli-ATCC 35218, a nonin-vasive bacterium.

TABLE 1. Cellular association and invasion by bacteria

Bacterial strain

% of HEp-2 cells showing:

Cellular associationwith bacteria

Cellular invasionby bacteria

H. pylori ATCC 51652 100 98H. pylori MC199 74 12H. pylori MC31 34 6S. flexneri SW1 24 6E. coli ATCC 35218 0 0



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

to occur in a variety of tumors of the gastrointestinal tract (11,22, 31, 48, 49, 55, 56). Therefore, our finding suggests thatcPLA2 up-regulation may play a role in the developmentof H. pylori-related gastric cancer. In partial support of thishypothesis, we observed by immunohistochemistry enhancedcPLA2 positivity in metaplastic areas of patients with H. pylori-positive gastritis and in patients with gastric adenocarcinoma(data not shown). To investigate whether up-regulation ofcPLA2 expression was directly related to H. pylori infection andbacterial invasiveness, we set up an in vitro model systemconsisting of HEp-2 cells exposed to H. pylori cell suspensions.The Hep-2 cell line has been extensively used to assess theeffects of H. pylori in epithelial cells in vitro (43, 54). Usingseveral H. pylori and other bacterial strains with a wide spec-trum of invasiveness, we demonstrated cellular adhesion andinvasion. However, we did not detect any change in eithercPLA2 mRNA or protein levels (Fig. 5 to 6), even when longerincubation times were used. The longer incubation times fre-quently resulted in HEp-2 lysis and the lifting of the HEp-2monolayers (unpublished observation). We therefore concludethat infection of Hep-2 cells by H. pylori as well as by otherbacterial strains does not promote cPLA2 expression.

To exclude cell line-specific effects, we studied cPLA2 pro-tein expression in AGS or MKN 28 gastric epithelial cellstreated with a wild-type H. pylori strain and found no signifi-cant change versus what occurred in control, untreated cells.Based on these results, we postulate that systemic events spe-cifically related to H. pylori infection, such as inflammatoryreaction and host immune response, are needed for the up-regulation of cPLA2 to occur in vivo (5, 8, 10).

The increased cPLA2 activity described by Pomorski et al. inAGS cells exposed to H. pylori is not in contrast with the resultsof our in vitro studies. In fact, an increase in cPLA2 activitymay occur through mechanisms independent of up-regulationof cPLA2 expression, e.g., in the intracellular calcium-medi-ated pathway (25, 28, 47).

In conclusion, our study shows that cPLA2 expression andPLA2 activity are up-regulated in patients with H. pylori gas-tritis. The increase in cPLA2 expression in vivo but not in vitro

suggests that systemic events specifically related to H. pyloriinfection may play a role in this up-regulation. We postulatethat up-regulation of cPLA2 might be involved in the cascadeof H. pylori-related events implicated in gastric carcinogenesis.

REFERENCES

1. Ackermann, E. J., E. S. Kempner, and E. A. Dennis. 1994. Ca21-independentcytosolic phospholipase A2 from macrophage-like p388D1 cells. J. Biol.Chem. 269:9227–9233.

2. Amandi-Burgermeister, E., U. Tibes, B. M. Kaiser, W. G. Friebe, and W. V.Scheuer. 1997. Suppression of cytokine synthesis, integrin expression andchronic inflammation by inhibitors of cytosolic phospholipase A2. Eur.J. Pharmacol. 326:237–250.

3. Barranco, S. C., C. M. Townsend, Jr., C. Casartelli, B. G. Macik, N. L.Burger, W. R. Boerwinkle, and W. K. Gourley. 1983. Establishment andcharacterization of an in vitro model system for human adenocarcinoma ofthe stomach. Cancer Res. 43:1703–1709.

4. Berstad, K., R. Sjodahl, and A. Berstad. 1994. Phosholipase A2 activity ingastric juice from patients with active and H. pylori-eradicated healed duo-denal ulcer. Aliment Pharmacol. Ther. 8:175–180.

5. Blaser, M. J. 1992. Hypothesis on the pathogenesis and natural history ofHelicobacter pylori-induced inflammation. Gastroenterology 107:720–727.

6. Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipid extractionand purification. Can. J. Biochem. Physiol. 37:911–917.

7. Bomalaski, J. S., M. Fallon, R. A. Turner, S. T. Crooke, P. C. Meunier, andM. A. Clark. 1990. Identification and isolation of phospholipase A2 activatingprotein in human rheumatoid arthritis synovial fluid: induction of eicosanoidsynthesis and an inflammatory response in joints injected in vivo. J. Lab.Clin. Med. 116:814–825.

8. Crabtree J. E. 1996. Gastric mucosal inflammatory response to Helicobacterpylori. Aliment Pharmacol. Ther. 10:29–37.

9. Davis, T. W., E. R. Boghaert, C. J. Guthridge, M. R. Steiner, and S. G.Zimmer. 1977. The effect of group II phospholipase A2 on RAS-inducedmetastasis, p. 9–17. In K. V. Honn (ed.), Eicosanoids and other bioactivelipids in cancer, inflammation and radiation injury. Plenum Press, New York,N.Y.

10. D’Elios, M. M., M. Manghetti, M. De Carli, F. Costa, C. T. Baldari, D.Burroni, J. L. Telford, S. Romagnani, and G. Del Prete. 1997. Th1 effectorcells specific for Helicobacter pylori in the gastric antrum of patients withpeptic ulcer disease. J. Immunol. 158:962–967.

11. Dimberg, J., A. Samuelsson, A. Hugander, and P. Soderkvist. 1988. Geneexpression of cyclooxygenase-2, group II and cytosolic phospholipase A2 inhuman colorectal cancer. Anticancer Res. 18:3283–3287.

12. Dixon, M. F., R. M. Genta, J. H. Yardley, P. Correa, and the participants inthe International Workshop on the Histopathology of Gastritis, Houston1994. 1996. Classification and grading of gastritis. Am. J. Surg. Pathol. 20:1161–1118.

13. The Eurogast Study Group. 1993. An international association betweenHelicobacter pylori infection and gastric cancer. Lancet 341:1359–1362.

14. Field, J. K., and D. A. Spandidos. 1990. The role of ras and myc oncogenesin human solid tumors and their relevance on diagnosis and prognosis.Anticancer Res. 10:1–22

FIG. 7. Expression of cPLA2 protein in AGS and MKN 28 cells in vitro. Western blot analysis was performed on cell lysates (25 mg) from AGSand MKN 28 cells incubated for 3, 6, or 18 h with H. pylori strain ATCC 51652 (obtained from a patient of the Mayo Clinic with severe activechronic gastritis and a duodenal ulcer) or with serum-free DMEM supplemented with 10% FBS (control). A representative autoradiograph fromthree independent experiments showing a cPLA2-immunoreactive band with an apparent molecular mass of 110 kDa is shown.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

15. Forman, D., D. G. Newell, and F. Fullerton. 1991. Association betweeninfection with Helicobacter pylori and risk of gastric cancer: evidence fromprospective investigation. BMJ 302:1302–1305.

16. Heasly, L. E., S. Thaler, M. Nicks, B. Price, K. Skorecki, and R. A. Nemenoff.1997. Induction of cytosolic phospholipase A2 by oncogenic ras in humannon-small cell lung cancer. J. Biol. Chem. 272:14501–14504.

17. Honda, S., T. Fujioka, M. Tokieda, A. Nishizono, and M. Nasu. 1998. De-velopment of Helicobacter pylori-induced gastric carcinoma in Mongoliangerbils. Cancer Res. 58:4255–4259.

18. Honn, K. V., R. S. Bockman, and L. J. Marnett. 1981. Prostaglandin andcancer: a review of tumor initiation through tumor metastasis. Prostaglan-dins 21:833–864.

19. Hori, T., S. Shibamoto, and M. Hayakawa. 1993. Stimulation of prostaglan-din production by hepatocyte growth factor in human gastric carcinoma cells.FEBS Lett. 334:331–334.

20. Hsu, S. M., L. Raine, L. Faine, and H. Fanger. 1981. Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase technique: a comparisonbetween ABC and unlabeled antibody (PAP) procedures. J. Histochem.Cytochem. 29:577–580.

21. International Agency for Research on Cancer Working Group on the Eval-uation of Carcinogenic Risks to Humans. 1994. Helicobacter pylori, p. 177–240. In Schistosomes, liver flukes, and Helicobacter pylori: views and expertopinions of an IARC Working Group on the Evaluation of CarcinogenicRisks to Humans. IARC, Lyon, France.

22. Kiyohara, H., H. Egami, H. Kako, Y. Shibata, K. Murata, S. Ohshima, K.Sei, S. Suko, R. Kurano, and M. Ogawa. 1993. Immunohistochemical local-ization of group II phospholipase A2 in human pancreatic carcinomas. Int. J.Pancreatol. 13:49–57.

23. Kiyohara, H., H. Egami, Y. Shibata, K. Murata, S. Ohshima, and M. Ogawa.1992. Light microscopy immunohistochemical analysis of the distribution ofgroup II phospholipase A2 in human digestive organs. J. Histochem. Cyto-chem. 40:1659–1664.

24. Kramer, R. M., E. F. Roberts, J. V. Manetta, J. R. Sportsman, and J. A.Jakubowski. 1993. Ca21-sensitive cytosolic phospholipase A2 (cPLA2) inhuman platelets. J. Lipid Mediat. 6:209–216.

25. Kramer, R. M., and J. D. Sharp. 1997. Structure, function and regulation ofCa21-sensitive cytosolic phopspholipase A2 (cPLA2). FEBS Lett. 410:49–53.

26. Kuwata, H., Y. Nakatani, M. Murakami, and I. Kudo. 1998. Cytosolic phos-pholipase A2 is required for cytokine-induced expression of type IIA secre-tory phospholipase A2 that mediates optimal cyclooxygenase-2-dependentdelayed prostaglandin E2 generation in rat 3Y1 fibroblasts. J. Biol. Chem.273:1733–1740.

27. Langton, S. R., and S. D. Cesareo. 1992. Helicobacter pylori-associated phos-pholipase A2 activity: a factor in peptic ulcer production? J. Clin. Pathol.45:221–224.

28. Mansbach, C. M., II. 1990. Phospholipases: old enzymes with new meaning.Gastroenterology 98:1369–1382.

29. Marnett, L. J. 1992. Aspirin and the potential role of prostaglandins in coloncancer. Perspectives in cancer research. Cancer Res. 52:5575–5589.

30. Marshall, B. J. 1994. Helicobacter pylori. Am. J. Gastroenterol. 89:116–128.31. Mukherjee, A. B., L. Miele, and N. Pattabiraman. 1994. Phospholipase A2

enzymes: regulation and physiological role. Biochem. Pharmacol. 48:1–10.32. Murata, K., H. Egami, H. Kiyohara, S. Oshima, T. Kurizaki, and M. Ogawa.

1993. Expression of group-II phospholipase A2 in malignant and non-malig-nant human gastric mucosa. Br. J. Cancer 68:103–111.

33. Nakano, T., O. Ohara, H. Teraoka, and H. Arita. 1990. Glucocorticoidssuppress group II phospholipase A2 production by blocking mRNA synthesisand post-transcriptional expression. J. Biol. Chem. 265:12745–12748.

34. Nardone, G., F. P. D’Armiento, G. Corso, P. Coscione, and G. Budillon.1994. Lipids of human gastric mucosa: effect of Helicobacter pylori infectionand non alcoholic cirrhosis. Gastroenterology 107:362–368.

35. Nardone, G., S. Staibano, A. Rocco, E. Mezza, F. P. D’Armiento, L. Insabato,A. Coppola, G. Salvatore, A. Lucariello, N. Figura, G. De Rosa, and G.Budillon. 1999. Effect of Helicobacter pylori infection and its eradication oncell proliferation, DNA status, and oncogene expression in patients withchronic gastritis. Gut 44:789–799.

36. Nevalainen, T., J. M. Gronroos, and M. Kallajoki. 1995. Expression of groupII phospholipase A2 in the human gastrointestinal tract. Lab. Investig. 72:201–208.

37. Nevalainen, T. J., F. Marki, P. T. Kortesuo, M. G. Grutter, S. Di Marco, andA. Shmitz. 1993. Synovial type (group II) phospholipase A2 in cartilage.J. Rheumatol. 20:325–330.

38. Nishizuka, Y. 1992. Intracellular signaling by hydrolysis of phospholipids andactivation of protein kinase C. Science 258:607–614.

39. Nomura, A., G. N. Stemmermann, P. H. Chyou, I. Kato, G. Perez-Perez, andM. J. Blaser. 1991. Helicobacter pylori infection and gastric carcinoma amongJapanese Americans in Hawaii. N. Engl. J. Med. 325:1132–1136.

40. Parsonnet, J., G. D. Friedman, N. Oremtreich, and H. Vogelman. 1997. Riskfor gastric cancer in people with CagA positive or CagA negative Helicobac-ter pylori infection. Gut 40:297–301.

41. Peterson, J. W., W. D. Dickey, S. S. Saini, W. Gourley, G. R. Klimpel, andA. K. Chopra. 1996. Phospholipase A2 activating protein and idiopathicinflammatory bowel disease. Gut 39:698–704.

42. Pomorski, T., T. F. Meyer, and M. Naumann. 2001. Helicobacter pylori-induced prostaglandin E2 synthesis involves activation of cytosolic phospho-lipase A2 in epithelial cells. J. Biol. Chem. 5:804–810.

43. Ricci, V., A. Galmiche, A. Doye, V. Necchi, E. Solcia, and P. Boquet. 2000.High cell sensitivity to Helicobacter pylori VacA toxin depends on a GPI-anchored protein and is not blocked by inhibition of the clathrin-mediatedpathway of endocytosis. Mol. Biol. Cell 11:3897–3909.

44. Romano, M., M. Razandi, S. Sekhon, W. J. Krause, and K. J. Ivey. 1988.Human cell line for the study of damage to gastric epitelial cells in vitro.J. Lab. Clin. Med. 111:430–440.

45. Romano, M., V. Ricci, A. Memoli, C. Tuccillo, A. Di Popolo, P. Sommi, A. M.Acquaviva, C. Del Vecchio Blanco, C. B. Bruni, and R. Zarrilli. 1998. Heli-cobacter pylori up-regulates cyclooxygenase-2 mRNA expression and prosta-glandin E2 synthesis in MKN 28 gastric mucosal cells in vitro. J. Biol. Chem.273:28560–28563.

46. Sharp, J. D., and D. White. 1993. Cytosolic PLA2: mRNA levels and poten-tial for transcriptional regulation. J. Lipid Mediat. 8:183–189.

47. Shier, W. T. 1979. Activation of high levels of endogenous phospholipase A2

in cultured cells. Proc. Natl. Acad. Sci. USA 76:195–199.48. Soydan, A. S., J. D. Gaffen, P. K. Weech, N. M. Tremblay, S. Kargman, G.

O’Neil, A. Bennett, and I. A. Tavares. 1997. Cytosolic phospholipase A2,cyclooxygenases and arachidonate in human stomach tumors. Eur. J. Cancer33:1508–1512.

49. Soydan, A. S., I. A. Tavares, P. K. Weech, N. M. Tremblay, and A. Bennett.1996. High molecular weight phospholipase A2 and fatty acid in human colontumours and associated normal tissue. Eur. J. Cancer 32A:1781–1787.

50. Tahara, E. 1993. Molecular mechanism of stomach carcinogenesis. J. CancerRes. Clin. Oncol. 119:265–272.

51. Takakuwa, T., S. Endo, K. Inada, T. Kasai, Y. Yamada, and M. Ogawa. 1997.Assessment of inflammatory cytokines, nitrate/nitrite, type II phospholipaseA2, and soluble adhesion molecules in systemic inflammatory response syn-drome. Res. Commun. Mol. Pathol. Pharmacol. 98:43–52.

52. Vadas, P., J. Browning, J. Edelson, and W. Pruzanski. 1993. Extracellularphospholipase A2 expression and inflammation: the relationship with asso-ciated disease states. J. Lipid Mediat. 8:1–30.

53. Watanabe, T., M. Tada, H. Nagai, S. Sasaki, and M. Nakao. 1998. Helico-bacter pylori infection induces gastric cancer in Mongolian gerbils. Gastro-enterology 115:642–648.

54. Wilkinson, S. M., J. R. Uhl, B. C. Kline, and F. R. Cockerill III. 1998.Assessment of invasion frequencies of cultured HEp-2 cells by clinical iso-lates of Helicobacter pylori using an acridine orange assay. J. Clin. Pathol.51:127–133.

55. Yamashita, S., M. Ogawa, T. Abe, J. Yamashita, K. Sakamoto, H. Niwa, andK. Yamamura. 1994. Group II phospholipase A2 in invasive gastric cancercell line is induced by interleukin 6. Biochem. Biophys. Res. Commun.198:878–884.

56. Yamashita, S., J. Yamashita, K. Sakamoto, K. Inada, Y. Nakashima, K.Murata, T. Saishoji, K. Nomura, and M. Ogawa. 1993. Increased expressionof membrane-associated phospholipase A shows malignant potential of hu-man breast cancer cells. Cancer 71:3058–3064.

57. Zarrilli, R., V. Ricci, and M. Romano. 1999. Molecular response of gastricepithelial cells to Helicobacter pylori-induced cell damage. Cell. Microbiol.1:93–99.

Editor: B. B. Finlay



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

in vivo and in vitro studies of cytosolic phospholipase a...

Documents