in vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 ›...

282
In vitro and in vivo regulation of pro-inflammatory cytokines and drug efflux transporters by signal transduction pathways in glial cells: implications in HIV-1 neuropathogenesis and its treatment by Tamima Ashraf A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Graduate Department of Pharmaceutical Sciences Leslie Dan Faculty of Pharmacy University of Toronto © Copyright by Tamima Ashraf, 2015

Upload: others

Post on 06-Jun-2020

2 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

In vitro and in vivo regulation of pro-inflammatory

cytokines and drug efflux transporters by signal transduction

pathways in glial cells: implications in HIV-1 neuropathogenesis

and its treatment

by

Tamima Ashraf

A thesis submitted in conformity with the requirements

for the degree of Doctor of Philosophy

Graduate Department of Pharmaceutical Sciences

Leslie Dan Faculty of Pharmacy

University of Toronto

© Copyright by Tamima Ashraf, 2015

Page 2: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

ii

In vitro and in vivo regulation of pro-inflammatory cytokines and drug efflux transporters

by signal transduction pathways in glial cells: implications in HIV-1 neuropathogenesis and

its treatment

Tamima Ashraf

Doctor of Philosophy

Graduate Department of Pharmaceutical Sciences

University of Toronto

2015

Abstract

Cognitive impairment remains highly prevalent in human immunodeficiency virus-1 (HIV-1)

infected patients due to viral replication and associated brain inflammation. One obstacle to

effective treatment is poor penetration of antiretroviral drugs across blood-brain barrier (BBB)

and into HIV-1 brain cellular targets (microglia, astrocytes) due to functional expression of

efflux transporters [P-glycoprotein (P-gp), Multidrug resistance-associated proteins (MRPs),

breast cancer resistance protein (BCRP)]. Identifying therapeutic compounds that are not

substrates of these transporters but target signaling pathways involved in inflammation may

benefit treatment of HIV-associated neurological complications. The aim of this PhD project

was: i) to investigate signaling pathways involved in the regulation of Mrp1 and P-gp in cultured

rat/human astrocytes triggered with HIV-1 glycoprotein 120 (gp120) or cytokines, ii) to

implement and characterize an in vivo model of gp120-associated brain inflammation, iii) to

assess the efficacy of chloroquine, minocycline and simvastatin in reversing brain inflammation

in vivo and iv) to elucidate key signaling pathways involved in gp120-associated brain

inflammation in vivo. We demonstrated that gp120-associated TNF-α release resulted in

increased Mrp1 functional expression in primary cultures of rat astrocytes and both c-jun N-

terminal kinase (JNK) and nuclear factor-кB (NF-κB) pathways were involved. In human

astrocytes, we demonstrated decreased P-gp expression following exposure to HIV-

1/gp120/interleukin-6 (IL-6) and involvement of NF-kB signaling in P-gp downregulation. In

our in vivo model, gp120 administration resulted in a significant increase in inflammatory

Page 3: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

iii

markers in different brain regions and in cerebrospinal fluid (CSF). Administration of anti-

inflammatory compounds partially or completely reduced upregulation of these markers.

Activation of mitogen-activated protein kinases (MAPKs) was also observed both in vitro and in

vivo which was attenuated by the anti-inflammatory compounds. Our data demonstrate that: i)

gp120 generates an inflammatory response and alters expression of efflux transporters both in

vitro and in vivo, in part, through an interaction with MAPK pathway and ii) anti-inflammatory

agents could partially/completely reverse this response suggesting that they could serve as a

promising novel therapeutic approach for HIV-1- associated brain inflammation

Page 4: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

iv

Acknowledgments

I am grateful to Dr. Reina Bendayan, my thesis supervisor, for her tremendous support,

encouragement and guidance throughout my graduate studies. Thank you for giving me the

opportunity to pursue my doctoral studies under your supervision. I have learnt a lot from you

and had a great experience in your laboratory.

I would like to sincerely thank my committee members Drs. Stephane Angers, Peter Pennefather,

Lyanne Schlichter and Sukriti Nag for their continuous support, constructive criticism and

guidance throughout my Ph.D. studies. I am truly grateful to all of you.

A special thanks to Dr. Patrick Ronaldson, a former Ph.D. and postdoctoral fellow in our

laboratory, who I had the opportunity to work with during the first few months of my Ph.D.

studies. Thank you for sharing your time, knowledge and expertise and providing me with the

necessary training with the astrocyte work.

Thanks to Dr. Carolyn Cummins and Rucha Patel for their help with the qPCR analysis.

I thank Dr. Michelle Farrugia and Dr. Yuri Persidsky for their help with the human fetal

astrocyte work.

I thank Dr. Jeffrey Henderson for collaborating with us and providing me with the opportunity to

learn immunohistochemistry in his facility.

My sincere thanks to the Graduate Department of Pharmaceutical Sciences for their generous

support and approval of several fellowship awards.

Thanks to all the members of the Bendayan lab, past and present: Tianna Huang, Kevin

Robillard, Gary Chan, Olena Kis, Anu Shah, Nilasha Banerjee, Dr. Maria De Rosa, Arpit Shah,

Monika Zhang, Donald Wang, Amy Kao and Billy Huang. A special thanks to Dr. Tozammel

Hoque for his assistance in various projects and all his encouragements throughout the past few

years. I sincerely thank Dr. Wenlei Jiang, Dr. Chiping Wu, Dr. Min Rui and Blake Ziegler for all

their help with the animal and capillary work.

I would also like thank my friends from the faculty- Lilia Magomedova, Celine Lacroix and

Monica Patel for their constant encouragement and support. I wish you all the best in your future

endeavors.

My deepest gratitude to my parents, my brother and my in-laws for always being there for me.

My heartfelt thanks to my mother, Anowara Begum, for being a constant source of courage and

inspiration. Thank you for teaching me how to always remain positive.

Lastly, I would like to thank my significant other, Mirza Ridwanul Haque, for being the greatest

source of support and encouragement. Thank you for being there for me during the ups and

downs. It would not have been possible without you.

Page 5: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

v

Table of Contents

Table of Contents

Acknowledgments .......................................................................................................................... iv

Table of Contents ............................................................................................................................ v

List of Tables ................................................................................................................................. xi

List of Figures ............................................................................................................................... xii

List of Appendices ........................................................................................................................ xv

List of Abbreviations ................................................................................................................... xvi

Chapter 1 ......................................................................................................................................... 1

1 Human immunodeficiency virus-1 (HIV-1) pathogenesis ......................................................... 1

1.1 HIV-1 epidemiology ........................................................................................................... 1

1.2 HIV-1 life cycle .................................................................................................................. 2

1.3 Treatment of HIV-1 infection ............................................................................................. 4

1.3.1 Entry inhibitors ....................................................................................................... 4

1.3.2 Fusion inhibitor ....................................................................................................... 5

1.3.3 NRTIs ...................................................................................................................... 5

1.3.4 NNRTIs ................................................................................................................... 6

1.3.5 Integrase inhibitors .................................................................................................. 6

1.3.6 PIs ........................................................................................................................... 6

1.4 Brain barriers and parenchymal cellular compartments ..................................................... 9

1.4.1 Blood-brain barrier (BBB) ...................................................................................... 9

1.4.2 Pericytes ................................................................................................................ 10

1.4.3 Brain parenchymal cellular compartments ........................................................... 10

1.4.4 Blood-cerebrospinal fluid barrier (BCSFB) .......................................................... 12

Page 6: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

vi

1.5 Brain HIV-1 infection and HIV-1-associated neurological disorders .............................. 13

1.5.1 HIV-1-associated neuropathogenesis .................................................................... 13

1.5.2 HIV-associated neurocognitive disorders (HAND) .............................................. 18

1.6 Treatment obstacles of brain HIV-1 infection: brain permeability of antiretroviral

drugs .................................................................................................................................. 20

1.7 ATP-binding cassette (ABC) transporters ........................................................................ 23

1.7.1 P-glycoprotein (P-gp) ............................................................................................ 26

1.7.2 Multidrug resistance-associated proteins (MRPs) ................................................ 29

1.7.3 Breast cancer resistance protein (BCRP) .............................................................. 35

1.7.4 Regulation of ABC transporters during HIV-1 infection ..................................... 38

1.8 Potential adjuvant therapy ................................................................................................. 39

1.8.1 Minocycline .......................................................................................................... 40

1.8.2 Chloroquine ........................................................................................................... 41

1.8.3 Simvastatin ............................................................................................................ 42

1.9 Signaling pathways ........................................................................................................... 43

1.9.1 NF-кB.................................................................................................................... 44

1.9.2 MAPKs ................................................................................................................. 45

1.9.3 Regulation of ABC transporters by MAPK and NF-кB ....................................... 50

1.9.4 Effect of anti-inflammatory compounds on MAPK and NF-кB........................... 51

1.10 In vitro and in vivo models to study drug transport and HIV-associated brain

inflammation ..................................................................................................................... 52

1.10.1 In vitro systems ..................................................................................................... 52

1.10.2 In vivo models ....................................................................................................... 53

2 Goal .......................................................................................................................................... 55

3 Rationale .................................................................................................................................. 55

4 Hypotheses ............................................................................................................................... 57

Page 7: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

vii

5 Objectives ................................................................................................................................. 57

Chapter 2 ....................................................................................................................................... 58

6 Regulation of Mrp1 by TNF-α in cultured glial cells: involvement of NF-кB and JNK

signaling pathways ................................................................................................................... 58

6.1 Abstract ............................................................................................................................. 59

6.2 Introduction ....................................................................................................................... 60

6.3 Materials and methods ...................................................................................................... 62

6.3.1 Materials ............................................................................................................... 62

6.3.2 Cell culture ............................................................................................................ 62

6.3.3 Gp120/cytokine Treatments .................................................................................. 63

6.3.4 Immunoblot Analysis ............................................................................................ 64

6.3.5 Quantitative PCR .................................................................................................. 66

6.3.6 Enzyme-linked immunoabsorbant assay (ELISA) ................................................ 66

6.3.7 Functional studies ................................................................................................. 67

6.3.8 Data Analysis ........................................................................................................ 67

6.4 Results ............................................................................................................................... 68

6.4.1 Effect of cytokines on Mrp1 protein expression ................................................... 68

6.4.2 Functional studies ................................................................................................. 74

6.4.3 Role of NF-кB on cytokine release and Mrp1 protein expression ........................ 76

6.4.4 Role of JNKs on Mrp1 functional expression ....................................................... 85

6.4.5 Effect of HIV-196ZM651 gp120 and TNF-α on Mrp1 gene expression .............. 92

6.5 Discussion ......................................................................................................................... 94

6.6 Acknowledgements ......................................................................................................... 100

Chapter 3 ..................................................................................................................................... 101

7 Regulation of P-gp by HIV-1 in primary cultures of human fetal astrocytes (HFAs) ........... 101

7.1 Abstract ........................................................................................................................... 102

Page 8: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

viii

7.2 Introduction ..................................................................................................................... 103

7.3 Materials and Methods .................................................................................................... 105

7.3.1 Reagents .............................................................................................................. 105

7.3.2 Primary Cultures of HFAs .................................................................................. 105

7.3.3 Isolation of CCR5 HIV-1 ADA and CCR5/CXCR4 HIV-1 89.6 viral isolates .. 106

7.3.4 Treatment with HIV-1, HIV-1 gp120 and IL-6 .................................................. 106

7.3.5 ELISA analysis ................................................................................................... 106

7.3.6 Immunoblot analysis ........................................................................................... 106

7.3.7 Transport assay ................................................................................................... 107

7.3.8 Data analysis ....................................................................................................... 107

7.4 Results ............................................................................................................................. 108

7.4.1 Interaction of viral protein gp120 (R5-tropic) with chemokine receptor and

pro-inflammatory cytokine secretion .................................................................. 108

7.4.2 Effect of R5/X4 and R5-tropic viral isolates on P-gp protein expression .......... 110

7.4.3 Effect of gp120 and IL-6 on P-gp protein expression ......................................... 111

7.4.4 Involvement of NF-кB in the regulation of P-gp expression .............................. 116

7.5 Discussion ....................................................................................................................... 118

7.6 Acknowledgements ......................................................................................................... 122

Chapter 4 ..................................................................................................................................... 123

8 Role of anti-inflammatory compounds on HIV-1 gp120-mediated brain inflammation ....... 123

8.1 Abstract ........................................................................................................................... 124

8.2 Background ..................................................................................................................... 125

8.3 Materials and methods .................................................................................................... 127

8.3.1 Materials ............................................................................................................. 127

8.3.2 Animals ............................................................................................................... 128

Page 9: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

ix

8.3.3 Animal surgery and ICV administration of gp120/maraviroc/signaling

pathway inhibitors ............................................................................................... 128

8.3.4 Intraperitoneal administration of minocycline, chloroquine and simvastatin ..... 129

8.3.5 Brain tissue, brain capillary isolation and CSF collection .................................. 129

8.3.6 Quantitative real-time PCR ................................................................................. 130

8.3.7 ELISA ................................................................................................................. 130

8.3.8 Immunoblot Analysis .......................................................................................... 131

8.3.9 Immunohistochemistry ....................................................................................... 131

8.3.10 Data analysis ....................................................................................................... 132

8.4 Results ............................................................................................................................. 132

8.4.1 Gp120-mediated inflammatory response in the brain ......................................... 132

8.4.2 Gp120-mediated activation of astrocytes ............................................................ 138

8.4.3 Effect of gp120 on tight junction proteins and drugs efflux transporters in

brain capillaries ................................................................................................... 140

8.4.4 Effect of gp120 on drug efflux transporter brain expression in brain regions .... 140

8.4.5 Anti-inflammatory effects of chloroquine, minocycline and simvastatin .......... 144

8.4.6 Gp120-mediated activation of signaling pathways ............................................. 149

8.5 Discussion ....................................................................................................................... 153

8.6 Conclusions ..................................................................................................................... 158

8.7 Acknowledgements ......................................................................................................... 159

Chapter 5 Discussion, limitations, future directions and conclusion .......................................... 160

9 Overall discussion .................................................................................................................. 160

10 Limitations ............................................................................................................................. 172

11 Future directions ..................................................................................................................... 173

11.1 Regulation of ABC transporters at the BBB and in glial cells ....................................... 173

11.2 Effect of anti-inflammatory compounds on HIV-1 gp120 associated cognitive deficits 174

Page 10: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

x

11.3 Permeability of antiretroviral drugs during HIV-1 gp120-associated brain

inflammation in vivo ....................................................................................................... 175

12 Conclusion.............................................................................................................................. 176

References ................................................................................................................................... 177

Appendices .................................................................................................................................. 219

List of publications ..................................................................................................................... 231

Copyright Acknowledgements .................................................................................................... 232

Page 11: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xi

List of Tables

Table 1-1 Preferred and alternative antiretroviral regimens for antiretroviral therapy-naive

patients (From Ashraf T, Robillard K, Chan G and Bendayan R. Role of CNS Transporters in the

Pharmacotherapy of HIV-1 Associated Neurological Disorders. 2013. Current Pharmaceutical

Design. 20: 1543-1563) .................................................................................................................. 7

Table 1-2 Comparison of CSF to plasma ratios of antiretroviral drugs in HIV-infected patients.

Values are reported as median and/or the range of CSF: plasma (from Ashraf T, Robillard K,

Chan G and Bendayan R. Role of CNS Transporters in the Pharmacotherapy of HIV-1

Associated Neurological Disorders. 2013. Current Pharmaceutical Design. 20: 1543-1563) ..... 22

Table 1-3 CNS expression/localization of ABC transporters implicated in antiretroviral drug

transport (From Ashraf T, Robillard K, Chan G and Bendayan R. Role of CNS Transporters in

the Pharmacotherapy of HIV-1 Associated Neurological Disorders. 2013. Current

Pharmaceutical Design. 20: 1543-63) ........................................................................................... 37

Table 6-1 ELISA analysis of TNF-α secretion in cultured astrocytes treated with HIV-196ZM651

gp120. ............................................................................................................................................ 82

Table 7-1 Pro-inflammatory cytokine secretion in primary cultures of HFAs treated with HIV-

196ZM651 gp120 ............................................................................................................................. 109

Page 12: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xii

List of Figures

Figure 1-1 HIV-1 life cycle ............................................................................................................. 3

Figure 1-2 HIV-1- associated pathogenesis in the brain ............................................................... 17

Figure 1-3 Localization of ABC transporters at the BBB and BCSFB ........................................ 24

Figure 1-4 Localization of of ABC transporters in astrocytes, microglia and neurons ................ 25

Figure 1-5 Membrane topology of P-gp ....................................................................................... 27

Figure 1-6 Membrane topology of MRP1/Mrp1. ......................................................................... 30

Figure 1-7 Membrane topology of BCRP ..................................................................................... 35

Figure 1-8 The MAPK pathway ................................................................................................... 46

Figure 6-1 Effect of cytokines on Mrp1 protein expression in primary cultures of rat astrocytes 70

Figure 6-2 Effect of cytokine neutralizing antibodies on Mrp1 protein expression in primary

cultures of rat astrocytes treated with HIV-196ZM651 gp120. .......................................................... 73

Figure 6-3 Effect of 24 h TNF-α exposure on the cellular retention of BCECF, a fluorescent Mrp

substrate, by cortical rat astrocyte monolayers. ............................................................................ 75

Figure 6-4 Expression of Mrp1 in primary cultures of rat astrocytes treated with gp120 and

SN50, a peptidic NF-κB inhibitor ................................................................................................. 78

Figure 6-5 Expression of Mrp1 in primary cultures of rat astrocytes treated with gp120 and BAY

11-7082, a pharmacological NF-κB inhibitor ............................................................................... 80

Figure 6-6 Expression of Mrp1 in primary cultures of rat astrocytes treated with TNF-α and

SN50, a peptidic NF-κB inhibitor. ................................................................................................ 84

Figure 6-7 Expression of Mrp1 in primary cultures of rat astrocytes treated with gp120 and

SP600125, a pharmacological JNK inhibitor ................................................................................ 86

Page 13: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xiii

Figure 6-8 Expression of Mrp1 in primary cultures of rat astrocytes treated with TNF-α and

SP600125, a pharmacological JNK inhibitor ................................................................................ 89

Figure 6-9 Effect of 24 h gp120 or TNF-α exposure on the cellular retention of BCECF, a

fluorescent Mrp substrate, by cortical rat astrocyte monolayers .................................................. 91

Figure 6-10 Effect of gp120 or TNF-α exposure on Mrp1 mRNA expression in primary cultures

of rat astrocytes ............................................................................................................................. 93

Figure 6-11 Proposed mechanism of NF-κB and JNK signaling in glial cells during an HIV-1

associated inflammatory response ................................................................................................ 99

Figure 7-1 Immunoblot analysis of CXCR4 and CCR5 in primary cultures of HFAs ............... 110

Figure 7-2 Immunoblot and densitometric analysis of P-gp in primary cultures of HFAs after

exposure to (A) either CCR5- tropic HIV-1 ADA or CCR5/CXCR4 dual-tropic HIV-1 89.6 viral

isolates, (B) 1.0 nM gp120 or (C) IL-6 (0.5 ng/ml or 10ng/ml). ................................................ 112

Figure 7-3 Accumulation of [3H]digoxin by HFAs in the presence or absence of gp120 .......... 113

Figure 7-4 Immunoblot and densitometric analysis of P-gp in primary cultures of HFAs treated

with 1.0nM gp120 in the presence of 0.5µg/ml IL-6 neutralizing antibody (NAB) ................... 115

Figure 7-5 Immunoblot and densitometric analysis of P-gp in primary cultures of HFAs treated

with (A) 1.0nM gp120 or (B) IL-6 (0.5 or 10ng/ml) in the presence of NF-κB inhibitory peptide,

SN50 (1.0 μM).. .......................................................................................................................... 117

Figure 8-1 Effect of gp120 on the mRNA levels of (A) IL-1β, (B) iNOS and (C) TNF-α in

different brain regions of ICV administered gp120 (500ng) rats along with a CCR5 antagonist,

maraviroc (MVC). ....................................................................................................................... 135

Figure 8-2 ELISA analysis of (A) IL-1β and (B) TNF-α secretion in the CSF of gp120 (500ng)

administered rats in the presence of Maraviroc (MVC).). .......................................................... 137

Page 14: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xiv

Figure 8-3 (A) Immunohistochemical and (B) immunoblotting (upper panel) and densitometric

analysis (lower panel) of GFAP in hippocampus of ICV administered gp120 rats compared to

saline treated animals.. ................................................................................................................ 139

Figure 8-4 Immunoblot (upper panel) and densitometric analysis (lower panel) of drug efflux

transporters (P-gp, Mrp1 and Bcrp) in (A) frontal cortex, (B) hippocampus and (C) striatum of

ICV administered gp120 rats.. .................................................................................................... 143

Figure 8-5 Effect of gp120 on the mRNA levels of (A) IL-1β, (B) iNOS and (C) TNF-α in

different brain regions of ICV administered gp120 rats receiving simultaneous intraperitoneal

injection of chloroquine or minocycline.. ................................................................................... 146

Figure 8-6 ELISA analysis of (A) IL-1β and (B) TNF-α secretion in the CSF of gp120 (500ng)

administered rats receiving simultaneous intraperitoneal injection of chloroquine or minocycline

or simvastatin.. ............................................................................................................................ 148

Figure 8-7 Protein (upper panel) and densitometric analysis (lower panel) of signaling kinases in

the hippocampal tissue of gp120 administered rats.. .................................................................. 152

Figure 9-1 A schematic summarizing gp120-mediated regulation of cytokine secretion and drug

efflux transporters as well as effect of anti-inflammatory compounds in vitro or in vivo. ......... 171

Page 15: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xv

List of Appendices

Appendix A…………………………………………………………………………………219

Appendix B…………………………………………………………………………………220

Page 16: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xvi

List of Abbreviations

Aβ, amyloid-β

AA, arachidonic acid

ABC, ATP-binding cassette

AIDS, acquired immunodeficiency syndrome

ANOVA, analysis of variance

BBB, blood-brain barrier

BCECF, 2',7'-bis- (2-carboxyethyl)-5- (and-6)- carboxyfluorescein

BCRP, breast cancer resistance protein

BCSFB, blood-cerebrospinal fluid barrier

CAR, constitutive androstane receptor

cART, combination antiretroviral therapy

CHARTER, CNS HIV Anti-Retroviral Therapy Effects Research

CNS, central nervous system

CPE, CNS penetration effectiveness

CSF, cerebrospinal fluid

CYPs, cytochrome P450 enzymes

DMEM, Dulbecco’s modified Eagle’s medium

DMSO, dimethyl sulfoxide

EAAT, Excitatory amino acid transporter

EDTA, ethylenediaminetetraacetic acid

EGTA, ethylene glycol tetraacetic acid

ELISA, Enzyme-linked immunoabsor bant assay

ESCRT, Endosomal sorting complex required for transport

Page 17: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xvii

ERKs, extracellular regulated kinases

FBS, fetal bovine serum

FITC, fluorescein isothiocyanate

FIV, feline immunodeficiency virus

GFAP, glial fibrillary acidic protein

GSH, glutathione

GSSG, glutathione disulfide

Gp120, glycoprotein 120

HAART, highly active antiretroviral therapy

HAD, HIV-associated dementia

HAND, HIV-associated neurocognitive disorder

HBSS, Hank’s balanced salt solution

HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

HFA, human fetal astrocyte

HIV-1, human immunodeficiency virus-1

HIVE, HIV-1 encephalitis

HO-1, heme oxygenase-1

HRP, horseradish peroxidase

ICAM, intracellular adhesion molecule

ICV, intracerebroventricular

IFN, interferon

IκB, inhibitor of NF-кB

IKK, IкB kinase

IL-1β, interleukin-1β

Page 18: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xviii

IL-6, interleukin 6

iNOS, inducible nitric oxide synthase

JAK-STAT, Janus kinase/signal transducers and activators of transcription

JNKs, c-jun N-terminal kinases

LPS, lippopolysaccharide

LTC4, leukotriene C4

MAPK, mitogen-activated protein kinase

MCP-1, monocyte chemoattractant protein-1

MDR, multidrug resistance

MIF, macrophage migration inhibitory factor

MIP, macrophage inflammatory protein

MRP, multidrug resistance-associated protein

mtDNA, mitochondrial DNA

NBD, nucleotide binding domain

NF-кB, nuclear factor- кB

NNRTI, non-nucleoside reverse transcriptase

NO, nitric oxide

NRTI, nucleoside reverse transcriptase

P38Ks, P38 kinases

PBMCs, peripheral blood mononuclear cells

PBS, phosphate buffer saline

PIs, protease inhibitors

P-gp, p-glycoprotein

PPAR, peroxisome proliferator-activated receptor

Page 19: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

xix

PMEA, 9‑(2‑phosphonomethoxyethyl)adenine

PMSF, phenylmethylsulfonyl fluoride

PVDF, polyvinylidene difluoride

PXR, pregnane X receptor

qPCR, quantitative polymerase chain reaction

RIPA, radioimmunoprecipitation assay buffer

ROS, reactive oxygen species

SCID, severe combined immunodeficiency

SD, standard deviation

SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis

SEM, standard error of mean

SIV, simian immunodeficiency virus

Tat, transactivator of transcription

TMD, transmembrane domain

TNF-α, tumor necrosis factor-α

VCAM, vascular adhesion molecule

Vpr, viral protein R

ZO-1, zona occluden-1

Page 20: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

1

Chapter 1

Background

1 Human immunodeficiency virus-1 (HIV-1) pathogenesis

1.1 HIV-1 epidemiology

HIV-1 is an enveloped retrovirus that debilitates the immune system by infecting immune cells

(i.e., T-cells, monocytes or macrophages) and ultimately causes acquired immunodeficiency

syndrome (AIDS) in human body (Barre-Sinoussi et al., 1983;Popovic et al., 1984). According to

the Joint United Nations Program on HIV/AIDS (UNAIDS), about 35.3 million people were

living with HIV-1 infection worldwide in 2012. In the same year, 1.6 million people died from

AIDS- related causes. Although the number of individuals newly infected with HIV-1 continues

to decrease globally, approximately 2.3 million new infections have been reported in adults (2

million) and children (260,000) in 2012. Sub-Saharan Africa remains the most affected area (25

million infected individuals) by HIV-1. However, the incidence rate in this region has decreased

significantly since 2001 due to more availability and accessibility of antiretroviral therapy. In

West and Central Africa, HIV-1 prevalence remains comparatively low, whereas, the epidemics

in Eastern Europe and Central Asia (1.3 million) are dramatically increasing. HIV-1 infected

individuals also constitute significant populations in South and South East Asia (3.9 million) and

in Latin America (1.5 million). In Western and Central Europe as well as North America, the

incidence rate has changed very little since the last decade and availability of antiretroviral

therapy has significantly reduced the AIDS-related mortality. An estimated 20,000 AIDS-related

deaths and 48,000 new infections have been reported in North America in 2012. About 1.3

million people are currently living with HIV-1 infection in North America (UNAIDS, 2013).

Heterosexual transmission remains the primary mode of HIV-1 transmission globally and

intravenous drug use (i.e., needle sharing) or homosexual transmission are other significant

mechanisms for HIV-1 acquisition.

Reproduced with permission from the copyright owner

Page 21: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

2

1.2 HIV-1 life cycle

HIV belongs to the lentiviral subgroup of the family Retroviridae and similar to other

lentiviruses, it is capable of infecting non-dividing cells such as T–cells, monocytes or

macrophages. Two variants of HIV have been identified- HIV-1 and HIV-2. HIV-1 is

responsible for the global HIV epidemic, whereas, HIV-2 is predominantly found in West Africa.

HIV-1 has a 9kb genome that encodes nine genes- gag, pol, env, vif, vpu, vpr, tat, rev and nef.

In its native form, the viral envelope spike is a heterotrimer that is formed by three gp120

molecules attached to three gp41 molecules. The surface glycoprotein 120 (gp120) and the

transmembrane protein gp41 expressed on the surface of the virus are encoded by the viral env

gene. Gp120 is a heavily glycosylated protein that contains five conserved domains (C1-C5) and

five variable domains (V1-V5). Structurally, gp120 has three main regions- the inner domain, the

outer domain and the bridging sheet. The inner domain is conserved between HIV strains. The

outer domain is heavily glycosylated and contains three of the five variable loops (V3-V5).The

bridging sheet contains the other two variable loops and contributes to CD4 receptor and

chemokine co-receptor binding. Entry of HIV-1 into host cells is initiated by binding of HIV-1

gp120 with CD4 receptor. CD4 is a transmembrane glycoprotein that is expressed by monocytes,

macrophages and subsets of T-cells and dendritic cells. The gp120-CD4 binding induces a

conformation change that exposes the co-receptor binding site and allows the binding of gp120

to chemokine co-receptor/co-receptors expressed on host cells. The co-receptors most frequently

used by HIV-1 in vivo have been determined to be CCR5 and CXCR4. CCR5 and CXCR4 are

both G-coupled receptors that contain an extracellular N-terminal tail, three intracellular and

extracellular loops and a C-terminal cytoplasmic tail. Co-receptor selectivity decides viral

tropism. Based on cellular tropism, HIV-1 can be divided into three groups: macrophage (M)

tropic, T-cell (T) tropic and dual tropic. Dual tropic viruses can infect both macrophage and T-

cell lines. M-tropic strains utilize CCR5 chemokine receptor to enter host cells, whereas, T-

tropic viruses use CXCR4 chemokine receptor. Mutations to CCR5 gene (CCrdelta32) can alter

the susceptibility to HIV-1 infection. The gp120-chemokine receptor binding allows the

hydrophobic N-terminus of the gp41 to insert into the target cell membrane. The helically heptad

repeats (HRs) of the gp41 ectodomain form a six helix bundle that leads to the close proximity of

the host cell membrane and viral membrane. Following fusion, the viral core is released into the

Reproduced with permission from the copyright owner

Page 22: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

3

host cell. The viral single-stranded RNA is then immediately transcribed into double-stranded

DNA by the viral reverse transcriptase and RNAse H. HIV-1 integrase then allows the

integration of the viral genetic material into the host cell genome. The subsequent transcription,

translation, post-translational modification and maturation precede the release of the new virions

from infected cells (Bukrinskaya, 2004) (Figure 1-1). Viral gag plays a major role in the

assembly of viral particles and budding of new virions (Meng and Lever, 2013). Gag has four

domains- matrix, nucleocapsid, capsid and p6. Gag binds to viral RNA using nucleocapsid

domain which is then trafficked to the membrane where gag multimerizes. During the budding

process, gag uses the host cellular endosomal sorting complex required for transport (ESCRT)

system. The C-terminal domain of gag interacts with ESCRTI and directs gag to ESCRTIII for

budding. During the budding process, the immature virions acquire the viral envelope complex

and HIV-1 protease cleaves the precursor viral proteins (i.e., gag-pol precursor) to yield mature

HIV-1 (Meng and Lever, 2013).

The sustained viral replication continues during infection and the virus migrates to different

tissues and organs using the circulatory system.

Figure 1-1 HIV-1 life cycle. The viral entry is initiated by the binding of viral envelope spike, a

protein complex comprised of gp120 and gp41, to the CD4 receptor that triggers a

conformational change and allows the subsequent binding of gp120 to the HIV-1 co-receptor (i.

e., CCR5 and CXCR4). Binding of gp120 to the co-receptor causes the fusion of viral and cell

Reproduced with permission from the copyright owner

Page 23: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

4

membrane allowing the release of viral genetic material into the cell cytoplasm. The immediate

transcription of the viral RNA into double-stranded DNA by the viral reverse transcriptase

allows the integration of the viral genetic material into the host cell genome. The subsequent

transcription of the genome results in the production of HIV-1 genomic RNA as well as viral

mRNA that is translated into proteins. The protein precursors are cleaved by viral protease into

functional proteins that assemble at the plasma membrane of the host cell. Once released, the

new virions undergo maturation before becoming infectious (from Ashraf T, Robillard K, Chan

G and Bendayan R. Role of CNS Transporters in the Pharmacotherapy of HIV-1 Associated

Neurological Disorders. 2013. Current Pharmaceutical Design. 20: 1543-1563)

1.3 Treatment of HIV-1 infection

Six different classes of antiretroviral drugs are currently used in HIV-1 treatment- entry inhibitor,

fusion inhibitor, nucleoside reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse

transcriptase inhibitors (NNRTIs), integrase inhibitor and protease inhibitors (PIs). These drugs

target different phases of HIV-1 life cycle (Sierra-Aragon and Walter, 2012). Due to the presence

of viral reservoir in resting memory CD4 positive T-cells, viral eradication remains difficult.

Other viral sanctuary sites are the central nervous system (CNS), testis and gut-associated

lymphoid tissue. Table 1-1 summarizes recommended preferred and alternative antiretroviral

regiments for the initial therapy of treatment-naive HIV patients. A brief description of different

classes of antiretroviral drugs is provided below.

1.3.1 Entry inhibitors

Entry inhibitor targets viral binding to the host cell membrane. Entry inhibitors are developed as

receptor antagonists that can interact with the host cell co-receptor and prevent the binding of

viral gp120. Maraviroc is the first approved CCR5 antagonist and is only effective against R5

tropic viruses (Perry, 2010). Maraviroc is generally prescribed in combination with NRTIs.

Interestingly, individuals carrying CCR5 mutant alleles are partially resistant to R5 tropic viral

infection indicating the importance of co-receptors in viral infectivity (Liu et al., 1996). Other

entry inhibitors that have been tested but discontinued are aplaviroc and vicriviroc (Caseiro et al.,

2012;Nichols et al., 2008). Cenicriviroc is currently in development (Lalezari et al., 2011;Marier

et al., 2011). Although the CXCR4 antagonist AMD3100 has been successful in early phase

Reproduced with permission from the copyright owner

Page 24: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

5

studies, its use as antiviral treatment was terminated due to toxicity (Hendrix et al., 2000).

Several attachment inhibitors (i.e., BMS-488043, BMS-663068) have also been developed,

although none of these inhibitors are used clinically (Hanna et al., 2011;Nettles et al., 2012).

These inhibitors block the interaction of CD4 with gp120. A post-attachment inhibitor,

ibalizumab (TNX-355) has also been developed that prevents the CD4 bound gp120 from

interacting with chemokine coreceptor (Pace et al., 2013).

1.3.2 Fusion inhibitor

Fusion inhibitors are designed to bind to the helical region within gp41 and prevent the

conformational changes required for membrane fusion. To date, efuvirtide (T-20) is the only

approved fusion inhibitor. Efuvirtide binding to HR1 prevents the association of HR1 with HR2

regions in gp41 and blocks membrane fusion. Sifuvirtide is another fusion inhibitor that has

shown antiviral activity in early phase human studies (He et al., 2008;Liu et al., 2011).

1.3.3 NRTIs

NRTIs are nucleoside analogs that compete with nucleosides to be incorporated into viral DNA

and a lack of the 3’-hydroxyl group results in the chain termination. HIV-1 reverse transcriptase

can introduce mutations in viral genome that can result in resistance to reverse transcriptase

inhibitors. Therefore, reverse transcriptase inhibitors are used in combination with other classes

of drugs. Zidovudine was the first approved NRTI (Fischl et al., 1987;Mitsuya et al., 1985). The

NRTIs currently used are abacavir, tenofovir disoproxil fumarate (TDF), emtricitabine,

lamivudine and zidovudine. Although NRTIs are used widely due to its success in inhibiting

viral reverse transcriptase, many NRTIs have also been associated with mitochondrial toxicity.

Mitochondrial toxicity has been estimated to occur in approximately 15-20% individuals who are

on NRTIs (Apostolova et al., 2011b). Although the exact mechanisms are not yet established, it

is proposed that NRTIs inhibit DNA polymerase responsible for mitochondrial DNA (mtDNA)

synthesis. Depletion of mtDNA, in turn, can result in impaired electron transport chain,

mitochondrial dysfunction and reactive oxygen species (ROS) production (Apostolova et al.,

2011a;Blas-Garcia et al., 2011). NRTI-associated mitochondrial toxicity can manifest into

hepatic failure and lactic acidosis. NRTI-mediated mitochondrial toxicity has also been detected

Reproduced with permission from the copyright owner

Page 25: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

6

in the brain of HIV-1 infected individuals on didanosine and/or zidovudine (Schweinsburg et al.,

2005).

1.3.4 NNRTIs

NNRTIs are non-competitive inhibitors of viral reverse transcriptase that bind to a hydrophobic

pocket near the substrate recognition site. They are administered in combination with NRTIs.

Commonly prescribed NNRTIs are efavirenz, nevirapine and rilpivirine. Long-term NNTRI

administration in HIV-1 infected individuals has been associated with a number of adverse

effects including neuropsychiatric disorders, hepatotoxicity, gastrointestinal toxicity and

metabolic disturbances. Some of the neuropsychiatric impairments include confusion, amnesia,

impaired concentration, hallucinations, depression, anxiety and others. For example, common

adverse effects associated with rilpivirine have been reported to be depression, insomnia,

headache and rash (James et al., 2012).

1.3.5 Integrase inhibitors

Integrase inhibitor binds to the viral integrase competitively and prevents strand transfer which is

essential for transfer of the proviral DNA into the host genome. Raltegravir, elvitegravir and

dolutegravir are the three approved integrase inhibitors that are prescribed in combination with

NRTIs.

1.3.6 PIs

PIs can bind to the active site of HIV-1 protease and prevent its catalytic activity. Saquinavir was

the first approved PI. Since then other PIs have been identified such as atazanavir, darunavir,

fosamprenavir, lopinavir, ritonavir, indinavir, nelfinavir and tipranavir. In the clinic, PIs are

generally administered with two NRTIs or one NRTI. In order to improve PIs bioavailability,

they are administered with low doses of ritonavir which is a potent inhibitor of cytochrome P450

enzymes (CYPs) and works as a booster.

PIs can be associated with toxicity and are prone to drug-drug interactions. In particular, they

have been implicated in the development of hyperlipidemia, lipodystrophy as well as insulin

resistance (Moyle, 2007;Pistell et al., 2010;Tsiodras et al., 2000). For example, saquinavir,

indinavir and lopinavir administration have been shown to result in an increase in triglycerides

and insulin resistance infected individuals (Calza et al., 2004;Galindo et al., 2008). A recent

Reproduced with permission from the copyright owner

Reproduced with permission from the copyright owner

Page 26: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

7

study performed in mice also correlated PI-associated metabolic dysfunction with neurocognitive

impairment (Gupta et al., 2012). In this study, mice receiving clinically relevant doses of

lopinavir/ritonavir showed metabolic dysfunction as well as cognitive impairment. Decreased

brain barrier integrity, decreased expression of synaptic markers and increased inflammatory

markers were also observed in these animals indicating the potential detrimental effects

associated with PIs (Gupta et al., 2012).

Reproduced with permission from the copyright owner

Page 27: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

8

Table 1-1 Preferred and alternative antiretroviral regimens for antiretroviral therapy-naive

patients (From Ashraf T, Robillard K, Chan G and Bendayan R. Role of CNS Transporters in the

Pharmacotherapy of HIV-1 Associated Neurological Disorders. 2013. Current Pharmaceutical

Design. 20: 1543-1563)

Preferred Regimens

One of the following Antiretroviral Regimens + NRTI Backbone

NNRTI Efavirenz

Tenofovir Disoproxil Fumarate and

Emtricitabine

PIs Atazanavir + Ritonavir

or Darunavir + Ritonavir

Integrase Inhibitor Raltegravir

Pregnant Women Lopinavir + Ritonavir Zidovudine and Lamivudine

Alternative Regimens

One of the following Antiretroviral Regimens + NRTI Backbone

NNRTI Efavirenz or Rilpivirine Abacavir + Lamivudine

Rilpivirine Tenofovir Disoproxil Fumarate

+ Emtricitabine

PIs

Atazanavir + Ritonavir or

Darunavir + Ritonavir Abacavir and Lamivudine

Fosamprenavir + Ritonavir or

Lopinavir + Ritonavir

Abacavir and Lamivudine or

Tenofovir Disoproxil Fumarate and Emtricitabine

Integrase Inhibitor Raltegravir Abacavir and Lamivudine Adapted from the 2012 Guidelines for the Use of Antiretroviral Agents in HIV-1 Infected Adults and

Adolescents (http://aidsinfo.nih.gov/guidelines).

Reproduced with permission from the copyright owner

Page 28: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

9

1.4 Brain barriers and parenchymal cellular compartments

1.4.1 Blood-brain barrier (BBB)

The BBB constitutes a remarkable physical and biochemical barrier between the brain and

systemic circulation that regulates the traffic of molecules into/out of the brain parenchyma

(Reese and Karnovsky, 1967). The discovery of the BBB is attributed to the German

immunologist Paul Ehrlich who first reported in 1880 that injection of cationic dyes into the

systemic circulation stained most of the organs with the exception of the brain and spinal cord

(Ehrlich, 1904). Later work from Edwin E. Goldman demonstrated that if the dye is injected in

the cerebrospinal fluid (CSF) directly, only the nervous tissue is stained whereas other tissues

remain unstained confirming the existence of a physiological barrier between the systemic

circulation and the brain (Goldmann, 1913). It was not until another 70 years when using

electron microscopy several researchers observed lack of horseradish peroxidase (HRP)

perfusion in mouse vascular endothelium suggesting the existence of a structural barrier at the

blood-brain interface (Reese and Karnovsky, 1967). The identification of tight junction proteins

that connect endothelial cells and restrict the paracellular trafficking of substrates further

confirmed the concept of a tightly regulated physiological barrier surrounding the CNS (Reese

and Karnovsky, 1967). To date, the BBB is known as a multi-cellular unit formed of a

monolayer of non-fenestrated brain microvessel endothelial cells, surrounding pericytes, adjacent

astrocytes and neurons. These cellular compartments and basal lamina are collectively referred to

as the “neurovascular unit” (Neuwelt et al., 2011). Brain microvessel endothelial cells are joined

by tight junctions that are maintained by trophic factors released from adjacent astrocytes and

pericytes. The intercellular network of tight junctions regulates the traffic of immune

surveillance cells and substances from the systemic circulation. Under physiological conditions,

these tight junctions form a continuous, almost impermeable cellular barrier that limits

paracellular flux and transport as well as the influx of endogenous and exogenous substances

with the exception of very small, lipid soluble molecules. The high transendothelial electrical

resistance (1500-2000 cm2) of the BBB further restricts the free flow of water and solutes.

Several receptors, ion channels, and influx/efflux transport proteins are prominently expressed at

the BBB (Pardridge, 2012;Simionescu et al., 2002). In brain microvessel endothelial cells,

specialized plasma membrane microdomains known as caveolae are believed to be involved in

Reproduced with permission from the copyright owner

Page 29: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

10

endocytosis of various macromolecules, including plasma proteins, immunoglobulins and

metalloproteins. During neuropathological conditions such as stroke, trauma, bacterial or viral

infections, multiple sclerosis, Alzheimer’s disease, Parkinson’s disease, epilepsy, brain tumors

and pain, the integrity of the BBB has been reported to be compromised (Neuwelt et al.,

2011;Ronaldson et al., 2008).

1.4.2 Pericytes

Pericytes are perivascular cells within the basal lamina that are important constituent of the BBB

(Fisher, 2009). These cells surround the endothelial cells and maintain the structural integrity and

stability of the BBB (Hori et al., 2004a). Pericytes are known to regulate many other brain

functions such as angiogenesis, capillary flow, immune response as well as hemostatis (az-Flores

et al., 1991;Bandopadhyay et al., 2001). Due to their multiple roles in maintaining a functional

BBB, pericytes have been implicated in the pathogenesis of numerous cerebrovascular and

neurodegenerative diseases (Dore-Duffy, 2008;Gonul et al., 2002).

1.4.3 Brain parenchymal cellular compartments

Neurons and the surrounding glial cells constitute the brain parenchyma. The term “glia”

(derived from Greek, meaning glue) was first used by Rudolf Virchow in 1846 to describe a cell

type that fastened the neuronal cells together. For decades, glial cells were viewed as structural

support cells in the brain. However, emerging evidence suggest that glial cells in the brain

perform a wide range of function that is critical to regulate and maintain brain homeostasis. Glial

cells include astrocytes, oligodendrocytes and microglia.

1.4.3.1 Astrocytes

Astrocytes are the most abundant glial cells in the brain. They possess a stellate morphology and

contain numerous cytoplasmic fibrils, of which glial acidic fibrillary protein (GFAP) is the main

constituent. Astrocytes possess numerous functions that aid in maintaining the homeostatic

environment of the CNS. Astrocyte-foot-processes surround more than 99% surface of the

cerebral capillary basement membrane and this close interaction between astrocytes and brain

microvessel endothelial cells has been implicated in the maintenance of tight junction integrity,

proliferation and angiogenesis of endothelial cells (Abbott et al., 2006). Other functions include

Reproduced with permission from the copyright owner Reproduced with permission from the copyright owner

Page 30: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

11

regulation of immune and inflammatory events during injury and infection (i.e., production and

secretion of cytokines), expression of adhesion molecules for neuronal development, buffering of

excess K+ during periods of neuronal hyperactivity and secretion of neurotropic factors (i.e.,

transforming growth factor-beta, glial-derived neurotropic factor, basic fibroblast growth factors)

that are known to promote growth of neurons as well as differentiation and maturation of

microglia. Astrocytes also express numerous transporters that mediate the trafficking of

nutrients, solutes and xenobiotics across the cell membrane (Hirrlinger et al., 2005;Pardridge et

al., 1997). Loss of astrocyte mediated neuroprotective effects as well as chronic activation of

astrocytes have been reported in neurodegenerative diseases as well as in HIV-associated

neuropathogenesis (Sidoryk-Wegrzynowicz et al., 2011).

1.4.3.2 Microglia

Microglia are the resident immunocompetent cells in the brain. These cells were first identified

by the Spanish neuroanatomist del Rio-Hortega in 1932. Under normal physiological condition,

these cells appear in a resting state, characterized by smaller cell body, ramified processes and

low expression of surface antigens. In response to injury or inflammatory stimuli, microglia

become activated and release inflammatory mediators such as pro-inflammatory cytokines,

prostaglandins and NO. Activated microglia further recruit other microglia to the site of injury,

trigger activation of astrocytes and signal recruitment of peripheral monocytes from the systemic

circulation. Activated microglia have been implicated in many diseases such as Alzheimer’s,

Parkinson’s, HIV-encephalitis (HIVE) and others (Garden and Moller, 2006). Many transport

proteins are also expressed in these cells (Lee et al., 2001b). More than a decade ago, our group

proposed that along with astrocytes, these cells constitute a secondary barrier to drug

permeability in the brain and demonstrated functional expression of multiple drug efflux

transporters in both microglia as well as astrocytes (Dallas et al., 2004a;Dallas et al., 2003;Lee et

al., 2001b;Ronaldson et al., 2004b;Ronaldson et al., 2008).

1.4.3.3 Oligodendrocytes

The primary function of oligodendrocytes is to form the insulating myelin sheath that surrounds

neuronal axons in the CNS. Myelin, an extension of the oligodendrocyte plasma membrane, is a

lipid-rich biological membrane that forms multilamellar, spirally wrapped sheaths around

Reproduced with permission from the copyright owner

Page 31: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

12

neuronal axons to increase the resistance for electrical impulses during an action potential. Injury

and loss of oligodendrocytes are directly related to axonal damage (Benarroch, 2009). Several

transporters have been detected at the gene or protein level in oligodendrocytes (Hirrlinger et al.,

2002).

1.4.3.4 Neurons

Neurons form the basic structural and functional component of the CNS. The primary function of

neurons is to transmit nerve signals through axonal processes. The interaction between blood

vessels and neurons plays an essential role for the neurovascular network and maintenance of

brain homeostasis. Irreversible neuronal injury or loss has been implicated in many diseases such

as Alzheimer’s disease, Parkinson’s disease, infectious diseases, stroke and multiple sclerosis.

Studies have demonstrated the expression of several drug transporters at this site (Lazarowski et

al., 2004).

1.4.4 Blood-cerebrospinal fluid barrier (BCSFB)

The BCSFB composed of choroid plexus epithelial cells plays a major role in determining the

permeability of nutrients and xenobiotics. The choroid plexus is a highly vascularised branched

structure with numerous villi that project into all four cerebral ventricles (Spector and Johanson,

1989). The capillaries of the choroid plexus are fenestrated and provide little resistance to the

movement of water and solutes. However, a barrier is formed by a monolayer of polarized

epithelial cells surrounding the fenestrated capillaries that are joined together by tight junctional

proteins (Groothuis and Levy, 1997;Segal, 2000). These tight junctions form a functional barrier

that restricts the movement of molecules and ions. The main function of the choroid plexus

epithelial cells is to secrete and maintain the homeostatic composition of the CSF. The CSF fills

the ventricles of the brain, the spinal canal and subarachnoid space. In humans, the total volume

of CSF is approximately 140 ml which is replaced four to five times daily (Enting et al., 1998).

The CSF also provides a drainage system for the brain known as the sink effect into which

products of metabolism and molecules penetrating into the CSF are diluted and subsequently

removed (Davson et al., 1970;Saunders et al., 1999). The sink effect is greater for large

molecular weight and hydrophilic compounds. At the level of choroid plexus epithelial cells,

Reproduced with permission from the copyright owner

Page 32: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

13

numerous polarized expression of receptors, ion channels and transporters have been reported

(Davson and Segal, 1970;de Lange, 2004;Garner and Brown, 1992;Kusuhara and Sugiyama,

2005;Spector and Johanson, 1989)

1.5 Brain HIV-1 infection and HIV-1-associated neurological disorders

1.5.1 HIV-1-associated neuropathogenesis

HIV-1 can penetrate the CNS early in the course of the infection either as a cell-free entity or

within infected monocytes that is also known as the “Trojan horse” hypothesis (Davis et al.,

1992). Infected monocytes can migrate into the brain either by transcellular or paracellular route.

The paracellular route involves migration in-between adjacent endothelial cells and the

transcellular route occurs directly through an individual endothelial cell likely through the

formation of a pore or channel (Wittchen, 2009). Studies have suggested that both transcellular

and paracellular migration of monocytes are associated with high intracellular adhesion molecule

(ICAM)-1 and vascular cell adhesion molecule (VCAM)-1 enriched endothelial projections

(Carman and Springer, 2004).

Perivascular macrophages and brain resident microglial cells constitute the immunocompetent

cells in the CNS and are the primary targets of HIV-1 (Persidsky and Gendelman, 2003).These

cells express both CD4 and chemokine co-receptor for viral entry (Dalgleish et al., 1984;Deng et

al., 1996). In a healthy brain, microglia appear in a resting state. In response to HIV-1, microglia

become activated and release pro-inflammatory cytokines, prostaglandins, ROS and NO that

further trigger the activation of neighbouring microglia and astrocytes and signal recruitment of

peripheral monocytes from the systemic circulation (Garden, 2002;Persidsky et al., 1999).

Microglia are the main source of productive infection in the brain while infection of astrocytes

tends to be latent and noncytopathic. HIV-1 entry into astrocytes is independent of CD4 receptor

and mediated by galactosyl ceramide (Boutet et al., 2001;Gorry et al., 2003). It is proposed that

HIV-1 infection in astrocytes is controlled by different phases of restriction. A few potential

mechanisms could be low level of viral production which is controlled post-transcriptionally and

low level of basal promoter activity. Lower Rev function along with insufficient translation of

viral proteins have been implicated as potential mechanism of restrictive HIV-1 infection in

astrocytes. Sequestration of the virus in the astrocytes and prolonged viral viability in astrocytes

can lead to the formation of viral reservoir at this site. HIV-1 infection triggers activation of

Reproduced with permission from the copyright owner

Page 33: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

14

astrocytes leading to inflammatory response and oxidative stress. A study by Churchill et al. has

demonstrated that astrocyte infection was prominent in HIV-1 infected subjects with dementia

(Churchill et al., 2009). In addition, astrocyte infection correlated with the severity of the

neuropathological changes suggesting an important role of astrocytes in HIV-1

neuropathogenesis (Churchill et al., 2009).

A number of studies have demonstrated that virus-infected cells or induced glial cells are source

of various neurotoxic factors such as arachidonic acid (AA) and its metabolites, platelet

activating factor, quinolinic acid, ROS, NO and glutamate (Genis et al., 1992;Kong et al.,

1996;Ronaldson and Bendayan, 2008). In addition, a number of pro-inflammatory cytokines

(i.e., tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), IL-10, IL-18,

interferonα (IFNα), IFNγ] are also known to be elevated during brain HIV-1 infection (Hult et

al., 2008;Perrella et al., 1992;Torre et al., 1992;von Giesen et al., 2004). Several studies have

reported detectable amount of these cytokines in the CSF of patients with HIV-associated

neurocognitive disorder (HAND) and also found statistically significant correlations of these

elevated cytokines with HAND pathogenesis (Sas et al., 2009). Heme oxygenase-1 (HO-1), a

cytoprotective cellular enzyme, has been found to be significantly decreased due to HIV-1

replication in cultured macrophages and HO-1 deficiency was found to be associated with

increased release of neurotoxic levels of glutamate (Ambegaokar and Kolson, 2014). Increased

macrophage migration inhibitory factor (MIF) has also been reported in plasma of HIV-1

infected patients, in infected peripheral blood mononuclear cells (PBMCs) as well as in PBMCs

treated with gp120 (Regis et al., 2010). MIF binds to different receptors (i.e., CD74, CD44,

CXCR2, CXCR4) and promotes the release of pro-inflammatory cytokines (i.e., TNF-α, IL-6)

(Calandra and Roger, 2003). In vitro studies in primary glial cell cultures suggest that shed viral

proteins [gp120, transactivating protein (Tat), viral protein R (vpr)] can induce secretion of pro-

inflammatory cytokines. For example, previous work from our laboratory has demonstrated that

R5-tropic gp120 can mediate secretion of pro-inflammatory cytokines (TNF-α, IL-1β and IL-6)

by interacting with CCR5 chemokine receptor in primary cultures of rodent astrocytes

(Ronaldson and Bendayan, 2006).

HIV-1 infection may result in a neuropathological condition known as HIVE. HIVE is

characterized by elevated monocyte/macrophage infiltration into the brain, myelin pallor, brain

atrophy, multinucleated giant cells, activated microglia, reactive astrocytosis (proliferation and

Reproduced with permission from the copyright owner

Page 34: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

15

activation of astrocytes) and presence of microglial nodules (Albright et al., 2003). Immune

activation in the brain parenchyma during HIVE is associated with enhanced monocyte

migration through the BBB (Kanmogne et al., 2007). Secretion of chemokines [i.e., monocyte

chemoattractant protein-1 (MCP-1); macrophage inflammatory protein-1α/β (MIP-1α/β);

regulated on activation, normal T cell expressed and secreted (RANTES)] from glial cells

facilitate this migration (Asensio and Campbell, 1999). In addition, HIV-1 infection can disrupt

the structural properties of the BBB by downregulating tight junction proteins [i.e., zona

occluden-1 (ZO-1), occludin] in brain microvessel endothelial cells (Kanmogne et al.,

2005;Nakamuta et al., 2008). A compromised BBB can facilitate entry of HIV-1 from the

periphery and ultimately, can increase the spread of the virus in brain parenchymal cellular

compartments. Several in vitro and in vivo studies have also demonstrated that HIV-1 proteins

(i.e., gp120, Tat) can downregulate tight junction proteins expressed in brain microvessel

endothelial cells (Kanmogne et al., 2005;Toborek et al., 2005). For example, Louboutin et al.

demonstrated a significant decrease in the tight junction protein claudin-5 due to gp120

administration in rat brain (Louboutin et al., 2010b). Upregulation of adhesion molecules (i.e.,

ICAM,VCAM] in brain endothelial cells have also been implicated in facilitating viral infected

monocyte infiltration (Andras et al., 2003;Pu et al., 2003). A recent study has identified

mechanisms involved in HIV-1 transport across the BBB. Using in situ brain perfusion and in

vitro BBB model, this study demonstrated that HIV-1 uses the mannose-6 phosphate receptor to

cross the brain microvessel endothelial cells as a free virus (Dohgu et al., 2012).

Evidence also suggests a significant contribution of oxidative stress in the pathogenesis of HIV-

1. Inflammatory cytokines and HIV-1 viral proteins (Tat, gp120) can induce oxidative stress in

glial cells. In rat cortical neuroglial cultures, gp120 triggered an increased production of ROS

and subsequent neuronal death (Wakabayashi et al., 2003). Upregulation of inducible nitric oxide

synthase (iNOS) expression and associated increase in NO and peroxynitrite production have

also been reported in astrocytes and microglia (Adamson et al., 1996;Hori et al., 1999;Zhao et

al., 2001). High levels of iNOS expression were also reported to be localized to microglial

nodules and reactive astrocytes in brain tissue isolated from patients with HIVE (Zhao et al.,

2001). Increased oxidative stress markers have also been detected in the CSF of HIV-1 infected

individuals with HIV-associated dementia implying their significance in the development of

HIV-1 associated cognitive deficits (Sacktor et al., 2004).

Reproduced with permission from the copyright owner

Page 35: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

16

Neurons do not appear to be susceptible to HIV-1 infection. However, chronic exposure to

neurotoxic, inflammatory and oxidative stress markers during HIV-1 infection can cause

irreversible neuronal damage (Kaul et al., 2001). Viral proteins (i.e., gp120, Tat, vpr) released

from infected cells are known to be neurotoxic (Guha et al., 2012;Kanmogne et al., 2002).

Studies have shown that mechanisms involved in neuronal apoptosis include interaction with

viral proteins to neuronal chemokine receptors, caspase activation, calcium toxicity,

excitotoxicity due to glutamate, loss of mitochondrial membrane potential and ultimately, DNA

fragmentation (Lindl et al., 2010). For example, it has been demonstrated that gp120 mediates

caspase-3-dependent apoptosis of neurons (Singh et al., 2004). Others demonstrated vpr

associated neuronal apoptosis and neurodegeneration in vivo (Guha et al., 2012;Jones et al.,

2007). Excessive K+ and excitatory neurotransmitter glutamate also lead to neuronal loss.

Physiologically, astrocytes actively participate in removing excess K+ and excitatory

neurotransmitter glutamate released from neurons. Functional glutamate uptake systems [i.e.,

excitatory amino acid transporter 1 (EAAT1), EAAT2] have been identified in astrocytes.

Evidence suggests that these uptake systems may be compromised due to HIV-1 infection.

Studies performed in cultured glial cells exposed to gp120 or Tat have reported reduced

expression of EAAT2 expression as well as decreased glutamate uptake (Wang et al.,

2003b;Zhou et al., 2004). Excess extracellular glutamate can further stimulate metabotropic

glutamate receptors in astrocytes leading to more glutamate release (Volterra and Meldolesi,

2005). Figure 1-2 summarizes the different mechanisms involved in HIV-associated

neuropathogenesis.

Reproduced with permission from the copyright owner

Page 36: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

17

Figure 1-2 HIV-1- associated pathogenesis in the brain (Adapted from Persidsky and

Gendelman, 2003. 74:691-701. J Leukoc Biol. ;Ronaldson et al., 2008.Glia.56: 1711:1735; From

Ashraf T, Robillard K, Chan G and Bendayan R. Role of CNS Transporters in the

Pharmacotherapy of HIV-1 Associated Neurological Disorders. 2013. Current Pharmaceutical

Design. 20: 1543-1563)

Reproduced with permission from the copyright owner

Page 37: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

18

1.5.2 HIV-associated neurocognitive disorders (HAND)

Neurocognitive impairment remains highly prevalent in HIV-1 infected individuals due to

persistence of viral replication and associated inflammation in the brain (Heaton et al.,

2010;Heaton et al., 2011). Prior to the use of antiretroviral therapy, approximately 20-30% of

HIV-1 infected patients developed HIV-associated dementia (HAD), the most severe form of

cognitive impairment. Since the initiation of combined antiretroviral therapy, the development

of HAD in HIV-1 infected patients has significantly decreased (Ances and Ellis, 2007).

However, milder forms of HAND are becoming more predominant in the post-highly active

antiretroviral therapy (HAART) era in part due to the longer life expectancy of infected

individuals on treatment. HAND is characterized by cognitive, motor or behavioral

abnormalities. Despite receiving treatment, HIV-1 infected patients may develop cognitive

impairments (i.e., attention, learning, memory), psychiatric illness (i.e., depression, anxiety) and

persisted fatigue interfering with their daily life functioning (i.e., employment, medication

management, driving) and ultimately, resulting in a poor quality of life in these individuals

(Warriner et al., 2010). Studies further suggest that cognitively impaired individuals with acute

and early HIV-1 infection are at elevated risk of clinically significant changes in normal daily

functioning (Doyle et al., 2013).

Several recently published studies have confirmed that despite the availability of combined

antiretroviral therapy (cART), neurological disorders are still persistent in HIV-1 infected

patients (Power et al., 2009;Vivithanaporn et al., 2010). In particular, Vivithanaporn et al.

studied 1,651 patients with HIV-AIDS in Canada over a 10 year period and reported that more

than one in four people with HIV-1 develops neurological disorders and more alarmingly, the

mortality rate of these patients are significantly higher than those with no neurological disorder

(Vivithanaporn et al., 2010). Vivithanaporn et al. further observed that patients suffering from

neurological infection suffer from 53 brain-related conditions including HAND, pain, seizure,

stroke and others (Vivithanaporn et al., 2010). Another study performed in 1,555 HIV-1

infected patients in the United States reported that 52%of the total subjects had

neuropsychological impairment (Heaton et al., 2010).

One study performed by the CNS HIV Anti-Retroviral Therapy Effects Research (CHARTER)

group reported that nadir CD4 cell count may be used as a predictor of neuropsychological

impairment (Ellis et al., 2011). This study suggested that the risk of developing neurocognitive

Reproduced with permission from the copyright owner

Page 38: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

19

deficit is lower in infected individuals whose CD4 levels were never allowed to fall to low levels

(Ellis et al., 2011). McCombe et al. further reported that increased age, survival duration, low

nadir CD4 cell count and high baseline viral load were predictors of the development of

symptomatic HAND in patients with HIV-1 infection (McCombe et al., 2013). Brain HIV RNA

and to a lesser extent HIV DNA in patients with HIVE and microglial nodule encephalitis were

found to be correlated with worse neuropsychological performance (Gelman et al., 2013). HIV-1

infection and the development of dual-tropism may be associated with HAND in the relatively

early stage of infection suggesting that viral interaction with cellular receptors may play an

important role in the early manifestation of HAND (Morris et al., 2013).

Although CD4 count and viral load were important markers for the likelihood of developing

HAND in the pre-cART era, there are currently no standard systemic or CSF biomarkers that can

be used to diagnose HAND. Increased concentrations of CSF neopterin, a marker for

macrophage activation, have been found in virally suppressed patients without any symptoms of

HAND (Canestri et al., 2010). A correlation of cytokines present in the CSF of HIV-1 infected

patients were found with their test results of neuropsychological functioning (Nolting et al.,

2012). Increased IL-6 and MIP-1β were also found to be elevated in the CSF collected from

advanced therapy-naive HIV-1 infected HAND patients (Airoldi et al., 2012). In this study,

initiation and continuation of antiretroviral therapy for 12 weeks greatly reduced plasma RNA

load, but did not affect CSF IL-6 and MIP-1β levels suggesting that CNS immune activation can

persist despite administration of virologically effective therapy (Airoldi et al., 2012).

Different neuropsychological test batteries are being used to detect cognitive impairments in

infected patients. Lack of reliable screening methods for early diagnosis and monitoring HAND

is a key obstacle to evaluate HAND. Recently, a smartphone based screen test, neuroscreen, has

been tested in HIV-1 infected individuals to detect neurocognitive deficits. Although it

demonstrated similar ability to assess cognitive deficits as paper tests, it is yet to be determined if

it can be useful for less cognitively impaired patients (Robbins et al., 2014). Neuroimaging

techniques (i.e., morphometry, magnetic resonance spectroscopy, diffusion tensor imaging,

positron emission tomography) have potential to detect neuropathological changes in HIV-1

infected patients and to evaluate the progression of disease and/or the efficacy of cART.

Reproduced with permission from the copyright owner

Page 39: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

20

1.6 Treatment obstacles of brain HIV-1 infection: brain permeability of

antiretroviral drugs

Treatment of brain HIV-1 infection remains challenging partly due to poor permeability of

antiretroviral drugs across the BBB and into glial cells. Several classes of antiretrovirals have

been reported to poorly permeate into the brain. In particular, a number of PIs and NRTIs exhibit

low bioavailability following oral administration and reach subtherapeutic concentration in the

brain, possibly permitting this site to become a sanctuary for HIV-1 (Best et al., 2009;Best et al.,

2012;Gisolf et al., 2000). The inadequate concentration of PIs in the CNS could allow continuing

production of HIV-1 and emergence of drug resistant viral strains despite adequate plasma

concentrations and acceptable systemic antiviral efficacy indicators (Kravcik et al.,

1999;Piacenti, 2006). Table 1-2 lists the CSF to plasma ratio of different antiretroviral drugs.

In order to determine the effectiveness of antiretroviral drug permeability in the brain, a CNS

penetration effectiveness (CPE) score has been established by the CHARTER group. The

ranking of individual antiretroviral drugs was based on their chemical properties, concentrations

in CSF and/or effectiveness in the CNS reported in clinical trials (Letendre et al., 2008). In order

to validate this ranking method, a study involving 833 HIV-1 infected individuals was designed

to establish a correlation between CSF viral loads and penetration of antiretroviral drugs. As

predicted, lower CPE ranks were found to be associated with higher CSF viral loads suggesting

persistent viral replication due to poor penetration of antiretroviral drugs (Letendre et al., 2008).

An updated CPE ranking has been proposed that incorporates data from recent studies and is

more strongly associated with CSF viral loads than the older CPE method (Letendre et al., 2010).

According to the most updated CPE ranking system, each drug has been given a score between 1

and 4 (Letendre et al., 2010). A higher CPE score indicates more CNS effectiveness. Based on

this ranking zidovudine, nevirapine and indinavir/ritonavir are given a score of 4, while abacavir,

emtricitabine, delavirdine, efavirenz, darunavir/ritonavir, fosamprenavir/ritonavir, indinavir,

lopinavir/ritonavir, maraviroc and raltegravir have a score of 3. Drugs such as didanosine,

lamivudine, stavudine, etravirine, atazanavir, atazanavir/ritonavir and fosamprenavir were given

a score of 2. The lowest ranking was given to tenofovir, zalcitabine, nelfinavir, ritonavir,

saquinavir, saquinavir/ritonavir, tipranavir/ritonavir and enfuvirtide indicating their poor

permeability. Although this system has not been validated for clinical use yet, it suggests that

Reproduced with permission from the copyright owner

Page 40: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

21

enhancing the penetration of antiretroviral drugs into the CNS can ultimately improve brain

HIV-1 infection and associated cognitive impairments. Data from several clinical studies support

that higher CPE ranks are associated with low CSF viral loads and/or improved cognitive

performance in HIV-1 infected individuals (Marra et al., 2009). Besides increased permeability

of antiretrovirals, early initiation of antiretroviral therapy may also reduce the risk of

neurocognitive complications in HIV-1 infected individuals. In a study performed by the

CHARTER group, nadir CD4 level was identified as a predictor of neuropsychological

impairment suggesting that the risk of developing neurocognitive deficit is lower in infected

individuals whose CD4 levels were never allowed to fall to low levels (Ellis et al., 2011).

Therefore, other factors can also determine the effectiveness of antiretroviral therapy in

improving neurocognitive impairment. In addition, as discussed in an earlier section, use of

certain antiretroviral drugs can be associated with adverse side effects including neurotoxicity.

More clinical evidence is required to understand penetration of antiretroviral drugs and

improvement in neurocognitive outcome. Overall, these observations suggest that

pharmacotherapy of brain HIV-1 infection is a complex process and further investigation is

necessary to design treatment strategies that can benefit patients with neurocognitive deficits.

Reproduced with permission from the copyright owner

Page 41: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

22

Table 1-2 Comparison of CSF to plasma ratios of antiretroviral drugs in HIV-infected patients. Values are reported as median and/or

the range of CSF: plasma (from Ashraf T, Robillard K, Chan G and Bendayan R. Role of CNS Transporters in the Pharmacotherapy

of HIV-1 Associated Neurological Disorders. 2013. Current Pharmaceutical Design. 20: 1543-1563)

.

Class Antiretroviral Drug CSF : Plasma Ratio References

PIs

Amprenavir 0.012 (0.008-0.018) (Croteau et al., 2012)

Atazanavir 0.008-0.02 (Best et al., 2009b)

Darunavir 0.009 (0.003-0.078) (Yilmaz et al., 2009)

Indinavir 0.11 (0-0.47) (Antinori et al., 2005)

Lopinavir 0.002 (0.001-0.008) (Capparelli et al., 2005)

Saquinavir 0.001-0.002 (Kravcik et al., 1999b)

Nelfinavir Not detected (Antinori et al., 2005;Solas et al., 2003)

Ritonavir 0.002 (0.001-0.005) (Kravcik et al., 1999b)

NRTIs

Abacavir 0.35 (0.31-0.44) (McDowell et al., 1999)

Didanosine 0.16 (0.03-0.24) (Huang et al., 2004)

Emtricitabine 0.26 (0.05-0.41) (Calcagno et al., 2011)

Lamivudine 0.23 (0-4.9) (Antinori et al., 2005)

Stavudine 0-0.20 (Antinori et al., 2005)

Tenofovir 0.057 (0.004-0.84) (Best et al., 2012)

Zidovudine 0.02 (0-6.74) (Antinori et al., 2005)

NNRTIs

Efavirenz 0.007 (0.003-0.011) (Tashima et al., 1999)

Enfuvirtide Negligible (Price et al., 2008)

Nevirapine 0.63 (0.41-0.77) (Antinori et al., 2005)

Integrase Inhibitor Raltegravir 0.06 (0.01-0.54) (Croteau et al., 2010)

CCR5 Antagonist Maraviroc 0.022 (0.004-0.17) (Tiraboschi et al., 2010)

Reproduced with permission from the copyright owner

Page 42: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

23

1.7 ATP-binding cassette (ABC) transporters

Subtherapeutic concentrations of antiretroviral drugs have been reported in the CNS. One

potential mechanism that may lead to poor penetration of antiretrovirals into different brain

cellular compartments is functional expression of efflux transporters that belong to the ABC

superfamily. Along with ABC transporters, drug metabolizing CYPs may play a role in

determining drug disposition into the CNS. In addition, drug-drug interactions can also lead to

inadequate or toxic drug concentrations resulting in poor therapeutic outcome, treatment failure

or adverse effects.

The ABC superfamily is one of the largest and ubiquitously expressed protein families

containing numerous functionally diverse membrane-associated transporters. To date, 50 ABC

proteins have been identified in humans that can be separated in seven subfamilies (A to G)

based on their structural organization (Dean and Allikmets, 2001). These membrane-associated

proteins transport numerous substrates across the lipid bilayer using ATP hydrolysis as the

energy source. ABC transporters are characterized by the presence of a highly conserved

Nucleotide Binding Domain (NBD) containing three distinct motifs, Walker A, Walker B and a

signature motif (LSGG) (Leslie et al., 2001). Localization of different ABC transporters at the

brain barriers and in brain cellular compartments is shown in figure 1-3 and figure 1-4,

respectively.

Reproduced with permission from the copyright owner

Page 43: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

24

Abluminal Luminal Basolateral Apical

MRP1

Mrp2

MRP4

MRP5

Mrp4

Brain Blood

Mrp4

MRP1

Mrp5

CSF

BBB CP

MRP4

MRP1

P-gpP-gp

P-gp

BCRP

BCRP

Figure 1-3 Localization of ABC transporters at the BBB and BCSFB. The arrows indicate the

direction of substrate transport (Adapted from Ashraf T, Kao A and Bendayan R. 2014.

Functional expression of drug transporters in glial cells: potential role on drug delivery to the

CNS. In Thomas P. Davis, editor: pharmacology of the blood-brain barrier: targeting CNS

disorders, vol 71, APHA, UK: Academic press; 45-111)

Reproduced with permission from the copyright owner

Reproduced with permission from the copyright owner

Page 44: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

25

Microglia

MR

P1

Mrp

4M

rp5

Mrp

6

P-g

p

Bc

rp

NeuronsM

RP

1

MR

P4

MR

P5

Mrp

6

MR

P8

P-g

p

Bcrp

Astrocytes

MR

P1

MR

P4

Mrp

5

Mrp

6

P-g

p

BC

RP

Figure 1-4 Localization of of ABC transporters in astrocytes, microglia and neurons. The arrows

indicate the direction of substrate transport (Adapted from Ashraf T, Kao A and Bendayan R.

2014. Functional expression of drug transporters in glial cells: potential role on drug delivery to

the CNS. In Thomas P. Davis, editor: pharmacology of the blood-brain barrier: targeting CNS

disorders, vol 71, APHA, UK: Academic press; 45-111)

Reproduced with permission from the copyright owner

Page 45: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

26

1.7.1 P-glycoprotein (P-gp)

P-gp was the first identified ABC transporter. It was isolated and characterized by Victor Ling in

Toronto, Canada, in a Chinese hamster ovary cell line where this transporter showed resistance

to colchicine (Juliano and Ling, 1976). These cells also showed resistance to a number of

structurally diverse anti-cancer agents, a phenomenon that was later termed as multidrug

resistance (MDR). P-gp consists of 1276-1280 amino acids with a molecular mass of

approximately 170 kDa. It is encoded by the MDR/mdr gene which has two isoforms in humans

(MDR1 and MDR2) and three isoforms in rodents (mdr1a, mdr1b and mdr2) (Chen et al.,

1986;Gottesman et al., 1995). P-gp is encoded by the MDR1 gene in humans, whereas,

MDR2/mdr2 is exclusively expressed in the liver and involved in phosphatidylcholine

translocation. In rodents, P-gp encoded by mdr1a and mdr1b demonstrate MDR phenotype.

The membrane topology of P-gp shows a tandemly duplicated structure with two homologous

halves connected by a hydrophilic linker region (Loo and Clarke, 2005). Each half consists of a

highly hydrophobic transmembrane domain (TMD) containing six transmembrane helices and an

intracellular NBD with an ATP-binding site (Gottesman et al., 1995;Rosenberg et al., 2003). The

hydrophilic linker region is phosphorylated at several sites by protein kinase C, although

phosphorylation of this linker region does not appear to affect P-gp function. N-linked

glycosylation sites have also been identified in P-gp within the first extracellular loop. Although

glycosylation does not appear to be required for substrate transport, studies suggest that

glycosylation may be required for proper protein folding. Recent structural studies have

generated an X-ray crystal structure of mouse P-gp which shows an internal cavity with

nucleotide-free inward facing conformation (Aller et al., 2009). This study also reported two co-

crystal structures of P-gp bound to cyclic peptide inhibitor. In the drug-bound conformation, the

drug-binding pocket of P-gp is open to the cytoplasm and lipid bilayer (Aller et al., 2009). This

conformation likely represents a pre-transport state of P-gp where drug binding followed by ATP

binding causes a dimerization in the NBDs, resulting in the outward facing conformation where

the drug is released due to changes in conformation and/or accompanied by ATP hydrolysis.

Since its discovery, overexpression of P-gp has shown resistance to numerous chemotherapeutic

drugs, immunosuppressants, cardiac glycosides, antibiotics and many more. A number of

antiretroviral drugs have been reported to be substrates of P-gp. They include a number of HIV

Reproduced with permission from the copyright owner

Page 46: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

27

PIs (i.e., darunavir, atazanavir, saquinavir, ritonavir, amprenavir), several NRTIs (i.e., tenofovir

DF, nelfinavir), entry inhibitor (maraviroc) and integrase inhibitor (raltegravir) (Fujimoto et al.,

2009;Janneh et al., 2007;Kassahun et al., 2007;Kim et al., 1998;Lee et al., 1998;Perloff et al.,

2005;Shaik et al., 2007;Walker et al., 2005). Some of these antiretrovirals, in particular PIs, have

also been identified as inhibitors of P-gp transport activity. Our laboratory has demonstrated that

PIs such as indinavir, ritonavir and saquinavir can inhibit digoxin transport, an established P-gp

substrate, in a rat brain endothelial cell line (RBE4), primary cultures of rat astrocytes and a rat

microglial cell line (MLS-9) (Bendayan et al., 2002;Ronaldson et al., 2004a). P-gp has also been

implicated in numerous drug-drug interactions and co-administration of drugs that are substrates,

inducers or inhibitors of P-gp can result in altered pharmacokinetic and pharmacodynamic

response (Kis et al., 2010).

Figure 1-5 Membrane topology of P-gp (TMD= Transmembrane domain; NBD= Nucleotide

binding domain) (From Sarkadi B, 2006. Physiol Review. 86:1179-236).

P-gp is expressed at several blood-tissue barriers (i.e., blood-intestinal, blood-testis, blood-

placenta) including the BBB and the BCSFB where this transporter is directly involved in the

elimination of pharmacological agents (Edwards et al., 2005;Su et al., 2009). Several studies

have detected P-gp localization at the luminal membrane of brain microvessel endothelial cells

and on the apical side of choroid plexus epithelia (Rao et al., 1999). Others including our group

Reproduced with permission from the copyright owner

Page 47: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

28

have also reported P-gp localization at the abluminal surface of the endothelium (Bendayan et

al., 2006;Pardridge et al., 1997). Pardridge et al. first demonstrated P-gp expression at the

abluminal surface of the endothelium in human and primate astrocyte foot processes (Pardridge

et al., 1997). Using immunogold cytochemistry, our laboratory has also detected P-gp

localization at the luminal and abluminal surface of endothelial cells as well as in astrocyte foot

processes (Bendayan et al., 2006). P -gp functional expression has been characterized in isolated

brain capillaries as well as in several primary and immortalized brain cell culture systems

including RBE4 and human brain microvessel endothelial cell line (Bendayan et al., 2002;Miller

et al., 2000). Studies have also reported P-gp expression in parenchymal glial cells. Work from

our laboratory has confirmed P-gp expression in a rat microglia cell line (MLS-9) as well as in

cultured rat and human astrocytes (Lee et al., 2001b;Ronaldson et al., 2004a). Subcellular

localization of P-gp in brain cellular compartments has also been investigated. Using

immunogold immunocytochemistry, our laboratory has further detected P-gp expression in

caveolae, nuclear envelope and in cytoplasmic vesicles in primary cultures of rat astrocytes

(Ronaldson et al., 2004a). Additionally, we have shown P-gp expression in purified nuclear

membranes prepared from isolated nuclei from RBE4 and MLS-9 cells (Babakhanian et al.,

2007).

Studies performed in mdr1a/1b knockout mice models further support the role of P-gp in

antiretroviral drug transport the brain. In mdr1a and mdr1b knockout mice, an enhanced

accumulation of PIs in the brain has been reported suggesting the involvement of P-gp in

limiting brain permeability of antiretrovirals. For example, brain permeation of indinavir,

nelfinavir, ritonavir and saquinavir has been reported to be 4 to 36-fold higher in mdr1a

knockout animals (Kim et al., 1998;Washington et al., 2000). In another study, administration of

P-gp specific inhibitor zosuquidar in macaques resulted in significant brain accumulation of

nelfinavir (Kaddoumi et al., 2007). A study by Choo et al. reported significant increases in [14

C]-

nelfinavir brain concentrations in mice pre-treated with several selective P-gp inhibitors

including zosuquidar (LY335979) (25-fold increase), valspodar (PSC 833) (13-fold increase) and

cyclosporin A (3-fold increase)(Choo et al., 2000). While these studies suggest that selective P-

gp inhibitors have the potential to enhance accumulation of different drugs into the CNS in vivo,

use of small molecule P-gp inhibitors to improve CNS drug delivery have been largely

unsuccessful in the clinic. In fact, several clinical trials have attempted to incorporate

Reproduced with permission from the copyright owner

Reproduced with permission from the copyright owner

Page 48: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

29

pharmacological P-gp inhibitors into therapeutic regimens; however, these trials have largely

failed due systemic toxicity associated with the high inhibitor doses necessary for effective

transporter inhibitor (Kaye, 2008). Therefore, pharmacological approaches that involve

inhibition of P-gp mediated transport should be employed with extreme caution to avoid an

unwanted elevation in CNS drug concentrations and subsequent toxicity as well as unexpected

adverse drug reactions.

Altered P-gp expression at the BBB and in brain parenchymal compartments can affect drug

distribution during therapy. P-gp has been reported to be regulated by many physiological and

pathological stimuli including pro-inflammatory cytokines, polypeptide hormone endothelin-1,

viral proteins, bacterial lipopolysaccharide (LPS) and amyloid-β (Aβ) (Bauer et al., 2007;Lee

and Piquette-Miller, 2001;Ronaldson and Bendayan, 2006). A number of signaling pathways

have been reported to regulate P-gp such as mitogen-activated protein kinase (MAPK) pathway,

nuclear factor-кB pathway (NF-κB), nuclear receptors [i.e., pregnane-X-receptor (PXR),

peroxisome proliferator-activated receptor (PPAR), constitutive androstane receptor (CAR)],

protein kinase C, protein kinase Akt and Rho pathways (Bauer et al., 2007;Miller, 2010;Miller et

al., 2008;Ott et al., 2009;Pan et al., 2010;Wang et al., 2010b;Zhong et al., 2010). Recent studies

in rodent brain capillaries also suggest that sphingolipid signaling through sphingosine-1-

phosphate receptor 1 is involved in the regulation of P-gp (Cannon et al., 2012). Therefore, a

more viable approach for controlling P-gp mediated drug transport in the CNS may be to target

endogenous P-gp regulatory pathways.

1.7.2 Multidrug resistance-associated proteins (MRPs)

MRP family is a group of ABC transporters that are ubiquitously expressed in many tissues (i.e.,

brain, liver, kidney, intestine) and primarily confer resistance to a number of organic anions. The

mammalian MRP family (humans, MRP; rodents, Mrp) has 13 members including nine proteins

involved in drug transport, MRP1-9 (ABCC1-6 and ABCC 10-12), one ion channel (cystic

fibrosis transmembrane regulator gene, CFTR), two receptors (sulfonylurea 1 and 2) and one

truncated protein that does not mediate transport (ABCC13) (Dallas et al., 2006;Keppler, 2011).

With regards to membrane topology, MRP transporters can be classified into two groups

(MRP1-3, MRP6-7 and MRP4-5, MRP8-9). MRP1-3, MRP6 and MRP7 have predicted

membrane topology of three TMDs showing a topology of 5 + 6 + 6 configuration of

Reproduced with permission from the copyright owner

Page 49: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

30

transmembrane helices where the first TMD is linked to the core region by a shorter cytoplasmic

loop. In the case of MRP1, the first TMD is not essential for transport activity, whereas, the

linker region is required for function (Borst et al., 2000). In comparison, MRP4, MRP5, MRP8

and MRP9 contain two TMDs each having 6 transmembrane helices and a NBD, but do not

possess the first TMD with five helices at their N-terminus (Bakos et al., 1998).

Figure 1-6 Membrane topology of MRP1/Mrp1 (TMD= Transmembrane domain; NBD=

Nucleotide binding domain) (From Dallas S, Miller DS, Bendayan R. 2006. Pharmacol Rev.

58:140-61).

MRP1 was first identified in a human lung cancer cell line, H69AR, which displayed

characteristics of the MDR phenotype in the absence of P-gp expression (Cole et al., 1992).

MRP1 shows substrate selectivity towards organic anions or neutral organic drugs and unlike

P-gp, MRP1 is also capable of transporting glutathione (GSH), glucuronide and sulphate

conjugates (Hipfner et al., 1999;Leier et al., 1996). Substrates of MRP1 include anticancer drugs,

inflammatory mediator leukotriene C4 (LTC4), PIs, oxyanions and several dietary constituents

(i.e., bioflavanoids) (Dallas et al., 2006;Leslie et al., 2001). In the presence of GSH, Mrp1 has

been shown to be involved in the transport of a few cationic drugs (i.e., vincristine, etoposide)

(Loe et al., 1998;Rappa et al., 1997). MRP1 is also known to be involved in the transport of a

number of HIV-1 PIs- atazanavir, saquinavir, ritonavir, indinavir and lopinavir (Dallas et al.,

2004a;Janneh et al., 2009;Janneh et al., 2005;van, I et al., 2001). Interaction of emtricitabine, an

NRTI and MRP1 has also been implicated (Bousquet et al., 2008). Using PBMCs, Bousquet et

Reproduced with permission from the copyright owner

Page 50: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

31

al. have shown a decrease in MRP1 function after exposure to emtricitabine and increased

intracellular calcein and [3H]-vincristine accumulation. In the presence of an MRP-specific

inhibitor, MK571, emtricitabine accumulation increased in PBMC suggesting an interaction with

MRP1 in vitro (Bousquet et al., 2008).

MRP1 is known to be ubiquitously expressed with higher expression in lung, testes and PBMCs.

In the CNS, MRP1 protein expression has been located in the luminal membrane of brain

microvessel endothelial cells and basolateral membrane of choroid plexus epithelial cells

(Gazzin et al., 2011;Rao et al., 1999). Studies have also detected MRP1 protein in pericytes,

astrocytes, microglia, oligodendrocytes and neurons (Berezowski et al., 2004;Dallas et al.,

2004a;Dallas et al., 2003). Functional expression of MRP1 has also been demonstrated in vivo. In

Mrp1 knockout mice, vincristine permeation in the knockout animal brain was found to be

significantly higher than the wild-type animal (Wang et al., 2010a). In addition, a few signaling

pathways have been identified in MRP1 regulation such as MAPK, NF-kB and Janus

Kinase-Signal Transducer and Activator of Transcription (JAK-STAT) (Ashraf et al.,

2011;Hayashi et al., 2006;Ronaldson et al., 2010).

MRP1, along with other MRP isoforms (MRP2, MRP4 and MRP5), can also contribute towards

cellular defence during oxidative stress by regulating intracellular GSH and glutathione disulfide

(GSSG) concentrations. GSH levels within cells are tightly regulated and compromised levels

lead to the progression of many disorders including cancer, inflammatory and neurodegenerative

diseases. Elevated levels of GSH have been found in tissues from Mrp1 and Mrp2 knockout mice

(Kruh et al., 2007). It is now known that both MRP1 and MRP2 can mediate transport of GSH as

a substrate as well as cotransport of GSH in the presence of other compounds. MRP1 mediated

transport of GSH has been well characterized in cultured astrocytes and this transporter has also

been implicated in the transport of GSSG and other oxidized GSH derivatives (Hirrlinger et al.,

2001). Other MRP isoforms are also known to be involved in GSH transport (MRP4 and MRP5),

although their functional role in brain cellular compartments is not clear (Lai and Tan,

2002;Wijnholds et al., 2000b). For example, using astrocyte cultures derived from Mrp1 and

Mrp5 knockout mice, Minich et al demonstrated that Mrp1, but not Mrp5 is involved in GSH and

GSSG transport in cultured astrocytes (Minich et al., 2006). Another recent study observed

depletion of cellular GSH and increase in the extracellular GSH content in primary rat astrocyte

Reproduced with permission from the copyright owner

Page 51: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

32

cultures treated with PIs indinavir or nelfinavir. This process was attenuated in the presence of

MRP-specific inhibitor, MK571 suggesting involvement of Mrp-mediated transport activity

(Brandmann et al., 2012).

MRP1 and MRP2 share similar substrate specificities, although differences in kinetic properties

exist between MRP1 and MRP2 mediated transport. Endogenous substrates of MRP2 include

conjugated steroids, bile salts and LTC4. MRP2 also transports many exogenous compounds

such as anticancer drugs, antiretrovirals, antibiotics, environmental toxins and metal complexes.

MRP2 can also mediate transport of GSH independently or along with other compounds. With

respect to antiretrovirals, studies have suggested that MRP2 can transport a number of PIs such

as atazanavir, ritonavir, saquinavir, indinavir and lopinavir (Agarwal et al., 2007;Huisman et al.,

2002;Janneh et al., 2005). MRP2-mediated transport of tenofovir has also been reported

(Mallants et al., 2005). MRP2 has a more limited tissue distribution compared to MRP1 (Leslie

et al., 2005). At the BBB, Mrp2 has been localized at the luminal side of brain microvessel

endothelial cells and brain capillaries (Miller et al., 2000). At the BCSFB, the mRNA expression

of Mrp2 has been reported to be negligible (Choudhuri et al., 2003). In brain parenchyma, Mrp2

mRNA, but not protein expression in astrocytes isolated from embryonic rats has been detected

(Hirrlinger et al., 2002). Study by Potschka et al demonstrated an increased accumulation of

phenytoin, an antiepileptic agent in Mrp2-transport deficient mice suggesting a functional role of

this transporter at the level of the BBB (Potschka et al., 2003). Nuclear receptor CAR has been

implicated in the regulation of Mrp2 in rodent capillaries (Wang et al., 2010b).

MRP3 has a narrower but similar substrate preference as MRP1 and MRP2. However, MRP3

cannot transport GSH and prefers glucuronide conjugates over glutathione conjugates (Zelcer et

al., 2001). Weiss et al. demonstrated that NNRTIs and NRTIs enhance cellular accumulation of

methylfuorescin glutathione complex, an MRP-specific substrate, in MRP1,MRP2 or MRP3

overexpressing cell lines indicating interaction between NRTIs/NNRTIs and MRP isoforms

(Weiss et al., 2007). At the BBB, Mrp3 expression appears negligible and has not been detected

in mouse brain microvessels; however, gene expression was reported in hCMEC/D3 cells

(Dauchy et al., 2009). Low levels of Mrp3 have also been detected in bovine brain microvessel

endothelial cells whereas expression was not observed in capillary enriched homogenate (Zhang

et al., 2000). In choroid plexus epithelium, Mrp3 staining was observed at the inter-cellular

junctions, although the function of this protein at this site is unknown (Soontornmalai et al.,

Reproduced with permission from the copyright owner

Page 52: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

33

2006). In brain parenchyma, MRP3/Mrp3 gene expression has been detected in astrocytes,

microglia, oligodendrocytes and neurons (Hirrlinger et al., 2002;Nies et al., 2004).

Unlike MRP1-3, MRP4 has the unique ability of transporting a range of endogenous molecules

involved in cellular communication of signaling including cyclic nucleotides (cycline adenosine

monophosphate, cyclic guanosine monophosphate), eicosanoids, urate, conjugated steroid

hormones, folate, bile acids, nucleotide and purine analogs (Chen et al., 2001). MRP4 substrates

also include several NRTIs- abacavir, zidovudine monophosphate and tenofovir (Borst et al.,

2004;Ray et al., 2006). In Mrp4 knockout mice model, increased brain penetration of adefovir

has been reported suggesting a functional role of MRP4 in limiting drug penetration into the

brain (Belinsky et al., 2007). Using immunocytochemical analysis, MRP4 expression has been

detected both at the luminal and abluminal sides of brain capillary endothelial cells and at the

basolateral side in the choroid plexus epithelia (Leggas et al., 2004;Nies et al., 2004;Roberts et

al., 2008;Zhang et al., 2004). MRP4 expression has also been localized in astrocytes, microglia,

oligodendrocytes and neurons (Ballerini et al., 2002). Our laboratory has also detected

MRP4/Mrp4 expression in primary cultures of human and rat astrocytes (Ronaldson and

Bendayan, 2008).

Similar to MRP4, MRP5 can function as a cyclic nucleotide export pump and confers resistance

to nucleoside analogs. In addition to cyclic nucleotides, MRP5 substrates include a number of

other organic anions such as nucleoside monophosphate analogs, glutathione S-conjugates and

fluorescein diacetate. GSH is also a substrate for MRP4 and MRP5, although GSH cotransport is

not necessary for all the substrates of these transporters. Among antiretroviral drugs, MRP5 has

been reported to transport stavudine (Reid et al., 2003). MRP5 is also expressed in brain cellular

compartments. In comparison to MRP4 expression, MRP5 is localized at the luminal membrane

of brain microvessel endothelial cells, but is expressed at the basolateral membrane of the

choroid plexus (Nies et al., 2004;Roberts et al., 2008;Zhang et al., 2004) . MRP5 is also highly

expressed in pyrimidal neurons and astrocytes (Nies et al., 2004). Others have reported Mrp5

gene expression in oligodendrocytes and microglia (Hirrlinger et al., 2002;Nies et al., 2004).

Using 9‑(2‑phosphonomethoxyethyl)adenine (PMEA), a substrate for MRP4 and MRP5, our

group has shown that these transporters are functional in a rat microglia cell line (MLS-9)(Dallas

et al., 2004b).

Reproduced with permission from the copyright owner

Page 53: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

34

Functional studies have shown that MRP6 exhibits a weak resistance to chemotherapeutic drugs

such as etoposide, doxorubicin and daunorubicin. MRP6 can also transport GSH conjugates (i.e.,

LTC4, N-ethymaleimide S-glutathione). Transcripts of Mrp6 have been detected in primary

cultures of bovine brain microvessel endothelial cells, in capillary enriched fraction of bovine

brain homogenate and in human brain tissue (Zhang et al., 2000). Mrp6 expression at the gene

and protein level has been detected in glial cells and neurons, but not in pericytes (Berezowski et

al., 2004). Loss of MRP6 function causes an autosomal recessive multi-organ disorder known as

pseudoxanthoma elasticum, resulting in calcification of elastic fibres (Varadi et al., 2011). To

date, interaction of MRP6 and antiretroviral drugs has not been established.

A few in vitro studies have suggested that MRP7 is a lipophilic anion transporter that confers

resistance to several natural product anticancer drugs (i.e., docetaxel, vincristine). High levels of

MRP7 transcripts have been detected in various tumor specimens suggesting a potential role of

this transporter in the intrinsic sensitivity of tumors (Takayanagi et al., 2004). Transcripts of

Mrp7 have been detected in brain tissue (Kao et al., 2002). Although MRP7 showed resistance to

lopinavir in an over-expressing cell line, functional expression of MRP7 in different brain

cellular compartments is yet to be characterized (Bierman et al., 2010).

MRP8 has been characterized as a lipophilic anion efflux pump in vitro (Chen et al., 2005).

MRP8, similar to MRP4 and MRP5, confers resistance to several purine and pyrimidine

nucleotide derivatives (Oguri et al., 2007). Transcripts and protein expression of MRP8 have

been detected in human brain samples and gliomas. MRP8 is considered an axonal protein since

immunofluorescence microscopy studies have detected MRP8 protein to be colocalized with

neurofilaments in white matter in human brain (Bortfeld et al., 2006). The axonal localization of

MRP8 together with its substrate affinity towards steroids indicates that this transporter may

potentially participate in regulating neurotransmitter receptors by mediating the efflux of

neurosteroids from neurons. With respect to antiretrovirals, MRP8 has been reported not to be

involved in the cellular efflux of zidovudine or lamivudine (Guo et al., 2003). Further studies are

needed to characterize MRP8 involvement in transporting other antiretroviral drugs,

MRP9 overexpressing cells have been reported to show resistance to atazanavir, lopinavir and

ritonavir (Bierman et al., 2010) suggesting the potential involvement of this transporter in

antiretroviral therapy. Although MRP9 transcripts have been detected in brain, additional studies

Reproduced with permission from the copyright owner

Page 54: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

35

are required to clarify the functional expression of this transporter in the brain (Bera et al., 2002).

Therefore, the role of MRP9 in antiretroviral drug transport in the brain is not yet clear.

1.7.3 Breast cancer resistance protein (BCRP)

This transporter was first identified in a P-gp and MRP1-negative breast cancer cell line that

showed high resistance to mitoxantrone, an anthracycline anticancer drug (Doyle et al., 1998).

ABCG2 (BCRP) consists of 665 amino acids with a molecular mass of approximately 72 kDa.

Unlike most other ABC transporters, ABCG2 is a half-transporter and is predicted to function as

a homodimer. Evidence also suggest that BCRP may also function as a monomer (Mitomo et al.,

2003).

The substrate profile of ABCG2 overlaps with that of P-gp or MRP1 and includes many anti-

cancer drugs (i.e., daunorubicin, doxorubicin, mitoxantrone, etoposide, topotecan,

camptothecins, methotrexate), antibiotics (i.e., erythromycin, enrofloxacine, gepafloxacine),

phototoxins (i.e., pheophorbide-A), calcium channel blockers (i.e., azidopine, dipyridamole),

HMG-CoA reductase inhibitors (i.e., rosuvastatin, pitavastatin), fluorescent compounds (i.e.,

rhodamine123), carcinogens (i.e.,aflatoxin B1) and many others (i.e., cimetidine, riboflavin)

(Mao and Unadkat, 2005;Merino et al., 2006;Zhang et al., 2005). ABCG2 also confers resistance

to zidovudine, lamivudine, abacavir and stavudine (Wang et al., 2003a). Experiments in bcrp

knockout animal show enhanced brain penetration of abacavir suggesting BCRP involvement in

brain antiretroviral drug transport (Giri et al., 2008).

Figure 1-7 Membrane topology of BCRP (TMD= Transmembrane domain; NBD= Nucleotide

binding domain) (from Sarkadi B, 2006. Physiol Review. 86:1179-236).

Reproduced with permission from the copyright owner

Page 55: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

36

ABCG2 is expressed in several blood-tissue barriers including the blood-brain, blood-placental

and blood-testis barriers. Cooray et al. detected luminal expression of ABCG2 in rat capillaries.

Several studies have also reported the expression of ABCG2/Abcg2 in primary cultures of

human brain microvessel endothelial cells, mouse brain capillaries and immortalized rat brain

endothelial cell line (Cooray et al., 2002;Eisenblatter and Galla, 2002;Lee et al., 2007;Zhang et

al., 2003). ABCG2 expression has also been detected in pericytes and at the luminal membrane

of choroid plexus epithelial cells (Eisenblatter et al., 2003). Our group has confirmed Abcg2

protein expression in primary cultures of rat astrocytes and in a microglia cell line, MLS-9 (Lee

et al., 2007).

Several in vivo studies support that ABCG2 can restrict brain permeation of a number of

compounds. Functionally active ABCG2 has been reported in intact brain capillaries (Hartz et

al., 2010b). A few studies have also reported ABCG2 mediated transport in cultured human and

rodent brain microvessel endothelial cells. However, several studies have suggested lack of

ABCG2 mediated transport in endothelial cells (Hori et al., 2004b;Zhang et al., 2003). For

example, accumulation of mitoxantrone, an established P-gp substrate, did not increase in the

presence of ABCG2 inhibitors in primary cultures of human brain endothelial cells as well as in

RBE4 cell line. In addition, a lack of ABCG2 mediated transport of mitoxantrone has been

demonstrated in primary cultures of rat astrocytes and in a microglia cell line (Lee et al., 2007).

A study by Cisternino et al. reported 700-fold higher Abcg2 mRNA in mouse brain capillaries

compared to the cortex. In mdr1a/b deficient mice, they also observed 3-fold higher Abcg2

mRNA levels in the capillaries compared to wild-type mice. At the protein level,

upregulated ABCG2 protein expression was observed in brain microvessels compared to wild

type animals In mdr1a knockout mice model suggesting a compensatory role of ABCG2

(Cisternino et al., 2004). Recent studies also indicate that ABCG2, in conjunction with P-gp can

limit the penetration of tyrosine kinase inhibitors into the brain (Agarwal et al., 2011;Breedveld

et al., 2005;Gardner et al., 2009).

Reproduced with permission from the copyright owner

Page 56: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

37

Table 1-3 CNS expression/localization of ABC transporters implicated in antiretroviral drug transport (From Ashraf T, Robillard K,

Chan G and Bendayan R. Role of CNS Transporters in the Pharmacotherapy of HIV-1 Associated Neurological Disorders. 2013.

Current Pharmaceutical Design. 20: 1543-63)

Name Gene name

CNS protein Expression/Localization Known antiretroviral

substrates

References

P-gp

(MDR1)

ABCB1

Brain microvessel endothelial cells

(LM/ALM), choroid plexus epithelium

(AP), astrocytes, neurons

Darunavir, atazanavir,

saquinavir, ritonavir,

amprenavir, lopinavir,

tipranavir, nelfinavir, tenofovir

df, raltegravir, maraviroc

(Fujimoto et al., 2009;Janneh et

al., 2007;Kassahun et al.,

2007;Kim et al., 1998;Lee et al.,

1998;Perloff et al., 2005;Walker

et al., 2005)

BCRP

(ABCG2)

ABCG2

Brain microvessel endothelial cells (LM),

choroid plexus epithelium (AP)

Zidovudine, lamivudine,

stavudine, abacavir, acyclovir

(Wang et al., 2003a)

MRP1

ABCC1

Brain microvessel endothelial cells (LM),

choroid plexus epithelium

(BL),astrocytes, microglia, neurons

Atazanavir, saquinavir,

ritonavir, indinavir, lopinavir,

emtricitabine

(Bousquet et al., 2008;Janneh et

al., 2009;Janneh et al.,

2007;Janneh et al., 2005;van, I et

al., 2001;Zastre et al., 2009)

MRP4

ABCC4

Brain microvessel endothelial cells (LM),

choroid plexus epithelium

(BL),astrocytes

Tenofovir, abacavir,

zidovudine

(Borst et al., 2004;Ray et al.,

2006)

MRP5

ABCC5

Brain microvessel endothelial cells (LM).

choroid plexus epithelium (BL),

astrocytes, neurons

Stavudine

(Reid et al., 2003)

(LM = luminal; ALM = abluminal; AP = apical; BL = basolateral)

Reproduced with permission from the copyright owner

Page 57: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

38

1.7.4 Regulation of ABC transporters during HIV-1 infection

Evidence in literature suggests that functional expression of ABC transporters in the brain is

altered during HIV-1 infection. Increased P-gp expression has been reported in brain autopsy

tissues from patients with HIVE (Langford et al., 2004). Since antiretroviral drugs can modulate

the expression of transporters in vitro and in vivo, it remains unclear if this increased P-gp

immunoreactivity is due to therapy itself or due to HIV-associated pathogenesis. In contrast,

decreased protein expression has been reported in brain autopsy samples from patients (not

receiving pharmacotherapy) with HIVE and in brain tissue from severe combined

immunodeficiency (SCID) mice model of HIVE (Persidsky et al., 2000). Using cell culture

systems, many groups have demonstrated altered P-gp expression in human or rodent brain

cellular compartments. Persidsky et al. reported decreased functional expression of P-gp in

primary cultures of human brain microvessel endothelial cells exposed to TNF-α, IL-1β, IFN-γ

and supernatants from HIV-1 infected macrophages (Persidsky et al., 2000). In both murine

brain microvessel endothelial cells and astrocytes, HIV-1 tat exposure resulted in an

upregulation of P-gp expression (Hayashi et al., 2005). Exposure to HIV-1 resulted in an

increase in MDR1 gene and protein expression in primary cultures of brain microvessel

endothelial cells. No significant change in MRP1 expression was observed (Roy et al., 2013).

However, co-exposure of HIV-1 and PI saquinavir, showed induced functional expression of P-

gp compared to HIV-1 exposure alone. Another group compared P-gp and MRP1 expression in

PBMCs isolated from HIV-1 infected patients and healthy volunteers and observed significant

decrease in P-gp expression, but no significant change in MRP1 (Meaden et al., 2001). In

contrast, Turriziani et al. reported increased mRNA expression of MDR1, MRP1, MRP4 and

MRP5 in PBMCs from infected individuals (Turriziani et al., 2008).

In our laboratory, we observed that HIV-1 gp120 can induce secretion of pro-inflammatory

cytokines (IL-6, IL1-β and TNF-α) by interacting with CCR5 chemokine receptors in primary

cultures of rat astrocytes and significantly decrease functional expression of P-gp (Ronaldson

and Bendayan, 2006). Our group also examined the effect of different cytokines on P-gp

expression and demonstrated that IL-6 could profoundly decrease P-gp expression, whereas,

TNF-α or IL-1β exposure resulted in a modest enhancement in P-gp expression (Ronaldson and

Bendayan, 2006). In regards to Mrp1 regulation, in primary cultures of rat astrocytes, we have

Reproduced with permission from the copyright owner

Page 58: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

39

observed an increase in functional expression of this transporter in response to gp120 treatment

which correlated with an enhanced efflux of GSH and GSSG, implying a potential role of MRP1

in regulating oxidative stress in glial cells (Ronaldson and Bendayan, 2008). In a transgenic rat

model, significant changes in mRNA expression of several ABC transporters were observed in

the brain, kidney, liver and testes (Robillard et al., 2014). In the brain, decreased mRNA

expression of Mdr1a, Mdr1b, Mrp1, MRP4 and increase Mrp5 mRNA expression was observed

(Robillard et al., 2014). These observations provide evidence that ABC transporters are regulated

during HIV-associated brain inflammation which may result in altered brain permeability of

antiretroviral drugs.

1.8 Potential adjuvant therapy

Antiretroviral drugs that are currently being used in HIV-1 therapy do not exhibit anti-

inflammatory properties (with the exception of maraviroc) and majority of them demonstrate

poor brain permeability. In addition, neurotoxicity has been associated with better permeable

drugs (i.e., efavirenz) (Cavalcante et al., 2010). Therefore, alternative treatment options are being

considered that can reduce HIV-associated brain inflammation.

A number of studies have reported the anti-inflammatory potential of different compounds

against LPS-mediated inflammatory response. Various anti-psychotic compounds (i.e.,

spiperone, risperidone), nonsteroidal anti-inflammatory drugs (i.e., flurbiprofen) and natural

extracts (i.e., tripchlorolide, xanthorrhizol, curcumin) are known to inhibit LPS induced cytokine

and NO release in microglia (Ajmone-Cat et al., 2001;Lim et al., 2005;Pan et al., 2008;Zheng et

al., 2008a;Zheng et al., 2008b). Administration of chloroquine, an anti-malarial drug, reduced

gene expression of TNF-α in LPS treated PBMCs (Weber and Levitz, 2000). A plant derived

compound, 2-cyano-3,12-dioxooleane-1,9(11)-dien-28-oic acid (CDDO)-methyl ester prevented

induced transcription of TNF-α and IL-1β in primary cultures of mouse microglia and

macrophages (Tran et al., 2008). Lipoic acid can be another potential suppressor of

neuroinflammation due to its role against cognitive deficits in rodents (Holmquist et al., 2007).

In a LPS injected rat model, minocycline, a tetracycline derivative, significantly reduced

microglial activation in the hippocampus and rescued behavioral deficits (Zhu et al., 2014).

Page 59: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

40

Several studies have also examined anti-inflammatory properties of different compounds in

attenuating HIV-1-associated inflammatory response. For example, chloroquine, has been found

to inhibit gp120 production and decrease mRNA synthesis of cytokines (Wozniacka et al.,

2008;Wozniacka et al., 2006). Curcumin treatment prevented gp120-mediated release of ROS,

TNF-α and MCP-1 in mouse microglial cells line N9 and protected primary rat cortical neurons

from apoptosis (Guo et al., 2013). Simvastatin prevented Tat induced upregulation of

inflammatory genes (Andras et al., 2008). Since neurological disorders are becoming more

prevalent in HIV-1 infected patients and inflammation is a common immune response,

identifying therapeutic compounds that can effectively permeate the BBB and exhibit anti-

inflammatory properties may provide an additional option in preventing/treating HIV-associated

neurological disorders.

1.8.1 Minocycline

Minocycline, a second generation tetracycline derivative, has been widely reported to have

neuroprotective properties (Orsucci et al., 2009). Due to its small molecular weight (495 kDa)

and highly lipophilic nature, minocycline can cross into BBB and has been known to penetrate

into the CSF of humans better than other tetracyclines. Minocycline was originally developed to

treat gram negative and gram positive bacterial infections. Currently, minocycline is

recommended for treatment of anthrax, acne, gonorrhoea, acute intestinal amoebiasis, respiratory

tract infection, chlamydial infections and a number of other infections.

Numerous published studies have documented that minocycline exhibits neuroprotective and

anti-inflammatory effects in various animal models (Cai et al., 2010;Ryu and McLarnon, 2006).

Administration of minocycline has been shown to successfully reverse the activation of glial

cells and secretion of inflammatory cytokines in an Aβ injected rat model (Ryu et al., 2004).

Minocycline administration resulted in beneficial effects in clinical trials for multiple sclerosis,

rheumatoid arthritis and asthma (Daoud et al., 2008;Zabad et al., 2007). In a recent study,

treatment with minocycline significantly attenuated the increase of immune activation markers

(i.e., CD38, CD69, HLA-DR,CCR5, IL-10, soluble CD14, LPS) in a humanized NOD/LtsZ-

scidIL-2Rγnull

mice model (Singh et al., 2014).

Page 60: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

41

Minocycline is also known to exhibit an anti-HIV-1 effect (Copeland and Brooks, 2010;Szeto et

al., 2010). In vitro, minocycline reduced HIV-1 replication and decreased CD4 T-cell activation.

Minocycline decreased the activation and proliferation markers (i.e., CD25, Ki-27) and

decreased cytokine secretion (IL-2, IFN-γ, TNF-α) (Szeto et al., 2010). Minocycline also reduced

CCR5 expression on CD4+ T-cells that may potentially reduce the spread of R5-tropic viruses

(Szeto et al., 2010). In vivo, minocycline was able to decrease viral plasma load and viral RNA

in the brain of Simian immunodeficiency virus (SIV) macaque model (Zink et al., 2005).

However, in a clinical study, minocycline administration was unable to decrease HIV-1 viral

load in the CSF (Ho et al., 2011). Another study has further reported that minocycline treatment

was unsuccessful to improve the neurocognitive outcome in patients with cognitive impairment

after 24 weeks of administration (Sacktor et al., 2011). Similarly, in a Ugandan population,

minocycline treatment did not improve cognitive function in therapy naive, HIV-infected

individuals (Nakasujja et al., 2013). Interestingly, in a SIV model of neuropathogenesis, early

administration of minocycline was reported to be effective against striatal dopaminergic system

dysfunction, suggesting that timely treatment initiation may contribute to minocycline efficacy

(Meulendyke et al., 2012). Using proton magnetic resonance spectroscopy in SIV infected

macaques and examining biomarkers in post-mortem tissues, Ratai et al. reported that

minocycline could attenuate a progressive decline in neuronal integrity, decrease glial activation

and CSF and plasma viral loads (Ratai et al., 2010). Following minocycline treatment, decreased

plasma viral load and monocyte activation was also observed in this primate model (Campbell et

al., 2011). It is still inconclusive if administration of minocycline in earlier stage of infection will

have a better clinical outcome in HIV-infected patients. Therefore, further investigation is

required to determine the potential anti-inflammatory effects of minocycline during HIV-1-

associated inflammatory response.

1.8.2 Chloroquine

Chloroquine, an anti-malarial drug, has been used to treat malaria for several decades and it is

recently being used to treat inflammatory disorders such as rheumatoid arthritis and systemic

lupus erythematosus. Studies have also demonstrated beneficial effects of chloroquine against

HIV-1 infection. Chloroquine is a weak base that is known to affect acid vesicles leading to

dysfunction of enzymes (i.e., acid hydrolases) necessary for post-translational modifications.

Page 61: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

42

Tsai et al. demonstrated altered production of gp120 due to chloroquine (Tsai et al., 1990).

Production of gp120 decreased in T- cells after chloroquine administration (Tsai et al., 1990).

Chloroquine may also inhibit HIV-1 replication by restricting intracellular iron distribution

which may lead to inhibition of ribonucelotide reductase necessary for viral replication.

Chloroquine has been shown to interfere with toll-like receptor 7 downstream pathways to

prevent activation of transcription factors to block the production of IFN-α (Martinson et al.,

2010;Ries et al., 2012;Sun et al., 2007).

A number of studies have also investigated the anti-inflammatory properties of chloroquine in in

vivo animal models. Chloroquine has been found to decrease mRNA synthesis of cytokines

(Naarding et al., 2007;Savarino et al., 2001;Wozniacka et al., 2008;Wozniacka et al., 2006). In a

LPS injected rat model, chloroquine significantly diminished LPS-mediated upregulation of

serum cytokines (Hong et al., 2004). In another study, administration of chloroquine in rats up to

four consecutive days completely prevented a bacterial toxin induced intracerebral toxicity

(Hagihara et al., 2000). The administration of hydroxyl analogue of chloroquine

(hydroxychloroquine) in HIV-1 infected patients resulted in a decrease in detectable viral RNA

and IL-6 levels in plasma suggesting a therapeutic potential of this compound (Sperber et al.,

1995). Another study reported reduced T-cell activation in chronic HIV-infected patients due to

chloroquine administration (Murray et al., 2010). In contrast, chloroquine administration in HIV-

1 infected patients on antiretroviral therapy did not improve T-cell activation or inflammatory

markers (Routy et al., 2014). Therefore, it is inconclusive if chloroquine has the potential to

reverse HIV-associated inflammatory response.

1.8.3 Simvastatin

Simvastatin, a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, is known to have

anti-inflammatory properties. Similar to other statins, simvastatin strongly inhibits endogenous

cholesterol synthesis by inhibiting 3-hydroxy-3-methylglutaryl coenzyme A reductase and also

inhibits the synthesis of isoprenoid intermediates (i.e., geranylgeranylpyrophosphate) that act as

important lipid attachments for post-translational modifications for a number of proteins.

Simvastatin is known to have anti-inflammatory properties and demonstrates neuroprotective

effects in various animal models (Adamson and Greenwood, 2003;Andras et al., 2008;Jiang et

al., 2007). In dyslipidemic patients, simvastatin treatment decreased IL-8 production in

Page 62: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

43

neurtrophil leukocytes (Marino et al., 2014). In a rodent model of traumatic brain injury,

administration of simvastatin in rats attenuated the activation of microglia and astrocytes (Li et

al., 2009). In a study by Andras et al., simvastatin prevented Aβ and HIV-1 Tat induced

upregulation of inflammatory genes in human brain microvessel endothelial cells (Andras et al.,

2008). Besides anti-inflammatory properties, simvastatin also exhibits anti-HIV effects. A study

by Navatob et al. demonstrated that simvastatin may limit the infection of R5 tropic virus in vitro

by disrupting CC-chemokine receptor and CC-chemokine expression pattern (Nabatov et al.,

2007). Amet et al. has demonstrated that simvastatin and lovastatin increased intracellular Gag

and decreased viral release from chronically infected cells due to diminished geranylgeranylation

(Amet et al., 2008). Simvastatin has also been reported to attenuate Aβ accumulation in brain

endothelial cells by increasing low density lipoprotein related receptor protein-1 (LRP1)

expression and decreasing HIV-1 induced receptor for advanced glycation end products (RAGE)

expression in hCMEC/D3 cells (Andras et al., 2010). In addition, pre-treatment with simvastatin

decreased HIV-1 induced accumulation of Aβ in these cells suggesting protective role of statins

at the BBB against Aβ accumulation (Andras et al., 2010). Overall, these studies indicate that

simvastatin has the potential to be used against the brain inflammatory responses observed

during HIV-1 infection.

1.9 Signaling pathways

Experimental data from various in vitro and in vivo models suggest the involvement of different

signal transduction pathways in the regulation of cytokine secretion and ABC transporters during

HIV-associated brain inflammation (Ashraf et al., 2011;Hayashi et al., 2006;Ronaldson et al.,

2010). Potential anti-inflammatory compounds are also known to target different signaling

pathways to attenuate the inflammatory response. For example, simvastatin has been reported to

reverse the production of TNF-α by inhibiting the MAPK and NF-κB pathways in cultured

endothelial cells (Jiang et al., 2007). Minocycline is also known to attenuate LPS-induced

increase in iNOS and nitric oxide expression by inhibiting MAPK and NF-κB in retinal

microglia (Yang et al., 2007). These two pathways are discussed briefly below:

Page 63: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

44

1.9.1 NF-кB

NF-κB is a transcription factor that was first discovered in the nuclei of mature B lymphocytes

(Nabel and Baltimore, 1987). Since then, the activation of NF-κB has been associated with

numerous immune and inflammatory responses. Unlike other transcription factors, NF-κB is a

cytosolic protein bound to inhibitor of NF- κB (IκB) protein which is regulated by an upstream

kinase known as IκB kinase complex (IKK). Upon activation by different stimuli, IκB is

phosphorylated by IKK followed by degradation that in turn triggers the translocation of

unbound NF-κB to the nucleus where it initiates transcription of specific target genes (Bonizzi

and Karin, 2004;Schmitz et al., 2004). A number of signals can activate NF-κB such as

inflammatory cytokines, phorbol esters, oxidative stress, UV light, bacterial and viral products

and growth. NF-κB can activate and enhance transcription of genes involved in inflammation

(i.e., TNF-α) (Bonizzi and Karin, 2004;Schmitz et al., 2004;Shah and Kumar, 2010).

Studies have demonstrated that NF-κB is activated in human brains of patients with Alzheimer’s

disease (Boissiere et al., 1997). NF-κB activation was also found to be related with the

pathophysiological responses associated with Parkinsons’s disease (Hunot et al., 1997). Since

inflammation is a component of these neurodegenerative diseases, it has been suggested that this

transcription factor may play a role in HIV-infection of the brain (Atwood et al., 1994). Studies

have demonstrated that NF-κB plays an important role in HIV-1 transcription, thereby, making

this transcription factor a potential pathway for anti-HIV therapy (Mingyan et al., 2009). NF-κB

activation has been found to be associated with cytokine secretion in myeloid cells during HIV-1

infection suggesting a pivotal role of this pathway during inflammation in the CNS. In addition,

NF-κB is known to be activated in different brain cells (i.e., endothelial cells, microglia and

astrocytes) during HIV-1 infection (Hayashi et al., 2005;Sui et al., 2007). Interestingly, NF-κB is

activated by inflammatory signals (i.e., cytokines) and in turn, can also activate and enhance

transcription of genes involved in inflammation (i.e., TNF-α) (Bonizzi and Karin, 2004;Schmitz

et al., 2004). Similar phenomenon has been observed with the MAPK pathway where various

cytokines amplify their own signals by activating components of these pathways. Evidence also

suggest that occasional cross-talk between NF-κB and MAPK occurs during regulation of several

transcription factors and gene transcription (Liu and Lin, 2007). Therefore, the potential

involvement of this pathway during HIV-associated inflammation needs further investigation.

Page 64: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

45

1.9.2 MAPKs

The MAPK pathway consists of a large family of serine/threonine kinases that construct a highly

regulated network of intracellular signaling pathways involved in generating various cellular

responses in the presence of extracellular stimuli and in turn, regulate multiple critical cellular

functions (i.e., gene expression, cytoskeletal organization, cell division) (Pearson et al., 2001)

The three main subfamilies of the MAPK pathway are extracellular signal-regulated kinases

(ERKs), c-jun N-terminal kinases (JNKs) and P38 kinases (P38Ks).These kinases are known to

be actively involved in regulating cytokine secretion as well as the expression of drug efflux

transporters (Hayashi et al., 2006;Leghmari et al., 2008;Ronaldson et al., 2010). These

pathways are also involved in various pathological processes associated with HIV-1 infection

(i.e., neurotoxicity, macrophage activation, viral replication) (Furler and Uittenbogaart,

2010;Medders and Kaul, 2011). A recent study has further demonstrated that inhibition of these

kinases can downregulate HIV-1 infection in vitro (Gong et al., 2011). Therefore, further

examination of these pathways during HIV-associated brain inflammation is necessary.

Page 65: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

46

Figure 1-8 The MAPK pathway (From Ronaldson et al., 2008. Glia. 56: 1711:1735).

1.9.2.1 ERK1/2

ERK1 and ERK2 were the first identified members of the ERK subfamily. These two kinases

have been widely studied due to their pronounced role in cell growth and differentiation, cell-

cycle regulation and cell survival (Whitmarsh and Davis, 2000). Although another five ERK

isoforms have been identified in different cell systems, their function and physiological

relevance is not yet fully understood. Previously, only growth factors were considered as

activators of the ERK1/2 pathway and the regulatory role of these kinases in cancer or tumor cell

growth have been examined extensively (Boulton et al., 1991;Cobb et al., 1991b). Besides

growth factors, other factors such as pro-inflammatory cytokines, viral infection or carcinogens

can also activate this pathway (Boulton et al., 1991;Cobb et al., 1991a). The upstream kinase of

ERK1/2 is MEK1/2 (Alessi et al., 1995). PD98059 and U0126 are two well-established MEK

inhibitors that can manipulate ERK1/2 regulated cellular activities (Dudley et al., 1995;Favata et

Reproduced with permission from the copyright owner

Page 66: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

47

al., 1998). The downstream targets of ERK1/2 include transcription factors c-fos, ELK1 and

CREB (Kyosseva, 2004).

Activation of the ERK1/2 has been observed in primary cultures of astrocytes and microglia in

response to LPS (Pyo et al., 1998;Schumann et al., 1998). An increase in ERK1/2

phosphorylation was found to be associated with cognitive and motor deficits during brain injury

in rats (Dash et al., 2002). In the context of HIV-1, gp120 or whole virus-mediated activation of

Raf-1, an upstream kinase of ERK1/2, led to profound but transient upregulation of ERK1/2

(Popik and Pitha, 1996). The same group demonstrated that MEK/ERK pathway was activated

by both CCR5 and CXCR4-tropic viruses. Other viral proteins have also been implicated in the

activation of ERK1/2. This pathway was found to be involved in Tat stimulated TNF- α

production in human macrophages (Leghmari et al., 2008). Using rat hippocampal slices, Tat-

mediated release of TNF-α and MCP-1 was found to be mediated by ERK1/2 activation.

Treatment with resveratrol inhibited ERK1/2 phosphorylation and attenuated Tat-induced release

of TNF-α and MCP-1 (Lee et al., 2011). Another viral protein Nef-mediated upregulation of

ICAM-1 was found to be ERK1/2 dependent and inhibition of ERK1/2 blocked ICAM-1

upregulation in endothelial cells (Fan et al., 2010).

1.9.2.2 JNKs

The three main subtypes of JNKs (JNK1, JNK2 and JNK3) are encoded by three different genes

and a total of 10 isoforms result from alternative splicing (Kumagae et al., 1999;Mielke and

Herdegen, 2000). JNKs respond to various cellular stress inducers (UV, heat shock,

cycloheximide) as well as pro-inflammatory cytokines (i.e., TNF-α , IL-1β) (Sluss et al., 1994).

As a result, these enzymes are also known as stress-activated proteins kinases (SAPKs). The full

activation of JNKs requires the phosphorylation of both Thr183 and Tyr185 residues by specific

upstream kinases, MKK4 and MKK7 (Johnson et al., 2007). Once activated, JNK phosphorylates

and in turn activates a number of transcription factors and non-transcription factors. In addition

to c-jun, the first identified downstream target of JNK, other JNK regulated transcription factors

are ATF-2, ELK-1, p53 and c-myc (Mielke et al., 1999). The non-transcription factors that are

also phosphorylated by JNK include members of the B-cell lymphoma 2 (Bcl-2) family and the

result of their activation can lead to apoptosis, motility, immune response, metabolism or DNA

repair (Jhonson et al., 2007).

Page 67: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

48

JNK1 and JNK2 are ubiquitously expressed in the body whereas JNK3 is expressed primarily in

the brain, and to a lesser extent in heart and testis (Kyriakis et al., 1994). However, JNKs may

have an isoform specific role in different cell systems (Gupta et al., 1996;Pawate and Bhat,

2006). All three isoforms have been detected in glial cells (microglia and astrocytes), but their

specific functional roles are not clearly understood (Hidding et al., 2002;Waetzig et al.,

2005;Zhang et al., 1998;Zhang et al., 1996).

It is established that JNKs are involved in the pathogenesis of various CNS diseases, such as

Alzheimer’s, Parkinson’s, ischemia, HIV-1 associated inflammation (Kumagae et al., 1999).

Therefore, inhibition of JNKs may provide anti-inflammatory effects in the brain. Studies in

cultured microglia and LPS injected mice showed that inhibition of JNKs attenuated LPS-

induced TNF-α secretion (Ciallella et al., 2005). In the context of HIV-1 infection, JNKs are also

known to be activated by viral proteins. Vpr induced apoptosis was found to be mediated by

activation of JNKs and subsequent downregulation of anti-apoptotic genes (Mishra et al., 2007).

HIV-1 or gp120-mediated activation of ERK1/2 and JNK pathways were also observed in

primary culture of microglia, astrocytes and neurons where treatment with HIV-1 or gp120

resulted in apoptosis in microglia and neurons (Lannuzel et al., 1997).

Several inhibitors of the JNKs (i.e., CEP-11004, CEP-1347, SP600125) have been effectively

used both in in vitro and in vivo models of brain inflammation (Bogoyevitch et al., 2004;Han et

al., 2001;Saporito et al., 2002;Vincenti and Brinckerhoff, 2001) providing evidence that JNK

inhibition might be a desirable target against neuroinflammation. CEP1347 has been shown to

inhibit gp120-mediated apoptosis in hippocampal neurons (Bodner et al., 2002). In cultured rat

embryonic neurons, the increased activity of JNKs and the subsequent neuronal death was

blocked by CEP-1347 (Maroney et al., 1998). In another study, CEP-11004 inhibited LPS

induced TNF-α secretion in cultured microglia and in LPS injected mice (Ciallella et al., 2005).

These data provide evidence that JNK inhibition might be a desirable target against neuro-

inflammation. A recently developed mixed lineage kinase 3 inhibitor, URMC-099, has shown

increased BBB permeability and shown potential in in vitro and in vivo models (Goodfellow et

al., 2013). URMC-099 inhibited LPS-induced TNF-α release in microglia, Tat- induced cytokine

release in human monocytes and upregulation of phospho-JNKs in Tat-injected mouse brain.

Page 68: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

49

This compound also exhibited neuroprotective and anti-inflammatory properties in both in vitro

and in vivo models of HIV-1 associated brain inflammation (Marker et al., 2013).

1.9.2.3 P38Ks

To date, four isoforms of P38K have been identified in humans (α, β, γ and δ) and data suggest

that P38αK and P38βK play a major role during inflammatory and immune responses. However,

the cellular and physiological role of P38γ and P38δ in inflammation are not yet clearly

understood. P38Ks are activated by dual phosphorylation on Thr180 and Tyr182 residues by

upstream kinases, MKK3 and MKK6 (Kyriakis and Avruch, 2001). SB203580 is a known

inhibitor of P38α and β isoforms. Some of the typical target transcription factors of P38Ks are

ATF2, Elk1 or SAP1 (Cohen et al., 1997). Similar to the JNKs, P38Ks are activated by cellular

stress, i.e., UV radiation, osmotic or heat shock, LPS and pro-inflammatory cytokines (Cuenda et

al., 1995). These kinases also play a major role in mediating inflammation-related responses

(Cuenda and Rousseau, 2007).

Evidence suggests that P38Ks are involved in the regulation of gene expression of several

cytokines (i.e., TNF-α, IL1-β) during neuroinflammatory conditions. For example, inhibition of

P38Ks prevented LPS-induced TNF-α production in rats (Zhu et al., 2005; Badger et al., 1996).

Both Tat and Nef-induced TNF-α production in human macrophages was found to be P38K

dependent (Kumawat et al., 2010;Leghmari et al., 2008). Viral protein Nef-mediated activation

of JNK, P38K and NF-кB pathways have also been reported in murine macrophages (Mangino et

al., 2012). Effect of Vpr on neuronal death has been found to be partly mediated through release

of pro-inflammatory cytokines IL-1β and IL-10. JNK as well as P38K pathways were found to

be involved in the release of these cytokines in monocyte derived macrophages(Guha et al.,

2012). P38K was also found to be involved in LPS-enhanced transcytosis of HIV-1 across brain

microvessel endothelial cells (Dohgu and Banks, 2008). This pathway is known to be involved in

HIV-1 replication. In an in vitro study done in T-cell and monocyte cell lines, inhibition of P38K

blocked viral replication (Muthumani et al., 2004). Therefore, the inhibition of this pathway

leads to successful suppression of cytokine synthesis. Several P38K inhibitors that have shown

successful cytokine suppression have been tested in clinical trials (Kaminska, 2005;Lee et al.,

2000;Schindler et al., 2007). The protective role of P38K inhibitors in the CNS suggest a

Page 69: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

50

therapeutic strategy against inflammatory conditions seen in HIV-1 infection and

neurodegenerative diseases.

1.9.3 Regulation of ABC transporters by MAPK and NF-кB

Ample evidence suggest that MAPK and NF-кB are involved in the regulation of transporters.

ERK1/2 are known to regulate the expression of both P-gp and Mrp1. In both human breast

carcinoma and gastric carcinoma cell lines, ERK1/2 inhibition resulted in significant decrease in

P-gp protein expression (Katayama et al., 2007). In cultured astrocytes, ERK1/2 inhibition

resulted in the attenuation of Tat-mediated upregulation of Mrp1 protein expression (Hayashi et

al., 2006). Activation of ERK pathway upregulated ABCG2 mRNA expression, whereas,

activation of JNKs downregulated ABCG2 mRNA expression in human acute lymphoblstic

leukemia cell lines (Tomiyasu et al., 2013).

Similar to ERK1/2, JNKs are also known to be involved in the regulation of ABC transporter

expression. JNK activation led to a decrease in mRNA and protein expression of P-gp in several

carcinoma cell lines (Zhou et al., 2006). C-jun, a downstream target of the JNK pathway, was

also found to be involved in the downregulation of MDR1 gene in a human cell line (Miao and

Ding, 2003). In the context of HIV-1 infection, Hayashi et al. has demonstrated that viral protein

Tat-induced upregulation of Mrp1 is ERK1/2 and JNK pathway dependent in brain microvessel

endothelial cells and in astrocytes (Hayashi et al., 2006). P38Ks are also involved in regulating

transporter expression. In a mouse leukemic cell line, the reversal of MDR phenotype was

observed after inhibiting the P38K pathway (Barancik et al., 2001). Other studies have

demonstrated the role of the NF-κB pathway in the regulation of P-gp expression (Bentires-Alj et

al., 2003;Yu et al., 2008). Regulation of ABC transporters has also been demonstrated in the

mouse BV-2 microglia cell line where exposure to LPS significantly reduced functional

expression of ABC transporters (e.g. Mdr1, Bcrp, Mrp4), presumably, through interactions with

the NF-κB pathway (Gibson et al., 2012). Based on these observations, it is clear that regulation

of these transporter is very complex, cell/tissue specific and dependent on disease related

pathologies.

Page 70: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

51

1.9.4 Effect of anti-inflammatory compounds on MAPK and NF-кB

Many compounds have demonstrated anti-inflammatory properties by interacting with MAPK or

NF-кB pathway. For example, curcumin and CDDO-methyl ester have suppressed activation of

NF-кB, whereas, cathechols have been found to attenuate both NF-кB and P38K activation (Tran

et al., 2008;Zheng et al., 2008b). Flurbiprofen derivative HCT1026 can inhibit cytokine induced

activation of signaling pathways in macrophages (Idris et al., 2009). Simvastatin has been shown

to reverse the production of TNF-α by inhibiting the MAPK and NF-kB pathways in cultured

endothelial cells (Jiang et al., 2007). Simvastatin has also been reported to inhibit LPS-

stimulated ERK1/2 activation (Sundararaj et al., 2008).

Chloroquine inhibited the phosphorylation of P38K in coronavirus infected human fetal lung cell

line (Kono et al., 2008). SB203580, a P38K inhibitor, suppressed viral replication in this cell

system suggesting that chloroquine may inhibit replication of coronavirus by suppressing P38K

pathway (Kono et al., 2008). Both in a murine B-lymphoma and in a monocytic cell line, CpG-

DNA induced phosphorylation of JNKs, P38Ks as well as their downstream targets c-Jun and

ATF-1 were observed (Yi and Krieg, 1998). Administration of chloroquine inhibited CpG-DNA

induced secretion of TNF-α and IL-6 by blocking phosphorylation of JNKs and P38Ks. NF-кB

was also found to be activated in these cell lines due to CpG-DNA exposure. Inhibition of NF-

кB as well as administration of a P38K inhibitor attenuated cytokine secretion suggesting

involvement of signaling pathways in generating inflammatory response (Yi and Krieg, 1998). In

a SIV model, minocycline administration has shown similar inhibitory effect on P38K and JNK

phosphorylation in the brain (Follstaedt et al., 2008). In microglial and spinal cord culture

system, minocycline attenuated glutamate-induced microglial activation, release of NO and IL-

1β by preventing P38K phosphorylation (Tikka et al., 2001). These studies provide evidence that

many compounds exert their anti-inflammatory properties by interacting with different signaling

pathways.

Although the mechanisms of action for some of these compounds are unknown in astrocytes or

microglia during HIV-1 infection, their ability to suppress inflammation indicates that signaling

pathways associated with the regulation of pro-inflammatory genes are likely to be involved.

Since these compounds have the potential to be used alongside antiretroviral drugs to mitigate

Page 71: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

52

the sufferings of patients with neurocognitive disorders, there effect on HIV-associated brain

inflammation should be investigated in greater detail.

1.10 In vitro and in vivo models to study drug transport and HIV-

associated brain inflammation

1.10.1 In vitro systems

In order to understand the CNS-specific role of drug transporters, numerous brain microvessel

endothelial cells and glial cell culture systems have been established (Nicolazzo et al.,

2006;Poller et al., 2008;Tsuji et al., 1992). To date, many researchers have established primary

cultures of brain microvessel endothelial cells from a number of mammalian species (i.e.,

bovine, porcine, murine, human). In addition, several immortalized rodent and human cell

systems were also generated (i.e., rat RBE4, GPNT, b.End3, BB19, NKIM-6, HCMEC/D3)

(Tsuji et al., 1992;Van Bree et al., 1992). Among these systems, the immortalized HCMEC/D3

cell line generated from human brain microvessel endothelial cells is one of the most established

and extensively characterized system to study drug transport across the BBB (Poller et al., 2008).

HCMEC/D3 cell line has been shown to retain several morphological and functional

characteristics of the brain microvessel endothelial cells in vivo. Dauchy et al. compared the gene

and functional expression of various ABC transporters between HCMEC/D3 and freshly isolated

human brain microvessels and reported that P-gp and BCRP expression are lower in HCMEC/D3

than in the human microvessels, but functional expression remains comparable (Dauchy et al.,

2009). Isolated brain capillaries from rodent brain tissues are also used to perform functional

assay and understand regulation of drug transporters (Bauer et al., 2007;Miller et al., 2000).

In order to study drug transport in brain parenchymal cells, standard procedures have been

established to generate primary cultures of astrocyte or microglia (Decleves et al., 2000;Hong et

al., 2000;Tanaka and Maeda, 1996) (Dallas et al., 2003;Hong et al., 2001;Lee et al.,

2001a;Ronaldson et al., 2004a;Schlichter et al., 1996). Mouse or rat neonatal brain tissues are

generally used to establish astrocyte cultures since astrocytes are still immature and continue to

divide at this stage. The process of astrocyte isolation involves mechanical and enzymatic

methods. The isolation process and culture conditions (i.e., lack of flask coating) do not allow

neuronal contamination. Microglia are the principal contaminating cells in astrocyte cultures.

After confluency, the cultured astrocytes are shaken to remove microglia that can be used to

Page 72: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

53

establish primary cultures of microglia. However, a major obstacle in working with microglia

has been the difficulties associated with obtaining a large number of primary microglial cells to

routinely perform studies. Therefore, immortalized cell systems, BV-2 and N9 are mostly

utilized. However, microglial activation can be poorly reproduced in these systems and these cell

lines also exhibit a limited cytokine and chemokine profile compared to primary cultures of

microglia.

Since the BBB is considered a dynamic multi-compartment unit, advances have been made to

establish co-culture systems where mixed cultures of cells are grown either together or in

separate compartments using transwell systems. A co-culture system may allow cell-cell

communication or generate specific signaling proteins or tropic factors necessary for the

differentiation and proliferation of neighboring cells. Therefore, co-culture systems with mixed

glia or pericytes have been considered a more physiological model of BBB (Meyer et al.,

1991;Pardridge, 1999). Several studies have also described dynamic three-dimensional model of

the BBB where drug transport properties are studies in brain microvessel endothelial cells co-

cultured with other cellular components of the neurovascular unit under flow conditions (Cucullo

et al., 2008).

Exposure to cultured brain microvessel endothelial cell or astrocytes or microglia to HIV-1/viral

proteins/LPS can induce secretion of inflammatory cytokines, ROS and other neurotoxic factors.

Therefore, these systems are often used to delineate regulation of transport activities during

inflammation or oxidative stress (Ronaldson and Bendayan, 2008). For example, regulation of P-

gp along with other ABC transporters has been demonstrated in the mouse BV-2 microglia cell

line where exposure to LPS significantly reduced functional expression of ABC transporters

(e.g., Mdr1, Bcrp, Mrp4) (Gibson et al., 2012).

1.10.2 In vivo models

Many animal models have also been generated to study HIV-associated brain inflammation. SIV

infected rhesus macaques has been widely used as an established animal model to study HIV

infection as well as HIV-associated brain inflammation (Rausch et al., 1999;Sasseville and

Lackner, 1997). SIV infected primates develop a progressive immune dysfunction characterized

by depletion of CD4+ T-cells. Similar to HIV-1 infected individuals, these non-human primates

develop reservoirs in resting CD4+ T-cells as well in the brain. Microglial activation, astrogliosis

Page 73: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

54

and multinucleated giant cells have been seen in SIV-infected macaque brains (Petry and Luke,

1997). Feline immunodeficiency virus (FIV) infection is also being used to study HIV-

pathogenesis (Miller et al., 2011). FIV infects feline populations and causes pathology similar to

HIV. Neuropathological changes as well as behavioral and psychological impairments have also

been observed in this model (Fletcher et al., 2011;Maingat et al., 2009). HIV-1 transgenic rat

model has been shown to be another model for examining HIV-associated immune response in

the periphery as well as in the brain. This model is developed by expressing a modified HIV

transgene with functional deletion of the gag and pol genes that makes the virus non-infectious

(Reid et al., 2001). These transgenic rats also develop cognitive and motor deficits (Reid et al.,

2001). Pro-inflammatory cytokines (IL-1β, IFN-γ,TNF-α) were found to be significantly

elevated in brain lysates of transgenic rats compared to wildtype controls. Other transgenic

mouse models are also available that express specific viral proteins (gp120 or Tat).

SCID mice injected with HIV-1 in the brain is a model that mimics several important

pathological changes observed during HIVE (i.e., activation of microglia, reactive astrogliosis,

neuronal apoptosis). This model is generated by inoculating cultured monocytes isolated from

HIV-1 infected patients into the mice brain. Persidsky et al. demonstrated that inflammatory

response was detectable on day 3 after inoculation and HIV-1 antigens were found in the mice

brain tissue up to 5 weeks (Persidsky et al., 1996). Immunohistochemistry on fixed brain

sections confirmed the inflammatory reactions such as activation of glial cells and presence of

pro-inflammatory cytokines (i.e., TNF-α, IL-6, IL-1β). Pathological changes were also observed

at sites distant from the inoculation area in the mice brain. In addition, neuronal cell death and

behavioral abnormalities were also noticed in the SCID mice model of HIVE (Persidsky et al.,

1996;Potula et al., 2005;Potula et al., 2008). A number of humanized mice models [i.e., hu-

PBL-SCID, SCID-hu-thy/liv, NOD/SCID-γ(c)(-/-), NOD/SCID-Rag 2(-/-)γ(c)(-/-)] has also been

used to investigate HIV-associated neuropathogenesis (Zhang et al., 2010).

Ample evidence suggests that intracerebral injection of gp120 or Tat leads to the activation of

glial cells and neuronal loss in rodent brains (Bansal et al., 2000;Louboutin et al.,

2010b;Nosheny et al., 2004). In different animal models, doses of gp120 ranging from 100ng to

500 ng (administered intracerebrally) have been shown to induce an inflammatory response. One

study demonstrated that when administered chronically (for 3 to 7 days) into the lateral ventricle,

Page 74: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

55

gp120 can induce prominent neuronal cell-death in cerebral cortex by activating caspase-3

(Acquas et al., 2004). Louboutin et al. have shown that chronic expression of gp120 in rat can

lead to ongoing brain inflammation (Louboutin et al., 2010b). In their system, an SV-40 derived

vector expressing gp120 was injected in rat caudate-putamens and chronic apoptosis of microglia

and neurons, secretion of MIP-1α and an increase in oxidative stress was observed. In this study,

different doses of gp120 was also injected in the rat caudate-putamens for 1 h, 6 h,1d, 2d, 4d, 7d,

14d and 28 days which resulted in increased glial population upto 14 days in a time and dose-

dependent manner (Louboutin et al., 2010b). Therefore, intracerebral injection of viral proteins is

another potential method to generate an in vivo model of HIV-1 associated brain inflammation.

2 Goal

The goals of this project are i) to understand the regulation of drug efflux transporters in

astrocytes during HIV-1 gp120 associated inflammation and ii) to identify potential anti-

inflammatory compounds that can successfully reverse HIV-1 gp120-associated brain

inflammation in vivo.

3 Rationale

Inflammation is a common immune response associated with brain HIV-1 infection that can

result in BBB disruption and neuronal loss (de Vries et al., 1997;Genis et al., 1992). Both

microglia and astrocytes are known to play significant roles in HIV-associated chronic brain

inflammation (Becher et al., 2000). Secretion of cytokines can further alter the expression of

drug efflux transporters (Hayashi et al., 2005;Ronaldson and Bendayan, 2006). Our laboratory

has extensively characterized the regulation of P-gp and Mrp1, two major transporters involved

in antiretroviral drug permeation, by HIV-1 gp120 in primary cultures of rodent astrocytes in

vitro (Ronaldson and Bendayan, 2006;Ronaldson and Bendayan, 2008). Previous work from our

laboratory suggests that HIV-1 gp120 mediated secretion of cytokines resulted in altered P-gp

expression in primary cultures of rat astrocytes (Ronaldson and Bendayan, 2006). It is not known

if P-gp is regulated in a similar manner in human astrocytes. The regulation of other ABC

transporters by gp120-mediated inflammation has not been examined in astrocytes. It is yet to be

established how different signaling pathways (MAPK and/or NF- κB) are involved in the

Page 75: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

56

regulation of cytokine secretion and drug transporters in this cell system. The regulation of drug

efflux transporters in astrocytes during HIV-1 gp120 associated inflammation is necessary to

understand antiretroviral drug permeation into these cells during pathological conditions. In

addition, identification of potential anti-inflammatory agents that can prevent cytokine secretion

in both microglia and astrocytes can be an effective therapeutic approach against the severity of

brain inflammation during brain HIV-1 infection. Therefore, development of an in vivo model of

HIV-1 gp120 associated brain inflammation to assess the anti-inflammatory effect of different

compounds is required. Understanding the mechanisms underlying CNS inflammatory response

and drug resistance and identifying potential anti-inflammatory agents may benefit in reversing

HIV-1 associated inflammatory responses in the brain.

Page 76: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

57

4 Hypotheses

i) HIV-1 gp120 triggers secretion of cytokines (TNF-α, IL-6 and IL1-β) and regulates membrane

drug efflux transporters (P-gp and Mrp1) through interacting with signaling pathways (i.e.,

MAPK) in astrocytes.

ii) HIV-1 gp120 induces an inflammatory response, alters drug efflux transporters and activates

signaling pathways in rodent brain.

iii) Anti-inflammatory agents (i.e., simvastatin, chloroquine, minocycline) can reverse HIV-1

gp120-associated cytokine release in the brain.

5 Objectives

1) To investigate the role of MAPK and NF-κB pathways in the regulation of P-gp and Mrp1 in

primary cultures of rat/human astrocytes exposed to pro-inflammatory cytokines (i.e., TNF-α,

IL-6 and IL1-β) or gp120.

2) To implement and characterize an in vivo model of HIV-associated brain inflammation by

intracerebroventricular (ICV) administration of gp120 in rodents

3) To evaluate the potential therapeutic effect of anti-inflammatory agents (i.e., minocycline,

chloroquine) in reversing the cytokine secretion as well the disruption of BBB in our

implemented rodent model of gp120-associated brain inflammation

4) To investigate, in vivo, the role of signaling pathways (i.e., MAPK) in the regulation of the

inflammatory response in our implemented model of gp120-associated brain inflammation.

Page 77: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

58

Chapter 2

6 Regulation of Mrp1 by TNF-α in cultured glial cells:

involvement of NF-кB and JNK signaling pathways

This work is published and reproduced in this thesis with permission from ASPET:

PT Ronaldson, T Ashraf and R Bendayan. Regulation of multidrug resistance protein 1 by tumor

necrosis factor-alpha in cultured glial cells: involvement of nuclear factor- κB and c-Jun N-

terminal kinase signaling pathways.2010. Molecular Pharmacology. 77(4):644-59.

Author contributions:

Research design: PT Ronaldson (first author), T Ashraf (second author) and R Bendayan

(principle investigator).

Conducted experiments and data analysis: PT Ronaldson (Figures 6-1, 6-2, 6-3, 6-4, 6-6, 6-7,6-8,

6-11; table 1); T Ashraf (Figure 6-5, 6-6,6-7,6-8, 6-9,6-10)

Writing of the manuscript: PT Ronaldson (preparation of the manuscript and responses to

reviewer’s comments); T Ashraf (revisions, submissions and responses to reviewer’s comments)

and R Bendayan (overall conceptual and editorial review of several manuscript drafts and

responses to reviewer’s comments)

Page 78: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

59

6.1 Abstract

Pharmacotherapy of brain HIV-1 infection may be limited by ABC transporters [i.e., P-gp,

Mrp1] that export antiretroviral drugs from HIV-1 brain cellular targets (i.e., astrocytes,

microglia). Using an in vitro astrocyte model of an HIV-1 associated inflammatory response, our

laboratory has shown that cytokines (i.e., TNF-α, IL-1β, IL-6), which are secreted in response to

HIV-1 envelope gp120 exposure, can decrease P-gp functional expression; however, it is

unknown if these same cytokines can alter expression and/or activity of other ABC transporters

(i.e., Mrp1). In primary cultures of rat astrocytes, Mrp1 expression was increased by TNF-α (2.7-

fold) but was not altered by IL-1β or IL-6. Cellular retention of 2', 7’-bis-(2-carboxyethyl)-5-

(and-6)-carboxyfluorescein (BCECF), an Mrp substrate, was reduced in TNF-α treated

astrocytes, suggesting increased Mrp-mediated transport. Pharmacological inhibition of NF-κB

signaling with SN50 prevented both TNF-α release and Mrp1 expression changes in astrocytes

triggered with gp120; however, SN50 did not attenuate Mrp1 expression in cells triggered with

TNF-α. In contrast, Mrp1 functional expression was not altered in the presence of gp120 or TNF-

α when astrocyte cultures were pre-treated with SP600125, an established JNK inhibitor.

SP600125 did not affect TNF-α release from cultured astrocytes triggered with gp120. Mrp1

mRNA expression was increased after treatment with gp120 (1.6-fold) or TNF-α (1.7-fold),

suggesting altered Mrp1 gene transcription. These data suggest that gp120 and TNF-α can up-

regulate Mrp1 expression in cultured astrocytes. Furthermore, our results imply that both NF-κB

and JNK signaling are involved in Mrp1 regulation during an HIV-1 associated inflammatory

response.

Page 79: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

60

6.2 Introduction

Astrocytes, the most numerous cell type in the brain, perform multiple functions required for

CNS homeostasis. During HIV-1 infection of the brain, astrocytes are known to participate in the

immune response via release of proinflammatory cytokines (Speth et al., 2005). Increased

cytokine secretion (i.e., TNF-α, IL-1β, IL-6) during brain HIV-1 infection is well established and

may be triggered by soluble viral proteins (i.e., HIV-1 envelope gp120) (Kaul et al., 2005).

Studies in cultured glial cells suggest that gp120 binding to chemokine receptors (i.e., CXCR4,

CCR5) may mediate this inflammatory response (Ronaldson et al., 2008). In vitro, our laboratory

has shown that proinflammatory cytokine release is increased in cultured rat astrocytes treated

with gp120 via a CCR5-dependent mechanism (Ronaldson and Bendayan, 2006).

Although advances in HIV-1 pharmacotherapy have efficiently reduced systemic viral load,

HAND remains a significant cause of morbidity and mortality in HIV-1 patients (McArthur et

al., 2003). These neurological complications may be associated with poor CNS permeation of

antiretroviral compounds, a phenomenon that may be attributed to expression of ABC efflux

transporters [i.e., P-gp, MRPs/Mrps (MRPs in humans; Mrps in rodents)] at brain barrier sites

(i.e., BBB, BCSFB) and in brain cellular targets of HIV-1 (i.e., microglia, astrocytes).

MRP1/Mrp1, a 190 kDa membrane protein, extrudes from cells many organic anions as well as

their GSH, glucuronide, and sulfate conjugates (Ronaldson et al., 2008). Although MRP1/Mrp1

is primarily associated with efflux of anticancer drugs, antiretroviral agents (i.e., HIV-1 PIs) are

also known substrates of this transporter (Dallas et al., 2004a;Williams et al., 2002). Mrp1

expression has been identified in several brain cellular compartments including brain capillary

endothelial cells (Miller et al., 2000), choroid plexus epithelial cells (Wijnholds et al., 2000a)

and glial cells (Dallas et al., 2003;Ronaldson and Bendayan, 2008). In the context of HIV-1

infection, expression levels of MRP1/Mrp1 remain controversial. While studies in PBMCs

isolated from HIV-1 infected patients showed no difference in MRP1 expression as compared to

healthy individuals (Meaden et al., 2001), another study has shown higher MRP1 expression

levels in response to HIV-1 infection (Turriziani et al., 2008). The high variability in the data can

be, in part, explained by differences in therapeutic regimens because some antiretroviral drugs

are known to alter expression of membrane transporters (Ronaldson et al., 2008;Zastre et al.,

2009).

Page 80: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

61

Cytokine secretion (i.e., TNF-α, IL-1β, IL-6) in response to infection or cell stress may alter

MRP1/Mrp1 functional activity. Using a human hepatoma cell line (HepG2), IL-1β and IL-6

treatment resulted in an increase in MRP1 mRNA expression and transport activity (Lee and

Piquette-Miller, 2003). Studies in Sprague-Dawley rats have demonstrated that treatment with

LPS, a bacterial endotoxin that stimulates cytokine release, enhances hepatic Mrp1 mRNA

expression, suggesting involvement of cytokines in regulating Mrp1 expression (Cherrington et

al., 2004). In contrast, studies in human monocyte-derived macrophages reported that gp120-

induced production and secretion of TNF-α and IL-6 were not correlated to altered expression of

MRP1 (Jorajuria et al., 2004).

Cellular exposure to HIV-1 virions, HIV-1 viral proteins and/or cytokines is associated with

activation of intracellular signaling systems such as NF-κB (Kim et al., 2005) and the MAPK

pathway (Ghorpade et al., 2003;Hayashi et al., 2006;Hayashi et al., 2005). Additionally, both

NF-κB and components of the MAPK pathway [i.e., JNKs] have been implicated in the

regulation of ABC transporters such as P-gp (Bauer et al., 2007;Hartz et al., 2008;Zhou et al.,

2006) and Mrp1 (Hayashi et al., 2006). Currently, there are no published reports demonstrating

the involvement of either pathway in the regulation of Mrp1 in glial cells exposed to HIV-1

gp120 and/or cytokines.

Recently, our laboratory has reported increased functional expression of Mrp1 in response to

oxidative stress in cultured rat astrocytes treated with gp120 (Ronaldson and Bendayan, 2008).

Furthermore, we have also shown that gp120 treatment can induce secretion of TNF-α, IL-1β,

and IL-6 from these astrocyte cultures (Ronaldson and Bendayan, 2006). It is unknown if

cytokines can regulate Mrp1 expression in glial cells and, if cytokines are capable of altering

Mrp1 expression, which intracellular signaling pathways may be involved. In the present study,

we have i) evaluated Mrp1 functional expression in cultured rat astrocytes triggered with TNF-α,

IL-1β, and IL-6 and ii) investigated the role of NF-κB and JNKs in the regulation of Mrp1

expression in cultured astrocytes exposed to HIV-196ZM651 gp120 or cytokines.

Page 81: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

62

6.3 Materials and methods

6.3.1 Materials

HIV-196ZM651 gp120 full length protein (derived from subtype C, R5-tropic HIV-1) was obtained

from the National Institute of Health (NIH) AIDS Research and Reference Reagent Program,

Division of AIDS, NIAID, NIH (Bethesda, MD). PSC833 (i.e., valspodar) was a generous gift

from Novartis Pharma (Basel, Switzerland). The rat monoclonal MRP1 antibody MRPr1 was

obtained from Kamiya Biomedical Company (Seattle, WA). BCECF, acetoxymethyl ester and

free acid, were purchased from Invitrogen (Mississauga, ON, Canada). MK571 was purchased

from Biomol Inc. (Plymouth Meeting, PA). The cell-permeable NF-κB inhibitory peptide SN50

and the pharmacological NF-κB inhibitor (E)3-[(4-methylphenyl)sulfonyl]-2-propenenitrile

(BAY 11-7082) were purchased from EMD Biosciences Inc. (La Jolla, CA). Rat recombinant

TNF-α, the anthrapyrazolone JNK inhibitor SP600125 and the murine monoclonal actin antibody

AC-40 were obtained from Sigma-Aldrich (Oakville, ON, Canada). Rat recombinant IL-1β, rat

recombinant IL-6, the murine monoclonal TNF-α neutralizing antibody, and the murine

monoclonal IL-1β neutralizing antibody were purchased from Chemicon Inc. (Temecula, CA).

The rat monoclonal IL-6 neutralizing antibody was obtained from R&D Systems (Minneapolis,

MN). The rabbit polyclonal total JNK/SAPK antibody and the rabbit polyclonal phosphorylated

JNK/SAPK antibody were purchased from Cell Signaling Technology (Danvers, MA).

6.3.2 Cell culture

Primary cultures of rat astrocytes were prepared as previously described by our laboratory

(Ronaldson et al., 2004a;Ronaldson and Bendayan, 2006;Ronaldson and Bendayan, 2008). All

procedures were carried out in accordance with the University of Toronto Animal Care

Committee and the Province of Ontario Animals for Research Act. Briefly, postnatal (1-3 day

old) Wistar rats (Charles River Laboratories, St Constant, PQ, Canada) were killed by cervical

dislocation and whole brains isolated. Cerebral cortices were dissected and subjected to

enzymatic digestion for 30 min in serum-free minimum essential medium containing 2.0 mg/ml

porcine pancreatic trypsin (Sigma-Aldrich) and 0.005% DNase I (Roche Applied Science, Laval,

PQ, Canada). Tissue was mechanically disaggregated using a cell dissociation kit (Sigma-

Aldrich) to yield a mixed glial cell suspension. The cell suspension was then centrifuged for 10

Page 82: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

63

min at 100 g and resuspended in fresh culture medium consisting of minimum essential medium

supplemented with 5% horse serum, 5% fetal bovine serum (FBS), and 50 μg/ml gentamicin.

The cells were plated on 75 cm2 polystyrene tissue culture flasks (Sarstedt, St. Leonard, PQ,

Canada) and incubated in fresh medium at 37˚C, 5% CO2 and 95% air overnight for 7-10 days.

The cells were then placed on an orbital shaker at 120 rpm for 6 h to remove contaminating

oligodendrocytes, microglia, progenitor cells and neurons. The cells were harvested with 0.1%

trypsin/ethylenediaminetetraacetic acid (EDTA) in Hank’s Balanced Salt Solution (HBSS) and

plated at a density of 5 x 104 cells/well on 48-well polystyrene plates (Becton-Dickinson,

Franklin Lakes, NJ). The astrocytic nature of isolated cells and culture purity were previously

assessed by morphological analysis and by immunostaining for standard biochemical markers

(i.e., GFAP) (Ronaldson et al., 2004a).

The human cervical carcinoma cell line stably transfected with human MRP1 (MRP1-HeLa) was

kindly provided by Dr. Susan Cole (Queen’s University, Kingston, ON, Canada). Cells were

grown as monolayers on 75 cm2 tissue culture flasks at 37C in 5% CO2 and 95% air. Cultures

were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (4 mM L-glutamine; 25 mM

D-glucose) supplemented with 400 g/ml G418 and 10% FBS. Confluent cultures were

subcultured with 0.25% trypsin-EDTA and were used as a positive control for western blotting

experiments.

6.3.3 Gp120/cytokine Treatments

All treatments were performed on monolayers of primary cultures of rat astrocytes grown in 75

cm2 tissue culture flasks. At the beginning of each experiment, culture medium was aspirated and

fresh culture medium containing 1.0 nM HIV-196ZM651 gp120. HIV-196ZM651 gp120 is R5-tropic

(also known as macrophage-tropic) and is derived from a subtype C viral isolate. R5-tropic

viruses are the most prevalent strains of HIV-1 in the brain (Gabuzda and Wang, 2000). In HIV-

1 infected patients, concentrations ranging between 12 ng/ml and 92 ng/ml have been reported to

be released in serum (Oh et al., 1992). These serum concentrations correspond to a molar

concentration range of 0.1 nM to approximately 1.0 nM. All experiments were conducted at

37C in 5% CO2 and 95% air. Control (i.e., untreated) cultures were comprised of untreated cells

in fresh culture medium. For experiments examining the involvement of NF-κB or JNK on the

Page 83: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

64

regulation of Mrp1 in gp120-treated cells, cultures were pre-treated with 1 µM SN50, 5 µM

BAY 11-7082 or 20 µM SP600125 respectively for 30 min prior to HIV-196ZM651 gp120

exposure. At 6, 12, and 24 h, the cells were collected and prepared for immunoblot analysis as

described below.

Cytokine exposure experiments were initiated by aspirating the culture medium and adding fresh

medium containing 0.5 ng/ml or 10 ng/ml TNF-α, 0.4 ng/ml or 10 ng/ml IL-1β, or 0.3 ng/ml or

10 ng/ml IL-6. These proinflammatory cytokines were selected since their expression is

increased during HIV-1 associated immunological responses in the brain (Kaul et al., 2005). The

lower concentration of each cytokine was selected based on the maximum level of TNF-α, IL-1β,

or IL-6 secreted from primary cultures of rat astrocytes triggered with HIV-196ZM651 gp120 as

determined by ELISA (Ronaldson and Bendayan, 2006), while the higher cytokine concentration

(i.e., 10 ng/ml) is widely reported in the literature to induce a profound inflammatory response in

vitro. Untreated cells in 5% horse serum, 5% fetal bovine serum containing culture medium were

used as control. For experiments examining the involvement of NF-κB or JNKs on the regulation

of Mrp1 in cells exposed to TNF-α, cultures were pre-treated with 1 µM SN50 or 20 µM

SP600125 respectively for 30 min prior to triggering with TNF-α. At 6, 12, and 24 h, the

medium was aspirated and the cells were collected for immunoblot analysis.

Treatment of primary cultures of rat astrocytes with cytokine neutralizing antibodies and HIV-

196ZM651 gp120 were conducted by aspirating culture medium and replacing it with fresh medium

containing the cytokine neutralizing antibody and 1.0 nM HIV-196ZM651 gp120. At 6, 12, and 24

h, the medium was aspirated and the cells were collected for immunoblot analysis.

Concentrations for the neutralizing antibodies were determined from cytokine activity curves

provided by the manufacturer. For these experiments, the following concentrations were selected

since they were shown to completely neutralize the biological activity of their respective

cytokine: 0.2 μg/ml TNF-α neutralizing antibody, 0.5 μg/ml IL-1β neutralizing antibody and 0.5

μg/ml IL-6 neutralizing antibody.

6.3.4 Immunoblot Analysis

Whole cell lysates from primary cultures of rat astrocytes and HeLa-MRP1 cells were prepared

by exposing the cells to 1.0 ml of modified radioimmunoprecipitation assay (RIPA) buffer [50

Page 84: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

65

mM Tris-HCl (pH 7.4), 150 mM NaCl, 1.0 mM ethylene glycol tetraacetic acid (EGTA), 1%

(v/v) Nonident P-40, 0.25% (m/v) sodium deoxycholate, 0.1% (m/v) Sodium dodecyl sulfate

(SDS), 200 µM phenylmethylsulfonyl fluoride (PMSF), 0.1% PI cocktail (Sigma-Aldrich)]. The

cells were then gently rocked for 15 min at 4C to allow lysis to occur. Cell suspensions were

collected and centrifuged at 3000 g for 15 min at 4C to remove cellular debris. Supernatants

were then collected for immunoblot analysis. Protein concentration of the cell lysates was

determined using Bradford’s protein assay.

For immunoblotting, 1 μg or 25 g or 50 g aliquots of cell lysates were mixed in Laemmli

buffer and resolved on a 10% SDS-polyacrylamide gel. The gel was then electrotransferred onto

a polyvinylidene difluoride (PVDF) membrane. Protein transfer was verified by Ponceau S

staining. The membranes were blocked overnight at 4°C in Tris-buffered saline (15 mM Tris-

HCl, 150 mM NaCl, pH 7.6) containing 0.05% (v/v) Tween-20 (TBS-T) and 5% (m/v) dry skim

milk powder. Following six washes (5 min each) with TBS-T, the membrane was incubated with

the appropriate primary antibody for 4 h at room temperature. MRP1/Mrp1 protein expression

was assessed using the monoclonal MRPr1 antibody, which was raised against a bacterial fusion

protein containing amino acids 194-360 of human MRP1 and its epitope was subsequently

localized to amino acids 238-247 (Hipfner et al., 1999). MRPr1 does not cross-react with P-gp or

MRP2-6 (Hipfner et al., 1999;Scheffer et al., 2000). Total and phosphorylated JNK protein

expression was determined using the polyclonal total JNK/SAPK antibody and the polyclonal

phosphorylated JNK/SAPK antibody respectively. The polyclonal total JNK/SAPK antibody was

produced by the immunization of rabbits with a GSH transferase/human JNK2 fusion protein

(Product Data Sheet, Cell Signaling Technology, 2008). The polyclonal phosphorylated

JNK/SAPK antibody was produced by immunizing the animals with a fusion protein

corresponding to the amino acids surrounding threonine 183 and tyrosine 185 of human JNK and

is specific for JNK isoforms that are phosphorylated at these residues (Product Data Sheet, Cell

Signaling Technology, 2008). Actin expression was detected using the monoclonal AC-40

antibody, which recognizes a conserved C-terminal epitope on all actin isoforms (Product Data

Sheet, Sigma-Aldrich Canada, 2005). Following a second wash, the membranes were incubated

for 1.5 h in the presence of anti-mouse (Serotec Inc., Raleigh, NC), anti-rat (Sigma-Aldrich), or

anti-rabbit (Sigma-Aldrich) HRP-conjugated secondary antibodies (1:5000 dilution) in 5% milk

Page 85: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

66

at room temperature. Protein bands were detected by enhanced chemiluminescence and exposed

to X-ray film for 1 min. The MRP1-HeLa cell line was used as a positive control for

MRP1/Mrp1.

6.3.5 Quantitative PCR

Total RNA was extracted from confluent monolayers of primary cultures of rat astrocytes

treated with either HIV-196ZM651 gp120 (1.0 nM) or TNF-α (10 ng/ml) for 6 h, 12 h or 24 h using

TRIZOL reagent (Invitrogen). Extracted RNA was treated with amplification grade DNase I

(Invitrogen) to remove contaminating genomic DNA. The concentration of RNA in each sample

was quantified spectrophotometrically by measuring UV absorbance at 260 nm. The High

Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Foster City, CA) was used to

synthesize first-strand cDNA. Primer pairs for the rat Mrp1 gene (5-

AGAAGGAATGTGTTAAGTCGAGGAA-3 and 5-CCTTAGGCTTGGTGGGATCTT-3) and

the rat Cyclophilin B gene (housekeeping gene; 5-GGAGATGGCACAGGAGGAA-3 AND 5-

GCCCGTAGTGCTTCAGCTT-3) were designed using Primer Express 3 software (Applied

Biosystems) and were validated for specificity and efficacy using BioTaq universal rat normal

tissue cDNA (BioTaq Inc., Gaithersburg, MD). Quantitative PCR (qPCR) was performed using

SYBR Green Master Mix (Applied Biosystems) on an ABI 7900HT Fast Real-time PCR System

(Applied Biosystems). The quantity of the target gene (i.e., Mrp1) was normalized to Cyclophilin

B using the comparative CT method (ΔΔCT). Results were expressed as mean ± standard

deviation (SD) of at least three separate experiments.

6.3.6 Enzyme-linked immunoabsorbant assay (ELISA)

An ultrasensitive ELISA kit for detection of rat TNF-α (Pierce Biotechnology, Rockford, IL) was

used to measure secretion of cytokines from primary cultures of rat astrocytes treated with HIV-

196ZM651 gp120 in the presence or absence of SN50. Standard curves for TNF-α (0-2500 pg/ml)

were generated using purified recombinant rat TNF-α and the assay was performed according to

manufacturer’s instructions. Absorbance was read at 450 nm using a SpectraMax Plus384

microplate spectrophotometer (Molecular Devices, Sunnyvale, CA). The concentration of

secreted TNF-α was expressed as pg/ml. All experiments reflect eight separate measurements

obtained from different cell cultures on different days.

Page 86: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

67

6.3.7 Functional studies

These studies were performed on confluent monolayers of rat astrocytes triggered with HIV-

196ZM651 gp120 or with TNF-α (0.5 or 10 ng/ml) and grown on 24-well polystyrene plates

(Becton-Dickinson) at an approximate density of 8 x 104 cells/well. Cells were washed and

incubated at 37C for 30 min in HBSS, pH 7.4, containing 10 mM (4-(2-hydroxyethyl)-1-

piperazineethanesulfonic acid) (HEPES) and 0.01% bovine serum albumin. The cells were then

incubated for the desired time with the cell permeable ester BCECF-AM (5 M) in the presence

or absence of SP600125 (20 μM). Since BCECF-AM is a known P-gp substrate (Bachmeier et

al., 2004), all incubations were performed in the presence of 1.0 M PSC833, an established P-

gp inhibitor. At the end of each time point, the incubation medium was aspirated and the reaction

was terminated with 1000 l ice-cold phosphate buffer saline (PBS). The cells were then

solubilized with 200 l 1% Triton-X-100 for 30 min. BCECF cellular retention was measured

using a fluorescent assay plate reader at an excitation wavelength of 505 nm and an emission

wavelength of 535 nm. All samples were corrected for background fluorescence. Cellular

BCECF content was standardized to cellular protein content (mg/ml) determined by the Bradford

colorimetric method using bovine serum albumin (Sigma-Aldrich) as the standard. Cellular

retention of BCECF was expressed as nanomoles per milligram of protein (nmol/mg protein).

6.3.8 Data Analysis

Each set of experiments was repeated at least three times in cells pertaining to different

isolations. In an individual experiment, each data point represents quadruplicate trials. Results

are reported as a mean SD from at least three separate experiments. To determine significance

of transport inhibition, Student’s t-test was used for unpaired experimental data. For multiple

comparisons, the test of repeated measures Analysis of variance (ANOVA) and the post hoc

multiple-comparison Bonferroni t-test were used. A value of p < 0.05 was considered to be

statistically significant.

Page 87: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

68

6.4 Results

6.4.1 Effect of cytokines on Mrp1 protein expression

Our laboratory has previously reported increased cytokine secretion (i.e., TNF-α, IL-1β, IL-6) in

primary cultures of rat astrocytes exposed to HIV-196ZM651 gp120 (Ronaldson and Bendayan,

2006). In addition, we demonstrated that cellular exposure to these cytokines decreased

functional expression of the ABC transporter P-gp (Ronaldson and Bendayan, 2006); however, it

was unknown whether TNF-α, IL-1β or IL-6 were involved in the regulation of other ABC

transporters that are expressed in astrocytes. Therefore, we explored the role of these cytokines

in the regulation of Mrp1 protein expression (Fig 6-1A). Mrp1 protein was detected using the

monoclonal MRPr1 antibody, which has been shown to react with both human MRP1 and rat

Mrp1 (Dallas et al., 2003). As expected, in the MRP1-HeLa cell line (the positive control), a

single band was observed at approximately 190 kDa, a size previously reported for MRP1/Mrp1

(Hipfner et al., 1999). Mrp1 protein expression was increased up to 2.7-fold by 24 h in primary

cultures of rat astrocytes treated with TNF-α but was not altered in cultures treated with either

IL-1β or IL-6 (Fig 6-1B). Appropriate loading of each sample was confirmed by detection of a

single band at approximately 43 kDa, which corresponds to actin. We did not observe any

change in actin protein expression in response to TNF-α, IL-1β, or IL-6 treatment at any of the

time points examined (data not shown).

Page 88: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

69

A.

Page 89: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

70

Figure 6-1 Effect of cytokines on Mrp1 protein expression in primary cultures of rat astrocytes.

A. Primary cultures of rat astrocytes were treated with TNF- (0.5 ng/ml; 10 ng/ml), IL-1 (0.4

ng/ml; 10 ng/ml), and IL-6 (0.3 ng/ml; 10 ng/ml) for 6 h, 12 h, and 24 h and Mrp1 expression

was assessed by immunoblot analysis. Crude membrane preparations of primary cultures of rat

astrocytes (25 g) and MRP1-HeLa cells (1 g) were resolved on a 10% SDS-polyacrylamide

gel and transferred to a PVDF membrane. The blots were incubated with the monoclonal

MRP1/Mrp1 antibody MRPr1 (1:500 dilution). Equal sample loading was confirmed by the

detection of actin using the monoclonal antibody AC40 (1:500 dilution). Primary cultures of rat

astrocytes not exposed to cytokines were used as a control. B. Densitometric analysis of Mrp1

protein in cultured rat astrocytes treated with TNF-α, IL-1β, or IL-6. Results (% control) are

expressed as mean ± SD of three separate experiments. Asterisks indicate data points that are

significantly different from control.

B.

Page 90: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

71

In order to confirm the involvement of these cytokines in altering Mrp1 expression, we measured

Mrp1 protein expression in cultured rat astrocytes treated with HIV-196ZM651 gp120 and various

cytokine neutralizing antibodies. In the presence of cytokine neutralizing antibodies only, Mrp1

protein expression was not significantly altered in our rat astrocyte cultures (Fig 6-2). We

observed no change in Mrp1 expression when cultures were treated with HIV-196ZM651 gp120 and

the TNF-α neutralizing antibody (Fig 6-2A & 6-2B). In contrast, Mrp1 protein expression was

significantly increased in primary cultures of rat astrocytes treated with HIV-196ZM651 gp120 and

the IL-1β or the IL-6 neutralizing antibody. These data suggest that TNF-α, but not IL-1β or IL-

6, is involved in upregulation of Mrp1 protein expression.

Page 91: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

72

A.

Page 92: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

73

Figure 6-2 Effect of cytokine neutralizing antibodies on Mrp1 protein expression in primary

cultures of rat astrocytes treated with HIV-196ZM651 gp120. A. Primary cultures of rat astrocytes

were treated with neutralizing antibodies for TNF- (0.2 ng/ml), IL-1 (0.5 ng/ml), and IL-6 (0.5

ng/ml) in the presence or absence of 1.0 nM HIV-196ZM651 gp120 for 6 h, 12 h, and 24 h and

Mrp1 expression was assessed by immunoblot analysis. Crude membrane preparations of

primary cultures of rat astrocytes (25 g) and MRP1-HeLa cells (1 g) were resolved on a 10%

SDS-polyacrylamide gel and transferred to a PVDF membrane. The blots were incubated with

the monoclonal MRP1/Mrp1 antibody MRPr1 (1:500 dilution). Equal sample loading was

confirmed by the detection of actin using the monoclonal antibody AC40 (1:500 dilution).

Primary cultures of rat astrocytes not exposed to HIV-196ZM651 gp120 or to the cytokine

neutralizing antibodies were used as a control. B. Densitometric analysis of Mrp1 protein in

cultured rat astrocytes treated with HIV-196ZM651 gp120 and various cytokine neutralizing

antibodies. Results (% control) are expressed as mean ± SD of three separate experiments.

Asterisks indicate data points that are significantly different from control. NAb = Neutralizing

Antibody.

B.

Page 93: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

74

6.4.2 Functional studies

In order to investigate whether increased Mrp1 mRNA and protein expression in response to

TNF-α exposure resulted in altered Mrp-mediated transport activity, we measured cellular

retention of BCECF, a fluorescein derivative and established Mrp1, Mrp2, Mrp4, and ABCG2

substrate (Bachmeier et al., 2004). Mrp2 expression was not detected in our primary cultures of

rat astrocytes and Mrp4 expression was not altered in response to either HIV-196ZM651 gp120

treatment (Ronaldson and Bendayan, 2008) or TNF-α exposure (data not shown). Additionally, a

previous study by our laboratory demonstrated that ABCG2 was expressed but not capable of

efflux transport in primary cultures of rat astrocytes (Lee et al., 2007). Therefore, we

hypothesized that any change in BCECF cellular retention would most likely correspond to an

alteration in Mrp1-mediated transport activity. For these experiments, cells were grown as

monolayers and incubated in the presence or absence of 0.5 ng/ml TNF-α or 10 ng/ml TNF-α for

24 h. The time course of BCECF (5 M) cellular retention at 37C (Fig 6-3) showed increasing

accumulation until approximately 15 min. At this point, BCECF cellular retention decreases for

the duration of the experiment, suggesting the presence of an active efflux process for this

fluorescent substrate. In cultured rat astrocytes treated with 0.5 ng/ml TNF-α for 24 h, BCECF

cellular retention was significantly decreased up to 2.4-fold (Fig 6-3), suggesting an increase in

Mrp1 functional activity. BCECF cellular retention was also decreased up to 4.4-fold in cultures

treated with 10 ng/ml TNF-α, implying that TNF-α increases Mrp1 functional activity in a

concentration-dependent manner.

Page 94: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

75

Figure 6-3 Effect of 24 h TNF-α exposure on the cellular retention of BCECF, a fluorescent Mrp

substrate, by cortical rat astrocyte monolayers. BCECF (5 M) accumulation was measured at

37C in the presence of 0.5 ng/ml or 10 ng/ml TNF-α. Results are expressed as mean ± SD of

three separate experiments, with each data point in an individual experiment representing

quadruplicate measurements. Asterisks represent data points that are significantly different from

control.

Page 95: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

76

6.4.3 Role of NF-кB on cytokine release and Mrp1 protein expression

NF-κB is a redox-regulated transcription factor that is known to be activated in cultured cells

triggered by gp120 (Saha and Pahan, 2007). In addition, NF-κB-mediated signaling has been

implicated in the regulation of ABC transporters such as P-gp in rat brain capillaries (Bauer et

al., 2007); however, it is currently unknown if NF-κB signaling can regulate Mrp1 expression.

Therefore, we investigated the possible involvement of NF-κB in the regulation of Mrp1 protein

expression in primary cultures of rat astrocytes triggered with gp120. Control experiments

showed that Mrp1 protein expression was increased in cultured astrocytes triggered with 1.0 nM

HIV-196ZM651 gp120 but was unchanged in cultures treated with denatured (i.e., heat-inactivated)

HIV-196ZM651 gp120 (Fig 6-4A). These data imply that a cellular response specific for the native

conformation of HIV-196ZM651 gp120 is required for enhancement of Mrp1 expression.

Furthermore, these results also indicate that altered Mrp1 expression was not associated with low

level endotoxin contamination in recombinant HIV-196ZM651 gp120 samples. Immunoblot

analysis of primary cultures of rat astrocytes triggered with 1.0 nM HIV-196ZM651 gp120 in the

presence and absence of SN50, a cell-permeable NF-κB inhibitory peptide, was performed.

SN50 has been previously shown to specifically inhibit NF-κB nuclear translocation at a

concentration of 10 µM or less (Lin et al., 1995), thus rendering it a good pharmacologic

inhibitor of NF-κB mediated signaling processes. Using trypan blue exclusion, we observed that

cell viability was not compromised by exposure to SN50 at concentrations up to 10 µM (data not

shown). In cells triggered with HIV-196ZM651 gp120, Mrp1 expression was increased by 2.5-fold;

however, Mrp1 protein expression was unchanged in cultures treated with HIV-196ZM651 gp120

and 1.0 µM SN50 at the time points examined (6, 12, or 24 h) (Fig 6-4B).

Page 96: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

77

A.

Page 97: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

78

Figure 6-4 Expression of Mrp1 in primary cultures of rat astrocytes treated with gp120 and

SN50, a peptidic NF-κB inhibitor. A: Immunoblot analysis of primary cultures of rat astrocytes

triggered with HIV-196ZM651 gp120 and with denatured HIV-196ZM651 gp120. Whole cell lysates

(25 μg) from primary cultures of rat astrocytes were resolved on a 10% SDS-polyacrylamide gel

and transferred to a PVDF membrane. Mrp1 was detected using the monoclonal antibody MRPr1

(1:500 dilution) and relative levels of Mrp1 expression were determined by densitometric

analysis. Results are expressed as mean ± SD of three separate experiments. Asterisks represent

data points that are significantly different from control. B: Immunoblot analysis of primary

cultures of rat astrocytes triggered with HIV-196ZM651 gp120 in the presence of 1.0 µM SN50, a

cell permeable NF-κB inhibitory peptide. Whole cell lysates (25 g) from primary cultures of rat

astrocytes were resolved on a 10% SDS-polyacrylamide gel and transferred to a PVDF

B.

Page 98: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

79

membrane. MRP1/Mrp1 was detected using the monoclonal antibody MRPr1 (1:500 dilution)

and relative levels of Mrp1 expression were determined by densitometric analysis. Results are

expressed as mean ± SD of three separate experiments. Asterisks represent data points that are

significantly different from control.

In order to confirm the involvement of NF-κB signaling in the regulation of Mrp1 protein

expression, we also conducted experiments in the presence and absence of BAY 11-7082, an

established pharmacological NF-κB inhibitor. Similar to our results with SN50, Mrp1 protein

expression was not significantly different from control in rat astrocyte cultures triggered with

HIV-196ZM651 gp120 (24 h) in the presence of 5.0 μM BAY 11-7082 (Fig 6-5). Appropriate

loading of each sample was confirmed by the detection of a single band at approximately 43

kDa, which corresponds to actin. Overall, these data provide evidence for involvement of NF-κB

signaling in the regulation of Mrp1 expression in primary cultures of rat astrocytes triggered with

HIV-1 viral envelope proteins.

Page 99: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

80

Figure 6-5 Expression of Mrp1 in primary cultures of rat astrocytes treated with gp120 and BAY

11-7082, a pharmacological NF-κB inhibitor. A: Immunoblot analysis of primary cultures of rat

astrocytes triggered with HIV-196ZM651 gp120 in the presence and absence of BAY 11-7082 (5

μM). Whole cell lysates ( 50 μg) from primary cultures of rat astrocytes were resolved on a 10%

SDS-polyacrylamide gel and transferred to a PVDF membrane. Whole cell lysate from HeLa-

MRP1 cells (1 μg) was used as a positive control. Mrp1 was detected using the monoclonal

antibody MRPr1 (1:500 dilution). B: Densitometric analysis of Mrp1 expression in primary

cultures of rat astrocytes triggered with HIV-196ZM651 gp120 in the presence and absence of 5 μM

BAY 11-7082. Results are expressed as mean ± SD of three separate experiments. Asterisks

represent data points that are significantly different from control.

Page 100: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

81

Since gp120 treatment is known to stimulate cytokine release (Ronaldson and Bendayan, 2006),

we investigated the role of NF-κB in TNF-α secretion in primary cultures of rat astrocytes

triggered with gp120. Secretion of TNF-α was measured in rat astrocyte cultures treated with

HIV-196ZM651 gp120 and SN50. Ultrasensitive ELISA analysis demonstrated increased TNF-α

protein expression (p < 0.01) in cell culture supernatants from primary cultures of rat astrocytes

triggered with 1.0 nM HIV-196ZM651 gp120 for 6, 12, and 24 h (table 6-1). In contrast, TNF-α

release in astrocyte cultures treated with 1.0 nM HIV-196ZM651 gp120 in the presence of 1.0 μM

SN50 was below the detection limit of the assay (i.e., less than 15 pg/ml). Previous work by our

laboratory has shown that basal levels of TNF-α in our primary cultures of rat astrocytes are

below the detection limit of the assay (Ronaldson and Bendayan, 2006). These observations

suggest that TNF-α secretion from primary cultures of rat astrocytes triggered with HIV-196ZM651

gp120 is mediated by an NF-κB dependent mechanism.

Page 101: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

82

Table 6-1 ELISA analysis of TNF-α secretion in cultured astrocytes treated with HIV-196ZM651 gp120.

Time of Exposure

HIV-196ZM651 gp120 (1.0 nM)

HIV-196ZM651 gp120 (1.0 nM)

+ SN50 (1.0 µM)

HIV-196ZM651 gp120 (1.0 nM)

+ SP600125 (20 µM)

6 h

583.08 ± 22.58

BDL **

570.43 ± 49.28

12 h

483.90 ± 32.81

BDL **

490.54 ± 36.43

24 h

384.71 ± 34.28

BDL **

369.56 ± 33.29

** p < 0.01; Results are expressed as mean SD of eight separate measurements obtained from different cultures on different days. Statistical

comparisons are between cultures treated with HIV-196ZM651 gp120 alone and cultures triggered with HIV-196ZM651 gp120 plus inhibitor; Cytokine values

are expressed as pg/ml; BDL= Values that are below detection limit of the assay.

Page 102: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

83

The above results imply that NF-κB mediated signaling is involved in release of TNF-α in

cultured astrocytes triggered with HIV-196ZM651 gp120; however, these data were unable to

discern if NF-κB is directly involved in the regulation of Mrp1 itself. In order to address this

question, we pre-treated our astrocyte cultures with 1.0 μM SN50 followed by exposure to 0.5

ng/ml or 10 ng/ml TNF-α. Immunoblot analysis showed increased expression of Mrp1 in

astrocyte cultures treated with 1.0 µM SN50 and 0.5 ng/ml TNF-α (2.4-fold) or 10 ng/ml TNF-α

(2.6-fold) (Fig 6-6), suggesting that NF-κB does not directly regulate Mrp1 expression.

Appropriate loading of each sample was confirmed by detection of a single band at

approximately 43 kDa, which corresponds to actin. Taken together, these data indicate that NF-

κB signaling processes are indirectly involved in the regulation of Mrp1 protein expression by

triggering release of cytokines (i.e., TNF-α) in glial cells following exposure to HIV-196ZM651

gp120.

Page 103: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

84

Figure 6-6 Expression of Mrp1 in primary cultures of rat astrocytes treated with TNF-α and

SN50, a peptidic NF-κB inhibitor. Immunoblot analysis of primary cultures of rat astrocytes

triggered with TNF-α (0.5 ng/ml or 10 ng/ml) in the presence of 1.0 µM SN50. Whole cell

lysates from primary cultures of rat astrocytes (25 g) were resolved on a 10% SDS-

polyacrylamide gel and transferred to a PVDF membrane. Mrp1 was detected using the

monoclonal antibody MRPr1 (1:500 dilution) and relative levels of Mrp1 expression were

determined by densitometric analysis. Results are expressed as mean ± SD of three separate

experiments. Asterisks represent data points that are significantly different from control.

Page 104: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

85

6.4.4 Role of JNKs on Mrp1 functional expression

Components of the MAPK pathway such as the JNKs have also been shown to be activated in

response to HIV-1 viral proteins and/or inflammation (Chen and Thorner, 2007;Hayashi et al.,

2006). Additionally, JNK isoforms may be involved in regulation of ABC membrane

transporters (Hartz et al., 2008;Hayashi et al., 2006). Therefore, we investigated the involvement

of JNKs in regulation of Mrp1 protein expression in primary cultures of rat astrocytes triggered

with HIV-196ZM651 gp120. Immunoblot analysis of cultured astrocytes triggered with 1.0 nM

HIV-196ZM651 gp120 in the presence or absence of 20 μM SP600125, an established JNK

inhibitor, was performed. SP600125 is known to reversibly inhibit JNK signaling with IC50

values in the range of 40-90 nM (Bennett et al., 2001). Furthermore, SP600125 displays greater

than 300-fold selectivity for JNK over related MAPKs (i.e., ERK1 and p38 MAPK) and 10-100-

fold greater selectivity over other intracellular kinases (Bennett et al., 2001). Using the trypan

blue exclusion method, we observed that cell viability was not altered in the presence of 20 µM

SP600125 (data not shown). In our hands, we demonstrated that 20 μM SP600125 decreased

total JNK phosphorylation in primary cultures of rat astrocytes triggered with TNF-α to a level

that was not significantly different from control untreated cells (data not shown). Mrp1 protein

expression was unchanged in cultures treated with HIV-196ZM651 gp120 and SP600125 at the time

points examined (6, 12, or 24 h) (Fig 6-7), suggesting that JNKs may be involved in the

regulation of this ABC transporter. Appropriate loading of each sample was confirmed by the

detection of a single band at approximately 43 kDa, which corresponds to actin.

Page 105: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

86

Figure 6-7 Expression of Mrp1 in primary cultures of rat astrocytes treated with gp120 and

SP600125, a pharmacological JNK inhibitor. Immunoblot analysis of primary cultures of rat

astrocytes triggered with HIV-196ZM651 gp120 in the presence of 20 µM SP600125. Whole cell

lysates from primary cultures of rat astrocytes (25 g) were resolved on a 10% SDS-

polyacrylamide gel and transferred to a PVDF membrane. Mrp1 was detected using the

monoclonal antibody MRPr1 (1:500 dilution) and relative levels of Mrp1 expression were

determined by densitometric analysis. Results are expressed as mean ± SD of three separate

experiments. Asterisks represent data points that are significantly different from control.

Page 106: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

87

To determine the role of JNKs in the regulation of cytokine release, we measured the secretion of

TNF-α in primary cultures of rat astrocytes treated with HIV-196ZM651 gp120 in the presence of

SP600125. TNF-α release in astrocyte cultures treated with 1.0 nM HIV-196ZM651 gp120 in the

presence of 20 μM SP600125 was not statistically different (p > 0.05) from TNF- α secretion in

astrocyte cultures treated with 1.0 nM HIV-196ZM651 gp120 alone (table 6-1). These observations

imply that JNK signaling is likely not involved in the release of TNF-α from primary cultures of

rat astrocytes triggered with HIV-196ZM651 gp120.

In order to determine if JNK signaling was directly involved in regulation of Mrp1 protein

expression, we pretreated our rat astrocyte cultures with 20 μM SP600125 followed by exposure

to 0.5 ng/ml or 10 ng/ml TNF-α. Control experiments in the absence of SP600125 demonstrated

increased Mrp1 protein expression in primary cultures of rat astrocytes exposed to 0.5 ng/ml

TNF-α (2.5-fold) or 10 ng/ml TNF-α (2.6-fold) (Fig 6-8A). In contrast, no change in protein

expression of Mrp1 was observed in astrocyte cultures treated with 20 µM SP600125 and 0.5

ng/ml TNF-α or 10 ng/ml TNF-α (Fig 6-8B). Appropriate loading of each sample was confirmed

by detection of a single band at approximately 43 kDa, which corresponds to actin.

Page 107: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

88

A.

Page 108: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

89

Figure 6-8 Expression of Mrp1 in primary cultures of rat astrocytes treated with TNF-α and

SP600125, a pharmacological JNK inhibitor. A: Immunoblot analysis of primary cultures of rat

astrocytes triggered with TNF-α (0.5 ng/ml or 10 ng/ml). Whole cell lysates from primary

cultures of rat astrocytes (25 g) were resolved on a 10% SDS-polyacrylamide gel and

transferred to a PVDF membrane. Mrp1 was detected using the monoclonal antibody MRPr1

(1:500 dilution) and relative levels of Mrp1 expression were determined by densitometric

analysis. Results are expressed as mean ± SD of three separate experiments. Asterisks represent

data points that are significantly different from control. B: Immunoblot analysis of primary

cultures of rat astrocytes triggered with TNF-α (0.5 ng/ml or 10 ng/ml) in the presence of 20 µM

SP600125. Whole cell lysates from primary cultures of rat astrocytes (25 g) were resolved on a

10% SDS-polyacrylamide gel and transferred to a PVDF membrane. Mrp1 was detected using

the monoclonal antibody MRPr1 (1:500 dilution) and relative levels of Mrp1 expression were

determined by densitometric analysis. Results are expressed as mean ± SD of three separate

experiments. Asterisks represent data points that are significantly different from control.

B.

Page 109: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

90

In order to investigate if pharmacological inhibition of JNK isoforms resulted in altered Mrp-

mediated transport activity, we measured cellular retention of BCECF in cortical astrocyte

monolayers triggered with HIV-196ZM651 gp120 or TNF-α in the presence or absence of

SP600125. For these experiments, cells were grown as monolayers and incubated with 1.0 nM

HIV-196ZM651 gp120 or 10 ng/ml TNF-α for 24 h. In cultures treated with the JNK inhibitor,

SP600125 (20 μM) was added 30 min prior to HIV-196ZM651 gp120 or TNF-α exposure. In

cultured rat astrocytes treated with 1.0 nM HIV-196ZM651 gp120 or 10 ng/ml TNF-α, BCECF

cellular retention was significantly decreased up to 2.4-fold (Fig 6-9). In contrast, BCECF

cellular retention was not altered in rat astrocyte cultures treated with SP600125 and HIV-

196ZM651 gp120 or with SP600125 and TNF-α. Control experiments demonstrated that 20 µM

SP600125 itself did not affect cellular retention of BCECF (data not shown). Taken together,

these data indicate that inhibition of JNK signaling processes attenuates the increase in Mrp1

functional expression observed in glial cells following exposure to HIV-1 viral proteins or

proinflammatory cytokines.

Page 110: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

91

Figure 6-9 Effect of 24 h gp120 or TNF-α exposure on the cellular retention of BCECF, a

fluorescent Mrp substrate, by cortical rat astrocyte monolayers. BCECF (5 M) accumulation

was measured at 37C in cultured astrocytes treated with 1.0 nM HIV-196ZM651 gp120 or 10

ng/ml TNF-α in the presence and absence of SP600125, a specific pharmacological JNK

inhibitor. Results are expressed as mean ± SD of three separate experiments, with each data point

in an individual experiment representing quadruplicate measurements. Asterisks represent data

points that are significantly different from control.

Page 111: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

92

6.4.5 Effect of HIV-196ZM651 gp120 and TNF-α on Mrp1 gene expression

Since we observed increased protein expression of Mrp1 in cultured rat astrocytes triggered with

gp120 or TNF-α, we sought to evaluate Mrp1 mRNA expression in cultured astrocytes exposed

to these same mediators. Quantitative PCR analysis was used to measure the expression of Mrp1

mRNA in primary cultures of rat astrocytes treated with HIV-196ZM651 gp120 or TNF-α. Mrp1

mRNA was significantly increased (1.6-fold) in cultured astrocytes triggered with 1.0 nM HIV-

196ZM651 gp120 for 6 h; however, Mrp1 expression was not altered in primary cultures of rat

astrocytes exposed to HIV-196ZM651 gp120 for 12 h or 24 h (Fig 6-10A). Similarly, Mrp1 mRNA

expression was increased in cells treated with 10 ng/ml TNF-α for 6 h (1.7-fold) but no change in

Mrp1 expression was observed in primary cultures of rat astrocytes triggered with TNF-α for 12

h or 24 h (Fig 6-10B). Taken together, these data suggest that increased Mrp1 protein expression

in cultured rat astrocytes triggered with either gp120 or TNF-α may result, at least in part, from

increased expression of Mrp1 mRNA.

Page 112: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

93

Figure 6-10 Effect of gp120 or TNF-α exposure on Mrp1 mRNA expression in primary cultures

of rat astrocytes. Primary cultures of rat astrocytes were triggered with 1.0 nM HIV-196ZM651

gp120 (A) or 10 ng/ml TNF-α (B) for 6 h, 12 h, or 24 h. Mrp1 mRNA expression was measured

using quantitative PCR analysis. Results (% control) are expressed as mean ± SD of four

separate experiments. Asterisks indicate data points that are significantly different from control.

B.

A.

Page 113: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

94

6.5 Discussion

ABC transporters (i.e., P-gp, Mrp1) are important determinants of xenobiotic permeation across

brain barriers and brain parenchyma cellular compartments (i.e., astrocytes, microglia)

(Ronaldson et al., 2008). This is particularly significant for treatment of HIV-1 infection because

antiretroviral agents (i.e., HIV-1 PIs) are known substrates for P-gp and/or Mrp1 (Dallas et al.,

2004a;Ronaldson and Bendayan, 2006;Williams et al., 2002), a factor that may limit the ability

of these drugs to attain efficacious CNS concentrations. Until recently, ABC transporter

functional expression had only been characterized in non-pathological (i.e., healthy) astrocyte

cultures (Ronaldson et al., 2004a). In order to elucidate the role of brain pathologies on ABC

transporter expression and/or activity, we implemented an in vitro model of an HIV-1 associated

inflammatory response by triggering cultured astrocytes with HIV-196ZM651 gp120 (Ronaldson

and Bendayan, 2006). This model was characterized by increased production and secretion of

proinflammatory cytokines (i.e., TNF-α, IL-1β, IL-6) as determined by semiquantitative RT-PCR

and ELISA respectively (Ronaldson and Bendayan, 2006).

Previous in vitro and in vivo studies have shown that cytokines (i.e., TNF-α, IL-1β, IL-6) can

alter Mrp1 expression (Cherrington et al., 2004;Lee and Piquette-Miller, 2003). In the context of

HIV-1 associated inflammation, Jorajuria and colleagues reported increased TNF-α and IL-6

production and increased expression of MRP1 mRNA in human monocyte-derived macrophages

infected with HIV-1 BaL, an R5-tropic viral strain (Jorajuria et al., 2004). Using Spearman’s

rank correlation test, these researchers concluded that MRP1 mRNA expression was not directly

correlated with TNF-α or IL-6 production (Jorajuria et al., 2004); however, a causal relationship

between cytokine secretion and altered MRP1 mRNA levels was not established. In our study,

we have directly triggered primary cultures of rat astrocytes with proinflammatory cytokines.

While we observed no change in Mrp1 expression in cultured astrocytes triggered with IL-1β or

IL-6, Mrp1 expression was increased in the presence of TNF-α (2.7-fold). We further examined

the role of these cytokines on Mrp1 protein expression by treating primary cultures of rat

astrocytes with HIV-196ZM651 gp120 in the presence of TNF-α, IL-1β or IL-6 neutralizing

antibodies. Our results indicate that Mrp1 expression was not altered in the presence of TNF-α

neutralizing antibody but was significantly increased when IL-1β or IL-6 neutralizing antibodies

were utilized. These data confirm that TNF-α is prominently involved in upregulation of Mrp1

Page 114: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

95

expression in our astrocyte cultures. Taken together with our previous publication (Ronaldson

and Bendayan, 2006), these results provide evidence for the complex manner by which cytokines

regulate ABC transporter expression. With respect to P-gp, we observed decreased expression

mediated by IL-6 but increased expression mediated by TNF-α and IL-1β (Ronaldson and

Bendayan, 2006), suggesting that multiple cytokine signaling pathways are involved in

regulation of P-gp expression. In the present study, we demonstrate that Mrp1 is increased by

TNF-α, but not by IL-1β or IL-6, suggesting that Mrp1 expression is regulated by a TNF-α

mediated pathway during an inflammatory response.

In order to determine if increased Mrp1 protein expression correlated with enhanced activity, we

used BCECF, an established Mrp substrate (Bachmeier et al., 2004). An important consideration

is that BCECF is also a substrate for Mrp2, Mrp4 and ABCG2. Since these transporters were

either not expressed (i.e., Mrp2), nor affected by HIV-196ZM651 gp120 or TNF-α treatment (i.e.,

Mrp4) or not functional (i.e., ABCG2) in our primary cultures of rat astrocytes (Lee et al.,

2007;Ronaldson and Bendayan, 2008), we are able to conclude that any difference in BCECF

efflux is most likely attributed to changes in Mrp1 activity. Our studies showed that TNF-α

treatment reduced BCECF cellular retention in a concentration-dependent manner, which implies

an increase in Mrp-mediated transport. These data are particularly intriguing in light of our

previous study, which showed a significant decrease in P-gp functional expression in the same in

vitro model (Ronaldson and Bendayan, 2006). Therefore, we propose that Mrp1 may play an

enhanced role in antiretroviral drug transport during HIV-1 associated inflammatory responses.

Changes in Mrp1 functional expression may be particularly relevant for HIV-1 PIs, which are

substrates for MRP1/Mrp1 (Dallas et al., 2004a;Williams et al., 2002).

Intracellular signaling mechanisms responsible for gp120 effects in glial cells have not been

clearly identified. Previous studies have indicated that NF-κB mediated signaling pathways are

activated in response to gp120 exposure in cultured rat astrocytes (Saha and Pahan, 2007). Since

it has been shown that NF-κB activation is associated with changes in expression of other ABC

transporters such as P-gp (Bauer et al., 2007;Hayashi et al., 2005), we hypothesized that NF-κB

may also be involved in Mrp1 regulation. In the present study, we show that increased Mrp1

expression induced by HIV-196ZM651 gp120 was attenuated by SN50, an NF-κB inhibitory

peptide. Although SN50 was used primarily as an inhibitor of NF-κB nuclear import, it may also

Page 115: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

96

affect nuclear translocation of other transcription factors. Using an immortalized human T-

lymphocyte cell line, SN50 (210 µg/ml; 75 µM) was shown to inhibit nuclear import of multiple

transcription factors including AP-1, NFAT, STAT1, and NF-κB (Torgerson et al., 1998). In

contrast, studies in primary cultures of human peripheral blood-derived T-lymphocytes

demonstrated that SN50 had no effect on nuclear translocation of AP-1 or NFAT at a

concentration that was 5.6-fold lower than used by Torgerson and colleagues (Kolenko et al.,

1999), suggesting that cross-talk with other signaling pathways occurs only at high

concentrations of SN50. This corroborates data obtained in a murine fibroblast cell line (3T3),

which showed that SN50 specifically inhibited NF-κB nuclear translocation at concentrations

less than 10 µM (Lin et al., 1995). We used a much lower concentration of SN50 than any of

these studies (i.e., 2.8 µg/ml; 1 µM), suggesting that our results reflect an inhibition of NF-κB

with little contribution from other signaling pathways.

NF-κB activation is associated with production/secretion of cytokines such as TNF-α (Filipov et

al., 2005). Therefore, we examined TNF-α release from primary cultures of rat astrocytes

exposed to HIV-196ZM651 gp120 in the presence and absence of SN50. Indeed, pre-treatment with

SN50 reduced TNF-α secretion to levels that were below ELISA detection limits (i.e., less than

15 ng/ml), suggesting involvement of NF-κB. When we treated our cultures with TNF-α in the

presence of SN50, we observed a significant increase in Mrp1 protein expression, implying that

NF-κB does not directly regulate Mrp1 expression. A recent study in LPS-treated mice deficient

in IκB demonstrated a similar increase in hepatic Mrp1 mRNA levels as compared to LPS-

treated wild-type mice (Lickteig et al., 2007). LPS treatment has been shown to induce the

cellular release of proinflammatory cytokines that can alter the expression of ABC transporters

including Mrp1 (Cherrington et al., 2004). Taken together with our present study, these data

suggest that NF-κB activity is involved in the regulation of Mrp1 expression only by enhancing

the release of TNF-α.

The cellular response to gp120 and/or cytokines involves a multiplicity of signaling pathways in

addition to NF-κB. It has been previously shown that both gp120 and TNF-α can activate the

MAPK pathway, in particular the JNKs (Barbin et al., 2001;Bodner et al., 2004). Other HIV-1

proteins (i.e., Tat) have been shown to up-regulate Mrp1 expression in primary cultures of

murine astrocytes via a JNK-dependent mechanism (Hayashi et al., 2006). Therefore, we

Page 116: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

97

investigated the role of the JNK pathway on regulation of Mrp1 expression in cultured astrocytes

exposed to gp120 and/or TNF-α. Pharmacological inhibition of JNK signaling with SP600125

prevented upregulation of Mrp1 expression in HIV-196ZM651 gp120 triggered astrocyte cultures.

Pre-treatment with SP600125 attenuated upregulation of Mrp1 in response to TNF-α exposure;

however, SP600125 had no effect on HIV-196ZM651 gp120 induced release of TNF-α from rat

astrocyte cultures. Furthermore, SP600125 prevented the increase in cellular BCECF efflux in

cultures treated with HIV-196ZM651 gp120 or TNF-α. Our data corroborates the work of Hayashi

and colleagues (2006) and implies that JNKs are involved, in part, in regulation of Mrp1

functional expression in glial cells exposed to HIV-1 viral proteins and/or inflammatory

mediators (Fig. 6-11). Specifically, our results indicate that JNK phosphorylation and

upregulation of Mrp1 occurs subsequent to NF-κB-mediated TNF-α release. Studies in human

macrophages and microglia have demonstrated that JNK phosphorylation may also occur in

response to gp120 binding to CCR5 (Yi et al., 2004). Since we did not observe a change in Mrp1

protein expression in cultured astrocytes treated with HIV-196ZM651 gp120 and the TNF-α

neutralizing antibody, we can conclude that JNK phosphorylation resulting from the gp120-

CCR5 interaction was not a confounding factor in our study.

Our data shows increased Mrp1 mRNA expression in cultured astrocytes triggered with HIV-

196ZM651 gp120 or with TNF-α, suggesting that an HIV-1 inflammatory response may, in part,

alter transcription of the Mrp1 gene. MAPK signaling cascades (i.e., JNK) are complex and may

affect the expression of ABC transporter genes by the recruitment of transcription factors (i.e.,

AP-1, c-Jun) (Hartz et al., 2008;Shinoda et al., 2005;Zhou et al., 2006). Using chromatin

immunoprecipitation, increased c-Jun binding to the MRP1 promoter was observed in human

small cell lung cancer cell lines treated with the anticancer drug doxorubicin (Shinoda et al.,

2005). Additionally, this study showed that SP600125 inhibited c-Jun binding, confirming the

involvement of JNK signaling in MRP1 regulation. Although conducted in cancerous human cell

culture systems, the hypotheses proposed in this study can be tested in healthy rodent cell culture

systems because similar signaling pathways and/or transcription factors are expressed in both

models. Some of these similarities include expression of JNK/AP-1 (Nair et al., 2008), JNK/c-

Jun (Shinoda et al., 2005), and Nrf2 (Song et al., 2009). Furthermore, human MRP1 and rat

Mrp1 are both regulated by a highly-conserved 100 nucleotide sequence in the promoter region,

suggesting that regulatory mechanisms for both genes may be structurally and functionally

Page 117: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

98

similar (Muredda et al., 2003). Nonetheless, studies are required to determine specific JNK-

associated transcription factors involved in regulation of Mrp1 during cellular exposure to HIV-

196ZM651 gp120 and/or proinflammatory cytokines.

In addition to inflammatory processes, oxidative stress is also involved in HIV-1 associated

pathologies in the CNS. Our group has recently shown that gp120 treatment can lead to an

oxidative stress response in primary cultures of rat astrocytes characterized by increased free

radical production and increased oxidation of intracellular glutathione (Ronaldson and

Bendayan, 2008). Our study demonstrated, for the first time, that gp120-induced oxidative stress

increases Mrp1 functional expression in cultured glial cells (Ronaldson and Bendayan, 2008).

Oxidative stress responses in astrocytes are associated with activation of several intracellular

signaling mechanisms including NF-κB (Caccamo et al., 2005) and JNK MAPK (Chen et al.,

2008). Additionally, Nrf2 signaling is also known to be activated in response to oxidiative stress

and may be involved in the regulation of ABC transporters such as MRP1/Mrp1 (Hayashi et al.,

2003;Song et al., 2009). Clearly, the cellular response to HIV-1 viral proteins such as gp120 is

complex and involves multiple pathophysiological responses (i.e., inflammation, oxidative

stress). Future studies will delineate those cellular signaling processes that are activated by

proinflammatory cytokines and those that are induced by oxidative stress in an effort to clarify

mechanisms of HIV-associated pathophysiological processes as well as novel strategies for the

treatment of brain HIV-1 infection.

Page 118: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

99

Figure 6-11 Proposed mechanism of NF-κB and JNK signaling in glial cells during an HIV-1

associated inflammatory response. Brain HIV-1 infection is characterized by the presence of

HIV-1 viral proteins such as gp120 within the brain parenchyma. In our model, R5-tropic gp120

(i.e., HIV-196ZM651 gp120) directly binds to specific chemokine receptors (i.e., CCR5) expressed

at the astrocyte cell surface (1). In turn, this activates NF-κB mediated signaling (2), leading to

increased production and secretion of proinflammatory cytokines including TNF-α (3). Once

secreted, TNF-α may bind to its receptor (TNFRs) that are expressed at the plasma membrane of

astrocytes (4). The activation of TNFRs leads to increased phosphorylation (i.e., activation) of

JNK isoforms (5). Our data show that these signaling events can lead to increased mRNA and

protein expression of ABC membrane transporters such as Mrp1 (6). The end result of this

signaling mechanism is an increase in Mrp1 transport activity. Overall, these data may point to a

greater role for Mrp1 in antiretroviral drug resistance during an HIV-1 associated inflammatory

response.

Page 119: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

100

6.6 Acknowledgements

The authors thank Dr. Carolyn Cummins (Leslie Dan Faculty of Pharmacy) for providing the

equipment and facility for the qPCR analysis. The authors also thank Ms. Manisha Ramaswamy

and Mr. Vijay Rasaiah for excellent technical assistance.

Page 120: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

101

Chapter 3

7 Regulation of P-gp by HIV-1 in primary cultures of human

fetal astrocytes (HFAs)

This work is published and reproduced in this thesis with permission from John Wiley and Sons:

T Ashraf, PT Ronaldson, Y Persidsky and R Bendayan. Regulation of P-glycoprotein by HIV-1

in primary cultures of human fetal astrocytes. 2011. Journal of Neuroscience Research. 89: 1773-

1782.

Author contributions:

Research design: T Ashraf (first author), PT Ronaldson, Y Persidsky and R Bendayan (principle

investigator).

Conducted experiments and data analysis: T Ashraf (figures 7-2C, 7-4, 7-5; table 1); PT

Ronaldson (figures 7-1,7-2B, 7-3; table 1) and Y Persidsky (Figure 7-2A)

Writing of the manuscript: T Ashraf (preparation of the manuscript drafts and responses to

reviewer’s comments); PT Ronaldson (conceptual and editorial review of several manuscript

drafts and responses to reviewer’s comments), Y Persidsky (editorial review) and R Bendayan

(overall conceptual and editorial review of several manuscript drafts and responses to reviewer’s

comments)

Page 121: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

102

7.1 Abstract

P-gp, a drug efflux pump, is known to alter the bioavailability of antiretroviral drugs at several

sites including the brain. We have previously shown that HIV-1 gp120 induces pro-inflammatory

cytokine secretion and decreases P-gp functional expression in rat astrocytes, a cellular reservoir

of HIV-1. However, whether P-gp is regulated in a similar way in human astrocytes is unknown.

This study investigates the regulation of P-gp in an in vitro model of gp120-triggered human

fetal astrocytes (HFAs). In this sytem, elevated levels of IL-6, IL-1β and TNF-α were detected in

culture supernatants. Pretreatment with CCR5 neutralizing antibody attenuated cytokine

secretion suggesting that gp120-CCR5 interaction mediated cytokine production. Treatment with

gp120 (R5-tropic) resulted in reduced P-gp expression (64%) and function as determined by

increased (1.6-fold) cellular accumulation of [3H]digoxin, a P-gp substrate. Exposure to R5 or

R5/X4-tropic viral isolates also resulted in a downregulation in P-gp expression (75% and 90%

respectively) and treatment with IL-6 also showed lower P-gp expression (50%). Moreover, IL-6

neutralizing antibody blocked gp120 mediated P-gp downregulation, suggesting that IL-6 is a

key modulator of P-gp. Gp120 or IL-6 mediated downregulation of P-gp was attenuated by SN50

(an NF-кB inhibitor), suggesting involvement of NF-кB signaling in P-gp regulation. Our results

suggest that, similarly to the case with rodent astrocytes, pathophysiological stressors associated

with brain HIV-1 infection have a down-regulatory effect on P-gp functional expression in

human astrocytes, which may ultimately result in altered antiretroviral drug accumulation within

brain parenchyma during HIV-1 infection.

Page 122: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

103

7.2 Introduction

Neuroinflammation is a common immune response associated with HIV-1 infection. The

sequestration of HIV-1 in brain cellular reservoirs (i.e., astrocytes, microglia) may allow the

virus to evade antiretroviral therapy, thereby prolonging HIV-1 associated inflammatory

responses (i.e., production of pro-inflammatory cytokines such as TNF-α and IL-6, chemokines

and other neurotoxins) (Alexaki et al., 2008;Persidsky and Gendelman, 2003). Brain autopsy

samples from HIV-1 infected individuals and tissue samples from HIV-1 inoculated animal

models confirm elevation of inflammatory mediators during progression of HIV-1 associated

neuroinflammation (Persidsky et al., 1997;Persidsky et al., 1999). The release of circulatory viral

proteins and cytokines in brain parenchyma often results in neurologic impairment and neuronal

cell loss that are associated with cognitive and motor disorders in patients with prolonged HIV-1

infection (Ances and Ellis, 2007;Kaul, 2009).

Poor penetration of antiretroviral drugs across the BBB and subsequently into parenchymal cells

remains a major obstacle in efficient suppression of HIV-1 infection in the brain (Ronaldson et

al., 2008). Inadequate permeability of different antiretroviral drugs, in particular HIV-1 PIs and

NRTIs, into different brain cellular compartments is primarily due to functional expression of

ABC efflux transporters (P-gp, MRPs and BCRP). P-gp is encoded by the MDR gene, which has

two isoforms in humans (i.e., MDR1, MDR2) and three isoforms in rodents (i.e., mdr1a, mdr1b,

mdr2). P-gp substrates include various classes of antiretroviral drugs such as PIs (i.e., darunavir,

ritonavir) and NRTIs (i.e., abacavir) (Kis et al., 2010). Mdr1a/1b knockout animal models show

increased CNS accumulation of several PIs, which confirms a role for P-gp in antiretroviral drug

permeability into the brain (Salama et al., 2005;Spitzenberger et al., 2007). Localization of P-gp

has been reported at the BBB in brain microvessel endothelial cells, adhesive pericytes and

astrocytes (Bendayan et al., 2006). Furthermore, we have also confirmed localization of P-gp in

a rat microglia cell line, in cultured rat astrocytes, in a rat brain endothelial cell line and in a

human brain microvessel endothelial cell line (Bendayan et al., 2002;Lee et al., 2001b;Ronaldson

et al., 2004a;Zastre et al., 2009).

Evidence in the literature suggest that P-gp functional expression in the brain is altered during

HIV-1 infection. Increased P-gp immunoreactivity in glial cells has been reported in brain

autopsy tissues from patients with HIVE (Langford et al., 2004;Persidsky et al., 2006b). It is not

Page 123: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

104

yet conclusive if the induced P-gp expression observed in post-mortem brain tissue is due to the

disease manifestation itself or the therapeutic regimen. It is known that antiretrovirals, in

particular, HIV-PIs, through their interaction with orphan nuclear receptors (i.e., PXR) may play

an important role in the upregulation of P-gp expression (Chan et al., 2011;Chandler et al.,

2003;Zastre et al., 2009). Therefore, in vitro systems have been used to delineate the cell-specific

effect of viral proteins and cytokines. Hayashi et al. have reported HIV-1 viral protein Tat

induced upregulation of P-gp expression in both murine brain microvessel endothelial cells and

astrocytes (Hayashi et al., 2005). Our group has demonstrated that both gp120 and IL-6 can

decrease P-gp expression in primary cultures of rat astrocytes, whereas, TNF-α or IL-1β

exposure results in an enhancement in P-gp expression. Due to the expression of ABC drug

transporters, astrocytes may act as a secondary barrier to drug permeability within brain

parenchyma, thereby, resulting in altered drug distribution in the brain extracellular fluid (Lee et

al., 2001a). Since drug efflux transporters such as P-gp are known to limit the uptake of

antiretroviral drugs in astrocytes, the upregulation or downregulation of P-gp along with other

ABC transporters can significantly alter the availability of these drugs within brain parenchyma.

Currently, much interest has focused on studying intracellular signaling systems/ transcription

factors that regulate P-gp. For example, a recent study showed that the transcription factor NF-

кB regulates TNF-α-induced upregulation of mdr1b promoter activity in a rat brain endothelial

cell line (Yu et al., 2008). Although these studies provide insight on P-gp regulation in rodent or

murine astrocytes, regulation of P-gp in human astrocytes in the context of HIV-1 infection has

not yet been characterized. Therefore, this study aims to determine if gp120 can induce an

immune response in primary cultures of human fetal astrocytes and examines how P-gp protein

expression is regulated by viral isolates, gp120 and IL-6.

Page 124: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

105

7.3 Materials and Methods

7.3.1 Reagents

HIV-196ZM651 gp120 full-length protein (subtype C; R5-tropic), rabbit polyclonal anti-CCR5 and

anti-CXCR4 were obtained from the NIH AIDS Research and Reference Reagent program

(Bethesda, MD). HIV-1ADA gp120 (subtype B; R5-tropic) full-length protein was purchased from

Immunodiagnostics (Woburn, Ma). Murine monoclonal C219 antibody against P-gp was

purchased from ID labs (London, ON, Canada). Murine monoclonal AC-40 antibody against

actin, horseradish peroxidase conjugated anti-mouse, human IL-6, CXCR4 and CCR5

neutralizing antibody were obtained from Sigma-Aldrich (Oakville, ON, Canada). IL-6-

neutralizing antibody was purchased from R&D systems (Minneapolis, MN). NF-κB inhibitory

peptide, SN50, was purchased from EMD Biosciences (La Jolla, CA). [3H]Digoxin (Specific

activity 23.5 Ci/mmol), a substrate for P-gp was purchased from PerkinElmer Life and analytical

Sciences (Boston, MA).

7.3.2 Primary Cultures of HFAs

Human fetal brain tissue samples were collected from consenting patients undergoing elective

pregnancy termination (between 12 to 14 weeks of gestation age). Ethics approval was obtained

from University Health Network (Toronto, ON, Canada). Primary cultures of HFAs were

established according to previously published protocol (Hammond et al., 2002) with few

modifications. Briefly, tissue was collected in ice-cold medium (DMEM supplemented with 5%

FBS and 5% penicillin/streptomycin). After removal of meninges, tissue was triturated until

disaggregated. The cell suspension was then centrifuged and re-suspended in initial growth

medium containing DMEM supplemented with 20% FBS and 0.025% penicillin/streptomycin.

Cells were distributed in 75 cm2 tissue culture flasks and incubated overnight at 37

oC under 5%

CO2 and 95% air so that viable cells can adhere to culture flasks. The medium was then replaced

with feeding medium (DMEM with 10% FBS and 0.025% penicillin/streptomycin) and cells

were grown as monolayer until confluency. HFAs were characterized by the detection of

vimentin, a biochemical marker for fetal astrocytes.

Page 125: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

106

7.3.3 Isolation of CCR5 HIV-1 ADA and CCR5/CXCR4 HIV-1 89.6 viral

isolates

HIV-1 89.6, a macrophage/T-lymphocyte dual-tropic (CCR5 and CXCR4-tropic) viral isolate,

was obtained from the AIDS Research and Reference Reagent program, National institute of

Allergy and infectious Diseases. HIV-1 ADA, a macrophage-tropic (CCR5-tropic) strain, was

isolated from PBMCs from an HIV-1 infected patient. Infected monocytes were cultured and

maintained following previously published protocols (Ricardo-Dukelow et al., 2007).

7.3.4 Treatment with HIV-1, HIV-1 gp120 and IL-6

Confluent HFA monolayers were treated with either CCR5 HIV-1 ADA or CCR5/CXCR4 HIV-

1 89.6 virus (100x concentrated stocks; reverse transcriptase activity 38.5 and 29.1 cpm/mlx105

day) for 24h. Similarly, HFAs were treated with HIV-196ZM651 gp120 (1.0 nM) in the presence or

absence of CXCR4 or CCR5 neutralizing antibodies (1mg/ml) for 6h and 24h. Additionally,

cells were treated with IL-6 (0.5 ng/ml or 10 ng/ml) or HIV-196ZM651 gp120 (1.0 nM) for desired

time (6h, 12h and 24h) in the presence or absence of SN50 (1.0 µM), an NF-κB inhibitory

peptide.

7.3.5 ELISA analysis

IL6, IL-1β and TNF-α secretion from cultured HFAs in response to HIV-196ZM651 gp120 (1.0

nM) were measured using commercially available ultrasensitive ELISA kits according to the

manufacturers protocol (Pierce Biotechnology, IL). Standard curves for all three cytokines (0-

1000 pg/ml) were generated using the appropriate recombinant human cytokines. For the IL-6

and IL-1β kits, the detection level ranged from 10.2 to 400 pg/ml and for the TNF-α kit, it

ranged from 15.6 to 1,000 pg/ml.

7.3.6 Immunoblot analysis

Protein expression of P-gp, CXCR4 and CCR5 were determined by SDS-PAGE according to

previously published protocols (Ronaldson et al., 2004b). Briefly, whole cell lysates were

isolated using the RIPA buffer. Proteins (50μg) were resolved by SDS-PAGE and

electrotransferred onto PVDF membranes. The membranes were blocked overnight in TBS

containing 0.1% twin and 5% skim milk. Then blots were incubated with appropriate primary

Page 126: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

107

antibody followed by HRP-conjugated secondary antibody. C219 (1:500), AC40 (1:300), anti-

CXCR4 (1:1000) and anti-CCR5 (1:1000) antibodies were used to detect P-gp, actin, CXCR4

and CCR5, respectively. Finally, proteins bands were detected using enhanced

chemiluminescence kit. Densitometric analysis was performed using the software AlphaDigiDoc

RT2 to quantify relative protein expression.

7.3.7 Transport assay

Primary cultures of HFAs were seeded on 48-well plates and accumulation of [3H]digoxin was

measured following previously published protocols (Ronaldson et al., 2006). Briefly, cells were

washed and incubated at 37°C for 30 min in HBSS, pH 7.4, containing 10 mM HEPES and

0.01% bovine serum albumin. The cells were then incubated for the desired time with

[3H]digoxin (100nM; Specific activity 23.5 Ci/mmol). At the end of each time point, the

incubation medium was aspirated, and the reaction was terminated with 1000 μl of ice-cold PBS.

The cells were then solubilised with 200 μl of 1% Triton-X-100 for 30 min. Radioactivity was

measured by standard liquid scintillation counting. Cellular protein content was determined by

the Bradford colorimetric method using bovine serum albumin as a standard.

7.3.8 Data analysis

Each experiment was repeated at least three times on cultured astrocytes isolated from different

tissue. Student’s t-test was used to determine statistical significance between two groups.

Multiple comparisons were performed using ANOVA and Bonferroni’s post-hoc analysis. A p

value less than 0.05 was considered as statistically significant.

Page 127: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

108

7.4 Results

7.4.1 Interaction of viral protein gp120 (R5-tropic) with chemokine receptor

and pro-inflammatory cytokine secretion

To characterize the inflammatory response mediated by gp120 in human astrocytes, we exposed

HFAs to HIV-1 gp120 (R5-tropic strain) and observed a significant increase in the secretion of

various pro-inflammatory cytokines (i.e., IL-6, IL-1β, TNF-α) (Table 7-1). When primary HFA

cultures were exposed to gp120 in the presence of neutralizing antibodies directed against

CXCR4 and CCR5, the CCR5 neutralizing antibody significantly decreased gp120 induced

secretion of all three cytokines examined whether administered alone or in conjunction with

CXCR4 neutralizing antibody. In contrast, administration of HIV-1 gp120 and CXCR4

neutralizing antibody failed to affect gp120 mediated cytokine secretion.

Page 128: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

109

Table 7-1 Pro-inflammatory cytokine secretion in primary cultures of HFAs treated with HIV-196ZM651 gp120

Treatment IL-6 (pg/ml) TNF-α (pg/ml) IL-1β (pg/ml)

6h 24h 6h 24h 6h 24h

Untreated _ 182.36 ± 26.83 _ 11.35 ± 3.69 _ 2.64 ± 1.23

gp120 431.57 ± 73.09*** 336.33 ± 54.32*** 679.50 ± 31.80*** 401.37 ± 20.98*** 296.46 ± 19.59*** 211.81 ± 22.52***

CXCR4 Nab 452.40 ± 69.99*** 347.52 ± 65.75*** 735.85 ± 108.93*** 464.13 ± 15.21*** 274.07 ± 2.38*** 210.71 ± 11.76*** ± gp120

CCR5 Nab 204.90 ± 18.55*** 164.20 ± 10.59 12.09 ± 4.84 20.24 ± 16.82 6.81 ± 13.80 5.93 ± 8.46 ± gp120 CXCR4 & CCR5 Nab 189.65 ± 19.29*** 167.59 ± 17.32 19.91 ± 13.04 26.08 ± 26.96 1.73 ± 1.75 1.98± 1.00 ± gp120

*** p<0.001; Nab = neutralizing antibody; Data points are expressed as mean SD of 8 separate measurements obtained from different cultures. For the 24h treatments, statistical comparisons are made between untreated controls and treated groups. For the 6h treatments, all the values are compared to the minimal detection limit of the respective kit. For the IL-6 and IL-1β kits, the detection level ranged from 10.2 to 400 pg/ml and for the TNF-α kit, it ranged from 15.6 to 1,000 pg/ml.

Page 129: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

110

7.4.2 Effect of R5/X4 and R5-tropic viral isolates on P-gp protein expression

It is currently unknown whether interaction of intact HIV-1 virus with chemokine receptors in

astrocytes can modify functional expression of drug transporters such as P-gp. In intact HIV-1

viral isolates, gp120 is expressed at the viral envelope and mediates attachment to chemokine

receptors expressed at the surface of target cells. We detected protein expression of both CXCR4

and CCR5 in our HFA cultures (Figure 7-1).

Figure 7-1 Immunoblot analysis of CXCR4 and CCR5 in primary cultures of HFAs. Whole cell

lysates (50 µg) from primary cultures of HFAs, 3T3-CXCR4 and 3T3-CCR5 cells were resolved

on a 10% SDS-polyacrylamide gel and transferred to PVDF membrane. Cell lysates prepared

from 3T3-CXCR4 and 3T3-CCR5 cells were used as positive controls. CXCR4 and CCR5 were

detected using the appropriate polyclonal antibody (anti-CXCR4, 1:1000 dilution; anti-CCR5,

1:1000 dilution).

Page 130: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

111

In order to test if HIV-1 can alter P-p expression, primary cultures of HFAs were exposed to R5-

tropic and X4/R5-tropic viral isolates. Since R5-tropic viruses are known to predominate in the

brain, we used HIV-1 ADA isolates. We also utilized HIV-1 89.6, an X4/R5 viral isolate, to test

the effect of dual tropism on P-gp expression. Exposure to either X5-tropic or X4/R5-dual-tropic

viral isolates for 24h resulted in decreased (p<0.001) P-gp expression by up to 75% and 90%

respectively (Figure 7-2A).

7.4.3 Effect of gp120 and IL-6 on P-gp protein expression

We have previously shown that gp120 exposure can significantly decrease P-gp protein

expression in primary cultures of rat astrocytes. However, it was unknown if gp120 had a similar

effect on P-gp expression in human astrocytes. Immunoblot analysis showed that HIV-1 gp120

treatment resulted in a time dependent decrease in P-gp protein expression (approximately 64%

or 2.8-fold after 24h) compared to untreated cells (Figure 7-2B). No significant change in protein

expression was observed after 6h or 12h of treatment.

Page 131: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

112

Figure 7-2 Immunoblot and densitometric analysis of P-gp in primary cultures of HFAs after

exposure to (A) either CCR5- tropic HIV-1 ADA or CCR5/CXCR4 dual-tropic HIV-1 89.6 viral

isolates, (B) 1.0 nM gp120 or (C) IL-6 (0.5 ng/ml or 10ng/ml). Whole cell lysates (50 µg) from

primary cultures of HFAs were resolved on a 10% SDS-polyacrylamide gel and transferred to a

PVDF membrane. MDR1 overexpressing cell lines (MDCK-MDR1 and MDA-MDR1) were

used as positive controls. P-gp was detected using the monoclonal antibody C219 (1:500 or

1:300 dilution) and actin was detected using AC40 antibody (1:500 dilution). Results are

expressed as mean ± SD of three separate experiments. Asterisks represent data points that are

significantly different from control (***p<0.001; *p<0.05).

Page 132: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

113

Decreased P-gp protein expression correlated with a reduction in P-gp mediated drug transport

activity. This was demonstrated by an increase in cellular [3H]digoxin accumulation, an

established substrate for P-gp, in gp120-treated HFA cultures as compared to untreated controls

(Figure 7-3).

Figure 7-3 Accumulation of [3H]digoxin by HFAs in the presence or absence of gp120.

[3H]digoxin (100 nM) accumulation was measured at 37C in cells treated with 1.0 nM gp120.

Results are expressed as mean ± SD of three separate experiments and each data point represents

quadruplicate measurements. Asterisks (*) represent data points that are significantly different

from control (p<0.05).

Page 133: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

114

Previously, we have demonstrated that IL-6 was a key regulator of P-gp expression in rat

astrocytes. Therefore, we investigated the effect of this cytokine in human astrocytes. IL-6 (0.5

ng/ml and 10 ng/ml) decreased P-gp expression up to 50% after 12h exposure (Figure 7-2C).

However, P-gp protein expression was not altered by longer exposure up to 48h (Data not

shown). In the presence of IL-6-neutralizing antibody, P-gp protein expression was not

significantly decreased by HIV-1 gp120 as compared to HFAs treated with only HIV-1 gp120

(Figure 7-4).

Page 134: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

115

Figure 7-4 Immunoblot and densitometric analysis of P-gp in primary cultures of HFAs treated

with 1.0nM gp120 in the presence of 0.5µg/ml IL-6 neutralizing antibody (NAB). Whole cell

lysates (50 µg) from primary cultures of HFAs were resolved on a 10% SDS-polyacrylamide gel

and transferred to a PVDF membrane. An MDR1 overexpressing cell line (MDA-MDR1) was

used as positive control. P-gp was detected using the monoclonal antibody C219 (1:300 dilution)

and actin was detected using AC40 antibody (1:500 dilution). Results are expressed as mean ±

SD of three separate experiments. Asterisks (*) represent data points that are significantly

different from control (p<0.05).

Page 135: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

116

7.4.4 Involvement of NF-кB in the regulation of P-gp expression

NF-κB signaling has been reported to play a role in inflammation-mediated regulation of P-gp.

However, the role of this pathway in regulating P-gp expression in human astrocytes has not

been demonstrated. Using immunoblot analysis, we investigated whether NF-κB can regulate P-

gp protein expression in HFAs exposed to gp120 or IL-6. Treatment with gp120 or IL-6 resulted

in a significant decrease in P-gp expression (64% and 50%, respectively). However, in the

presence of SN50, a peptidic inhibitor of NF-κB nuclear translocation, P-gp protein expression

remained unchanged when exposed to gp120 or IL-6 in HFAs, suggesting a role for this

transcription factor in P-gp downregulation (Figure 7-5).

Page 136: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

117

Figure 7-5 Immunoblot and densitometric analysis of P-gp in primary cultures of HFAs treated

with (A) 1.0nM gp120 or (B) IL-6 (0.5 or 10ng/ml) in the presence of NF-κB inhibitory peptide,

SN50 (1.0 μM). Whole cell lysates (50 µg) from primary cultures of HFAs were resolved on a

10% SDS-polyacrylamide gel and transferred to a PVDF membrane. An MDR1 overexpressing

cell line (MDCK-MDR1) was used as positive control. P-gp was detected using the monoclonal

antibody C219 (1:500 dilution) and actin was detected using AC40 antibody (1:500 dilution).

Results are expressed as mean ± SD of three separate experiments. Asterisks (*) represent data

points that are significantly different from control (p<0.05).

Page 137: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

118

7.5 Discussion

Pharmacotherapy of HIV-1 brain infection is limited. This, in part, is attributed to functional

expression of ABC drug transporters such as P-gp actively pumping several xenobitotics

including antiretroviral drugs out of several cellular compartments. Since astrocytes in brain

parenchyma are able to harbour latent HIV-1 infection (Gorry et al., 2003), expression of P-gp in

these cells is a major determinant of successful antiretroviral drug cellular permeability and

suppression of viral infection. Since the regulation of P-gp expression by HIV-1 in human

astrocytes had not been investigated prior to the present study, we investigated the effect of HIV-

1 isolates on P-gp protein expression in an in vitro model of HFAs. In our primary cultures of

HFAs, we observed a significant decrease in P-gp protein expression in the presence of R5-tropic

and R5/X4-tropic HIV-1 viral isolates suggesting a downregulatory effect of HIV- 1 on P-gp

expression. Previously, Gollapudi and Gupta reported altered expression of P-gp in a HIV-1

infected T- cell line and in a monocytic cell line. In contrast to our findings, they reported

upregulation of P-gp expression in their leukocytic cell systems when subjected to HIV-1

infection (Gollapudi and Gupta, 1990). Compared with T-cells or monocytes, astrocytes do not

harbour productive HIV-1 infection and utilize different mechanisms of HIV-1 viral entry and

sequestration (Boutet et al., 2001;Liu et al., 2004;Sabri et al., 1999).Therefore, it is possible that

regulation of P-gp expression by HIV-1 is also cell-type specific, which may account for the

apparent discrepancies between our present study and the work of Gollapudi and Gupta.

Shed viral proteins are also known to alter expression of ABC transporters. For example, viral

protein Tat-induced P-gp expression has been reported both in cultured brain microvessel

endothelial cells and in astrocytes (Hayashi et al., 2005), whereas, we have previously

demonstrated that gp120 exposure can significantly downregulate P-gp protein expression (4.7-

fold) resulting in increased accumulation of saquinavir, an antiretroviral drug, in primary cultures

of rat astrocytes (Ronaldson et a., 2006). HIV-1 Tat is an accessory protein that is critical for

viral replication, whereas, gp120 is a structural protein that is part of the viral envelope and is

essential for the viral binding to host cells that initiates HIV-1 cellular entry process. The

mechanism of action of both proteins are different. Tat is known to cross the cell membrane and

interact with transcription factors within a cell (Mahlknecht et al., 2008;Sune and Garcia-Blanco,

1995), whereas, gp120 is known to interact with chemokine receptors on the cell surface

Page 138: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

119

(Ronaldson and Bendayan, 2006;Wu et al., 1997). Therefore, it is anticipated that these proteins

may activate signaling pathways differently and in turn, have different effects on P-gp

expression. In our present study, we further demonstrate that gp120 exposure results in a 2.8-fold

decrease in P-gp protein expression in human astrocytes. As expected, the magnitude of P-gp

downregulation is less profound in HFAs exposed to viral protein as compared to cells exposed

to R5-tropic and dual-tropic HIV-1 viral isolates. In our hands, exposure to gp120 also results in

a significant reduction in P-gp function as shown by increased accumulation of digoxin

(approximately 1.6-fold in gp120 treated cells compared to the control). Although the decrease in

P-gp protein expression is less profound in HFAs than in cultured rat astrocytes (2.8-fold versus

4.7-fold), the functional activity of P-gp was downregulated to a similar degree in both models

(1.5-fold increase in digoxin accumulation in rat astrocytes versus 1.6-fold increase in HFAs)

(Ronaldson and Bendayan, 2006). The comparable functional loss of P-gp in both human and rat

astrocytes in the presence of gp120 suggests that although the effect of this viral protein on the

P-gp expression is different between two models, the effect on drug transport activity remains

similar.

In this study, we have further characterized gp120 mediated cytokine secretion in HFAs. It is

known that during HIV-1 infection, secreted gp120 can interact with microglia/ macrophages as

well as astrocytes in the CNS and induce secretion of neurotoxic cytokines (Kaul and Lipton,

2006). Transgenic mice expressing gp120 show activation of glial cells and neuronal damage

suggesting a significant role for this viral protein in HIV-1 mediated neuroinflammation (Toggas

et al., 1994). Previously, gp120 triggered cytokine secretion (IL-6, IL-1β and TNF-α) has been

characterized in primary cultures of rat astrocytes. Here, we have characterized cytokine

secretion by gp120 in human astrocytes. Our findings show that R5-tropic gp120 induced

secretion of IL-6, IL-1β and TNF-α in HFAs indicating that an inflammatory response can be

triggered by gp120 in these cells. Neutralization of cell surface CCR5 chemokine receptor

significantly diminished gp120-mediated cytokine production suggesting that interaction of

gp120 with CCR5 is responsible for cytokine release in these cells. Our findings in HFAs are in

agreement with previously published findings in a rodent model and emphasize that the gp120-

CCR5 interaction is a critical event in neuroinflammatory signaling within human brain

parenchyma.

Page 139: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

120

Ample literature evidence suggests alteration of P-gp expression by pro-inflammatory cytokines.

In human hepatocytes, IL-6 exposure resulted in a reduced MDR1 gene expression and P-gp

activity (Lee and Piquette-Miller, 2001). Recently, an IL-6 mediated decrease in P-gp expression

has been reported in cultured human brain microvessel endothelial cells further supporting the

fact that P-gp expression can be altered by this cytokine (Poller et al., 2010). In rodent astrocytes,

IL-6 treatment resulted in a continuous and profound decrease in P-gp expression from 6h to 24h

(8.9-fold after 24h). Comparison of P-gp expression following IL-6 exposure in different cells

suggests that this cytokine may have a down-regulatory effect on P-gp expression. Accordingly,

treatment with IL-6 also results in a time-dependent decrease in P-gp protein expression in

cultured HFAs. P-gp protein expression is 50% (2-fold) downregulated after 12h of treatment

with either low or high concentration of IL-6. However, the downregulatory effect of IL-6 is lost

during longer exposure (24h) and P-gp protein expression returned to the control levels. Time

dependent regulation of P-gp by other cytokines has been reported previously. Bauer et al. have

shown that TNF-α induced regulation of P-gp is time-dependent where a transient exposure to

TNF-α caused a decrease in P-gp expression and a longer exposure increased the expression of

this transporter in rat brain capillaries (Bauer et al., 2007). Compared to the profound

downregulation (8.9-fold) previously reported in rodent astrocytes (Ronaldson and Bendayan,

2006), the IL-6 mediated decrease in P-gp expression in HFAs is modest (2-fold). This finding

may be explained by the difference in endogenous levels of IL-6 between the culture

supernatants of rat and human astrocytes. IL-6 was undetectable in primary cultures of rat

astrocytes. Although previous studies reported no evidence of IL-6 presence in untreated

cultured HFAs (Lee et al., 1993), we detect IL-6 in HFA culture supernatant (approximately

182.36 pg/ml). Astrocytes are known to be the primary source of IL-6 cytokine during

inflammation; however, elevated endogenous levels of IL-6 in HFAs may be related to the

prenatal phenotype of these cells. Previously, a beneficial role of IL-6 has been reported in

neuronal protection implying that endogenous IL-6 secreted from HFAs may have a

neuroprotective role during fetal brain development (Gadient and Otten, 1997). Since the HFAs

are continuously exposed to endogenous IL-6 levels, it is likely that the IL-6 mediated decrease

in P-gp expression may substantially differ between human and rat astrocytes.

Page 140: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

121

We have further examined the role of IL-6 in regulating P-gp expression by treating cultured

HFAs with HIV1 gp120, in the presence of IL-6-neutralizing antibody. Our results show that P-

gp protein expression was not significantly altered in these conditions confirming that IL-6

secretion is primarily responsible for the gp120-mediated downregulation observed in HFAs.

These findings further support our findings in rodent astrocytes where IL-6 was also the principal

cytokine responsible for P-gp downregulation (Ronaldson and Bendayan, 2006).

Viral proteins and/or cytokines are known to activate intracellular signaling pathways (Kaul et

al., 2005;Sluss et al., 1994). Few studies have reported the activation of NF-кB in response to

gp120 in various cell systems including astrocytes (Saha and Pahan, 2007). Furthermore, NF-кB

signaling is known to be involved in ABC drug transporters regulation. Using rat brain

capillaries, Bauer et al. demonstrated that alteration of P-gp expression by TNF-α is NF-κB

dependent. Previous work by our group showed that NF-κB is involved in the regulation of

Mrp1, another drug efflux transporter, in gp120 treated cultured rat astrocytes, by inducing TNF-

α secretion (Ronaldson et al., 2010). However, the role of NF-κB in P-gp regulation in HFAs

triggered with gp120 or IL-6 has not been elucidated. Therefore, we investigated the

involvement of NF-κB in our HFA model by inhibiting this transcription factor using the

inhibitory peptide, SN50. In HFAs, inhibition of NF-kB attenuated both gp120 and IL-6

mediated decreases in P-gp expression whereas inhibition of this transcription factor did not

affect endogenous P-gp expression. These findings demonstrate that NF-κB is involved in the

downregulation of P-gp by gp120 or IL-6 in HFAs.

To date, a limited number of studies have examined the expression of ABC transporters in adult

human brain and none of these studies have investigated P-gp expression in HIV-1 infected

treatment-naive patients. Due to the limitation in obtaining appropriate controls (i.e., treatment

naive, age-matched), it is still unclear how HIV-1 associated neuroinflammation affects the

functional expression of these transporters in adult human brain. Therefore, we have chosen to

use an in vitro system to determine the effect of viral proteins and cytokines in HFAs. Our

findings demonstrate for the first time that HIV-1 isolates, gp120 and/or IL-6 exposure can

downregulate P-gp protein expression in primary cultures of HFAs and that NF-κB signaling

pathway is involved in this regulation. The present study performed in human astrocytes

validates our previous data obtained in primary cultures of rat astrocytes by showing that gp120

Page 141: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

122

induced inflammatory response and loss of P-gp function exist and remain comparable in both

models. Furthermore, our results suggest that astrocytes may be involved in antiretroviral drug

sequestration within brain parenchyma during HIV-1 infection. The availability of antiretroviral

drugs in astrocytes, in turn, may aid in limiting brain viral infection by preventing the latent virus

from becoming infectious. However, in addition to P-gp, other transporters of the ABC family

are also known to be involved in antiretroviral drug transport. For example, MRP1 can transport

several HIV-PIs used in antiretroviral therapy (Dallas et al., 2004a;Ronaldson et al., 2008).

Using rodent astrocytes, we have previously demonstrated that gp120 exposure results in an

upregulation of Mrp1 expression in primary cultures of rat astrocytes (Ronaldson et al., 2010).

Although we have not yet investigated the regulation of MRP1or other MRP isoforms involved

in antiretroviral drug transport in human astrocytes, the regulation of these transporters during

HIV-associated neuroinflammatory response will also contribute towards the overall

antiretroviral drug permeability in astrocytes. Further work is needed to clarify the effect of

downregulated P-gp in astrocytes on antiretroviral therapy efficacy. Overall, the results of our

work emphasize that rodent astrocytes can be used as an effective glial culture model for

understanding and elucidating mechanisms involved in inflammation and drug resistance in

HIV-1 infection of human astrocytes.

7.6 Acknowledgements

The authors thank Dr. Michelle Farrugia (Mount Sinai Hospital, Toronto, ON) for her

remarkable assistance in obtaining human fetal brain tissue.

This work is supported by the Canadian Institutes of Health Research (CIHR, MOP-56976 to

RB), the Ontario HIV Treatment Network (OHTN to RB) and from the National Institute of

Health (RO1 MH65151, RO1 AA017398 to YP).

Page 142: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

123

Chapter 4

8 Role of anti-inflammatory compounds on HIV-1 gp120-

mediated brain inflammation

This work is published and reproduced in this thesis with permission from Biomed Central:

T Ashraf,W Jiang, T Hoque, J Henderson, C Wu and R Bendayan. Role of anti-inflammatory

compounds in human immunodeficiency virus-1 glycoprotein120 -mediated brain inflammation.

2014. Journal of Neuroinflammation. 11:91.

Author contributions:

Research design: T Ashraf (first author), W Jiang, T Hoque, J Henderson (collaborator), C Wu

and R Bendayan (principle investigator).

Conducted experiments and data analysis: T Ashraf (figures 8-1, 8-2, 8-3,8-4,8-5,8-6,8-7 except

animal surgery and qPCR); W Jiang (figures 8-1, 8-2,8-5,8-6); T Hoque (figures 8-3,8-4); J

Henderson (figure 8-3) and C Wu (figure 8-7, animal surgery).

Writing of the manuscript: T Ashraf (preparation of the manuscript drafts and responses to

reviewer’s comments); T Hoque (editorial review, submission and image resolution

improvement); J Henderson (editorial review) and R Bendayan (overall conceptual and editorial

review of several manuscript drafts and responses to reviewer’s comments)

Page 143: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

124

8.1 Abstract

Neuroinflammation is a common immune response associated with brain HIV-1 infection.

Identifying therapeutic compounds that exhibit better brain permeability and can target signaling

pathways involved in inflammation may benefit treatment of HIV-associated neurological

complications. The objective of this study was to implement an in vivo model of brain

inflammation by intracerebroventricular administration of the HIV-1 viral coat protein gp120 in

rats and to examine anti-inflammatory properties of HIV adjuvant therapies such as minocycline,

chloroquine and simvastatin.

Male Wistar rats were administered a single dose of gp120ADA (500 ng) daily for seven

consecutive days, intracerebroventricularly, with or without prior intraperitoneal administration

of minocycline, chloroquine or simvastatin. Maraviroc, a CCR5 antagonist, was administered

intracerebroventricularly prior to gp120 administration for seven days as control. Real-time

qPCR was used to assess gene expression of inflammatory markers in the frontal cortex,

hippocampus and striatum. IL-1β and TNF-α secretion in CSF was measured applying ELISA.

Protein expression of MAPKs (ERK1/2, JNKs and P38Ks) was detected using immunoblot

analysis. Student’s t-test and ANOVA were applied to determine statistical significance.

In gp120ADA-injected rats, mRNA transcripts of IL-1β and iNOS were significantly elevated in

the frontal cortex, striatum and hippocampus compared to saline or heat-inactivated gp120-

injected controls. In CSF, a significant increase in TNF-α and IL-1β was detected. Maraviroc

reduced upregulation of these markers suggesting that the interaction of R5-tropic gp120 to

CCR5 chemokine receptor is critical for induction of an inflammatory response. Minocycline,

chloroquine or simvastatin attenuated upregulation of IL-1β and iNOS transcripts in different

brain regions. In CSF, minocycline suppressed TNF-α and IL-1β secretion, whereas chloroquine

attenuated IL-1β secretion. In gp120-injected animals, activation of ERK1/2 and JNKs was

observed in the hippocampus and ERK1/2 activation was significantly reduced by the anti-

inflammatory agents.

Our data demonstrate that anti-inflammatory compounds can completely or partially reverse

gp120-associated brain inflammation through an interaction with MAPK signaling pathways and

Page 144: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

125

suggest their potential role in contributing towards the prevention and treatment of HIV-

associated neurological complications.

8.2 Background

Neurocognitive impairment remains highly prevalent in HIV-1 infected individuals due to

persistence of viral replication and associated inflammation in the brain (Heaton et al., 2011) .

Since the initiation of HAART, the development of HAD in HIV-1 infected patients has

significantly decreased. However, milder forms of HAND are becoming more predominant in

the post-HAART era, in part due to the longer life expectancy of infected individuals on

treatment. Despite receiving treatment, up to 50% of HIV-1 infected patients continue to develop

cognitive impairment, psychiatric illness and persistent fatigue (Heaton et al., 2011).

In response to HIV-1, resident microglia in the brain become activated and release inflammatory

mediators that further trigger the activation of neighboring microglia and astrocytes and signal

recruitment of peripheral monocytes from the systemic circulation (Ronaldson et al., 2008).

Studies have demonstrated that virus-infected cells or glial cells can release various neurotoxic

factors (AA, platelet activating factor, quinolinic acid, ROS, NO and glutamate) and a number of

pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, IL-8, IL-18, IFNα, IFNγ) (Perrella et al.,

1992;Ronaldson and Bendayan, 2008;Ronaldson et al., 2008). Irreversible neuronal injury and

loss is often caused by inflammation and oxidative stress associated with these mediators present

in the systemic circulation that crosses the BBB and/or mediators secreted in the brain from glial

cells. Detectable amounts of these cytokines in the CSF of patients with HAND have been

reported (Perrella et al., 1992). In vitro studies in primary glial cell cultures also suggest that

shed viral proteins (such as gp120, Tat and vpr) can induce secretion of pro-inflammatory

cytokines. For example, previous work from our laboratory has demonstrated that R5-tropic

gp120 can mediate secretion of pro-inflammatory cytokines (TNF-α, IL-1β and IL-6) by

interacting with CCR5 chemokine receptor in primary cultures of human or rodent astrocytes

(Ashraf et al., 2011;Ronaldson and Bendayan, 2006). HIV-1 proteins (such as gp120 and Tat)

can also downregulate tight junction proteins expressed in brain microvessel endothelial cells

which may facilitate the entry of the virus into the brain parenchyma (Kanmogne et al., 2005).

Page 145: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

126

The treatment of brain HIV-1 infection remains challenging partly due to poor permeability of

antiretroviral drugs across the BBB and into glial cells. One possible mechanism for the low

brain permeability of these drugs is the functional expression of ATP-dependent, membrane-

associated efflux transporters known as ABC transporters (P-gp, MRPs and Bcrp) at the BBB

and in brain parenchyma (Bendayan et al., 2002). Several in vivo and in vitro studies have

examined the role of these transporters in reducing the permeability of antiretroviral drugs into

brain cellular compartments (Bendayan et al., 2002;Kaddoumi et al., 2007). For example,

administration of P-gp specific inhibitor zosuquidar in macaques resulted in significant brain

accumulation of nelfinavir (Kaddoumi et al., 2007). Evidence in the literature suggests that

functional expression of these transporters in the brain is altered during HIV-1 infection.

Langford et al. reported increased P-gp immunoreactivity in glial cells in brain autopsy tissues

from patients with HIVE (Langford et al., 2004), whereas, Persidsky et al. reported a decreased

P-gp expression in tissues obtained from HIVE patients and from the SCID mice model of HIVE

(Persidsky et al., 2000). Furthermore, shed viral proteins (such as gp120 and Tat) and secreted

pro-inflammatory cytokines during HIV-1 infection are also known to alter the expression of

drug efflux transporters. Our previous work in rodent and human astrocytes suggests that gp120

can significantly downregulate P-gp functional expression (Ronaldson and Bendayan, 2006). We

have also observed an increase in Mrp1 functional expression in response to gp120 in primary

cultures of rat astrocytes (Ronaldson and Bendayan, 2006;Ronaldson and Bendayan, 2008).

However, whether gp120 can modulate the expression of these transporters in vivo in a similar

manner is yet to be characterized.

Several classes of antiretrovirals have been reported to poorly permeate into the brain, whereas

better permeable antiretroviral drugs can be associated with adverse side effects including

neurotoxicity (Cavalcante et al., 2010). Due to the complexities associated with the treatment of

brain HIV-1 infection and HIV-associated chronic secretion of inflammatory mediators, much

interest has risen in identifying potential adjuvant therapies that can be used along with

antiretroviral drugs. For example, minocycline, a second generation tetracycline derivative, has

been considered as a potential candidate due to its versatile role in neuroprotection in different

brain disease models (Meulendyke et al., 2012;Szeto et al., 2010). Chloroquine, an antimalarial

drug and simvastatin, a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, have also

Page 146: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

127

demonstrated an anti-inflammatory and anti-HIV effect at non-toxic concentrations in vitro or in

vivo (Andras et al., 2008;Hagihara et al., 2000;Naarding et al., 2007;Nabatov et al., 2007).

Furthermore, minocycline, chloroquine and simvastatin can inhibit MAPK signaling pathways

(ERK1/2, JNKs and P38Ks) involved in generating inflammatory responses (Nikodemova et al.,

2006). In a clinical trial minocycline treatment was found to be unsuccessful in improving the

neurocognitive outcome in patients with cognitive impairment (Sacktor et al., 2011). On the

contrary, in a SIV model early administration of minocycline was reported to be effective against

striatal dopaminergic system dysfunction, suggesting that timely treatment initiation may have an

effect on minocycline efficacy (Meulendyke et al., 2012). Based on these observations, we

propose that early administration of these anti-inflammatory compounds may have the potential

to reverse HIV-associated inflammatory response.

The objective of the present work was to implement an in vivo model of HIV-associated

inflammation by ICV administration of viral coat protein gp120 and to investigate the regulation

of drug transporters, tight junction proteins, signaling pathways and the potential anti-

inflammatory effects of chloroquine, minocycline and simvastatin.

8.3 Materials and methods

8.3.1 Materials

HIV-1ADA gp120 full-length protein (subtype B; R5-tropic) and maraviroc were obtained from

Immunodiagnostic Inc (Woburn, Massachusetts, United States) and the NIH AIDS Research and

Reference Reagent program (Bethesda, Maryland, United States), respectively. ERK1/2 inhibitor

U0126 and simvastatin were purchased from Cell Signaling (Whitby, Ontario, Canada) and

Toronto Research Chemicals (Toronto, Ontario, Canada), respectively. Chloroquine,

minocycline, JNK inhibitor SP600125, murine monoclonal AC-40 antibody against actin, rabbit

polyclonal antibody against GFAP and HRP conjugated secondary antibodies (anti-mouse, anti-

rabbit and anti-rat) were obtained from Sigma-Aldrich (Oakville, Ontario, Canada). Alexa fluor

488 donkey anti-rabbit, anti-occludin, anti-zo1 and anti-claudin5 antibody, TRIzol™, DNAse I

and Prolong gold anti-fade reagent with 4',6-diamidino-2-phenylindole (DAPI) were purchased

from Invitrogen (Carlsbad, California, United States). Tissue-Tek cryo-optimum cutting

temperature (OCT) formulation was purchased from Thermo Fisher Scientific (Waltham,

Page 147: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

128

Massachusetts, United States). ERK1/2, phospho-ERK1/2, JNK, phospho-JNK, P38K and

phospho-P38K antibodies were obtained from Cell Signaling (Whitby, Ontario, Canada). Murine

monoclonal C219 antibody against P-gp, rat monoclonal MRP1 antibody and anti-BCRP (rat

monoclonal) antibody were purchased from ID labs (London, Ontario, Canada), Kamiya

Biomedical Company (Seattle, Washington, United States) and Abcam Inc (Boston,

Massachusetts, United States), respectively. ELISA kits were obtained from R&D Systems

(Minneapolis, Minnesota, United States). Guide cannula, dummy cannula, screws and dental

cement for stereotaxic surgery were purchased from HRS Scientific (Montreal, Quebec, Canada).

High capacity reverse transcriptase cDNA synthesis kit and SYBR Green Fastmix were obtained

from Applied Biosystems (Foster City, California, United States) and Quanta Biosciences Inc

(Gaithersburg, Maryland, United States), respectively.

8.3.2 Animals

This study was approved by the University of Toronto Animal Care Committee, Toronto,

Ontario, Canada. Adult Wistar male rats (weighing approximately 250 grams; 12 weeks of age)

were purchased from Charles River Laboratories (St. Constant, Quebec, Canada). Animals were

housed with rodent chow and water ad libitum on a 12 hour light-dark cycle. All procedures

were carried out in accordance with the guidelines of University of Toronto Animal Care

Committee and the Canadian Council on Animal Care. The rats were randomly assigned to nine

different groups: (1) wild-type (no surgery), (2) control (saline), (3) heat-inactivated gp120, (4)

gp120, (5) maraviroc + gp120, (6) chloroquine + gp120, (7) minocycline + gp120, (8)

simvastatin + gp120, (8) JNK inhibitor SP600125 + gp120, and (9) ERK1/2 inhibitor U0126 +

gp120.

8.3.3 Animal surgery and ICV administration of gp120/maraviroc/signaling

pathway inhibitors

Animals were anaesthetized with isoflurane (2 to 3%). The implantation of the guide cannula

was performed according to previously published protocols using the following stereotaxic

coordinates: 1 mm posterior to bregma, 1.5 mm lateral from midline and 3.5 mm ventral from

the surface of the skull according to the Atlas of Paxinos and Watson (Bagetta et al.,

1996;Paxinos G and Watson, 2006). Ketoprofen (5 mg/kg) was administered subcutaneously

Page 148: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

129

during surgery for pain relief. Animals were allowed to recover for seven days after surgery.

Following recovery, animals were administered a single dose of (100 ng or 300 ng or 500 ng)

gp120ADA (R5-tropic; clade B) daily for seven consecutive days ICV using a 5 μl Hamilton

syringe. gp120 was diluted into a sterile normal saline solution and administered in a volume of

2 μl (such as 250 ng/μl) over 2 minute period. Control animals received equal amount of saline.

Heat-inactivated gp120 was also administered for seven days as an additional control group.

Maraviroc, a selective CCR5 antagonist, was administered 30 minutes prior to gp120

administration for seven days [4 μl/4 minutes; 250 ng/μl in 1% dimethyl sulfoxide (DMSO)].

ERK1/2 inhibitor U0126 (7 μg) and JNK inhibitor SP600125 (10 μg) were administered ICV

prior to gp120 administration at the same rate (4 μl/4 minutes; dissolved in 1.5% DMSO).

8.3.4 Intraperitoneal administration of minocycline, chloroquine and

simvastatin

Minocycline (50 mg/kg loading dose followed by 25 mg/kg/day) or chloroquine (25 mg/kg/day)

or simvastatin (1 mg/kg) was administered daily for seven consecutive days by a single

intraperitoneal injection 30 minutes prior to ICV gp120 administration. Minocycline and

chloroquine were dissolved in sterile water and simvastatin was dissolved in a 1% DMSO

solution.

8.3.5 Brain tissue, brain capillary isolation and CSF collection

Twenty four hours after the last injection, animals were anaesthetized and CSF samples were

collected by cisterna magna puncture according to previously published protocol (Jiang et al.,

2009). Subsequently, anaesthetized animals were perfused through the left ventricle of the heart

with 200 ml of saline solution and whole rat brains were harvested. For real-time qPCR and

immunoblot analysis, brains were dissected on ice to isolate frontal cortex, hippocampus and

striatum from both hemispheres. Samples were flash frozen in liquid nitrogen and kept at -80°C.

Capillaries were also isolated from saline and gp120-injected rat brains following previously

published protocol (Chan et al., 2013c). For immunohistochemical analysis, saline perfusion was

followed by 180 ml of paraformaldehyde (4%) dissolved in PBS perfusion before collecting

whole brains. These samples were stored in 50 ml paraformaldehyde (4%) at 4°C.

Page 149: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

130

8.3.6 Quantitative real-time PCR

Real-time qPCR was applied to determine the gene expression of inflammatory markers

according to previously described protocols followed by our laboratory (Hoque et al., 2012).

Briefly, total RNA was extracted from brain regions using TRIzol™ (Invitrogen, Carlsbad,

California, United States) reagent and the high capacity cDNA reverse transcriptase kit (Applied

Biosystems, Foster City, California, United States) was used to synthesize first-strand cDNA.

Primer pairs for the rat IL-1β gene (5-CTCAACTGTGAAATAGCAGCTTTC–3 and 5

GGACAGCCCAAGTCAAGG–3), rat TNF-α (5-TCTTCTCATTCCTGCTCGTG–3 and 5-

GATGAGAGGGAGCCCATTT–3), rat iNOS (5-CCAAGGTGACCTGAAAGAGG–3 and 5

TTGATGCTTGTGACTCTTAGGG–3), rat IL-6 (5-CTTCACAAGTCGGAGGCTTAAT–3 and

5-ACAGTGCATCATCGCTGTTC–3) and the rat Cyclophilin B gene (housekeeping gene; 5-

GGAGATGGCACAGGAGGAA-3 and 5-GCCCGTAGTGCTTCAGCTT-3) were designed

using Primer Express 3 software (Applied Biosystems, Foster City, California, United States))

and were validated for specificity and efficacy using LPS-treated rat astrocyte samples.

Quantitative PCR was performed using SYBR Green Master Mix (Quanta Biosciences Inc,

Gaithersburg, Maryland, United States) using an Eppendorf Real-time PCR System (Eppendorf

Canada, Mississauga, Ontario, Canada). A relative quantification was performed by comparing

the threshold cycle values of samples with serially diluted standards. Expression levels were

normalized to housekeeping gene Cyclophilin B.

8.3.7 ELISA

Commercially available colorimetric sandwich ELISA kits for rat IL-1β and TNF-α were used to

detect the secretion of these cytokines in CSF in the presence or absence of maraviroc,

chloroquine, minocycline and simvastatin. CSF collected from control (no surgery) and ICV

heat-inactivated gp120-administered animals was analyzed as an additional control group. The

assays were performed according to the manufacturer’s instruction with slight modifications as

previously described in our laboratory. Standard curves were generated using appropriate rat

cytokines and absorbance read at 450 nm was converted to pg/ml. We confirmed the minimal

detection level to be 2.5 pg/ml and 1.5 pg/ml for IL-1β and TNF-α, respectively.

Page 150: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

131

8.3.8 Immunoblot Analysis

Immunoblotting was performed as described previously in our laboratory (Ronaldson and

Bendayan, 2006). Tissue and capillary homogenates were prepared using a lysis buffer (1% (v/v)

NP-40 in 20 mM tris, 150 mM NaCl, 5 mM EDTA at pH 7.5 containing 1 mM PMSF and 0.1%

(v/v) PI cocktail). Tissues were sonicated for 10 seconds and centrifuged at 20,000 g for 10

minutes at 4°C to remove cellular debris. Protein concentrations of tissue or capillary

homogenates were determined using Bradford’s protein assay (Bio-rad laboratories, California,

United States). Total protein (1 μg, 5 μg to 50 μg) were separated on 7 to 12% SDS-PAGE and

transferred onto a PVDF membrane. After blocking with 5% skim milk for one hour, the

membrane was probed for protein of interest with primary antibody [anti-P-gp (C219), 1:500;

Mrp1, 1:500; Bcrp, 1:500; β-actin, 1:2000; ZO-1, 1:500; occludin, 1:500; claudin5, 1:250;

GFAP, 1:1000; iNOS, 1:500; ERK1/2,1:250; phospho-ERK1/2, 1:100; JNK, 1:250; phospho-

JNK, 1:100; P38K, 1:250; phospho-P38K, 1:100]. β-Actin was used as loading control. HRP-

conjugated secondary antibody was added after washes in tris-buffered saline with Tween. After

further washing, bands were detected using enhanced chemiluminescent reagent (Thermo

Fischer Scientific, Ontario, Canada). Densitometric analysis was performed in AlphaDigiDoc

RT2 software (Alpha Innotech, San Leandro, California, United States) to quantify relative

protein expression. The graphs represent relative density of the bands of interest normalized to

corresponding β-actin.

8.3.9 Immunohistochemistry

Immunohistochemistry was performed according to previously published protocol (Hui et al.,

2010). Briefly, paraformaldehyde-fixed samples were transferred to a 30% sucrose solution and

kept overnight at 4°C before mounting with OCT compound. Coronal cryostat sections (25 μm)

were prepared at Murine Imaging and Histology Facility (Faculty of Pharmacy, University of

Toronto, Toronto, Ontario, Canada). Sections were incubated in blocking buffer (5% goat serum

and 0.2% Triton X-100 in 0.1 M PBS) for one hour followed by overnight incubation with

primary antibody at 4°C (Anti-GFAP, 1:200). Following incubation, sections were washed

thoroughly in PBS and incubated for two hours in Alexa-Fluor conjugated secondary antibody

(1:200). After further washing, coverslips were mounted onto the specimen using a prolong gold

anti-fade mounting medium with DAPI. Specimens were examined using a Nikon E1000

Page 151: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

132

fluorescent microscope (Nikon Corp., Mississauga, Canada). Images were captured using the

software SimplePCI (Compix, Inc., Imaging Systems, Sewickley, Pennsylvania, United States).

8.3.10 Data analysis

Student’s t-test was used to determine statistical significance between two groups. Multiple

comparisons were performed using ANOVA and Bonferroni’s post-hoc analysis. A P value less

than 0.05 was considered to be statistically significant. Data were analyzed using GraphPad

Prism software (San Diego, California, United States). Samples collected from three to twelve

animals per group were used.

8.4 Results

8.4.1 Gp120-mediated inflammatory response in the brain

Previous studies have demonstrated that ICV or region-specific administration of different

strains of gp120 from 100 ng to 500 ng into rodents can induce an inflammatory response

(Bagetta et al., 1999;Louboutin et al., 2010b). In our hands, administration of 100 ng to 300 ng

HIV-1 gp120ADA daily for seven days in adult male Wistar rats did not induce a significant

inflammatory response in brain tissue (data not shown). Therefore, a dose of 500 ng was chosen.

At this dose, we observed a significant upregulation of IL-1β, iNOS and TNF-α in different brain

regions. Compared to saline-administered animals, in gp120 (500 ng)-injected rats, transcripts of

IL-1β, iNOS and TNF-α were significantly elevated in the frontal cortex, whereas, elevated IL-

1β and iNOS mRNA were observed in the hippocampus and striatum (Figure 8-1A-C). No

significant change was observed in IL-6 transcript levels (data not shown). Heat-inactivated

gp120 did not induce any changes in inflammatory markers and remained comparable to saline

treatment (Figure 8-1A-C). ANOVA analysis performed for different regions in Figure 8-1 did

not show a significant difference of IL-1β, iNOS and TNF-α transcripts between wild-type

animals (no surgery) and saline-treated animals (Figure 8-1A-C).

Our previous work in vitro suggested that R5-tropic gp120 could interact with CCR5 chemokine

receptors resulting in pro-inflammatory cytokine secretion (Ronaldson and Bendayan, 2006). In

order to demonstrate that the inflammatory response observed in gp120-administered animals is

mediated by the specific interaction of gp120 with CCR5 chemokine receptor in vivo, we

Page 152: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

133

administered maraviroc, a CCR5 antagonist ICV prior to gp120 administration in rodents.

Administration of maraviroc (1 μg) resulted in a downregulation of IL-1β, iNOS and TNF-α

transcript levels in different brain regions when compared to only gp120-treated animals (Figure

8-1A-C).

Page 153: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

134

Page 154: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

135

Figure 8-1 Effect of gp120 on the mRNA levels of (A) IL-1β, (B) iNOS and (C) TNF-α in

different brain regions of ICV administered gp120 (500ng) rats along with a CCR5 antagonist,

maraviroc (MVC). Wildtype (no surgery), control (saline) and heat inactivated (HI) gp120

injected animals were also analyzed. Results are expressed as mean±standard error of mean

(SEM) (n=10 for saline and gp120 groups; n=3 for wildtype, HI gp120 and maraviroc treated

groups). Asterisk represent data point significantly different from saline administered animals

(*** p<0.001; ** p<0.01; *p<0.05).

Page 155: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

136

At the protein level, a significant increase in TNF-α and IL-1β was also detected in CSF samples

collected from gp120-administered animals (Figure 8-2A and 8-2B). Consistent with the qPCR

data, maraviroc treatment attenuated the gp120-mediated secretion of cytokines. Also, heat-

inactivated gp120-mediated secretion of IL-1β and TNF-α was found to not be significantly

different from saline-treated animals (Figure 8-2A and 8-2B).

Page 156: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

137

Figure 8-2 ELISA analysis of (A) IL-1β and (B) TNF-α secretion in the CSF of gp120 (500ng)

administered rats in the presence of Maraviroc (MVC). CSF collected from saline and heat

injected animals were used as control. Results are expressed as mean±SEM (n=10 for saline and

gp120 groups; n≥3 for wildtype, HI gp120 and maraviroc treated groups). Asterisk represent data

point significantly different from saline administered animals (***p<0.001; ** p<0.01).

Page 157: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

138

8.4.2 Gp120-mediated activation of astrocytes

ICV administration of gp120 has previously been shown to result in astrocyte activation in vivo

as demonstrated by an increase in GFAP expression, a cellular marker for astrocyte (Louboutin

et al., 2010b). Therefore, in our model we investigated expression of GFAP using

immunohistochemistry (Figure 8-3A). In gp120-administered animals, we observed an increase

in GFAP staining in the hippocampus. This was further confirmed by immunoblotting analysis

(Figure 8-3B).

Page 158: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

139

Figure 8-3 (A) Immunohistochemical and (B) immunoblotting (upper panel) and densitometric

analysis (lower panel) of GFAP in hippocampus of ICV administered gp120 rats compared to

saline treated animals. A representative blot is shown. Results are expressed as mean±SEM. For

immunoblotting, samples obtained from five different animals were used per group. Asterisk

represent data point significantly different from saline administered animals (*p<0.05).

Page 159: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

140

8.4.3 Effect of gp120 on tight junction proteins and drugs efflux transporters in

brain capillaries

Previous studies have reported a breakdown of the BBB in models of brain HIV-1 infection in

vitro and in vivo (Persidsky et al., 2000). In order to determine the integrity of the BBB in our in

vivo model, we examined the expression of tight junction proteins (occludin, ZO-1, claudin5) as

well as drug efflux transporters (P-gp, Mrp1 and Bcrp) in brain capillaries isolated from gp120-

treated animals. We did not observe any significant changes in ZO-1, occludin, claudin5, P-gp,

Mrp1 and Bcrp protein expression in brain capillaries isolated from saline or gp120-administered

rats (data not shown).

8.4.4 Effect of gp120 on drug efflux transporter brain expression in brain

regions

We have previously shown in vitro that gp120 exposure can significantly decrease P-gp protein

expression and increase Mrp1 protein expression in primary cultures of rat astrocytes and/or

HFAs. However, it was unknown if gp120 could alter the expression of these transporters in

vivo. Applying immunoblot analysis, we detected significant changes in P-gp, Mrp1 and Bcrp

protein expression in different brain regions of gp120-treated animals (Figure 8-4). Gp120

administration resulted in a significant decrease in P-gp protein expression in the frontal cortex

and hippocampus (40 and 30%, respectively) (Figure 8-4A and 8-4B). In the striatum of gp120-

treated animals, we did not detect any significant changes in P-gp protein expression compared

to saline-administered animals (Figure 8-4C). A significant upregulation of Mrp1 was observed

in hippocampus and striatum (67 and 68%, respectively) (Figure 8-4B and 8-4C), whereas, no

significant change was detected in the frontal cortex (Figure 8-4A). Bcrp, another drug efflux

transporter, was found to be upregulated in the frontal cortex (118% compared to saline) (Figure

8-4A) but not in the hippocampus and striatum (Figure 8-4B and 8-4C).

Page 160: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

141

Page 161: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

142

Page 162: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

143

Figure 8-4 Immunoblot (upper panel) and densitometric analysis (lower panel) of drug efflux

transporters (P-gp, Mrp1 and Bcrp) in (A) frontal cortex, (B) hippocampus and (C) striatum of

ICV administered gp120 rats. Transporter over-expressing cell lines were used as positive

controls. Representative blots are shown. Results are expressed as mean±SEM. Samples

obtained from six different animals were used per group. Asterisk represent data point

significantly different from saline administered animals (**p<0.01; * p<0.05).

Page 163: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

144

8.4.5 Anti-inflammatory effects of chloroquine, minocycline and simvastatin

Animals were administered gp120 (500 ng) ICV with or without prior intraperitoneal

administration of minocycline or chloroquine or simvastatin in order to assess their potential

anti-inflammatory effect. Administration of minocycline or chloroquine partially or completely

suppressed the gp120-induced upregulation of the inflammatory markers examined (Figure 8-5).

In particular, administration of minocycline or chloroquine completely attenuated gp120-

mediated upregulation of IL-1β and iNOS transcripts in all three brain regions (Figure 8-5A-C).

Page 164: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

145

Page 165: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

146

Figure 8-5 Effect of gp120 on the mRNA levels of (A) IL-1β, (B) iNOS and (C) TNF-α in

different brain regions of ICV administered gp120 rats receiving simultaneous intraperitoneal

injection of chloroquine or minocycline. Saline injected animals were used as control. Results

are expressed as mean±SEM. Samples obtained from at least ten different animals were used per

group. Asterisk represent data point significantly different from saline administered animals

(*** p<0.001; **p<0.01; * p<0.05). Diamonds represent data point significantly different from

gp120-treatment (♦♦♦ p<0.001; ♦♦p<0.01).

Page 166: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

147

Minocycline was also effective in suppressing TNF-α transcripts in brain tissues and both TNF-α

and IL-1β secretion in the CSF of gp120-administered animals, whereas chloroquine only

attenuated IL-1β secretion (Figure 8-6A and 8-6B). Simvastatin attenuated both IL-1β and iNOS

transcripts in the hippocampus and striatum (Figure 8-5A and 8-5B), but only suppressed iNOS

in the frontal cortex (Figure 8-5B). At the protein level, however, simvastatin could not

significantly suppress gp120-mediated IL-1β and TNF-α secretion in the CSF (Figure 8-6A and

8-6B).

Page 167: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

148

Figure 8-6 ELISA analysis of (A) IL-1β and (B) TNF-α secretion in the CSF of gp120 (500ng)

administered rats receiving simultaneous intraperitoneal injection of chloroquine or minocycline

or simvastatin. CSF collected from saline injected animals was used as control. Results are

expressed as mean±SEM. Samples obtained from at least ten different animals were used per

group. Asterisk represent data point significantly different from saline administered animals (***

p<0.001; **p<0.01). Diamonds represent data point significantly different from gp120-treatment

(♦♦♦ p<0.001).

Page 168: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

149

8.4.6 Gp120-mediated activation of signaling pathways

The three main subfamilies of the MAPK pathway (ERK1/2, JNK and P38K) are known to be

actively involved in regulating cytokine secretion (Kaminska, 2005). Therefore, we investigated

the activation of ERK1/2, JNK and P38K in different brain regions of gp120-administered

animals. In the hippocampus, we observed phosphorylation of ERK1/2 and JNKs (Figure 8-7A),

however, we did not detect significant changes in ERK1/2, JNK or P38K phosphorylation in the

frontal cortex and striatum (data not shown). Administration of minocycline and simvastatin

significantly reduced ERK1/2 phosphorylation, whereas the effect of chloroquine was not found

to be significant (Figure 8-7B). Gp120-mediated JNK phosphorylation was found to not be

affected despite treatment with anti-inflammatory compounds (data not shown). However, in our

in vitro model of primary cultures of rat astrocytes triggered with gp120, we detected attenuation

of both ERK1/2 and JNKs in the presence of minocycline, chloroquine and simvastatin (data not

shown). In order to further demonstrate that the gp120-mediated activation of these pathways can

be attenuated in our model, inhibitors of ERK1/2 (U0126) and JNK (SP600125) pathways were

administered ICV daily prior to gp120 administration and we confirmed significant inhibition of

ERK1/2 and JNK phosphorylation, respectively (Figure 8-7C and 8-7D).

Page 169: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

150

Page 170: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

151

Page 171: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

152

Figure 8-7 Protein (upper panel) and densitometric analysis (lower panel) of (A) ERK1/2 and

phospho-ERK1/2; JNK and phospho-JNK; P38K and phospho-P38K, (B) ERK1/2 and phospho-

ERK1/2 in the presence of chloroquine, minocycline and simvastatin, (C) ERK1/2 and phospho-

ERK1/2 in the presence of ERK1/2 inhibitor U0126; (D) JNK and phospho-JNK in the presence

of SP600125 in the hippocampal tissue of gp120 administered rats. Representative blots are

shown. Tissue collected from saline administered animals was used as control. Results are

expressed as mean±SEM. Samples obtained from three to six different animals were used per

group. Asterisk represent data point significantly different from saline administered animals (***

p<0.001; * p<0.05). Diamonds represent data point significantly different from gp120-treatment

(♦ p<0.05).

Page 172: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

153

8.5 Discussion

A number of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6, IFN-γ) and oxidative stress

markers (such as NO) are known to be elevated during brain HIV-1 infection. HIV-1 coat protein

gp120 has previously been shown to generate an inflammatory response and oxidative stress

both in vitro and in vivo (Bagetta et al., 1996;Ronaldson and Bendayan, 2006;Ronaldson and

Bendayan, 2008). This viral protein is shed during HIV-1 replication and circulating levels of

gp120 have been detected in plasma and in the CSF (Banks and Kastin, 1998;Banks et al.,

1997;Cashion et al., 1999;Dohgu et al., 2012;Oh et al., 1992). Our laboratory has extensively

investigated gp120-mediated release of pro-inflammatory cytokines and oxidative stress in

primary cultures of rodent astrocytes as well as in HFAs exposed to viral isolates in vitro (Ashraf

et al., 2011;Ronaldson and Bendayan, 2006;Ronaldson and Bendayan, 2008). In this study, we

implemented an in vivo model of brain inflammation by ICV administration of gp120. In

different models, doses of gp120 ranging from 100 to 500 ng (administered intracerebrally) have

been shown to induce an inflammatory response (Louboutin et al., 2010b). In our model, ICV

administration of 500 ng of HIV-1 gp120ADA resulted in a significant upregulation of different

inflammatory markers in the frontal cortex, hippocampus and striatum. Heat-denatured gp120

failed to generate an inflammatory response, suggesting that a native gp120 structure is

necessary to interact with chemokine receptors to induce an inflammatory response. We

observed upregulation of IL-1β, iNOS and TNF-α in the frontal cortex of gp120-administered

animals. In the hippocampus and striatum, IL-1β and iNOS transcripts were found to be elevated

due to gp120 treatment. These markers are known to be upregulated during HIV-1 infection

(Bagetta et al., 1999;Perrella et al., 1992). We also observed enhanced secretion of cytokines IL-

1β and TNF-α in the CSF. Previously, increased GFAP expression has been observed in HIV-1

infected brain (Vanzani et al., 2006). In our model, we observed a significant increase in GFAP

expression in the hippocampus, indicating activation of astrocytes in this region.

Interaction of gp120 and chemokine receptors has previously been reported in vitro (Ashraf et

al., 2011;Ronaldson and Bendayan, 2006). Previous work from our laboratory has detected

expression of CCR5 in both human and rat primary culture of astrocytes. Using neutralizing

Page 173: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

154

antibodies against CCR5 and CXCR4 receptors, we have demonstrated that R5-tropic gp120 can

interact with CCR5 chemokine receptors and result in pro-inflammatory cytokines (IL-1β, IL-6

and TNFα) secretion in vitro (Ashraf et al., 2011;Ronaldson and Bendayan, 2006). Maraviroc is

a potent and specific inhibitor of CCR5 that is clinically used to treat HIV-1 infection. Consistent

with our in vitro findings, maraviroc attenuated the gp120-mediated increase in IL-1β, iNOS and

TNF-α in our in vivo model suggesting that the mechanism of gp120-associated inflammation is

CCR5-receptor dependent. These findings provide evidence of in vivo interaction of gp120 with

CCR5 receptor and emphasize the critical role of this interaction in generating a brain

inflammatory response.

Downregulation of tight junction proteins (such as occludin, ZO-1, claudin5) has been implicated

in the pathogenesis of brain HIV-1 infection (Persidsky et al., 2000). A compromised BBB can

facilitate entry of HIV-1 from the periphery, and can ultimately increase the spread of the virus

in brain parenchymal cellular compartments. Although in vitro and in vivo studies have

demonstrated that HIV-1 proteins (like gp120 and Tat) can downregulate tight junction proteins

expressed in brain microvessel endothelial cells (Kanmogne et al., 2005;Louboutin et al., 2010a),

we did not observe any significant change in tight junction proteins expression in our model.

This lack of effect may be due to the dose, duration and/or strain of the gp120 treatment we used.

Persidsky et al. reported that downregulation of tight junction proteins is associated with Rho

activation in brain microvessel endothelial cells and this activation was mediated by monocyte

migration across these cells (Persidsky et al., 2006a). Ricardo-Dukelow et al. demonstrated that

HIV-1 infected macrophages upregulate a number of proteins in brain microvessel endothelial

cells that may lead to BBB disruption (Ricardo-Dukelow et al., 2007). Therefore, lack of

immune cell infiltration could be another potential reason for lack of change in tight junction

protein expressions in our model. We also did not detect any significant changes in transporter

protein expression in the capillaries.

Tight junction proteins form a physiological barrier at the brain capillary level, whereas a

biochemical barrier also exists both at the BBB level and in brain parenchyma. This biochemical

barrier primarily consists in the expression of drug efflux transporters and several metabolizing

enzymes that restrict the bioavailability of a number of antiretroviral drugs into the brain.

Modulation of these transporters by pathological stimuli has been previously reported (Hayashi

Page 174: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

155

et al., 2006;Hayashi et al., 2005;Ronaldson and Bendayan, 2006;Ronaldson and Bendayan,

2008). Decreased P-gp expression at the gene and protein level has been reported in brain

autopsy samples from patients with HIVE as well as in brain tissue collected from a SCID mice

model of HIVE (Persidsky et al., 2000). In vitro, HIV-1 viral isolates or gp120-mediated

downregulation of P-gp has also been reported by our laboratory in both rodent and human

astrocytes (Ashraf et al., 2011;Ronaldson and Bendayan, 2006). Consistent with these data, in

our in vivo model, we observed downregulation of this transport protein expression in the frontal

cortex and hippocampus further confirming that gp120 has a down-regulatory effect on P-gp

functional expression in brain parenchyma.

Altered functional expression of Mrp1 has also been reported in the context of HIV-1. Hayashi et

al. reported Tat-induced upregulation of Mrp1, both at the gene and protein level in cultured

astrocytes (Hayashi et al., 2006). In primary cultures of rat astrocytes triggered with gp120 or

TNF-α, we also detected an increase in Mrp1 functional expression (Ronaldson et al.,

2010;Ronaldson and Bendayan, 2008). In the present study, a significant upregulation of Mrp1 in

the hippocampus and striatum was detected, further suggesting that gp120 exerts an up-

regulatory effect on Mrp1 protein expression in vivo. In our hands, Bcrp was also found to be

upregulated in the frontal cortex of gp120-treated animals. In contrast, IL-1β and TNF-α-

mediated downregulation of Abcg2 has previously been reported in porcine brain microvessel

endothelial cells (von Wedel-Parlow et al., 2009). These results indicate that, similar to other

drug efflux transporters, Bcrp is susceptible to modulation by inflammatory cytokines. However,

cytokine-mediated regulation of this transporter could be species and/or cell specific. Our in vivo

data are consistent with previous in vitro findings in glial cells where exposure to gp120 resulted

in a significant production of pro-inflammatory cytokines along with a downregulation of P-gp

expression and an upregulation of Mrp1 expression (Ashraf et al., 2011;Ronaldson and

Bendayan, 2006;Ronaldson and Bendayan, 2008). Together, these observations provide evidence

that regulation of drug efflux transporters is highly complex during HIV-associated brain

inflammation. Since a number of antiretroviral drugs are known substrates for these transporters,

changes in the expression of these transporters in brain parenchyma may result in an altered

distribution of antiretroviral drugs at cellular targets of HIV-1 infection.

Page 175: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

156

To date, only a few studies have reported on the neuroprotective and anti-inflammatory potential

of different compounds (such as minocycline, curcumin, neurosteroids) in attenuating a HIV-

associated inflammatory response (Maingat et al., 2013;Meulendyke et al., 2012;Tang et al.,

2009). The limitations of currently used antiretroviral drugs include lack of anti-inflammatory

properties, poor brain permeability and neurotoxicity associated with better permeable drugs.

Since neurological disorders are becoming more prevalent in HIV-1 infected patients and

inflammation is a common immune response, identifying therapeutic compounds that can

effectively permeate the BBB, exhibit anti-inflammatory properties, and are well tolerated may

provide an additional option in preventing and/or treating HAND. For example, in a recent study,

Maingat et al. reported efficacy of neurosteroid, dehydroepiandrosterone sulfate, in preventing

inflammation and neurodegeneration as well as behavioral deficits in a FIV model (Maingat et

al., 2013). Minocycline, a second generation tetracycline derivative, has been reported by many

to have anti-inflammatory properties both in vitro and in vivo (Meulendyke et al., 2012;Ryu et

al., 2004). In an Aβ injected rat model, minocycline has shown to successfully reverse the

activation of glial cells (Ryu et al., 2004). In our study, minocycline also effectively inhibited

gp120-mediated upregulation of different inflammatory markers in the frontal cortex,

hippocampus and striatum and further prevented secretion of cytokines in the CSF. Recently,

minocycline has been tested in a clinical trial in HIV-infected patients with cognitive

impairment. Although this study reported that minocycline treatment was unsuccessful in

improving neurocognitive function in patients with cognitive impairment (Sacktor et al., 2011), it

is still inconclusive if administration of the drug at earlier stages of the infection could have a

better clinical outcome. Since minocycline has been reported to have a safe profile when

administered with antiretroviral drugs in HIV-infected individuals, it will be important to assess

if early administration of antiretroviral drugs along with minocycline has any beneficial effects

against HIV-associated neurocognitive disorders. Several clinical studies indicate earlier

administration of antiretroviral drugs can decrease the incidence of neurological disorders (Ellis

et al., 2011). In a SIV model, early administration of minocycline was reported to be effective

against striatal dopaminergic system dysfunction, suggesting that timely treatment initiation may

have an effect on minocycline efficacy (Meulendyke et al., 2012). Since antiretroviral drugs

(with the exception of maraviroc) do not have anti-inflammatory properties, a combination

Page 176: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

157

therapy including antiretroviral and anti-inflammatory compounds may prevent the development

of HIV-associated cognitive deficits.

We also tested chloroquine, an antimalarial drug which exhibits anti-inflammatory and anti-HIV

effects in vitro and in vivo. For example, chloroquine administration has been reported to reduce

T-cell activation in chronic HIV-infected patients (Murray et al., 2010). In a rodent model,

chloroquine prevented a bacterial toxin-induced intracerebral toxicity (Hagihara et al., 2000). In

our gp120-administered model, chloroquine was able to suppress IL-1β and iNOS mRNA levels

in the frontal cortex, hippocampus and striatum. Chloroquine was also effective in reversing

gp120-mediated IL-1β release in the CSF. However, chloroquine was not able to inhibit gp120-

mediated release of TNF-α. Clinical trials are necessary to determine whether chloroquine could

be beneficial in reducing HIV-associated cognitive impairments, particularly in populations

where malaria is also prevalent. Simvastatin, an HMG-CoA reductase inhibitor, is another

compound that has demonstrated anti-inflammatory properties and neuroprotective effects

(Andras et al., 2008;Tong et al., 2012). In a study by Andras et al., simvastatin prevented Aβ and

HIV-1 Tat-induced upregulation of inflammatory genes in human brain microvessel endothelial

cells (Andras et al., 2008). In another study, this drug attenuated oxidative stress and

inflammation and also restored short-term and long-term memory in a transgenic mice model of

Alzheimer’s disease (Tong et al., 2012). In our study, simvastatin was able to suppress IL-1β and

iNOS in the hippocampus and striatum, but had minimal effect on IL-1β and TNF-α transcript

levels in the frontal cortex. Also, the 1 mg/kg dose of simvastatin was not able to attenuate the

secretion of cytokines in the CSF. In contrast to several other statins, simvastatin is known to

have good permeability into the brain. However, in the periphery, simvastatin is highly

metabolized by cytochrome P450 enzymes which can result in adverse drug-drug interaction

with HIV-PIs making it a less ideal candidate for adjuvant therapy in HIV-infected individuals.

Anti-inflammatory properties of statins that are not substrate of CYPs (rosuvastatin or

pravastatin) or less potent inhibitors of CYPs (atorvastatin) should be considered in future

studies.

Experimental data from various in vitro models suggest the involvement of different signal

transduction pathways in the regulation of cytokine secretion and drug transporters during HIV-

associated inflammation (Ashraf et al., 2011;Hayashi et al., 2006;Ronaldson et al., 2010).

Page 177: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

158

Potential anti-inflammatory compounds are also known to target different signaling pathways to

attenuate the inflammatory response. In particular, MAPKs are widely known to be involved in

various pathological processes associated with HIV-1 infection (such as neurotoxicity,

macrophage activation, viral replication) (Gong et al., 2011). Studies have further demonstrated

that inhibition of these kinases can downregulate HIV-1 infection as well as decrease

transcellular transport of HIV-1 across BBB in vitro (Dohgu and Banks, 2008;Dohgu et al.,

2011;Gong et al., 2011). Therefore, we examined these pathways in our gp120-associated brain

inflammation model and observed activation of ERK1/2 and JNKs in the hippocampus. The

presence of minocycline or simvastatin decreased the gp120-mediated phosphorylation of

ERK1/2 but not JNKs in the hippocampus. Since a number of studies suggest that chloroquine,

simvastatin and minocycline can attenuate JNK activation in vitro or in vivo, we speculate that

the lack of effect of these compounds on JNK phosphorylation could be time-dependent and

could not be delineated in our in vivo model (Nikodemova et al., 2006). However, using specific

inhibitors of ERK1/2 and JNK pathway, we were able to attenuate the gp120-mediated activation

of these two pathways in vivo.

In summary, using a gp120-induced brain inflammation model in vivo, we have demonstrated

that compounds with anti-inflammatory properties have the potential to prevent or reduce brain

inflammation by interacting with signaling pathways. In our model, we have also observed

altered expression of drug transporters due to gp120-mediated brain inflammation in vivo. The

expression of ABC transporters expressed at the BBB, in part, regulate the permeability of

antiretroviral drugs into the brain. In addition, drug transporters localized at brain parenchymal

cellular compartments also contribute towards the drug disposition in CNS. Alteration of these

transporters due to HIV-associated pathogenesis and/or antiretroviral therapy may change the

therapeutic outcome. Many different factors determine the effectiveness of antiretroviral therapy

in improving neurocognitive impairment. We propose that identification of compounds with anti-

inflammatory properties will significantly benefit patients with neurocognitive impairments.

8.6 Conclusions

The major findings from our work revealed that agents such as minocycline, chloroquine and

simvastatin which are known to display anti-inflammatory properties, are effective in reducing

Page 178: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

159

brain inflammation triggered by the HIV-1 viral envelope protein, gp120 in an in vivo rodent

model. Furthermore, we demonstrated that this effect is mediated, in part, through an interaction

with the MAPK signaling pathway. Future studies are needed to determine the efficacy of the

early administration of antiretroviral drugs along with adjuvant therapy against the progression

of HIV-associated brain inflammation as well as cognitive deficits.

8.7 Acknowledgements

The authors thank Dr. Min Rui and Blake Ziegler for their assistance in animal work and brain

capillary work, respectively. This work is supported by a grant from the Ontario HIV Treatment

Network (OHTN). Dr. Bendayan is a Career Scientist of the OHTN, Ministry of Health of

Ontario.

Page 179: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

160

Chapter 5 Discussion, limitations, future directions and conclusion

9 Overall discussion

HIV-1 associated neurocognitive disorders are becoming prevalent in the post-cART era,

whereas, the incidence of HAD has decreased (Heaton et al., 2011;Valcour, 2013;Vivithanaporn

et al., 2010). About 50% of people living with HIV-1 infection will develop HAND.

Neurological symptoms commonly experienced by infected individuals are problems with

learning efficiency, memory loss, poor concentration, chronic pain, depression, fatigue and

motor abnormalities. These neurological deficits significantly impact the quality of life of

infected individuals (Valcour, 2013;Vivithanaporn et al., 2010). The introduction of cART is

allowing people with HIV-1 to live longer, but it is not sufficient to prevent development of

neurological impairments. The sequestration of the virus in brain cellular reservoirs (i.e.,

astrocytes, microglia) allows the virus to evade antiretroviral therapy. Studies have demonstrated

that virus-infected cells or neighboring astrocytes release a number of pro-inflammatory

cytokines (i.e., TNF-α, IL-6, IL-1β), chemokines, ROS, NO and other neurotoxins (Alexaki et

al., 2008;Persidsky and Gendelman, 2003). Elevated inflammatory mediators have been

detected in brain autopsy samples from HIV-1 infected individuals and tissue samples from HIV-

1 inoculated animal models (Persidsky et al., 1997;Persidsky et al., 1999). Shed viral proteins

(such as gp120, Tat and vpr) can also generate inflammatory response and oxidative stress in

brain macrophages, microglia and astrocytes (Guha et al., 2012;Mangino et al., 2012;Ronaldson

and Bendayan, 2008).

Brain HIV-1 infection is difficult to treat since poor penetration of antiretroviral drugs has been

reported across the BBB and BCSFB due to expression of drug efflux transporters. Expression of

efflux transporters has also been detected in brain parenchymal cells that can act as a secondary

barrier to drug permeability in HIV-1 cellular reservoirs (Bendayan et al., 2006;Dallas et al.,

2004a;Dallas et al., 2004b;Ronaldson et al., 2004a). A number of antiretroviral drugs have been

shown to be substrates of one or more ABC transporters. Our laboratory has previously

demonstrated P-gp and other ABC transporter-mediated efflux of antiretroviral drugs in astrocyte

and microglial cell systems (Dallas et al., 2004a;Dallas et al., 2004b;Ronaldson et al., 2004a).

Page 180: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

161

Altered expression of ABC transporters has been previously reported in literature due to HIV-1

associated pathologies. In order to determine the effect of HIV-1 gp120 associated

pathophysiological responses (i.e., inflammation, oxidative stress) in the regulation of drug

transporters, our laboratory has examined primary cultures of rat astrocytes exposed to viral

envelope protein gp120. During HIV-1 infection, gp120 is shed in the systemic circulation or

the extracellular fluid from cells infected with HIV-1(Oh et al., 1992). Our group has showed

that R5 tropic HIV-1 gp120 can induce secretion of pro-inflammatory cytokines (IL-6, IL1-β and

TNF-α) by interacting with CCR5 chemokine receptors in primary cultures of rat astrocytes and

significantly decrease functional expression of P-gp (Ronaldson and Bendayan, 2006). The effect

of different cytokines on P-gp expression was also examined and the results showed profound

decrease in P-gp expression due to IL-6 exposure, whereas, TNF-α or IL-1β exposure resulted in

a modest enhancement in this transporter expression (Ronaldson and Bendayan, 2006).

Another ABC transporter, Mrp1, was also found to be regulated by gp120. Previous work from

our laboratory has reported an increase in functional expression of this transporter in response

to gp120 treatment in primary cultures of rat astrocytes which correlated with an enhanced efflux

of GSH and GSSG, implying a potential role of Mrp1 in regulating oxidative stress in astrocytes

(Ronaldson and Bendayan, 2008). Whether Mrp1 is regulated by gp120-associated

inflammation in astrocytes was not known. Therefore, we designed this part of our study to

primarily investigate the regulation of Mrp1 during HIV-1 gp120-associated inflammation and

identify which intracellular signaling pathways may be involved. TNF-α was the only cytokine

identified to alter Mrp1 protein expression in our in vitro model, whereas, IL-1β and IL-6 did not

have any significant effect. We observed that Mrp1 protein expression was increased in primary

cultures of rat astrocytes treated with TNF-α. Increased transcript levels of Mrp1 were also

detected after 6 hours of treatment with both gp120 and TNF-α (Ronaldson et al., 2010).

Previously, increased production of TNF-α and IL-6 as well as increased mRNA expression of

MRP1 has been reported in human monocyte derived macrophages infected with HIV-1 BAL, a

R5-tropic viral strain (Jorajuria et al., 2004). However, secretion of cytokines were found not to

be correlated to altered expression of MRP1 in their system (Jorajuria et al., 2004).

Inflammation-associated alteration of Mrp1 has been reported by other groups. Cherrington et al.

has reported upregulation of hepatic Mrp1in LPS administered Sprague-Dawley rats

Page 181: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

162

(Cherrington et al., 2002). Lee and Piquette-Miller have reported cytokine-mediated

upregulation of Mrp functional activity in hepatoma cell lines where exposure to IL-6 or IL-1β

resulted in significant increase in Mrp1 transcript levels as well as functional activity (Lee and

Piquette-Miller, 2001). However, IL-6 or IL-1β exposure did not alter Mrp1 expression in our

system of cultured astrocytes. Since transporter expression, localization, activity, and regulation

may vary between tissues, it is likely that the differences observed between our findings and the

study of Lee and Piquette-Miller is due to tissue-specific regulation.

We have also confirmed the involvement of the JNK and NF-κB pathways in the regulation of

Mrp1 in primary cultures of rat astrocytes. In order to evaluate the involvement of NF-κB

signaling, we used two established inhibitors of this signaling pathway (i.e., SN50, BAY 11-

7082) (Ronaldson et al., 2010). Similarly, we studied the role of JNK signaling using SP600125,

an established and well-accepted inhibitor of this pathway (Ronaldson et al., 2010). We have

demonstrated that gp120-mediated upregulation of Mrp1 was attenuated in the presence of SN50

or Bay-117082, two NF-κB inhibitors, suggesting the involvement of this transcription factor in

Mrp1 regulation. However, the presence of SN50 did not block TNF-α-mediated Mrp1

upregulation indicating that this pathway does not directly regulate Mrp1 protein expression. In

contrast, pretreatment with SP600125, an inhibitor of the JNK pathway, attenuated the observed

TNF-α-mediated increase in Mrp1 protein expression. In addition, SP600125 treatment resulted

in the attenuation of BCECF efflux from astrocytes suggesting that JNKs directly participate in

the functional regulation of Mrp1 transporter during TNF-α exposure. Others have also

investigated the involvement of signaling pathways in the regulation of Mrp1 in the context of

HIV-1 infection. For example, Hayashi et al. demonstrated Tat induced upregulation of Mrp1 at

the mRNA and protein level in cultured astrocytes with an involvement of the MAPK pathway

(Hayashi et al., 2006). In summary, our results demonstrate the involvement of two intracellular

signaling cascades in the regulation of Mrp1 functional expression in cultured rat astrocytes. In

this study, we have demonstrated for the first time that NF-кB is not directly involved in the

regulation of Mrp1, but mediates its effect by activating JNK pathway which in turn results in

the release of TNF-α (Ronaldson et al., 2010).

We have also paralleled some of the key findings regarding cytokine secretion and functional

expression of P-gp in HFAs (Ashraf et al., 2011). We have demonstrated that similar to rat

Page 182: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

163

astrocytes, R5-tropic gp120 induces secretion of IL-6, IL-1β and TNF-α in HFAs. Pretreatment

with CCR5 neutralizing antibody attenuated cytokine secretion suggesting that cytokine

production was mediated via gp120-CCR5 interactions. The regulation of P-gp expression by

HIV-1 in human astrocytes was not known prior to the present study. Therefore, we investigated

the effect of HIV-1 isolates on P-gp protein expression in our in vitro model. Exposure to

macrophage (R5) or dual macrophage/T-lymphocyte (R5/X4)-tropic viral isolates decreased P-

gp expression suggesting a downregulatory effect of HIV- 1 on P-gp expression. A low numer of

astrocytes are known to be infected in vitro (3 to 19%). Therefore, the downregulation of P-gp

expression could be due to inflammatory mediators released by astrocytes during HIV-1

exposure. Li et al. previously reported that HIV-1 can induce cytokine secretion in HFAs

independent of infection. In their study, high levels of IL-6 were detected after astrocytes were

treated with HIV-1. We speculate that profound downregulation of P-gp expression in our

cultured HFAs could be due to HIV-associated cytokine release (Li et al., 2007). Previously,

Gollapudi and Gupta reported upregulation of P-gp expression in HIV-1 infected T- cell line and

in a monocytic cell line when subjected to HIV-1 infection (Gollapudi and Gupta, 1990). Since

T-cells or monocytes harbour productive HIV-1 infection and astrocytes harbor latent infection,

these discrepancies in the regulation of P-gp expression by HIV-1 could be due to different cell

types. In HFAs, treatment with gp120 also reduced P-gp expression by 64% and increased

cellular accumulation of digoxin, an established substrate of P-gp. Previously, decreased P-gp

protein expression has been reported in brain autopsy samples from patients with HIVE and in

brain tissue from SCID mice model of HIVE (Persidsky et al., 2000). Langford and colleagues

used post-mortem tissues from patients who were on antiretroviral therapy and examined P-gp

expression (Langford et al., 2004). An increased P-gp immunoreactivity in glial cells was

detected in these brain autopsy tissues from patients with HIVE. However, of the 26 patients

selected in this study, 16 were on antiretroviral therapy and for the remaining 10 patients,

treatment information was not available. There was no comparison of P-gp expression between

treatment-naive patients and patients on antiretroviral therapy (Langford et al., 2004). Data from

a number of published studies in the literature including work from our own laboratory suggest

that antiretroviral therapy can alter the expression of ABC transporters (Chandler et al.,

2003;Zastre et al., 2009). Using HCMEC/D3 cell system, our group has demonstrated that in the

presence of atazanavir or ritonavir, two HIV-PIs, a significant upregulation in P-gp functional

Page 183: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

164

expression occurs (Zastre et al., 2009). Since antiretroviral drugs can modulate the expression of

transporters in vitro and in vivo, it is still inconclusive if this increased P-gp immunoreactivity is

due to therapy itself or due to HIV-associated pathogenesis. In both murine brain microvessel

endothelial cells and astrocytes, HIV-1 Tat exposure resulted in an upregulation of P-gp

expression (Hayashi et al., 2005). Since the role and mechanism of action of Tat and gp120 are

different, we propose that different viral proteins may activate signaling pathways differently and

in turn, have different effects on P-gp expression.

In HFAs, IL-6 treatment decreased P-gp expression by 50% after 12 hours of treatment. This

decrease was not found to be as profound as previously observed in primary cultures of rat

astrocytes (Ronaldson and Bendayan, 2006). However, endogenous levels of IL-6 differed

between the culture supernatants of rat and human astrocytes. IL-6 was undetectable in primary

cultures of rat astrocytes, whereas, approximately182.36 pg/ml IL-6 was detected in the

untreated cultured HFAs. Therefore, it is likely that these cells are continuously exposed to

endogenous IL-6 levels and IL-6 mediated decrease in P-gp expression may differ between

human and rat astrocytes due to elevated basal IL-6 levels. We have also conducted longer

exposure and demonstrated that with prolonged exposure (36h and 48h) to IL-6, there was no

change in P-gp expression. Previously, downregulation of P-gp expression due to IL-6 exposure

have been reported in different cells or tissues suggesting that this cytokine may have a down-

regulatory effect on P-gp expression. Lee and Piquette-Miller have shown that IL-6 exposure

results in a reduced MDR1 gene expression and P-gp activity in human hepatocytes (Lee and

Piquette-Miller, 2001). Increase in IL-6 serum levels was also found to be correlated with

decrease P-gp protein expression in the intestine (Ogura et al., 2008). IL-6 induced

downregulation of P-gp expression has also been demonstrated in the human brain microvessel

endothelial cell line, HCMEC/D3 cells (Poller et al., 2010).

Results from our study in HFAs also demonstrated that gp120 or IL-6 mediated effect on P-gp

was attenuated by SN50 suggesting involvement of NF-кB signaling in P-gp downregulation.

Although, in primary cultures of HFAs, due to the limitation in obtaining human fetal brain

tissue, we have not investigated the secretion of cytokines in the presence of an NF-кB inhibitor,

we speculate that gp120 mediated secretion of IL-6 is regulated by NF-кB and therefore, by

inhibiting NF-кB, we can attenuate P-gp downregulation.

Page 184: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

165

Our results demonstrate that HIV-1 as well as the viral protein gp120 has a downregulatory

effect on P-gp expression suggesting that astrocytes may be involved in antiretroviral drug

sequestration within brain parenchyma during HIV-1 infection. Previous work done by our group

in rodent astrocytes also support these findings where an increased accumulation of the HIV-PI,

saquinavir, was observed in primary cultures of rat astrocytes treated with gp120 compared to

untreated astrocytes (Ronaldson and Bendayan, 2006). The availability of antiretroviral drugs

within the astrocytes may aid in limiting brain viral infection by preventing the latent virus from

becoming infectious. However, increased sequestration of antiretroviral drugs into astrocytes

may also lead to reduced concentrations at sites of cytopathic infection (i.e., microglia) and may

contribute to the development of viral drug resistance. At present, it is not known whether these

transporters are altered in microglia. Besides, other transporters of the ABC family are also

known to be involved in antiretroviral drug transport. For example, MRP1 is also known to

transport several PIs used in antiretroviral therapy (Dallas et al., 2004a;Janneh et al., 2005).

Using rodent astrocytes, we have shown that gp120 exposure results in an upregulation of Mrp1

expression in primary cultures of rat astrocytes (Ronaldson et al., 2010;Ronaldson and

Bendayan, 2008). The regulation of these transporters during HIV-associated neuroinflammatory

response will also contribute towards the overall antiretroviral drug permeability in astrocytes

and microglia. Further in vivo studies are needed to clarify whether changes in transporter

expression in astrocytes and microglia will affect antiretroviral drug distribution in the

parenchyma in vivo. Overall, our data provide evidence that the regulation of ABC transporters is

highly complex in HIV-associated brain inflammation and may result in altered brain

permeability of antiretroviral drugs.

Our in vitro work suggest that gp120 can result in an inflammatory response in astrocytes and

alters functional expression of drug efflux transporters. However, whether gp120 can interact

with CCR5 receptor in a similar manner in vivo in order to generate an inflammatory response is

not known. In addition, it has not been examined if gp120-associated inflammation can alter the

expression of drug transporters in vivo. In order to address these questions, we implemented an

in vivo rodent model of HIV-associated brain inflammation by administering HIV-1 gp120 into

one of the lateral cerebral ventricles. In gp120-injected rats, transcripts of TNF-α, IL-1β and

iNOS were found to be significantly elevated in different brain regions. A significant increase in

Page 185: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

166

TNF-α and IL-1β secretion was also detected in the CSF (Ashraf et al., 2014). HIV-1 gp120 has

previously been shown to generate similar inflammatory response in vivo (Bagetta et al.,

1999;Corasaniti et al., 1998;Louboutin et al., 2010b). Previous studies have demonstrated gp120-

mediated induction of IL-1β and TNF-α mRNA in the hypothalamus of gp120 administered rats

(Ilyin and Plata-Salaman, 1997). Another study has reported IL-1β associated apoptotic cell

death in the cortex of rodent brain after ICV administration of gp120 (Bagetta et al., 1999).

Administration of maraviroc, a CCR5-specific antagonist, prior to gp120 treatment attenuated

upregulation of these inflammatory markers in our model. Previously, we have confirmed that

the interaction of R5-tropic gp120 to CCR5 receptor in primary cultures of rat and human

astrocytes is critical for induction of an inflammatory response (Ashraf et al., 2011;Ronaldson

and Bendayan, 2006). In our present study, for the first time, we have confirmed that similar

interaction takes place in vivo and is necessary for generating gp120-mediated inflammatory

response (Ashraf et al., 2014).

In our in vivo model, we have also observed an increase in GFAP expression in hippocampal

lysates isolated from gp120-treated animals indicating activation of astrocytes. However, no

significant change was observed in tight junction protein (ZO-1, occludin and claudin5) or drug

transporter expressions in brain capillaries isolated from gp120 administered rats (Ashraf et al.,

2014). A number of studies have previously shown downregulation of tight junction proteins in

brain microvessel endothelial cells or in vivo models of HIV-1 or gp120-associated brain

inflammation (Kanmogne et al., 2005). The lack of changes in tight junction proteins in our

model is possibly due to the dose and duration of gp120 administration.

Following gp120 administration, changes in drug transporters were observed in different brain

regions. Altered P-gp, Mrp1 and Bcrp were observed in different regions suggesting that gp120-

associated inflammation can modulate the expression of antiretroviral drug transporters in vivo.

In our previous work, we observed downregulation of P-gp and upregulation of Mrp1 in cultured

astrocytes triggered with gp120 (Ronaldson et al., 2010). In our animal model, we observed

downregulation of P-gp protein expression in frontal cortex and hippocampus confirming that

gp120 has a down-regulatory effect on P-gp functional expression in brain parenchyma.

Significant upregulation of Mrp1 in hippocampus and striatum was detected further suggesting

that gp120 exerts an up-regulatory effect on Mrp1 protein expression in vivo. Bcrp expression

Page 186: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

167

was also found to be upregulated in frontal cortex suggesting that similar to other drug efflux

transporters, this transporter is also susceptible to gp120-associated brain inflammation.

Since a number of antiretroviral drugs penetrate poorly in the brain and lack anti-inflammatory

properties, many different compounds are being investigated that can potentially be used as

adjuvant therapy to prevent the development of HIV-1-associated neurocognitive deficits. In

order to evaluate the potential efficacy of different anti-inflammatory compounds (minocycline,

chloroquine and simvastatin) against inflammation in this in vivo rodent model, the animals were

administered gp120 ICV with or without prior intraperitoneal administration of minocycline or

chloroquine or simvastatin. Minocycline, a second generation tetracycline derivative, showed the

most potency in reducing gp120-associated increase in inflammatory markers. Minocycline was

successful in suppressing both TNF-α and IL-1β secretion in the CSF of gp120 administered

animals. A number of other in vivo studies have shown protective effects of minocycline against

brain HIV-1 infection. Minocycline significantly reduced encephalitis in SIV-infected pigtailed

macaques (Zink et al., 2005). Suppressed CNS viral load and decreased CNS inflammatory

markers (e.g. macrophage marker CD68, major histocompatibility complex class II, T-cell

intracytoplasmic antigen 1, SIV glycoprotein 41,Aβ precursor protein, and activated p38) were

observed after minocycline treatment (Zink et al., 2005). Striatal dopamine deficiency was also

reversed by early administration of minocycline in SIV-infected macaques (Meulendyke et al.,

2012). Using proton magnetic resonance spectroscopy in vivo and biomarkers in post-mortem

tissues, it was reported that minocycline could attenuate a progressive decline in neuronal

integrity, decrease glial activation and both CSF and plasma viral loads (Ratai et al., 2010).

Decreased plasma virus and monocyte activation was also observed in SIV-infectd macaques

following minocycline administration (Campbell et al., 2011). However, in clinical trials,

minocycline was not successful in improving neurocognitive outcome in patients with advanced

cognitive impairments (Nakasujja et al., 2013;Sacktor et al., 2011). We speculate that

administering minocycline in early stage of the infection may prevent development of HAND. In

addition, it is still unclear if clinically prescribed doses of minocycline would achieve plasma

and cellular levels that would be effective in suppressing HIV-1 replication and associated

inflammation in the brain. Interaction with other antiretroviral drugs also has to be considered.

One study reported that administration of minocycline altered the plasma concentration of

Page 187: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

168

atazanavir, but did not have any significant effect on ritonavir plasma concentrations (DiCenzo et

al., 2008). However, this study was limited due to the small sample size, short study duration and

concomitant medications used by patients. It is yet to be examined whether long-term

administration of minocycline with atazanavir and other PIs can influence treatment response.

Other clinical trials with minocycline reported a safety profile for this drug when administered

along with other antiretroviral drugs for 24 weeks (Sacktor et al., 2011). Further studies are

needed to clarify the clinical role of early administration of minocycline in the treatment of HIV-

associated neurological disorder.

In our animal model, chloroquine, an anti-malarial drug, was able to suppress IL-1β and iNOS

mRNA levels in different brain regions and was also effective in reversing gp120-mediated IL-

1β release in the CSF. Chloroquine has been previously reported to inhibit in vitro replication of

HIV-1 by modulating glycosylation properties of gp120 (Savarino et al., 2004). In clinical trials,

hydroxychloroquine has decreased plasma viral load. Hydroxychloroquine treatment has also

been shown to decrease IL-1α and IL-6 secretion in human monocytes and T-cells (Sperber et

al., 1993). In later stage of SIV-infected macaques, chloroquine treatment decreased activation

of plasma dendritic cells and IFN-α secretion (Ma et al., 2012). In contrast, chloroquine

transiently increased IFN-related genes and did not provide any benefit against SIV infection in

acute SIV infected macaques (Vaccari et al., 2014). In addition, in several clinical studies,

chloroquine or hydroxychloroquine treatment failed to reduce viral load, CD4+ T-cell activation

and plasma inflammatory markers (Engchanil et al., 2006;Paton et al., 2012;Routy et al., 2014).

Therefore, it remains unclear whether chloroquine can confer anti-HIV effects and elicit a

therapeutic response. Further studies are needed to investigate the effect of chloroquine used in

conjunction with antiretroviral drugs against the development of HIV-1 associated

neurocognitive disorder. If proven beneficial, the cost and availability of chloroquine will make

it an ideal candidate for adjuvant therapy in resource-poor countries where both malaria and

HIV-1 are prevalent.

Simvastatin, an HMG-CoA reductase inhibitor known to possess anti-inflammatory properties,

administration did not demonstrate similar efficacy compared to minocycline or chloroquine.

Although simvastatin attenuated transcripts of IL-1β and iNOS in the brain regions, it could not

significantly suppress gp120-mediated IL-1β and TNF-α secretion in the CSF. This lack of effect

Page 188: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

169

could be attributed to the dose of simvastatin used in our study, since higher doses of simvastatin

have been reported to be successful in attenuating brain inflammation in other models of brain

injury (Li et al., 2009). Many HIV-1 infected patients have dyslipidemia that may require statin

treatment. However, a number of statins including simvastatin is metabolized by cytochrome

P450 enzymes in the periphery and administering them with PIs can result in adverse drug-drug

interactions. Statins that are not metabolized by cytochrome P450 enzymes (rosuvastatin or

pravastatin) are known not to permeate well in the brain. Further studies are required to

determine if statins can be beneficial in preventing HIV-1-associated cognitive deficits.

Our previous in vitro work demonstrated the involvement of MAPK pathway in the regulation of

drug efflux transporters. We have reported involvement of JNK signaling pathway in the

regulation of Mrp1 in primary cultures of rat astrocytes (Ronaldson et al., 2010). Previous work

from our group also reported involvement of ERK1/2, JNKs and P38Ks in gp120-mediated

downregulation of P-gp in cultured rodent astrocytes (unpublished work). Therefore, we

investigated the activation of MAPK signaling pathways in different brain regions of gp120-

administered animals. In our in vivo model, we observed activation of ERK1/2 and JNKs in the

hippocampus (Ashraf et al., 2014). Interestingly, the presence of minocycline or simvastatin

attenuated the gp120-mediated phosphorylation of ERK1/2 in the hippocampus. None of the

compounds tested were able to attenuate JNK activation observed in the hippocampus in the

gp120 treated animals. Although in primary cultures of rat astrocytes, we have shown attenuation

of JNKs as well as ERK1/2 phosphorylation in the presence of all three compounds (Appendix

C). Using specific inhibitors of ERK1/2 and JNK pathway, we were also able to attenuate the

gp120-mediated activation of these two pathways in vivo (Ashraf et al., 2014). These findings

further confirm that signaling pathways can be targeted by anti-inflammatory compounds or

inhibitors in order to reverse inflammatory response observed during brain HIV-1 infection.

Several studies have investigated the in vivo efficacy of MAPK pathway inhibitors in attenuating

brain inflammation (Eggert et al., 2010;Munoz et al., 2007). In addition to MAPK pathways,

other pathways have also been implicated. For example, treatment with statins has been reported

to reduce mRNA expression of LPS-induced TNF-α and MCP1 in macrophage cell line via a

PPARα and PPARγ dependent pathway (Yano et al., 2007). Therefore, the mechanisms of action

Page 189: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

170

of these compounds need to be further assessed in cell culture models as well as in animal

models that will provide future opportunities of testing them in clinical trials.

In summary, our results suggest that interaction of R5-tropic gp120 to CCR5 chemokine receptor

in vitro or in vivo results in the activation of signaling pathways and secretion of cytokines.

These cytokines can further activate other signaling pathways that can result in alteration of drug

efflux transporters. Inhibitors of signaling pathways also prevented cytokine release and

cytokine-mediated regulation of drug transporters. Both JNK and NF-кB pathways were found to

be involved in gp120-mediated Mrp1 regulation in vitro. NF-кB pathway was involved in gp120-

mediated downregulation of P-gp in human astrocytes. Administration of maraviroc or anti-

inflammatory compounds prevented the release of these cytokines. In vivo, maraviroc,

minocycline and chloroquine attenuated gp120-mediated release of IL-1β in the CSF. Maraviroc

and minocycline also attenuated TNF-α release. The anti-inflammatory compounds also

interacted with MAPK pathways in vitro or in vivo. Minocycline, chloroquine and simvastatin

attenuated gp120-mediated activation of JNKs as well as ERK1/2 in vitro, whereas, minocycline

and simvastatin decreased gp120-induced EKR1/2 phosphorylation in vivo. Signaling pathway

inhibitors U0126 and SP600125 also prevented gp120-medated activation of ERK1/2 and JNKs

in vivo, respectively, indicating the potential of these inhibitors in reversing brain inflammation.

Figure 9-1 summarizes our findings in vitro and in vivo.

Page 190: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

171

CCR5 receptor

Maraviroc

HIV-1 gp120 (R5 tropic)

Gene transcription

Nucleus

JNK

P-JNK

ERK

P-ERK

MinocyclineSimvastatinChloroquine

SP600125

TNF-α IL-1β

MaravirocMinocyclineChloroquine

MaravirocMinocycline

NF-кB

In vivo In vivo

In vivo

In vitro

In vivo

In vivo

In vitro

In vitro SN50

Cytokine secretion

MEK1/2

U0126

In vivo

MinocyclineSimvastatin

Chloroquine

CytokineReceptor

CytokineReceptor

Mrp

1

P-g

p

Figure 9-1 A schematic summarizing gp120-mediated regulation of cytokine secretion and drug

efflux transporters as well as effect of anti-inflammatory compounds in vitro or in vivo.

Page 191: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

172

10 Limitations

The use of rodent cell culture systems (i.e., primary cultures of rat astrocytes) is well-accepted as

a useful model system for in vitro studies. A number of studies have examined the functional

expression of drug efflux transporters in rodent cell culture systems. However, species specific

differences may exist in the regulation of cytokine secretion or drug efflux transporters (Ashraf

et al., 2011;Ronaldson and Bendayan, 2006). We have paralleled some key findings in HFA

cultures to compare the regulation of P-gp by gp120-mediated cytokine secretion. However, due

to the difficulty in obtaining human fetal brain tissue in a regular basis, it became difficult to

perform a detailed investigation of the regulation of transporters and involvement of signaling

pathways in the context of HIV-1 gp120-associated inflammation in human astrocytes. In

addition, it is known that astrocytes in the adult brain are non-proliferative unless activated in

response to infection or injury. Therefore, our astrocyte cultures obtained from neonatal rat

brains or human fetal brain may not be reflective of adult astrocytes and in vivo studies may be

undertaken to complement the data obtained in these cultured systems. Several studies have

described techniques for isolation of primary cultures of human astrocytes from post-mortem or

surgically resected adult brain tissue (De Groot et al., 1997;Verwer et al., 2007). The problem

with the use of such protocols stems from the availability of brain tissue samples on a regular

basis from which to prepare the cultures. Therefore, rodent neonatal brain and to a lesser extent,

human fetal brain tissue still represent a widely used source for astrocytes due to their relative

ease of collection and maintenance.

In our recent work, we have determined the effect of an individual HIV-1 protein i.e., gp120 on

generating an inflammatory response in cultured astrocytes as well as in rodent brain. It is

important to understand the role of individual viral proteins in the regulation of pro-

inflammatory cytokines as well as drug efflux transporters. Our work with gp120 has allowed us

to understand part of the pathology associated with HIV-1 in the brain. However, an HIV-1

infected model is necessary to understand the activation of signaling pathways, secretion of

cytokines and regulation of transporters by the whole virus. Therefore, a better model to evaluate

the mechanisms involved in inflammation and drug resistance in HIV-1 infection of the brain

will be infectious animal models (i.e., SIV infected macaques).

Page 192: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

173

Our in vitro model has allowed us to examine the secretion of cytokines and the regulation of

these transporters after short-term exposures (i.e., 24 hours) only. Therefore, we have

implemented a model to investigate these phenomena in vivo after 7-day exposure. We have

observed a significant increase in gene and protein expression of inflammatory markers as well

as alteration of transporter protein expression. However, we could not characterize the

distribution of gp120 in our model after ICV administration. In order to determine the brain

distribution of gp120, we have administered fluorescein isothiocyanate (FITC)-gp120 ICV in a

volume of 2µl (250ng/ µl) or 2.5 µl (1 µg/ µl) or 5µl (1 µg/ µl) in Wistar rats. After FITC-gp120

administration, animals were sacrificed after 13 minutes, 30 minutes and 2 hours. The collected

brain tissue was processed for immunohistochemistry. We also collected different brain regions

(frontal cortex, hippocampus and striatum) after FITC-gp120 ICV administration and used tissue

homogenate to detect the presence of FITC using spectrophotometry compared to saline

administered animals. We were not able to demonstrate the brain distribution of gp120 at these

above mentioned doses. Previous studies with ICV administration of FITC conjugated proteins

used significantly higher concentration of proteins (40 to 100 µg) in order to demonstrate their

brain distribution (Frigerio et al., 2012). However, administration of gp120 in a higher

concentration may lead to significant damage to the BBB and brain parenchyma rendering it

difficult to determine the brain distribution of gp120.

11 Future directions

11.1 Regulation of ABC transporters at the BBB and in glial cells

Our work has demonstrated that P-gp is regulated by the NF-кB pathway in primary cultures of

HFAs and Mrp1 is regulated by NF- кB and JNK pathways (Ronaldson and Bendayan, 2006).

Our laboratory has also investigated the involvement of the MAPK pathway in the regulation of

P-gp in cultured astrocytes triggered with gp120 (unpublished work). It is still not known

whether gp120 can modulate the expression of these transporters in brain microvessel endothelial

cells. In addition, regulation of these transporters in microglia, the primary site of HIV-1 in the

brain, has not been examined. A number of other signaling pathways or transcription factors

have been implicated in the regulation of transporters. Nrf2, a sensor of oxidative stress, has been

Page 193: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

174

reported to be involved in regulating Mrp1 expression in mouse embryo fibroblasts (Hayashi et

al., 2003). The Rho signaling has been reported to be involved in the regulation of P-gp (Zhong

et al., 2010). In endothelial cells, intact lipid rafts were found to be involved in HIV-1 Tat-

mediated activation of Rho signaling and upregulation of P-gp (Zhong et al., 2010). A number of

nuclear receptors have been implicated in the regulation of ABC transporters. In particular, PXR

and CAR are two well-known xenobiotic sensors that are capable of interacting with a wide

spectrum of pharmaceutical agents including PIs (Urquhart et al., 2007). Work published by

others and our laboratory show that PXR and CAR are actively involved in the regulation of drug

efflux transporters in different tissues including intestine, liver and brain (Bauer et al.,

2004;Bauer et al., 2008;Bauer et al., 2006;Chan et al., 2013a;Chan et al., 2011;Wang et al.,

2010b). Our group has shown that in the presence of atazanavir or ritonavir, two HIV-PIs, a PXR

dependent induction in P-gp functional expression occurs in HCMEC/D3 cells (Chan et al.,

2013b;Zastre et al., 2009). Several nuclear receptors (i.e., CAR, PPARγ, PPARα) have also been

implicated in ABCG2 regulation (Hartz et al., 2010a;Hirai et al., 2007;Szatmari et al., 2006).

Recent work from our laboratory also demonstrated that PPARα-selective agonists (i.e.,

clofibrate, GW7647) can significantly induce ABCG2 mRNA and protein expression in

HCMEC/D3 cells, whereas pharmacological inhibitors (i.e., MK886, GW6471) prevent this

induction (Hoque et al., 2012). The involvement of these nuclear receptors in the regulation of

ABC transporters in astrocytes and microglia are not understood and further studies are needed

to elucidate their role.

11.2 Effect of anti-inflammatory compounds on HIV-1 gp120

associated cognitive deficits

In order to demonstrate that early administration of anti-inflammatory compounds can prevent

the development of HIV-1 gp120 associated cognitive deficits, our laboratory has recently

implemented an in vivo model of HIV-1 gp120 associated cognitive deficits by ICV

administration of gp120 in Wistar male rats. The learning and memory components are currently

being characterized in this model using Morris water maze. Once characterized, the efficacy of

different anti-inflammatory compounds (i.e., minocycline, chloroquine) in the prevention of

cognitive impairments will be assessed in this model. Several other compounds have been

reported to have anti-inflammatory properties. For example neurosteroid,

Page 194: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

175

dehydroepiandrosterone sulfate has been reported to successfully prevent inflammation and

behavioral deficits in a FIV model (Maingat et al., 2009). Another study reported that

administration of anthraquinone derivative from rhubarb, emodin, showed anti-inflammatory

properties by inhibiting NO and PGE2 production and downregulating COX-2 and iNOS

expression in caco-2 cells (Choi et al., 2013). Several signaling pathway inhibitors have also

been demonstrated to have neuroprotective properties. For example, CEP-1347, an inhibitor of

multilineage kinase, has shown to have reduced microgliosis and neuronal loss in a SCID mice

model of HIVE (Eggert et al., 2010). A brain penetrable inhibitor of P38α, MW01-2-069A-SRM,

has been demonstrated to suppress pro-inflammatory cytokine upregulation as well as behavioral

deficits in an Alzheimer’s disease mouse model (Munoz et al., 2007). In order to prevent or

delay the progression of HIV-1-associated neurological disorder, it is critical to identify

compounds that have anti-inflammatory properties and penetrate well into the brain.

11.3 Permeability of antiretroviral drugs during HIV-1 gp120-associated

brain inflammation in vivo

Our laboratory has previously demonstrated that gp120-mediated inflammation can alter the

functional expression of P-gp and Mrp1 in vitro (Ashraf et al., 2011;Ronaldson and Bendayan,

2006;Ronaldson and Bendayan, 2008). Recently, we have also demonstrated that administration

of gp120 in vivo resulted in altered P-gp, Mrp1 and Bcrp in different brain regions (Ashraf et al.,

2014). However, it is yet to be demonstrated whether the altered expression of these transporters

affect antiretroviral drug distribution in vivo. In our implemented gp120-associated brain

inflammation model, we did not detect changes in transporter expression at the level of brain

capillaries and anticipate that drug permeability will not be altered. Lack of changes at the brain

capillaries could be due to the moderate inflammatory response observed in our model. We

speculate that in the gp120-associated cognitive deficit model there will be significant damages

to the BBB which will allow investigating the permeability of antiretroviral drugs in vivo during

HIV-associated neuropathological condition.

Page 195: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

176

12 Conclusion

Limited drug penetration in the brain remains a major obstacle to pharmacotherapy for brain

HIV-1 infection. The expression of ABC transporters at the BBB as well as in brain HIV-1

cellular targets (i.e., microglia, astrocytes) determines the permeability and disposition of

antiretroviral drugs in the brain. Our work has demonstrated that HIV-1 gp120-associated

inflammation can change the expression of P-gp and Mrp1 in astrocytes suggesting that

antiretroviral drug permeability may be significantly altered at brain parenchymal cellular

compartments during brain HIV-1 infection. Our current findings also suggest a role of different

signaling pathways in the regulation of cytokines and drug efflux transporters. We have shown

that agents such as minocycline, chloroquine and simvastatin are effective in reducing brain

inflammation triggered by HIV-1 gp120 in vivo and this effect is mediated, in part, through an

interaction with the MAPK signaling pathway. Future studies are needed to determine the

efficacy of the early administration of antiretroviral drugs along with adjuvant therapy against

the progression of HIV-associated brain inflammation as well as cognitive deficits. In order to

successfully treat brain HIV-1 infection, a more comprehensive understanding of antiretroviral

drug transporters and anti-inflammatory compounds as well as their regulatory mechanisms in

the context of HIV-1 infection is required both in vitro and in vivo.

Page 196: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

177

References

Abbott NJ, Ronnback L and Hansson E (2006) Astrocyte-Endothelial Interactions at the Blood-

Brain Barrier. Nat Rev Neurosci 7:41-53.

Acquas E, Bachis A, Nosheny RL, Cernak I and Mocchetti I (2004) Human Immunodeficiency

Virus Type 1 Protein Gp120 Causes Neuronal Cell Death in the Rat Brain by Activating

Caspases. Neurotox Res 5:605-615.

Adamson DC, Wildemann B, Sasaki M, Glass JD, McArthur JC, Christov VI, Dawson TM and

Dawson VL (1996) Immunologic NO Synthase: Elevation in Severe AIDS Dementia and

Induction by HIV-1 Gp41. Science 274:1917-1921.

Adamson P and Greenwood J (2003) How Do Statins Control Neuroinflammation? Inflamm Res

52:399-403.

Agarwal S, Pal D and Mitra AK (2007) Both P-Gp and MRP2 Mediate Transport of Lopinavir, a

Protease Inhibitor. Int J Pharm 339:139-147.

Agarwal S, Sane R, Ohlfest JR and Elmquist WF (2011) The Role of the Breast Cancer

Resistance Protein (ABCG2) in the Distribution of Sorafenib to the Brain. J Pharmacol Exp Ther

336:223-233.

Airoldi M, Bandera A, Trabattoni D, Tagliabue B, Arosio B, Soria A, Rainone V, Lapadula G,

Annoni G, Clerici M and Gori A (2012) Neurocognitive Impairment in HIV-Infected Naive

Patients With Advanced Disease: the Role of Virus and Intrathecal Immune Activation. Clin Dev

Immunol 2012:467154.

Ajmone-Cat MA, Nicolini A and Minghetti L (2001) Differential Effects of the Nonsteroidal

Antiinflammatory Drug Flurbiprofen and Its Nitric Oxide-Releasing Derivative,

Nitroflurbiprofen, on Prostaglandin E(2), Interleukin-1beta, and Nitric Oxide Synthesis by

Activated Microglia. J Neurosci Res 66:715-722.

Albright AV, Soldan SS and Gonzalez-Scarano F (2003) Pathogenesis of Human

Immunodeficiency Virus-Induced Neurological Disease. J Neurovirol 9:222-227.

Alessi DR, Cuenda A, Cohen P, Dudley DT and Saltiel AR (1995) PD 098059 Is a Specific

Inhibitor of the Activation of Mitogen-Activated Protein Kinase Kinase in Vitro and in Vivo. J

Biol Chem 270:27489-27494.

Alexaki A, Liu Y and Wigdahl B (2008) Cellular Reservoirs of HIV-1 and Their Role in Viral

Persistence. Curr HIV Res 6:388-400.

Page 197: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

178

Aller SG, Yu J, Ward A, Weng Y, Chittaboina S, Zhuo R, Harrell PM, Trinh YT, Zhang Q,

Urbatsch IL and Chang G (2009) Structure of P-Glycoprotein Reveals a Molecular Basis for

Poly-Specific Drug Binding. Science 323:1718-1722.

Ambegaokar SS and Kolson DL (2014) Heme Oxygenase-1 Dysregulation in the Brain:

Implications for HIVAssociated Neurocognitive Disorders. Curr HIV Res 12(3):174-188.

Amet T, Nonaka M, Dewan MZ, Saitoh Y, Qi X, Ichinose S, Yamamoto N and Yamaoka S

(2008) Statin-Induced Inhibition of HIV-1 Release From Latently Infected U1 Cells Reveals a

Critical Role for Protein Prenylation in HIV-1 Replication. Microbes Infect 10(5):471-480.

Ances BM and Ellis RJ (2007) Dementia and Neurocognitive Disorders Due to HIV-1 Infection.

Semin Neurol 27:86-92.

Andras IE, Eum SY, Huang W, Zhong Y, Hennig B and Toborek M (2010) HIV-1-Induced

Amyloid Beta Accumulation in Brain Endothelial Cells Is Attenuated by Simvastatin. Mol Cell

Neurosci 43(2):232-243.

Andras IE, Pu H, Deli MA, Nath A, Hennig B and Toborek M (2003) HIV-1 Tat Protein Alters

Tight Junction Protein Expression and Distribution in Cultured Brain Endothelial Cells. J

Neurosci Res 74:255-265.

Andras IE, Rha G, Huang W, Eum S, Couraud PO, Romero IA, Hennig B and Toborek M (2008)

Simvastatin Protects Against Amyloid Beta and HIV-1 Tat-Induced Promoter Activities of

Inflammatory Genes in Brain Endothelial Cells. Mol Pharmacol 73:1424-1433.

Apostolova N, Blas-Garcia A and Esplugues JV (2011a) Mitochondrial Interference by Anti-

HIV Drugs: Mechanisms Beyond Pol-Gamma Inhibition. Trends Pharmacol Sci 32(12):715-725.

Apostolova N, Blas-Garcia A and Esplugues JV (2011b) Mitochondrial Toxicity in HAART: an

Overview of in Vitro Evidence. Curr Pharm Des 17(20):2130-2144.

Asensio VC and Campbell IL (1999) Chemokines in the CNS: Plurifunctional Mediators in

Diverse States. Trends Neurosci 22(11):504-512.

Ashraf T, Jiang W, Hoque MT, Henderson J, Wu C and Bendayan R (2014) Role of Anti-

Inflammatory Compounds in Human Immunodeficiency Virus-1 Glycoprotein120-Mediated

Brain Inflammation. J Neuroinflammation 11:91-11.

Ashraf T, Ronaldson PT, Persidsky Y and Bendayan R (2011) Regulation of P-Glycoprotein by

Human Immunodeficiency Virus-1 in Primary Cultures of Human Fetal Astrocytes. J Neurosci

Res 89(11):1773-1782.

Atwood WJ, Tornatore CS, Traub R, Conant K, Drew PD and Major EO (1994) Stimulation of

HIV Type 1 Gene Expression and Induction of NF-Kappa B (P50/P65)-Binding Activity in

Tumor Necrosis Factor Alpha-Treated Human Fetal Glial Cells. AIDS Res Hum Retroviruses

10:1207-1211.

Page 198: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

179

az-Flores L, Gutierrez R, Varela H, Rancel N and Valladares F (1991) Microvascular Pericytes:

a Review of Their Morphological and Functional Characteristics. Histol Histopathol 6:269-286.

Babakhanian K, Bendayan M and Bendayan R (2007) Localization of P-Glycoprotein at the

Nuclear Envelope of Rat Brain Cells. Biochem Biophys Res Commun 361(2):301-306.

Bachmeier CJ, Trickler WJ and Miller DW (2004) Drug Efflux Transport Properties of 2',7'-

Bis(2-Carboxyethyl)-5(6)-Carboxyfluorescein Acetoxymethyl Ester (BCECF-AM) and Its

Fluorescent Free Acid, BCECF. J Pharm Sci 93:932-942.

Bagetta G, Corasaniti MT, Aloe L, Berliocchi L, Costa N, Finazzi-Agro A and Nistico G (1996)

Intracerebral Injection of Human Immunodeficiency Virus Type 1 Coat Protein Gp120

Differentially Affects the Expression of Nerve Growth Factor and Nitric Oxide Synthase in the

Hippocampus of Rat. Proc Natl Acad Sci U S A 93:928-933.

Bagetta G, Corasaniti MT, Berliocchi L, Nistico R, Giammarioli AM, Malorni W, Aloe L and

Finazzi-Agro A (1999) Involvement of Interleukin-1beta in the Mechanism of Human

Immunodeficiency Virus Type 1 (HIV-1) Recombinant Protein Gp120-Induced Apoptosis in the

Neocortex of Rat. Neuroscience 89(4):1051-1066.

Bakos E, Evers R, Szakacs G, Tusnady GE, Welker E, Szabo K, de HM, van DL, Borst P,

Varadi A and Sarkadi B (1998) Functional Multidrug Resistance Protein (MRP1) Lacking the N-

Terminal Transmembrane Domain. J Biol Chem 273:32167-32175.

Ballerini P, Di IP, Ciccarelli R, Nargi E, D'Alimonte I, Traversa U, Rathbone MP and Caciagli F

(2002) Glial Cells Express Multiple ATP Binding Cassette Proteins Which Are Involved in ATP

Release. Neuroreport 13:1789-1792.

Bandopadhyay R, Orte C, Lawrenson JG, Reid AR, De SS and Allt G (2001) Contractile

Proteins in Pericytes at the Blood-Brain and Blood-Retinal Barriers. J Neurocytol 30:35-44.

Banks WA and Kastin AJ (1998) Characterization of Lectin-Mediated Brain Uptake of HIV-1

GP120. J Neurosci Res 54(4):522-529.

Banks WA, Kastin AJ and Akerstrom V (1997) HIV-1 Protein Gp120 Crosses the Blood-Brain

Barrier: Role of Adsorptive Endocytosis. Life Sci 61(9):L119-L125.

Bansal AK, Mactutus CF, Nath A, Maragos W, Hauser KF and Booze RM (2000) Neurotoxicity

of HIV-1 Proteins Gp120 and Tat in the Rat Striatum. Brain Res 879:42-49.

Barancik M, Bohacova V, Kvackajova J, Hudecova S, Krizanova O and Breier A (2001)

SB203580, a Specific Inhibitor of P38-MAPK Pathway, Is a New Reversal Agent of P-

Glycoprotein-Mediated Multidrug Resistance. Eur J Pharm Sci 14:29-36.

Barbin G, Roisin MP and Zalc B (2001) Tumor Necrosis Factor Alpha Activates the

Phosphorylation of ERK, SAPK/JNK, and P38 Kinase in Primary Cultures of Neurons.

Neurochem Res 26(2):107-112.

Page 199: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

180

Barre-Sinoussi F, Chermann JC, Rey F, Nugeyre MT, Chamaret S, Gruest J, Dauguet C, xler-

Blin C, Vezinet-Brun F, Rouzioux C, Rozenbaum W and Montagnier L (1983) Isolation of a T-

Lymphotropic Retrovirus From a Patient at Risk for Acquired Immune Deficiency Syndrome

(AIDS). Science 20;220:868-871.

Bauer B, Hartz AM, Fricker G and Miller DS (2004) Pregnane X Receptor Up-Regulation of P-

Glycoprotein Expression and Transport Function at the Blood-Brain Barrier. Mol Pharmacol

66(3):413-419.

Bauer B, Hartz AM, Lucking JR, Yang X, Pollack GM and Miller DS (2008) Coordinated

Nuclear Receptor Regulation of the Efflux Transporter, Mrp2, and the Phase-II Metabolizing

Enzyme, GSTpi, at the Blood-Brain Barrier. J Cereb Blood Flow Metab 28(6):1222-1234.

Bauer B, Hartz AM and Miller DS (2007) Tumor Necrosis Factor Alpha and Endothelin-1

Increase P-Glycoprotein Expression and Transport Activity at the Blood-Brain Barrier. Mol

Pharmacol 71:667-675.

Bauer B, Yang X, Hartz AM, Olson ER, Zhao R, Kalvass JC, Pollack GM and Miller DS (2006)

In Vivo Activation of Human Pregnane X Receptor Tightens the Blood-Brain Barrier to

Methadone Through P-Glycoprotein Up-Regulation. Mol Pharmacol 70(4):1212-1219.

Becher B, Prat A and Antel JP (2000) Brain-Immune Connection: Immuno-Regulatory

Properties of CNS-Resident Cells. Glia 29:293-304.

Belinsky MG, Guo P, Lee K, Zhou F, Kotova E, Grinberg A, Westphal H, Shchaveleva I, Klein-

Szanto A, Gallo JM and Kruh GD (2007) Multidrug Resistance Protein 4 Protects Bone Marrow,

Thymus, Spleen, and Intestine From Nucleotide Analogue-Induced Damage. Cancer Res 67:262-

268.

Benarroch EE (2009) Oligodendrocytes: Susceptibility to Injury and Involvement in Neurologic

Disease. Neurology 19;72:1779-1785.

Bendayan R, Lee G and Bendayan M (2002) Functional Expression and Localization of P-

Glycoprotein at the Blood Brain Barrier. Microsc Res Tech 57:365-380.

Bendayan R, Ronaldson PT, Gingras D and Bendayan M (2006) In Situ Localization of P-

Glycoprotein (ABCB1) in Human and Rat Brain. J Histochem Cytochem 54:1159-1167.

Bennett BL, Sasaki DT, Murray BW, O'Leary EC, Sakata ST, Xu W, Leisten JC, Motiwala A,

Pierce S, Satoh Y, Bhagwat SS, Manning AM and Anderson DW (2001) SP600125, an

Anthrapyrazolone Inhibitor of Jun N-Terminal Kinase. Proc Natl Acad Sci U S A

20;98(24):13681-13686.

Bentires-Alj M, Barbu V, Fillet M, Chariot A, Relic B, Jacobs N, Gielen J, Merville MP and

Bours V (2003) NF-KappaB Transcription Factor Induces Drug Resistance Through MDR1

Expression in Cancer Cells. Oncogene 22:90-97.

Page 200: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

181

Bera TK, Iavarone C, Kumar V, Lee S, Lee B and Pastan I (2002) MRP9, an Unusual Truncated

Member of the ABC Transporter Superfamily, Is Highly Expressed in Breast Cancer. Proc Natl

Acad Sci U S A 99:6997-7002.

Berezowski V, Landry C, Dehouck MP, Cecchelli R and Fenart L (2004) Contribution of Glial

Cells and Pericytes to the MRNA Profiles of P-Glycoprotein and Multidrug Resistance-

Associated Proteins in an in Vitro Model of the Blood-Brain Barrier. Brain Res 20;1018:1-9.

Best BM, Letendre SL, Brigid E, Clifford DB, Collier AC, Gelman BB, McArthur JC,

McCutchan JA, Simpson DM, Ellis R, Capparelli EV and Grant I (2009) Low Atazanavir

Concentrations in Cerebrospinal Fluid. AIDS 23:83-87.

Best BM, Letendre SL, Koopmans P, Rossi SS, Clifford DB, Collier AC, Gelman BB, Marra

CM, McArthur JC, McCutchan JA, Morgello S, Simpson DM, Capparelli EV, Ellis RJ and Grant

I (2012) Low Cerebrospinal Fluid Concentrations of the Nucleotide HIV Reverse Transcriptase

Inhibitor, Tenofovir. J Acquir Immune Defic Syndr 59:376-381.

Bierman WF, Scheffer GL, Schoonderwoerd A, Jansen G, van Agtmael MA, Danner SA and

Scheper RJ (2010) Protease Inhibitors Atazanavir, Lopinavir and Ritonavir Are Potent Blockers,

but Poor Substrates, of ABC Transporters in a Broad Panel of ABC Transporter-Overexpressing

Cell Lines. J Antimicrob Chemother 65:1672-1680.

Blas-Garcia A, Apostolova N and Esplugues JV (2011) Oxidative Stress and Mitochondrial

Impairment After Treatment With Anti-HIV Drugs: Clinical Implications. Curr Pharm Des

17(36):4076-4086.

Bodner A, Maroney AC, Finn JP, Ghadge G, Roos R and Miller RJ (2002) Mixed Lineage

Kinase 3 Mediates Gp120IIIB-Induced Neurotoxicity. J Neurochem 82(6):1424-1434.

Bodner A, Toth PT and Miller RJ (2004) Activation of C-Jun N-Terminal Kinase Mediates

Gp120IIIB- and Nucleoside Analogue-Induced Sensory Neuron Toxicity. Exp Neurol

188(2):246-253.

Bogoyevitch MA, Boehm I, Oakley A, Ketterman AJ and Barr RK (2004) Targeting the JNK

MAPK Cascade for Inhibition: Basic Science and Therapeutic Potential. Biochim Biophys Acta

1697:89-101.

Boissiere F, Hunot S, Faucheux B, Duyckaerts C, Hauw JJ, Agid Y and Hirsch EC (1997)

Nuclear Translocation of NF-KappaB in Cholinergic Neurons of Patients With Alzheimer's

Disease. Neuroreport 8:2849-2852.

Bonizzi G and Karin M (2004) The Two NF-KappaB Activation Pathways and Their Role in

Innate and Adaptive Immunity. Trends Immunol 25:280-288.

Borst P, Balzarini J, Ono N, Reid G, de VH, Wielinga P, Wijnholds J and Zelcer N (2004) The

Potential Impact of Drug Transporters on Nucleoside-Analog-Based Antiviral Chemotherapy.

Antiviral Res 62(1):1-7.

Page 201: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

182

Borst P, Evers R, Kool M and Wijnholds J (2000) A Family of Drug Transporters: the Multidrug

Resistance-Associated Proteins. J Natl Cancer Inst 92:1295-1302.

Bortfeld M, Rius M, Konig J, Herold-Mende C, Nies AT and Keppler D (2006) Human

Multidrug Resistance Protein 8 (MRP8/ABCC11), an Apical Efflux Pump for Steroid Sulfates, Is

an Axonal Protein of the CNS and Peripheral Nervous System. Neuroscience 137:1247-1257.

Boulton TG, Nye SH, Robbins DJ, Ip NY, Radziejewska E, Morgenbesser SD, DePinho RA,

Panayotatos N, Cobb MH and Yancopoulos GD (1991) ERKs: a Family of Protein-

Serine/Threonine Kinases That Are Activated and Tyrosine Phosphorylated in Response to

Insulin and NGF. Cell 65:663-675.

Bousquet L, Pruvost A, Didier N, Farinotti R and Mabondzo A (2008) Emtricitabine: Inhibitor

and Substrate of Multidrug Resistance Associated Protein. Eur J Pharm Sci 35:247-256.

Boutet A, Salim H, Taoufik Y, Lledo PM, Vincent JD, Delfraissy JF and Tardieu M (2001)

Isolated Human Astrocytes Are Not Susceptible to Infection by M- and T-Tropic HIV-1 Strains

Despite Functional Expression of the Chemokine Receptors CCR5 and CXCR4. Glia 34:165-

177.

Brandmann M, Tulpule K, Schmidt MM and Dringen R (2012) The Antiretroviral Protease

Inhibitors Indinavir and Nelfinavir Stimulate Mrp1-Mediated GSH Export From Cultured Brain

Astrocytes. J Neurochem 120:78-92.

Breedveld P, Pluim D, Cipriani G, Wielinga P, van TO, Schinkel AH and Schellens JH (2005)

The Effect of Bcrp1 (Abcg2) on the in Vivo Pharmacokinetics and Brain Penetration of Imatinib

Mesylate (Gleevec): Implications for the Use of Breast Cancer Resistance Protein and P-

Glycoprotein Inhibitors to Enable the Brain Penetration of Imatinib in Patients. Cancer Res

65:2577-2582.

Bukrinskaya AG (2004) HIV-1 Assembly and Maturation. Arch Virol 149:1067-1082.

Caccamo D, Campisi A, Curro M, Bramanti V, Tringali M, Li VG, Vanella A and Ientile R

(2005) Antioxidant Treatment Inhibited Glutamate-Evoked NF-KappaB Activation in Primary

Astroglial Cell Cultures. Neurotoxicology 26(5):915-921.

Cai ZY, Yan Y and Chen R (2010) Minocycline Reduces Astrocytic Reactivation and

Neuroinflammation in the Hippocampus of a Vascular Cognitive Impairment Rat Model.

Neurosci Bull 26:28-36.

Calandra T and Roger T (2003) Macrophage Migration Inhibitory Factor: a Regulator of Innate

Immunity. Nat Rev Immunol 3(10):791-800.

Calza L, Manfredi R and Chiodo F (2004) Dyslipidaemia Associated With Antiretroviral

Therapy in HIV-Infected Patients. J Antimicrob Chemother 53:10-14.

Page 202: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

183

Campbell JH, Burdo TH, Autissier P, Bombardier JP, Westmoreland SV, Soulas C, Gonzalez

RG, Ratai EM and Williams KC (2011) Minocycline Inhibition of Monocyte Activation

Correlates With Neuronal Protection in SIV NeuroAIDS. PLoS One 6(4):e18688.

Canestri A, Lescure FX, Jaureguiberry S, Moulignier A, Amiel C, Marcelin AG, Peytavin G,

Tubiana R, Pialoux G and Katlama C (2010) Discordance Between Cerebral Spinal Fluid and

Plasma HIV Replication in Patients With Neurological Symptoms Who Are Receiving

Suppressive Antiretroviral Therapy. Clin Infect Dis 50(5):773-778.

Cannon RE, Peart JC, Hawkins BT, Campos CR and Miller DS (2012) Targeting Blood-Brain

Barrier Sphingolipid Signaling Reduces Basal P-Glycoprotein Activity and Improves Drug

Delivery to the Brain. Proc Natl Acad Sci U S A 109(39):15930-15935.

Carman CV and Springer TA (2004) A Transmigratory Cup in Leukocyte Diapedesis Both

Through Individual Vascular Endothelial Cells and Between Them. J Cell Biol 167(2):377-388.

Caseiro MM, Nelson M, Diaz RS, Gathe J, de Andrade Neto JL, Slim J, Solano A, Netto EM,

Mak C, Shen J, Greaves W, Dunkle LM, Vilchez RA and Zeinecker J (2012) Vicriviroc Plus

Optimized Background Therapy for Treatment-Experienced Subjects With CCR5 HIV-1

Infection: Final Results of Two Randomized Phase III Trials. J Infect 65(4):326-335.

Cashion MF, Banks WA, Bost KL and Kastin AJ (1999) Transmission Routes of HIV-1 Gp120

From Brain to Lymphoid Tissues. Brain Res 20;822(1-2):26-33.

Cavalcante GI, Capistrano VL, Cavalcante FS, Vasconcelos SM, Macedo DS, Sousa FC, Woods

DJ and Fonteles MM (2010) Implications of Efavirenz for Neuropsychiatry: a Review. Int J

Neurosci 120(12):739-745.

Chan GN, Hoque MT and Bendayan R (2013a) Role of Nuclear Receptors in the Regulation of

Drug Transporters in the Brain. Trends Pharmacol Sci 34(7):361-372.

Chan GN, Patel R, Cummins CL and Bendayan R (2013b) Induction of P-Glycoprotein by

Antiretroviral Drugs in Human Brain Microvessel Endothelial Cells. Antimicrob Agents

Chemother 57(9):4481-4488.

Chan GN, Saldivia V, Yang Y, Pang H, de L, I and Bendayan R (2013c) In Vivo Induction of P-

Glycoprotein Expression at the Mouse Blood-Brain Barrier: an Intracerebral Microdialysis

Study. J Neurochem10.

Chan GN, Tozammel HM, Cummins CL and Bendayan R (2011) Regulation of P-Glycoprotein

by Orphan Nuclear Receptors in Human Brain Microvessel Endothelial Cells. J Neurochem10-

4159.

Chandler B, Almond L, Ford J, Owen A, Hoggard P, Khoo S and Back D (2003) The Effects of

Protease Inhibitors and Nonnucleoside Reverse Transcriptase Inhibitors on P-Glycoprotein

Expression in Peripheral Blood Mononuclear Cells in Vitro. J Acquir Immune Defic Syndr

33:551-556.

Page 203: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

184

Chen CJ, Chin JE, Ueda K, Clark DP, Pastan I, Gottesman MM and Roninson IB (1986) Internal

Duplication and Homology With Bacterial Transport Proteins in the Mdr1 (P-Glycoprotein)

Gene From Multidrug-Resistant Human Cells. Cell 47:381-389.

Chen RE and Thorner J (2007) Function and Regulation in MAPK Signaling Pathways: Lessons

Learned From the Yeast Saccharomyces Cerevisiae. Biochim Biophys Acta 1773(8):1311-1340.

Chen SH, Lin JK, Liu SH, Liang YC and Lin-Shiau SY (2008) Apoptosis of Cultured Astrocytes

Induced by the Copper and Neocuproine Complex Through Oxidative Stress and JNK

Activation. Toxicol Sci 102(1):138-149.

Chen ZS, Guo Y, Belinsky MG, Kotova E and Kruh GD (2005) Transport of Bile Acids,

Sulfated Steroids, Estradiol 17-Beta-D-Glucuronide, and Leukotriene C4 by Human Multidrug

Resistance Protein 8 (ABCC11). Mol Pharmacol 67:545-557.

Chen ZS, Lee K and Kruh GD (2001) Transport of Cyclic Nucleotides and Estradiol 17-Beta-D-

Glucuronide by Multidrug Resistance Protein 4. Resistance to 6-Mercaptopurine and 6-

Thioguanine. J Biol Chem 276:33747-33754.

Cherrington NJ, Hartley DP, Li N, Johnson DR and Klaassen CD (2002) Organ Distribution of

Multidrug Resistance Proteins 1, 2, and 3 (Mrp1, 2, and 3) MRNA and Hepatic Induction of

Mrp3 by Constitutive Androstane Receptor Activators in Rats. J Pharmacol Exp Ther 300:97-

104.

Cherrington NJ, Slitt AL, Li N and Klaassen CD (2004) Lipopolysaccharide-Mediated

Regulation of Hepatic Transporter MRNA Levels in Rats. Drug Metab Dispos 32:734-741.

Choi RJ, Ngoc TM, Bae K, Cho HJ, Kim DD, Chun J, Khan S and Kim YS (2013) Anti-

Inflammatory Properties of Anthraquinones and Their Relationship With the Regulation of P-

Glycoprotein Function and Expression. Eur J Pharm Sci 48(1-2):272-281.

Choo EF, Leake B, Wandel C, Imamura H, Wood AJ, Wilkinson GR and Kim RB (2000)

Pharmacological Inhibition of P-Glycoprotein Transport Enhances the Distribution of HIV-1

Protease Inhibitors into Brain and Testes. Drug Metab Dispos 28:655-660.

Choudhuri S, Cherrington NJ, Li N and Klaassen CD (2003) Constitutive Expression of Various

Xenobiotic and Endobiotic Transporter MRNAs in the Choroid Plexus of Rats. Drug Metab

Dispos 31:1337-1345.

Churchill MJ, Wesselingh SL, Cowley D, Pardo CA, McArthur JC, Brew BJ and Gorry PR

(2009) Extensive Astrocyte Infection Is Prominent in Human Immunodeficiency Virus-

Associated Dementia. Ann Neurol 66(2):253-258.

Ciallella JR, Saporito M, Lund S, Leist M, Hasseldam H, McGann N, Smith CS, Bozyczko-

Coyne D and Flood DG (2005) CEP-11004, an Inhibitor of the SAPK/JNK Pathway, Reduces

TNF-Alpha Release From Lipopolysaccharide-Treated Cells and Mice. Eur J Pharmacol

515:179-187.

Page 204: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

185

Cisternino S, Mercier C, Bourasset F, Roux F and Scherrmann JM (2004) Expression, Up-

Regulation, and Transport Activity of the Multidrug-Resistance Protein Abcg2 at the Mouse

Blood-Brain Barrier. Cancer Res 64:3296-3301.

Cobb MH, Boulton TG and Robbins DJ (1991a) Extracellular Signal-Regulated Kinases: ERKs

in Progress. Cell Regul 2:965-978.

Cobb MH, Robbins DJ and Boulton TG (1991b) ERKs, Extracellular Signal-Regulated MAP-2

Kinases. Curr Opin Cell Biol 3:1025-1032.

Cohen PS, Schmidtmayerova H, Dennis J, Dubrovsky L, Sherry B, Wang H, Bukrinsky M and

Tracey KJ (1997) The Critical Role of P38 MAP Kinase in T Cell HIV-1 Replication. Mol Med

3(5):339-346.

Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz EU,

Duncan AM and Deeley RG (1992) Overexpression of a Transporter Gene in a Multidrug-

Resistant Human Lung Cancer Cell Line. Science 258:1650-1654.

Cooray HC, Blackmore CG, Maskell L and Barrand MA (2002) Localisation of Breast Cancer

Resistance Protein in Microvessel Endothelium of Human Brain. Neuroreport 13:2059-2063.

Copeland KF and Brooks JI (2010) A Novel Use for an Old Drug: the Potential for Minocycline

As Anti-HIV Adjuvant Therapy. J Infect Dis 201:1115-1117.

Corasaniti MT, Bagetta G, Rotiroti D and Nistico G (1998) The HIV Envelope Protein Gp120 in

the Nervous System: Interactions With Nitric Oxide, Interleukin-1beta and Nerve Growth Factor

Signalling, With Pathological Implications in Vivo and in Vitro. Biochem Pharmacol 56:153-

156.

Cucullo L, Couraud PO, Weksler B, Romero IA, Hossain M, Rapp E and Janigro D (2008)

Immortalized Human Brain Endothelial Cells and Flow-Based Vascular Modeling: a Marriage of

Convenience for Rational Neurovascular Studies. J Cereb Blood Flow Metab 28(2):312-328.

Cuenda A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF, Young PR and Lee JC (1995)

SB 203580 Is a Specific Inhibitor of a MAP Kinase Homologue Which Is Stimulated by Cellular

Stresses and Interleukin-1. FEBS Lett 364:229-233.

Cuenda A and Rousseau S (2007) P38 MAP-Kinases Pathway Regulation, Function and Role in

Human Diseases. Biochim Biophys Acta 1773(8):1358-1375.

Dalgleish AG, Beverley PC, Clapham PR, Crawford DH, Greaves MF and Weiss RA (1984) The

CD4 (T4) Antigen Is an Essential Component of the Receptor for the AIDS Retrovirus. Nature

20-1985 Jan 2;312:763-767.

Dallas S, Miller DS and Bendayan R (2006) Multidrug Resistance-Associated Proteins:

Expression and Function in the Central Nervous System. Pharmacol Rev 58:140-161.

Page 205: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

186

Dallas S, Ronaldson PT, Bendayan M and Bendayan R (2004a) Multidrug Resistance Protein 1-

Mediated Transport of Saquinavir by Microglia. Neuroreport 19;15:1183-1186.

Dallas S, Schlichter L and Bendayan R (2004b) Multidrug Resistance Protein (MRP) 4- and

MRP 5-Mediated Efflux of 9-(2-Phosphonylmethoxyethyl)Adenine by Microglia. J Pharmacol

Exp Ther 309:1221-1229.

Dallas S, Zhu X, Baruchel S, Schlichter L and Bendayan R (2003) Functional Expression of the

Multidrug Resistance Protein 1 in Microglia. J Pharmacol Exp Ther 307:282-290.

Daoud A, Gloria CJ, Taningco G, Hammerschlag MR, Weiss S, Gelling M, Roblin PM and Joks

R (2008) Minocycline Treatment Results in Reduced Oral Steroid Requirements in Adult

Asthma. Allergy Asthma Proc 29(3):286-294.

Dauchy S, Miller F, Couraud PO, Weaver RJ, Weksler B, Romero IA, Scherrmann JM, De W, I

and Decleves X (2009) Expression and Transcriptional Regulation of ABC Transporters and

Cytochromes P450 in HCMEC/D3 Human Cerebral Microvascular Endothelial Cells. Biochem

Pharmacol 77:897-909.

Davis LE, Hjelle BL, Miller VE, Palmer DL, Llewellyn AL, Merlin TL, Young SA, Mills RG,

Wachsman W and Wiley CA (1992) Early Viral Brain Invasion in Iatrogenic Human

Immunodeficiency Virus Infection. Neurology 42:1736-1739.

Davson H, Hollingsworth G and Segal MB (1970) The Mechanism of Drainage of the

Cerebrospinal Fluid. Brain 93:665-678.

Davson H and Segal MB (1970) The Effects of Some Inhibitors and Accelerators of Sodium

Transport on the Turnover of 22Na in the Cerebrospinal Fluid and the Brain. J Physiol 209:131-

153.

De Groot CJ, Langeveld CH, Jongenelen CA, Montagne L, van d, V and Dijkstra CD (1997)

Establishment of Human Adult Astrocyte Cultures Derived From Postmortem Multiple Sclerosis

and Control Brain and Spinal Cord Regions: Immunophenotypical and Functional

Characterization. J Neurosci Res 49(3):342-354.

de Lange EC (2004) Potential Role of ABC Transporters As a Detoxification System at the

Blood-CSF Barrier. Adv Drug Deliv Rev 56:1793-1809.

de Vries HE, Kuiper J, de Boer AG, Van Berkel TJ and Breimer DD (1997) The Blood-Brain

Barrier in Neuroinflammatory Diseases. Pharmacol Rev 49:143-155.

Dean M and Allikmets R (2001) Complete Characterization of the Human ABC Gene Family. J

Bioenerg Biomembr 33:475-479.

Decleves X, Regina A, Laplanche JL, Roux F, Boval B, Launay JM and Scherrmann JM (2000)

Functional Expression of P-Glycoprotein and Multidrug Resistance-Associated Protein (Mrp1)

in Primary Cultures of Rat Astrocytes. J Neurosci Res 60:594-601.

Page 206: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

187

Deng H, Liu R, Ellmeier W, Choe S, Unutmaz D, Burkhart M, Di MP, Marmon S, Sutton RE,

Hill CM, Davis CB, Peiper SC, Schall TJ, Littman DR and Landau NR (1996) Identification of a

Major Co-Receptor for Primary Isolates of HIV-1. Nature 20;381:661-666.

DiCenzo R, Peterson DR, Cruttenden K, Mariuz P, Rezk NL, Hochreiter J, Gelbard H and

Schifitto G (2008) Effects of Minocycline and Valproic Acid Coadministration on Atazanavir

Plasma Concentrations in Human Immunodeficiency Virus-Infected Adults Receiving

Atazanavir-Ritonavir. Antimicrob Agents Chemother 52(9):3035-3039.

Dohgu S and Banks WA (2008) Lipopolysaccharide-Enhanced Transcellular Transport of HIV-1

Across the Blood-Brain Barrier Is Mediated by the P38 Mitogen-Activated Protein Kinase

Pathway. Exp Neurol 210:740-749.

Dohgu S, Fleegal-DeMotta MA and Banks WA (2011) Lipopolysaccharide-Enhanced

Transcellular Transport of HIV-1 Across the Blood-Brain Barrier Is Mediated by Luminal

Microvessel IL-6 and GM-CSF. J Neuroinflammation 8:167-168.

Dohgu S, Ryerse JS, Robinson SM and Banks WA (2012) Human Immunodeficiency Virus-1

Uses the Mannose-6-Phosphate Receptor to Cross the Blood-Brain Barrier. PLoS One 7:e39565.

Dore-Duffy P (2008) Pericytes: Pluripotent Cells of the Blood Brain Barrier. Curr Pharm Des

14:1581-1593.

Doyle KL, Morgan EE, Morris S, Smith DM, Little S, Iudicello JE, Blackstone K, Moore DJ,

Grant I, Letendre SL and Woods SP (2013) Real-World Impact of Neurocognitive Deficits in

Acute and Early HIV Infection. J Neurovirol 19(6):565-573.

Doyle LA, Yang W, Abruzzo LV, Krogmann T, Gao Y, Rishi AK and Ross DD (1998) A

Multidrug Resistance Transporter From Human MCF-7 Breast Cancer Cells. Proc Natl Acad Sci

U S A 95:15665-15670.

Dudley DT, Pang L, Decker SJ, Bridges AJ and Saltiel AR (1995) A Synthetic Inhibitor of the

Mitogen-Activated Protein Kinase Cascade. Proc Natl Acad Sci U S A 92(17):7686-7689.

Edwards JE, Alcorn J, Savolainen J, Anderson BD and McNamara PJ (2005) Role of P-

Glycoprotein in Distribution of Nelfinavir Across the Blood-Mammary Tissue Barrier and

Blood-Brain Barrier. Antimicrob Agents Chemother 49:1626-1628.

Eggert D, Dash PK, Gorantla S, Dou H, Schifitto G, Maggirwar SB, Dewhurst S, Poluektova L,

Gelbard HA and Gendelman HE (2010) Neuroprotective Activities of CEP-1347 in Models of

NeuroAIDS. J Immunol 184(2):746-756.

Eisenblatter T and Galla HJ (2002) A New Multidrug Resistance Protein at the Blood-Brain

Barrier. Biochem Biophys Res Commun 293:1273-1278.

Eisenblatter T, Huwel S and Galla HJ (2003) Characterisation of the Brain Multidrug Resistance

Protein (BMDP/ABCG2/BCRP) Expressed at the Blood-Brain Barrier. Brain Res 971:221-231.

Page 207: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

188

Ellis RJ, Badiee J, Vaida F, Letendre S, Heaton RK, Clifford D, Collier AC, Gelman B,

McArthur J, Morgello S, McCutchan JA and Grant I (2011) CD4 Nadir Is a Predictor of HIV

Neurocognitive Impairment in the Era of Combination Antiretroviral Therapy. AIDS 25:1747-

1751.

Engchanil C, Kosalaraksa P, Lumbiganon P, Lulitanond V, Pongjunyakul P, Thuennadee R,

Tungsawad S and Suwan-apichon O (2006) Therapeutic Potential of Chloroquine Added to

Zidovudine Plus Didanosine for HIV-1 Infected Children. J Med Assoc Thai 89(8):1229-1236.

Enting RH, Hoetelmans RM, Lange JM, Burger DM, Beijnen JH and Portegies P (1998)

Antiretroviral Drugs and the Central Nervous System. AIDS 12:1941-1955.

Fan Y, Liu C, Qin X, Wang Y, Han Y and Zhou Y (2010) The Role of ERK1/2 Signaling

Pathway in Nef Protein Upregulation of the Expression of the Intercellular Adhesion Molecule 1

in Endothelial Cells. Angiology 61(7):669-678.

Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE, Pitts

WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA and Trzaskos JM (1998)

Identification of a Novel Inhibitor of Mitogen-Activated Protein Kinase Kinase. J Biol Chem

273(29):18623-18632.

Filipov NM, Seegal RF and Lawrence DA (2005) Manganese Potentiates in Vitro Production of

Proinflammatory Cytokines and Nitric Oxide by Microglia Through a Nuclear Factor Kappa B-

Dependent Mechanism. Toxicol Sci 84(1):139-148.

Fischl MA, Richman DD, Grieco MH, Gottlieb MS, Volberding PA, Laskin OL, Leedom JM,

Groopman JE, Mildvan D, Schooley RT and . (1987) The Efficacy of Azidothymidine (AZT) in

the Treatment of Patients With AIDS and AIDS-Related Complex. A Double-Blind, Placebo-

Controlled Trial. N Engl J Med 317(4):185-191.

Fisher M (2009) Pericyte Signaling in the Neurovascular Unit. Stroke 40:S13-S15.

Fletcher NF, Meeker RB, Hudson LC and Callanan JJ (2011) The Neuropathogenesis of Feline

Immunodeficiency Virus Infection: Barriers to Overcome. Vet J 188(3):260-269.

Follstaedt SC, Barber SA and Zink MC (2008) Mechanisms of Minocycline-Induced

Suppression of Simian Immunodeficiency Virus Encephalitis: Inhibition of Apoptosis Signal-

Regulating Kinase 1. J Neurovirol 14(5):376-388.

Frigerio F, Frasca A, Weissberg I, Parrella S, Friedman A, Vezzani A and Noe FM (2012) Long-

Lasting Pro-Ictogenic Effects Induced in Vivo by Rat Brain Exposure to Serum Albumin in the

Absence of Concomitant Pathology. Epilepsia 53(11):1887-1897.

Fujimoto H, Higuchi M, Watanabe H, Koh Y, Ghosh AK, Mitsuya H, Tanoue N, Hamada A and

Saito H (2009) P-Glycoprotein Mediates Efflux Transport of Darunavir in Human Intestinal

Caco-2 and ABCB1 Gene-Transfected Renal LLC-PK1 Cell Lines. Biol Pharm Bull 32(9):1588-

1593.

Page 208: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

189

Furler RL and Uittenbogaart CH (2010) Signaling Through the P38 and ERK Pathways: a

Common Link Between HIV Replication and the Immune Response. Immunol Res 48:99-109.

Gabuzda D and Wang J (2000) Chemokine Receptors and Mechanisms of Cell Death in HIV

Neuropathogenesis. J Neurovirol 6 Suppl 1:S24-S32.

Gadient RA and Otten UH (1997) Interleukin-6 (IL-6)--a Molecule With Both Beneficial and

Destructive Potentials. Prog Neurobiol 52:379-390.

Galindo MJ, Verdejo J, Gonzalez-Munoz M, Ferrer A and Polo R (2008) Metabolic Changes in

Protease Inhibitor-Naive Patients Treated for 1 Year With Lopinavir/Ritonavir. J Acquir Immune

Defic Syndr 48:628-629.

Garden GA (2002) Microglia in Human Immunodeficiency Virus-Associated

Neurodegeneration. Glia 40(2):240-251.

Garden GA and Moller T (2006) Microglia Biology in Health and Disease. J Neuroimmune

Pharmacol 1:127-137.

Gardner ER, Smith NF, Figg WD and Sparreboom A (2009) Influence of the Dual ABCB1 and

ABCG2 Inhibitor Tariquidar on the Disposition of Oral Imatinib in Mice. J Exp Clin Cancer Res

28:99.:99.

Garner C and Brown PD (1992) Two Types of Chloride Channel in the Apical Membrane of Rat

Choroid Plexus Epithelial Cells. Brain Res 591:137-145.

Gazzin S, Berengeno AL, Strazielle N, Fazzari F, Raseni A, Ostrow JD, Wennberg R, Ghersi-

Egea JF and Tiribelli C (2011) Modulation of Mrp1 (ABCc1) and Pgp (ABCb1) by Bilirubin at

the Blood-CSF and Blood-Brain Barriers in the Gunn Rat. PLoS One 6:e16165.

Gelman BB, Lisinicchia JG, Morgello S, Masliah E, Commins D, Achim CL, Fox HS, Kolson

DL, Grant I, Singer E, Yiannoutsos CT, Sherman S, Gensler G, Moore DJ, Chen T and Soukup

VM (2013) Neurovirological Correlation With HIV-Associated Neurocognitive Disorders and

Encephalitis in a HAART-Era Cohort. J Acquir Immune Defic Syndr 62(5):487-495.

Genis P, Jett M, Bernton EW, Boyle T, Gelbard HA, Dzenko K, Keane RW, Resnick L,

Mizrachi Y, Volsky DJ and . (1992) Cytokines and Arachidonic Metabolites Produced During

Human Immunodeficiency Virus (HIV)-Infected Macrophage-Astroglia Interactions:

Implications for the Neuropathogenesis of HIV Disease. J Exp Med 176:1703-1718.

Ghorpade A, Holter S, Borgmann K, Persidsky R and Wu L (2003) HIV-1 and IL-1 Beta

Regulate Fas Ligand Expression in Human Astrocytes Through the NF-Kappa B Pathway. J

Neuroimmunol 141:141-149.

Gibson CJ, Hossain MM, Richardson JR and Aleksunes LM (2012) Inflammatory Regulation of

ATP Binding Cassette Efflux Transporter Expression and Function in Microglia. J Pharmacol

Exp Ther 343(3):650-660.

Page 209: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

190

Giri N, Shaik N, Pan G, Terasaki T, Mukai C, Kitagaki S, Miyakoshi N and Elmquist WF (2008)

Investigation of the Role of Breast Cancer Resistance Protein (Bcrp/Abcg2) on Pharmacokinetics

and Central Nervous System Penetration of Abacavir and Zidovudine in the Mouse. Drug Metab

Dispos 36:1476-1484.

Gisolf EH, Enting RH, Jurriaans S, de WF, van der Ende ME, Hoetelmans RM, Portegies P and

Danner SA (2000) Cerebrospinal Fluid HIV-1 RNA During Treatment With

Ritonavir/Saquinavir or Ritonavir/Saquinavir/Stavudine. AIDS 14:1583-1589.

Gollapudi S and Gupta S (1990) Human Immunodeficiency Virus I-Induced Expression of P-

Glycoprotein. Biochem Biophys Res Commun 171:1002-1007.

Gong J, Shen XH, Chen C, Qiu H and Yang RG (2011) Down-Regulation of HIV-1 Infection by

Inhibition of the MAPK Signaling Pathway. Virol Sin 26:114-122.

Gonul E, Duz B, Kahraman S, Kayali H, Kubar A and Timurkaynak E (2002) Early Pericyte

Response to Brain Hypoxia in Cats: an Ultrastructural Study. Microvasc Res 64:116-119.

Goodfellow VS, Loweth CJ, Ravula SB, Wiemann T, Nguyen T, Xu Y, Todd DE, Sheppard D,

Pollack S, Polesskaya O, Marker DF, Dewhurst S and Gelbard HA (2013) Discovery, Synthesis,

and Characterization of an Orally Bioavailable, Brain Penetrant Inhibitor of Mixed Lineage

Kinase 3. J Med Chem 56(20):8032-8048.

Gorry PR, Ong C, Thorpe J, Bannwarth S, Thompson KA, Gatignol A, Vesselingh SL and

Purcell DF (2003) Astrocyte Infection by HIV-1: Mechanisms of Restricted Virus Replication,

and Role in the Pathogenesis of HIV-1-Associated Dementia. Curr HIV Res 1:463-473.

Gottesman MM, Hrycyna CA, Schoenlein PV, Germann UA and Pastan I (1995) Genetic

Analysis of the Multidrug Transporter. Annu Rev Genet 29:607-649.

Groothuis DR and Levy RM (1997) The Entry of Antiviral and Antiretroviral Drugs into the

Central Nervous System. J Neurovirol 3:387-400.

Guha D, Nagilla P, Redinger C, Srinivasan A, Schatten GP and Ayyavoo V (2012) Neuronal

Apoptosis by HIV-1 Vpr: Contribution of Proinflammatory Molecular Networks From Infected

Target Cells. J Neuroinflammation 9:138-139.

Guo L, Xing Y, Pan R, Jiang M, Gong Z, Lin L, Wang J, Xiong G and Dong J (2013) Curcumin

Protects Microglia and Primary Rat Cortical Neurons Against HIV-1 Gp120-Mediated

Inflammation and Apoptosis. PLoS One 8(8):e70565.

Guo Y, Kotova E, Chen ZS, Lee K, Hopper-Borge E, Belinsky MG and Kruh GD (2003) MRP8,

ATP-Binding Cassette C11 (ABCC11), Is a Cyclic Nucleotide Efflux Pump and a Resistance

Factor for Fluoropyrimidines 2',3'-Dideoxycytidine and 9'-(2'-

Phosphonylmethoxyethyl)Adenine. J Biol Chem 278:29509-29514.

Page 210: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

191

Gupta S, Barrett T, Whitmarsh AJ, Cavanagh J, Sluss HK, Derijard B and Davis RJ (1996)

Selective Interaction of JNK Protein Kinase Isoforms With Transcription Factors. EMBO J

15(11):2760-2770.

Gupta S, Knight AG, Losso BY, Ingram DK, Keller JN and Bruce-Keller AJ (2012) Brain Injury

Caused by HIV Protease Inhibitors: Role of Lipodystrophy and Insulin Resistance. Antiviral Res

95:19-29.

Hagihara N, Walbridge S, Olson AW, Oldfield EH and Youle RJ (2000) Vascular Protection by

Chloroquine During Brain Tumor Therapy With Tf-CRM107. Cancer Res 60:230-234.

Hammond RR, Iskander S, Achim CL, Hearn S, Nassif J and Wiley CA (2002) A Reliable

Primary Human CNS Culture Protocol for Morphological Studies of Dendritic and Synaptic

Elements. J Neurosci Methods 118:189-198.

Han Z, Boyle DL, Chang L, Bennett B, Karin M, Yang L, Manning AM and Firestein GS (2001)

C-Jun N-Terminal Kinase Is Required for Metalloproteinase Expression and Joint Destruction in

Inflammatory Arthritis. J Clin Invest 108:73-81.

Hanna GJ, Lalezari J, Hellinger JA, Wohl DA, Nettles R, Persson A, Krystal M, Lin P, Colonno

R and Grasela DM (2011) Antiviral Activity, Pharmacokinetics, and Safety of BMS-488043, a

Novel Oral Small-Molecule HIV-1 Attachment Inhibitor, in HIV-1-Infected Subjects.

Antimicrob Agents Chemother 55(2):722-728.

Hartz AM, Bauer B, Block ML, Hong JS and Miller DS (2008) Diesel Exhaust Particles Induce

Oxidative Stress, Proinflammatory Signaling, and P-Glycoprotein Up-Regulation at the Blood-

Brain Barrier. FASEB J 22:2723-2733.

Hartz AM, Madole EK, Miller DS and Bauer B (2010a) Estrogen Receptor Beta Signaling

Through Phosphatase and Tensin Homolog/Phosphoinositide 3-Kinase/Akt/Glycogen Synthase

Kinase 3 Down-Regulates Blood-Brain Barrier Breast Cancer Resistance Protein. J Pharmacol

Exp Ther 334:467-476.

Hartz AM, Mahringer A, Miller DS and Bauer B (2010b) 17-Beta-Estradiol: a Powerful

Modulator of Blood-Brain Barrier BCRP Activity. J Cereb Blood Flow Metab 30:1742-1755.

Hayashi A, Suzuki H, Itoh K, Yamamoto M and Sugiyama Y (2003) Transcription Factor Nrf2

Is Required for the Constitutive and Inducible Expression of Multidrug Resistance-Associated

Protein 1 in Mouse Embryo Fibroblasts. Biochem Biophys Res Commun 310(3):824-829.

Hayashi K, Pu H, Andras IE, Eum SY, Yamauchi A, Hennig B and Toborek M (2006) HIV-TAT

Protein Upregulates Expression of Multidrug Resistance Protein 1 in the Blood-Brain Barrier. J

Cereb Blood Flow Metab 26:1052-1065.

Hayashi K, Pu H, Tian J, Andras IE, Lee YW, Hennig B and Toborek M (2005) HIV-Tat Protein

Induces P-Glycoprotein Expression in Brain Microvascular Endothelial Cells. J Neurochem

93:1231-1241.

Page 211: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

192

He Y, Cheng J, Lu H, Li J, Hu J, Qi Z, Liu Z, Jiang S and Dai Q (2008) Potent HIV Fusion

Inhibitors Against Enfuvirtide-Resistant HIV-1 Strains. Proc Natl Acad Sci U S A

105(42):16332-16337.

Heaton RK, Clifford DB, Franklin DR, Jr., Woods SP, Ake C, Vaida F, Ellis RJ, Letendre SL,

Marcotte TD, Atkinson JH, Rivera-Mindt M, Vigil OR, Taylor MJ, Collier AC, Marra CM,

Gelman BB, McArthur JC, Morgello S, Simpson DM, McCutchan JA, Abramson I, Gamst A,

Fennema-Notestine C, Jernigan TL, Wong J and Grant I (2010) HIV-Associated Neurocognitive

Disorders Persist in the Era of Potent Antiretroviral Therapy: CHARTER Study. Neurology

75:2087-2096.

Heaton RK, Franklin DR, Ellis RJ, McCutchan JA, Letendre SL, Leblanc S, Corkran SH, Duarte

NA, Clifford DB, Woods SP, Collier AC, Marra CM, Morgello S, Mindt MR, Taylor MJ,

Marcotte TD, Atkinson JH, Wolfson T, Gelman BB, McArthur JC, Simpson DM, Abramson I,

Gamst A, Fennema-Notestine C, Jernigan TL, Wong J and Grant I (2011) HIV-Associated

Neurocognitive Disorders Before and During the Era of Combination Antiretroviral Therapy:

Differences in Rates, Nature, and Predictors. J Neurovirol 17:3-16.

Hendrix CW, Flexner C, MacFarland RT, Giandomenico C, Fuchs EJ, Redpath E, Bridger G and

Henson GW (2000) Pharmacokinetics and Safety of AMD-3100, a Novel Antagonist of the

CXCR-4 Chemokine Receptor, in Human Volunteers. Antimicrob Agents Chemother

44(6):1667-1673.

Hidding U, Mielke K, Waetzig V, Brecht S, Hanisch U, Behrens A, Wagner E and Herdegen T

(2002) The C-Jun N-Terminal Kinases in Cerebral Microglia: Immunological Functions in the

Brain. Biochem Pharmacol 64(5-6):781-788.

Hipfner DR, Deeley RG and Cole SP (1999) Structural, Mechanistic and Clinical Aspects of

MRP1. Biochim Biophys Acta 1461:359-376.

Hirai T, Fukui Y and Motojima K (2007) PPARalpha Agonists Positively and Negatively

Regulate the Expression of Several Nutrient/Drug Transporters in Mouse Small Intestine. Biol

Pharm Bull 30:2185-2190.

Hirrlinger J, Konig J and Dringen R (2002) Expression of MRNAs of Multidrug Resistance

Proteins (Mrps) in Cultured Rat Astrocytes, Oligodendrocytes, Microglial Cells and Neurones. J

Neurochem 82:716-719.

Hirrlinger J, Konig J, Keppler D, Lindenau J, Schulz JB and Dringen R (2001) The Multidrug

Resistance Protein MRP1 Mediates the Release of Glutathione Disulfide From Rat Astrocytes

During Oxidative Stress. J Neurochem 76:627-636.

Hirrlinger J, Moeller H, Kirchhoff F and Dringen R (2005) Expression of Multidrug Resistance

Proteins (Mrps) in Astrocytes of the Mouse Brain: a Single Cell RT-PCR Study. Neurochem Res

30:1237-1244.

Page 212: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

193

Ho EL, Spudich SS, Lee E, Fuchs D, Sinclair E and Price RW (2011) Minocycline Fails to

Modulate Cerebrospinal Fluid HIV Infection or Immune Activation in Chronic Untreated HIV-1

Infection: Results of a Pilot Study. AIDS Res Ther 8:17.

Holmquist L, Stuchbury G, Berbaum K, Muscat S, Young S, Hager K, Engel J and Munch G

(2007) Lipoic Acid As a Novel Treatment for Alzheimer's Disease and Related Dementias.

Pharmacol Ther 113:154-164.

Hong M, Schlichter L and Bendayan R (2000) A Na(+)-Dependent Nucleoside Transporter in

Microglia. J Pharmacol Exp Ther 292:366-374.

Hong M, Schlichter L and Bendayan R (2001) A Novel Zidovudine Uptake System in Microglia.

J Pharmacol Exp Ther 296:141-149.

Hong Z, Jiang Z, Liangxi W, Guofu D, Ping L, Yongling L, Wendong P and Minghai W (2004)

Chloroquine Protects Mice From Challenge With CpG ODN and LPS by Decreasing

Proinflammatory Cytokine Release. Int Immunopharmacol 4:223-234.

Hoque MT, Robillard KR and Bendayan R (2012) Regulation of Breast Cancer Resistant Protein

by Peroxisome Proliferator-Activated Receptor Alpha in Human Brain Microvessel Endothelial

Cells. Mol Pharmacol 81(4):598-609.

Hori K, Burd PR, Furuke K, Kutza J, Weih KA and Clouse KA (1999) Human

Immunodeficiency Virus-1-Infected Macrophages Induce Inducible Nitric Oxide Synthase and

Nitric Oxide (NO) Production in Astrocytes: Astrocytic NO As a Possible Mediator of Neural

Damage in Acquired Immunodeficiency Syndrome. Blood 93:1843-1850.

Hori S, Ohtsuki S, Hosoya K, Nakashima E and Terasaki T (2004a) A Pericyte-Derived

Angiopoietin-1 Multimeric Complex Induces Occludin Gene Expression in Brain Capillary

Endothelial Cells Through Tie-2 Activation in Vitro. J Neurochem 89:503-513.

Hori S, Ohtsuki S, Tachikawa M, Kimura N, Kondo T, Watanabe M, Nakashima E and Terasaki

T (2004b) Functional Expression of Rat ABCG2 on the Luminal Side of Brain Capillaries and Its

Enhancement by Astrocyte-Derived Soluble Factor(s). J Neurochem 90:526-536.

Hui KK, Liadis N, Robertson J, Kanungo A and Henderson JT (2010) Calcineurin Inhibition

Enhances Motor Neuron Survival Following Injury. J Cell Mol Med 14(3):671-686.

Huisman MT, Smit JW, Crommentuyn KM, Zelcer N, Wiltshire HR, Beijnen JH and Schinkel

AH (2002) Multidrug Resistance Protein 2 (MRP2) Transports HIV Protease Inhibitors, and

Transport Can Be Enhanced by Other Drugs. AIDS 16:2295-2301.

Hult B, Chana G, Masliah E and Everall I (2008) Neurobiology of HIV. Int Rev Psychiatry 20:3-

13.

Hunot S, Brugg B, Ricard D, Michel PP, Muriel MP, Ruberg M, Faucheux BA, Agid Y and

Hirsch EC (1997) Nuclear Translocation of NF-KappaB Is Increased in Dopaminergic Neurons

of Patients With Parkinson Disease. Proc Natl Acad Sci U S A 94:7531-7536.

Page 213: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

194

Idris AI, Ralston SH and van't Hof RJ (2009) The Nitrosylated Flurbiprofen Derivative

HCT1026 Inhibits Cytokine-Induced Signalling Through a Novel Mechanism of Action. Eur J

Pharmacol 602:215-222.

Ilyin SE and Plata-Salaman CR (1997) HIV-1 Envelope Glycoprotein 120 Regulates Brain IL-

1beta System and TNF-Alpha MRNAs in Vivo. Brain Res Bull 44(1):67-73.

James C, Preininger L and Sweet M (2012) Rilpivirine: a Second-Generation Nonnucleoside

Reverse Transcriptase Inhibitor. Am J Health Syst Pharm 69:857-861.

Janneh O, Anwar T, Jungbauer C, Kopp S, Khoo SH, Back DJ and Chiba P (2009) P-

Glycoprotein, Multidrug Resistance-Associated Proteins and Human Organic Anion

Transporting Polypeptide Influence the Intracellular Accumulation of Atazanavir. Antivir Ther

14(7):965-974.

Janneh O, Jones E, Chandler B, Owen A and Khoo SH (2007) Inhibition of P-Glycoprotein and

Multidrug Resistance-Associated Proteins Modulates the Intracellular Concentration of

Lopinavir in Cultured CD4 T Cells and Primary Human Lymphocytes. J Antimicrob Chemother

60(5):987-993.

Janneh O, Owen A, Chandler B, Hartkoorn RC, Hart CA, Bray PG, Ward SA, Back DJ and

Khoo SH (2005) Modulation of the Intracellular Accumulation of Saquinavir in Peripheral Blood

Mononuclear Cells by Inhibitors of MRP1, MRP2, P-Gp and BCRP. AIDS 19:2097-2102.

Jiang JL, Wang S, Li NS, Zhang XH, Deng HW and Li YJ (2007) The Inhibitory Effect of

Simvastatin on the ADMA-Induced Inflammatory Reaction Is Mediated by MAPK Pathways in

Endothelial Cells. Biochem Cell Biol 85:66-77.

Jiang W, Desjardins P and Butterworth RF (2009) Cerebral Inflammation Contributes to

Encephalopathy and Brain Edema in Acute Liver Failure: Protective Effect of Minocycline. J

Neurochem 109(2):485-493.

Jones GJ, Barsby NL, Cohen EA, Holden J, Harris K, Dickie P, Jhamandas J and Power C

(2007) HIV-1 Vpr Causes Neuronal Apoptosis and in Vivo Neurodegeneration. J Neurosci

27:3703-3711.

Jorajuria S, Dereuddre-Bosquet N, Naissant-Storck K, Dormont D and Clayette P (2004)

Differential Expression Levels of MRP1, MRP4, and MRP5 in Response to Human

Immunodeficiency Virus Infection in Human Macrophages. Antimicrob Agents Chemother

48(5):1889-1891.

Juliano RL and Ling V (1976) A Surface Glycoprotein Modulating Drug Permeability in

Chinese Hamster Ovary Cell Mutants. Biochim Biophys Acta 455:152-162.

Kaddoumi A, Choi SU, Kinman L, Whittington D, Tsai CC, Ho RJ, Anderson BD and Unadkat

JD (2007) Inhibition of P-Glycoprotein Activity at the Primate Blood-Brain Barrier Increases the

Distribution of Nelfinavir into the Brain but Not into the Cerebrospinal Fluid. Drug Metab

Dispos 35:1459-1462.

Page 214: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

195

Kaminska B (2005) MAPK Signalling Pathways As Molecular Targets for Anti-Inflammatory

Therapy--From Molecular Mechanisms to Therapeutic Benefits. Biochim Biophys Acta

1754:253-262.

Kanmogne GD, Kennedy RC and Grammas P (2002) HIV-1 Gp120 Proteins and Gp160 Peptides

Are Toxic to Brain Endothelial Cells and Neurons: Possible Pathway for HIV Entry into the

Brain and HIV-Associated Dementia. J Neuropathol Exp Neurol 61:992-1000.

Kanmogne GD, Primeaux C and Grammas P (2005) HIV-1 Gp120 Proteins Alter Tight Junction

Protein Expression and Brain Endothelial Cell Permeability: Implications for the Pathogenesis of

HIV-Associated Dementia. J Neuropathol Exp Neurol 64:498-505.

Kanmogne GD, Schall K, Leibhart J, Knipe B, Gendelman HE and Persidsky Y (2007) HIV-1

Gp120 Compromises Blood-Brain Barrier Integrity and Enhances Monocyte Migration Across

Blood-Brain Barrier: Implication for Viral Neuropathogenesis. J Cereb Blood Flow Metab

27:123-134.

Kao HH, Huang JD and Chang MS (2002) CDNA Cloning and Genomic Organization of the

Murine MRP7, a New ATP-Binding Cassette Transporter. Gene 20;286:299-306.

Kassahun K, McIntosh I, Cui D, Hreniuk D, Merschman S, Lasseter K, Azrolan N, Iwamoto M,

Wagner JA and Wenning LA (2007) Metabolism and Disposition in Humans of Raltegravir

(MK-0518), an Anti-AIDS Drug Targeting the Human Immunodeficiency Virus 1 Integrase

Enzyme. Drug Metab Dispos 35(9):1657-1663.

Katayama K, Yoshioka S, Tsukahara S, Mitsuhashi J and Sugimoto Y (2007) Inhibition of the

Mitogen-Activated Protein Kinase Pathway Results in the Down-Regulation of P-Glycoprotein.

Mol Cancer Ther 6:2092-2102.

Kaul M (2009) HIV-1 Associated Dementia: Update on Pathological Mechanisms and

Therapeutic Approaches. Curr Opin Neurol 22:315-320.

Kaul M, Garden GA and Lipton SA (2001) Pathways to Neuronal Injury and Apoptosis in HIV-

Associated Dementia. Nature 410:988-994.

Kaul M and Lipton SA (2006) Mechanisms of Neuroimmunity and Neurodegeneration

Associated With HIV-1 Infection and AIDS. J Neuroimmune Pharmacol 1:138-151.

Kaul M, Zheng J, Okamoto S, Gendelman HE and Lipton SA (2005) HIV-1 Infection and AIDS:

Consequences for the Central Nervous System. Cell Death Differ 12 Suppl 1:878-892.

Kaye SB (2008) Reversal of Drug Resistance in Ovarian Cancer: Where Do We Go From Here?

J Clin Oncol 26(16):2616-2618.

Keppler D (2011) Multidrug Resistance Proteins (MRPs, ABCCs): Importance for

Pathophysiology and Drug Therapy. Handb Exp Pharmacol299-323.

Page 215: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

196

Kim JM, Oh YK, Lee JH, Im DY, Kim YJ, Youn J, Lee CH, Son H, Lee YS, Park JY and Choi

IH (2005) Induction of Proinflammatory Mediators Requires Activation of the TRAF, NIK, IKK

and NF-KappaB Signal Transduction Pathway in Astrocytes Infected With Escherichia Coli.

Clin Exp Immunol 140(3):450-460.

Kim RB, Fromm MF, Wandel C, Leake B, Wood AJ, Roden DM and Wilkinson GR (1998) The

Drug Transporter P-Glycoprotein Limits Oral Absorption and Brain Entry of HIV-1 Protease

Inhibitors. J Clin Invest 101:289-294.

Kis O, Robillard K, Chan GN and Bendayan R (2010) The Complexities of Antiretroviral Drug-

Drug Interactions: Role of ABC and SLC Transporters. Trends Pharmacol Sci 31:22-35.

Kolenko V, Bloom T, Rayman P, Bukowski R, Hsi E and Finke J (1999) Inhibition of NF-Kappa

B Activity in Human T Lymphocytes Induces Caspase-Dependent Apoptosis Without Detectable

Activation of Caspase-1 and -3. J Immunol 163(2):590-598.

Kong LY, Wilson BC, McMillian MK, Bing G, Hudson PM and Hong JS (1996) The Effects of

the HIV-1 Envelope Protein Gp120 on the Production of Nitric Oxide and Proinflammatory

Cytokines in Mixed Glial Cell Cultures. Cell Immunol 172:77-83.

Kono M, Tatsumi K, Imai AM, Saito K, Kuriyama T and Shirasawa H (2008) Inhibition of

Human Coronavirus 229E Infection in Human Epithelial Lung Cells (L132) by Chloroquine:

Involvement of P38 MAPK and ERK. Antiviral Res 77(2):150-152.

Kravcik S, Gallicano K, Roth V, Cassol S, Hawley-Foss N, Badley A and Cameron DW (1999)

Cerebrospinal Fluid HIV RNA and Drug Levels With Combination Ritonavir and Saquinavir. J

Acquir Immune Defic Syndr 21:371-375.

Kruh GD, Belinsky MG, Gallo JM and Lee K (2007) Physiological and Pharmacological

Functions of Mrp2, Mrp3 and Mrp4 As Determined From Recent Studies on Gene-Disrupted

Mice. Cancer Metastasis Rev 26:5-14.

Kumagae Y, Zhang Y, Kim OJ and Miller CA (1999) Human C-Jun N-Terminal Kinase

Expression and Activation in the Nervous System. Brain Res Mol Brain Res 67:10-17.

Kumawat K, Pathak SK, Spetz AL, Kundu M and Basu J (2010) Exogenous Nef Is an Inhibitor

of Mycobacterium Tuberculosis-Induced Tumor Necrosis Factor-Alpha Production and

Macrophage Apoptosis. J Biol Chem 285(17):12629-12637.

Kusuhara H and Sugiyama Y (2005) Active Efflux Across the Blood-Brain Barrier: Role of the

Solute Carrier Family. NeuroRx 2:73-85.

Kyosseva SV (2004) Mitogen-Activated Protein Kinase Signaling. Int Rev Neurobiol 59:201-

20.:201-220.

Kyriakis JM and Avruch J (2001) Mammalian Mitogen-Activated Protein Kinase Signal

Transduction Pathways Activated by Stress and Inflammation. Physiol Rev 81(2):807-869.

Page 216: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

197

Lai L and Tan TM (2002) Role of Glutathione in the Multidrug Resistance Protein 4

(MRP4/ABCC4)-Mediated Efflux of CAMP and Resistance to Purine Analogues. Biochem J

361:497-503.

Lalezari J, Gathe J, Brinson C, Thompson M, Cohen C, Dejesus E, Galindez J, Ernst JA, Martin

DE and Palleja SM (2011) Safety, Efficacy, and Pharmacokinetics of TBR-652, a CCR5/CCR2

Antagonist, in HIV-1-Infected, Treatment-Experienced, CCR5 Antagonist-Naive Subjects. J

Acquir Immune Defic Syndr 57(2):118-125.

Langford D, Grigorian A, Hurford R, Adame A, Ellis RJ, Hansen L and Masliah E (2004)

Altered P-Glycoprotein Expression in AIDS Patients With HIV Encephalitis. J Neuropathol Exp

Neurol 63:1038-1047.

Lannuzel A, Barnier JV, Hery C, Huynh VT, Guibert B, Gray F, Vincent JD and Tardieu M

(1997) Human Immunodeficiency Virus Type 1 and Its Coat Protein Gp120 Induce Apoptosis

and Activate JNK and ERK Mitogen-Activated Protein Kinases in Human Neurons. Ann Neurol

42(6):847-856.

Lazarowski A, Ramos AJ, Garcia-Rivello H, Brusco A and Girardi E (2004) Neuronal and Glial

Expression of the Multidrug Resistance Gene Product in an Experimental Epilepsy Model. Cell

Mol Neurobiol 24(1):77-85.

Lee CG, Gottesman MM, Cardarelli CO, Ramachandra M, Jeang KT, Ambudkar SV, Pastan I

and Dey S (1998) HIV-1 Protease Inhibitors Are Substrates for the MDR1 Multidrug

Transporter. Biochemistry 37:3594-3601.

Lee EO, Kim SE, Park HK, Kang JL and Chong YH (2011) Extracellular HIV-1 Tat Upregulates

TNF-Alpha Dependent MCP-1/CCL2 Production Via Activation of ERK1/2 Pathway in Rat

Hippocampal Slice Cultures: Inhibition by Resveratrol, a Polyphenolic Phytostilbene. Exp

Neurol 229(2):399-408.

Lee G, Babakhanian K, Ramaswamy M, Prat A, Wosik K and Bendayan R (2007) Expression of

the ATP-Binding Cassette Membrane Transporter, ABCG2, in Human and Rodent Brain

Microvessel Endothelial and Glial Cell Culture Systems. Pharm Res 24:1262-1274.

Lee G, Dallas S, Hong M and Bendayan R (2001a) Drug Transporters in the Central Nervous

System: Brain Barriers and Brain Parenchyma Considerations. Pharmacol Rev 53:569-596.

Lee G and Piquette-Miller M (2001) Influence of IL-6 on MDR and MRP-Mediated Multidrug

Resistance in Human Hepatoma Cells. Can J Physiol Pharmacol 79:876-884.

Lee G and Piquette-Miller M (2003) Cytokines Alter the Expression and Activity of the

Multidrug Resistance Transporters in Human Hepatoma Cell Lines; Analysis Using RT-PCR and

CDNA Microarrays. J Pharm Sci 92(11):2152-2163.

Lee G, Schlichter L, Bendayan M and Bendayan R (2001b) Functional Expression of P-

Glycoprotein in Rat Brain Microglia. J Pharmacol Exp Ther 299:204-212.

Page 217: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

198

Lee JC, Kumar S, Griswold DE, Underwood DC, Votta BJ and Adams JL (2000) Inhibition of

P38 MAP Kinase As a Therapeutic Strategy. Immunopharmacology 47:185-201.

Lee SC, Liu W, Dickson DW, Brosnan CF and Berman JW (1993) Cytokine Production by

Human Fetal Microglia and Astrocytes. Differential Induction by Lipopolysaccharide and IL-1

Beta. J Immunol 150:2659-2667.

Leggas M, Adachi M, Scheffer GL, Sun D, Wielinga P, Du G, Mercer KE, Zhuang Y, Panetta

JC, Johnston B, Scheper RJ, Stewart CF and Schuetz JD (2004) Mrp4 Confers Resistance to

Topotecan and Protects the Brain From Chemotherapy. Mol Cell Biol 24:7612-7621.

Leghmari K, Contreras X, Moureau C and Bahraoui E (2008) HIV-1 Tat Protein Induces TNF-

Alpha and IL-10 Production by Human Macrophages: Differential Implication of PKC-BetaII

and -Delta Isozymes and MAP Kinases ERK1/2 and P38. Cell Immunol 254:46-55.

Leier I, Jedlitschky G, Buchholz U, Center M, Cole SP, Deeley RG and Keppler D (1996) ATP-

Dependent Glutathione Disulphide Transport Mediated by the MRP Gene-Encoded Conjugate

Export Pump. Biochem J 314:433-437.

Leslie EM, Deeley RG and Cole SP (2001) Toxicological Relevance of the Multidrug Resistance

Protein 1, MRP1 (ABCC1) and Related Transporters. Toxicology 167:3-23.

Leslie EM, Deeley RG and Cole SP (2005) Multidrug Resistance Proteins: Role of P-

Glycoprotein, MRP1, MRP2, and BCRP (ABCG2) in Tissue Defense. Toxicol Appl Pharmacol

204:216-237.

Letendre S, Marquie-Beck J, Capparelli E, Best B, Clifford D, Collier AC, Gelman BB,

McArthur JC, McCutchan JA, Morgello S, Simpson D, Grant I and Ellis RJ (2008) Validation of

the CNS Penetration-Effectiveness Rank for Quantifying Antiretroviral Penetration into the

Central Nervous System. Arch Neurol 65:65-70.

Letendre SL, Ellis RJ, Ances BM and McCutchan JA (2010) Neurologic Complications of HIV

Disease and Their Treatment. Top HIV Med 18:45-55.

Li B, Mahmood A, Lu D, Wu H, Xiong Y, Qu C and Chopp M (2009) Simvastatin Attenuates

Microglial Cells and Astrocyte Activation and Decreases Interleukin-1beta Level After

Traumatic Brain Injury. Neurosurgery 65:179-185.

Li J, Bentsman G, Potash MJ and Volsky DJ (2007) Human Immunodeficiency Virus Type 1

Efficiently Binds to Human Fetal Astrocytes and Induces Neuroinflammatory Responses

Independent of Infection. BMC Neurosci 8:31.

Lickteig AJ, Slitt AL, Arkan MC, Karin M and Cherrington NJ (2007) Differential Regulation of

Hepatic Transporters in the Absence of Tumor Necrosis Factor-Alpha, Interleukin-1beta,

Interleukin-6, and Nuclear Factor-KappaB in Two Models of Cholestasis. Drug Metab Dispos

35(3):402-409.

Page 218: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

199

Lim CS, Jin DQ, Mok H, Oh SJ, Lee JU, Hwang JK, Ha I and Han JS (2005) Antioxidant and

Antiinflammatory Activities of Xanthorrhizol in Hippocampal Neurons and Primary Cultured

Microglia. J Neurosci Res 82:831-838.

Lin YZ, Yao SY, Veach RA, Torgerson TR and Hawiger J (1995) Inhibition of Nuclear

Translocation of Transcription Factor NF-Kappa B by a Synthetic Peptide Containing a Cell

Membrane-Permeable Motif and Nuclear Localization Sequence. J Biol Chem 270(24):14255-

14258.

Lindl KA, Marks DR, Kolson DL and Jordan-Sciutto KL (2010) HIV-Associated

Neurocognitive Disorder: Pathogenesis and Therapeutic Opportunities. J Neuroimmune

Pharmacol 5(3):294-309.

Liu J and Lin A (2007) Wiring the Cell Signaling Circuitry by the NF-Kappa B and JNK1

Crosstalk and Its Applications in Human Diseases. Oncogene 26:3267-3278.

Liu R, Paxton WA, Choe S, Ceradini D, Martin SR, Horuk R, MacDonald ME, Stuhlmann H,

Koup RA and Landau NR (1996) Homozygous Defect in HIV-1 Coreceptor Accounts for

Resistance of Some Multiply-Exposed Individuals to HIV-1 Infection. Cell 86(3):367-377.

Liu Y, Liu H, Kim BO, Gattone VH, Li J, Nath A, Blum J and He JJ (2004) CD4-Independent

Infection of Astrocytes by Human Immunodeficiency Virus Type 1: Requirement for the Human

Mannose Receptor. J Virol 78:4120-4133.

Liu Z, Shan M, Li L, Lu L, Meng S, Chen C, He Y, Jiang S and Zhang L (2011) In Vitro

Selection and Characterization of HIV-1 Variants With Increased Resistance to Sifuvirtide, a

Novel HIV-1 Fusion Inhibitor. J Biol Chem 286(5):3277-3287.

Loe DW, Deeley RG and Cole SP (1998) Characterization of Vincristine Transport by the M(r)

190,000 Multidrug Resistance Protein (MRP): Evidence for Cotransport With Reduced

Glutathione. Cancer Res 58:5130-5136.

Loo TW and Clarke DM (2005) Recent Progress in Understanding the Mechanism of P-

Glycoprotein-Mediated Drug Efflux. J Membr Biol 206:173-185.

Louboutin JP, Reyes BA, Agrawal L, Maxwell CR, Van Bockstaele EJ and Strayer DS (2010a)

Blood-Brain Barrier Abnormalities Caused by Exposure to HIV-1 Gp120--Protection by Gene

Delivery of Antioxidant Enzymes. Neurobiol Dis 38(2):313-325.

Louboutin JP, Reyes BA, Agrawal L, Van Bockstaele EJ and Strayer DS (2010b) HIV-1 Gp120-

Induced Neuroinflammation: Relationship to Neuron Loss and Protection by RSV40-Delivered

Antioxidant Enzymes. Exp Neurol 221:231-245.

Ma JP, Xia HJ, Zhang GH, Han JB, Zhang LG and Zheng YT (2012) Inhibitory Effects of

Chloroquine on the Activation of Plasmacytoid Dendritic Cells in SIVmac239-Infected Chinese

Rhesus Macaques. Cell Mol Immunol 9(5):410-416.

Page 219: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

200

Mahlknecht U, Dichamp I, Varin A, Van LC and Herbein G (2008) NF-KappaB-Dependent

Control of HIV-1 Transcription by the Second Coding Exon of Tat in T Cells. J Leukoc Biol

83:718-727.

Maingat F, Vivithanaporn P, Zhu Y, Taylor A, Baker G, Pearson K and Power C (2009)

Neurobehavioral Performance in Feline Immunodeficiency Virus Infection: Integrated Analysis

of Viral Burden, Neuroinflammation, and Neuronal Injury in Cortex. J Neurosci 29(26):8429-

8437.

Maingat FG, Polyak MJ, Paul AM, Vivithanaporn P, Noorbakhsh F, Ahboucha S, Baker GB,

Pearson K and Power C (2013) Neurosteroid-Mediated Regulation of Brain Innate Immunity in

HIV/AIDS: DHEA-S Suppresses Neurovirulence. FASEB J 27(2):725-737.

Mallants R, Van OK, Van VL, Mols R, De CE and Augustijns P (2005) Multidrug Resistance-

Associated Protein 2 (MRP2) Affects Hepatobiliary Elimination but Not the Intestinal

Disposition of Tenofovir Disoproxil Fumarate and Its Metabolites. Xenobiotica 35:1055-1066.

Mangino G, Serra V, Borghi P, Percario ZA, Horenkamp FA, Geyer M and Affabris E (2012)

Exogenous Nef Induces Proinflammatory Signaling Events in Murine Macrophages. Viral

Immunol 25(2):117-130.

Mao Q and Unadkat JD (2005) Role of the Breast Cancer Resistance Protein (ABCG2) in Drug

Transport. AAPS J 7:E118-E133.

Marier JF, Trinh M, Pheng LH, Palleja SM and Martin DE (2011) Pharmacokinetics and

Pharmacodynamics of TBR-652, a Novel CCR5 Antagonist, in HIV-1-Infected, Antiretroviral

Treatment-Experienced, CCR5 Antagonist-Naive Patients. Antimicrob Agents Chemother

55(6):2768-2774.

Marino F, Maresca AM, Castiglioni L, Cosentino M, Maio RC, Schembri L, Klersy C,

Mongiardi C, Robustelli TL, Grandi AM and Guasti L (2014) Simvastatin Down-Regulates the

Production of Interleukin-8 by Neutrophil Leukocytes From Dyslipidemic Patients. BMC

Cardiovasc Disord 14:37-14.

Marker DF, Tremblay ME, Puccini JM, Barbieri J, Gantz Marker MA, Loweth CJ, Muly EC, Lu

SM, Goodfellow VS, Dewhurst S and Gelbard HA (2013) The New Small-Molecule Mixed-

Lineage Kinase 3 Inhibitor URMC-099 Is Neuroprotective and Anti-Inflammatory in Models of

Human Immunodeficiency Virus-Associated Neurocognitive Disorders. J Neurosci 33(24):9998-

10010.

Maroney AC, Glicksman MA, Basma AN, Walton KM, Knight E Jr, Murphy CA, Bartlett BA,

Finn JP, Angeles T, Matsuda Y, Neff NT and Dionne CA (1998) Motoneuron Apoptosis Is

Blocked by CEP-1347 (KT 7515), a Novel Inhibitor of the JNK Signaling Pathway. J Neurosci

18(1):104-111.

Marra CM, Zhao Y, Clifford DB, Letendre S, Evans S, Henry K, Ellis RJ, Rodriguez B, Coombs

RW, Schifitto G, McArthur JC and Robertson K (2009) Impact of Combination Antiretroviral

Page 220: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

201

Therapy on Cerebrospinal Fluid HIV RNA and Neurocognitive Performance. AIDS 23:1359-

1366.

Martinson JA, Montoya CJ, Usuga X, Ronquillo R, Landay AL and Desai SN (2010)

Chloroquine Modulates HIV-1-Induced Plasmacytoid Dendritic Cell Alpha Interferon:

Implication for T-Cell Activation. Antimicrob Agents Chemother 54(2):871-881.

McArthur JC, Haughey N, Gartner S, Conant K, Pardo C, Nath A and Sacktor N (2003) Human

Immunodeficiency Virus-Associated Dementia: an Evolving Disease. J Neurovirol 9(2):205-221.

McCombe JA, Vivithanaporn P, Gill MJ and Power C (2013) Predictors of Symptomatic HIV-

Associated Neurocognitive Disorders in Universal Health Care. HIV Med 14(2):99-107.

Meaden ER, Hoggard PG, Maher B, Khoo SH and Back DJ (2001) Expression of P-

Glycoprotein and Multidrug Resistance-Associated Protein in Healthy Volunteers and HIV-

Infected Patients. AIDS Res Hum Retroviruses 20;17(14):1329-1332.

Medders KE and Kaul M (2011) Mitogen-Activated Protein Kinase P38 in HIV Infection and

Associated Brain Injury. J Neuroimmune Pharmacol 6:202-215.

Meng B and Lever AM (2013) Wrapping Up the Bad News: HIV Assembly and Release.

Retrovirology 10:5-10.

Merino G, Alvarez AI, Pulido MM, Molina AJ, Schinkel AH and Prieto JG (2006) Breast Cancer

Resistance Protein (BCRP/ABCG2) Transports Fluoroquinolone Antibiotics and Affects Their

Oral Availability, Pharmacokinetics, and Milk Secretion. Drug Metab Dispos 34:690-695.

Meulendyke KA, Pletnikov MV, Engle EL, Tarwater PM, Graham DR and Zink MC (2012)

Early Minocycline Treatment Prevents a Decrease in Striatal Dopamine in an SIV Model of

HIV-Associated Neurological Disease. J Neuroimmune Pharmacol 7(2):454-464.

Meyer J, Rauh J and Galla HJ (1991) The Susceptibility of Cerebral Endothelial Cells to

Astroglial Induction of Blood-Brain Barrier Enzymes Depends on Their Proliferative State. J

Neurochem 57:1971-1977.

Miao ZH and Ding J (2003) Transcription Factor C-Jun Activation Represses Mdr-1 Gene

Expression. Cancer Res 63:4527-4532.

Mielke K and Herdegen T (2000) JNK and P38 Stresskinases--Degenerative Effectors of Signal-

Transduction-Cascades in the Nervous System. Prog Neurobiol 61:45-60.

Miller C, Bielefeldt-Ohmann H, MacMillan M, Huitron-Resendiz S, Henriksen S, Elder J and

VandeWoude S (2011) Strain-Specific Viral Distribution and Neuropathology of Feline

Immunodeficiency Virus. Vet Immunol Immunopathol 143(3-4):282-291.

Miller DS (2010) Regulation of P-Glycoprotein and Other ABC Drug Transporters at the Blood-

Brain Barrier. Trends Pharmacol Sci 31:246-254.

Page 221: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

202

Miller DS, Bauer B and Hartz AM (2008) Modulation of P-Glycoprotein at the Blood-Brain

Barrier: Opportunities to Improve Central Nervous System Pharmacotherapy. Pharmacol Rev

60:196-209.

Miller DS, Nobmann SN, Gutmann H, Toeroek M, Drewe J and Fricker G (2000) Xenobiotic

Transport Across Isolated Brain Microvessels Studied by Confocal Microscopy. Mol Pharmacol

58:1357-1367.

Mingyan Y, Xinyong L and De CE (2009) NF-KappaB: the Inducible Factors of HIV-1

Transcription and Their Inhibitors. Mini Rev Med Chem 9:60-69.

Minich T, Riemer J, Schulz JB, Wielinga P, Wijnholds J and Dringen R (2006) The Multidrug

Resistance Protein 1 (Mrp1), but Not Mrp5, Mediates Export of Glutathione and Glutathione

Disulfide From Brain Astrocytes. J Neurochem 97:373-384.

Mishra S, Mishra JP and Kumar A (2007) Activation of JNK-Dependent Pathway Is Required

for HIV Viral Protein R-Induced Apoptosis in Human Monocytic Cells: Involvement of

Antiapoptotic BCL2 and C-IAP1 Genes. J Biol Chem 282(7):4288-4300.

Mitomo H, Kato R, Ito A, Kasamatsu S, Ikegami Y, Kii I, Kudo A, Kobatake E, Sumino Y and

Ishikawa T (2003) A Functional Study on Polymorphism of the ATP-Binding Cassette

Transporter ABCG2: Critical Role of Arginine-482 in Methotrexate Transport. Biochem J

373:767-774.

Mitsuya H, Weinhold KJ, Furman PA, St Clair MH, Lehrman SN, Gallo RC, Bolognesi D, Barry

DW and Broder S (1985) 3'-Azido-3'-Deoxythymidine (BW A509U): an Antiviral Agent That

Inhibits the Infectivity and Cytopathic Effect of Human T-Lymphotropic Virus Type

III/Lymphadenopathy-Associated Virus in Vitro. Proc Natl Acad Sci U S A 82(20):7096-7100.

Morris SR, Woods SP, Deutsch R, Little SJ, Wagner G, Morgan EE, Heaton RK, Letendre SL,

Grant I and Smith DM (2013) Dual-Mixed HIV-1 Coreceptor Tropism and HIV-Associated

Neurocognitive Deficits. J Neurovirol 19(5):488-494.

Moyle G (2007) Metabolic Issues Associated With Protease Inhibitors. J Acquir Immune Defic

Syndr 45 Suppl 1:S19-S26.

Munoz L, Ralay RH, Roy SM, Hu W, Craft JM, McNamara LK, Chico LW, Van Eldik LJ and

Watterson DM (2007) A Novel P38 Alpha MAPK Inhibitor Suppresses Brain Proinflammatory

Cytokine Up-Regulation and Attenuates Synaptic Dysfunction and Behavioral Deficits in an

Alzheimer's Disease Mouse Model. J Neuroinflammation 4:21.

Muredda M, Nunoya K, Burtch-Wright RA, Kurz EU, Cole SP and Deeley RG (2003) Cloning

and Characterization of the Murine and Rat Mrp1 Promoter Regions. Mol Pharmacol

64(5):1259-1269.

Murray SM, Down CM, Boulware DR, Stauffer WM, Cavert WP, Schacker TW, Brenchley JM

and Douek DC (2010) Reduction of Immune Activation With Chloroquine Therapy During

Chronic HIV Infection. J Virol 84:12082-12086.

Page 222: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

203

Muthumani K, Wadsworth SA, Dayes NS, Hwang DS, Choo AY, Abeysinghe HR, Siekierka JJ

and Weiner DB (2004) Suppression of HIV-1 Viral Replication and Cellular Pathogenesis by a

Novel P38/JNK Kinase Inhibitor. AIDS 18(5):739-748.

Naarding MA, Baan E, Pollakis G and Paxton WA (2007) Effect of Chloroquine on Reducing

HIV-1 Replication in Vitro and the DC-SIGN Mediated Transfer of Virus to CD4+ T-

Lymphocytes. Retrovirology 4:6.

Nabatov AA, Pollakis G, Linnemann T, Paxton WA and de Baar MP (2007) Statins Disrupt

CCR5 and RANTES Expression Levels in CD4(+) T Lymphocytes in Vitro and Preferentially

Decrease Infection of R5 Versus X4 HIV-1. PLoS One 2:e470.

Nabel G and Baltimore D (1987) An Inducible Transcription Factor Activates Expression of

Human Immunodeficiency Virus in T Cells. Nature 326:711-713.

Nair S, Hebbar V, Shen G, Gopalakrishnan A, Khor TO, Yu S, Xu C and Kong AN (2008)

Synergistic Effects of a Combination of Dietary Factors Sulforaphane and (-) Epigallocatechin-

3-Gallate in HT-29 AP-1 Human Colon Carcinoma Cells. Pharm Res 25(2):387-399.

Nakamuta S, Endo H, Higashi Y, Kousaka A, Yamada H, Yano M and Kido H (2008) Human

Immunodeficiency Virus Type 1 Gp120-Mediated Disruption of Tight Junction Proteins by

Induction of Proteasome-Mediated Degradation of Zonula Occludens-1 and -2 in Human Brain

Microvascular Endothelial Cells. J Neurovirol 14:186-195.

Nakasujja N, Miyahara S, Evans S, Lee A, Musisi S, Katabira E, Robertson K, Ronald A,

Clifford DB and Sacktor N (2013) Randomized Trial of Minocycline in the Treatment of HIV-

Associated Cognitive Impairment. Neurology 80(2):196-202.

Nettles RE, Schurmann D, Zhu L, Stonier M, Huang SP, Chang I, Chien C, Krystal M, Wind-

Rotolo M, Ray N, Hanna GJ, Bertz R and Grasela D (2012) Pharmacodynamics, Safety, and

Pharmacokinetics of BMS-663068, an Oral HIV-1 Attachment Inhibitor in HIV-1-Infected

Subjects. J Infect Dis 206(7):1002-1011.

Neuwelt EA, Bauer B, Fahlke C, Fricker G, Iadecola C, Janigro D, Leybaert L, Molnar Z,

O'Donnell ME, Povlishock JT, Saunders NR, Sharp F, Stanimirovic D, Watts RJ and Drewes LR

(2011) Engaging Neuroscience to Advance Translational Research in Brain Barrier Biology. Nat

Rev Neurosci 12:169-182.

Nichols WG, Steel HM, Bonny T, Adkison K, Curtis L, Millard J, Kabeya K and Clumeck N

(2008) Hepatotoxicity Observed in Clinical Trials of Aplaviroc (GW873140). Antimicrob Agents

Chemother 52(3):858-865.

Nicolazzo JA, Charman SA and Charman WN (2006) Methods to Assess Drug Permeability

Across the Blood-Brain Barrier. J Pharm Pharmacol 58:281-293.

Nies AT, Jedlitschky G, Konig J, Herold-Mende C, Steiner HH, Schmitt HP and Keppler D

(2004) Expression and Immunolocalization of the Multidrug Resistance Proteins, MRP1-MRP6

(ABCC1-ABCC6), in Human Brain. Neuroscience 129:349-360.

Page 223: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

204

Nikodemova M, Duncan ID and Watters JJ (2006) Minocycline Exerts Inhibitory Effects on

Multiple Mitogen-Activated Protein Kinases and IkappaBalpha Degradation in a Stimulus-

Specific Manner in Microglia. J Neurochem 96(2):314-323.

Nolting T, Lindecke A, Hartung HP, Koutsilieri E, Maschke M, Husstedt IW, Sopper S, Stuve O

and Arendt G (2012) Cytokine Levels in CSF and Neuropsychological Performance in HIV

Patients. J Neurovirol 18(3):157-161.

Nosheny RL, Bachis A, Acquas E and Mocchetti I (2004) Human Immunodeficiency Virus Type

1 Glycoprotein Gp120 Reduces the Levels of Brain-Derived Neurotrophic Factor in Vivo:

Potential Implication for Neuronal Cell Death. Eur J Neurosci 20:2857-2864.

Ogura J, Kobayashi M, Itagaki S, Hirano T and Iseki K (2008) Alteration of Mrp2 and P-Gp

Expression, Including Expression in Remote Organs, After Intestinal Ischemia-Reperfusion. Life

Sci 20;82:1242-1248.

Oguri T, Bessho Y, Achiwa H, Ozasa H, Maeno K, Maeda H, Sato S and Ueda R (2007)

MRP8/ABCC11 Directly Confers Resistance to 5-Fluorouracil. Mol Cancer Ther 6:122-127.

Oh SK, Cruikshank WW, Raina J, Blanchard GC, Adler WH, Walker J and Kornfeld H (1992)

Identification of HIV-1 Envelope Glycoprotein in the Serum of AIDS and ARC Patients. J

Acquir Immune Defic Syndr 5:251-256.

Orsucci D, Calsolaro V, Mancuso M and Siciliano G (2009) Neuroprotective Effects of

Tetracyclines: Molecular Targets, Animal Models and Human Disease. CNS Neurol Disord

Drug Targets 8:222-231.

Ott M, Fricker G and Bauer B (2009) Pregnane X Receptor (PXR) Regulates P-Glycoprotein at

the Blood-Brain Barrier: Functional Similarities Between Pig and Human PXR. J Pharmacol

Exp Ther 329:141-149.

Pace CS, Fordyce MW, Franco D, Kao CY, Seaman MS and Ho DD (2013) Anti-CD4

Monoclonal Antibody Ibalizumab Exhibits Breadth and Potency Against HIV-1, With Natural

Resistance Mediated by the Loss of a V5 Glycan in Envelope. J Acquir Immune Defic Syndr

62(1):1-9.

Pan W, Yu C, Hsuchou H and Kastin AJ (2010) The Role of Cerebral Vascular NFkappaB in

LPS-Induced Inflammation: Differential Regulation of Efflux Transporter and Transporting

Cytokine Receptors. Cell Physiol Biochem 25:623-630.

Pan XD, Chen XC, Zhu YG, Zhang J, Huang TW, Chen LM, Ye QY and Huang HP (2008)

Neuroprotective Role of Tripchlorolide on Inflammatory Neurotoxicity Induced by

Lipopolysaccharide-Activated Microglia. Biochem Pharmacol 76:362-372.

Pardridge WM (1999) Blood-Brain Barrier Biology and Methodology. J Neurovirol 5:556-569.

Pardridge WM (2012) Drug Transport Across the Blood-Brain Barrier. J Cereb Blood Flow

Metab 32(11):1959-1972.

Page 224: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

205

Pardridge WM, Golden PL, Kang YS and Bickel U (1997) Brain Microvascular and Astrocyte

Localization of P-Glycoprotein. J Neurochem 68:1278-1285.

Paton NI, Goodall RL, Dunn DT, Franzen S, Collaco-Moraes Y, Gazzard BG, Williams IG,

Fisher MJ, Winston A, Fox J, Orkin C, Herieka EA, Ainsworth JG, Post FA, Wansbrough-Jones

M and Kelleher P (2012) Effects of Hydroxychloroquine on Immune Activation and Disease

Progression Among HIV-Infected Patients Not Receiving Antiretroviral Therapy: a Randomized

Controlled Trial. JAMA 308(4):353-361.

Pawate S and Bhat NR (2006) C-Jun N-Terminal Kinase (JNK) Regulation of INOS Expression

in Glial Cells: Predominant Role of JNK1 Isoform. Antioxid Redox Signal 8:903-909.

Paxinos G and Watson C (2006) The Rat Brain in Stereotaxic Coordinates. Academic press,

Sydney.

Pearson G, Robinson F, Beers GT, Xu BE, Karandikar M, Berman K and Cobb MH (2001)

Mitogen-Activated Protein (MAP) Kinase Pathways: Regulation and Physiological Functions.

Endocr Rev 22:153-183.

Perloff ES, Duan SX, Skolnik PR, Greenblatt DJ and von Moltke LL (2005) Atazanavir: Effects

on P-Glycoprotein Transport and CYP3A Metabolism in Vitro. Drug Metab Dispos 33(6):764-

770.

Perrella O, Carrieri PB, Guarnaccia D and Soscia M (1992) Cerebrospinal Fluid Cytokines in

AIDS Dementia Complex. J Neurol 239(7):387-388.

Perry CM (2010) Maraviroc: a Review of Its Use in the Management of CCR5-Tropic HIV-1

Infection. Drugs 70(9):1189-1213.

Persidsky Y, Buttini M, Limoges J, Bock P and Gendelman HE (1997) An Analysis of HIV-1-

Associated Inflammatory Products in Brain Tissue of Humans and SCID Mice With HIV-1

Encephalitis. J Neurovirol 3:401-416.

Persidsky Y and Gendelman HE (2003) Mononuclear Phagocyte Immunity and the

Neuropathogenesis of HIV-1 Infection. J Leukoc Biol 74:691-701.

Persidsky Y, Ghorpade A, Rasmussen J, Limoges J, Liu XJ, Stins M, Fiala M, Way D, Kim KS,

Witte MH, Weinand M, Carhart L and Gendelman HE (1999) Microglial and Astrocyte

Chemokines Regulate Monocyte Migration Through the Blood-Brain Barrier in Human

Immunodeficiency Virus-1 Encephalitis. Am J Pathol 155:1599-1611.

Persidsky Y, Heilman D, Haorah J, Zelivyanskaya M, Persidsky R, Weber GA, Shimokawa H,

Kaibuchi K and Ikezu T (2006a) Rho-Mediated Regulation of Tight Junctions During Monocyte

Migration Across the Blood-Brain Barrier in HIV-1 Encephalitis (HIVE). Blood 107:4770-4780.

Persidsky Y, Limoges J, McComb R, Bock P, Baldwin T, Tyor W, Patil A, Nottet HS, Epstein L,

Gelbard H, Flanagan E, Reinhard J, Pirruccello SJ and Gendelman HE (1996) Human

Immunodeficiency Virus Encephalitis in SCID Mice. Am J Pathol 149:1027-1053.

Page 225: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

206

Persidsky Y, Ramirez SH, Haorah J and Kanmogne GD (2006b) Blood-Brain Barrier: Structural

Components and Function Under Physiologic and Pathologic Conditions. J Neuroimmune

Pharmacol 1:223-236.

Persidsky Y, Zheng J, Miller D and Gendelman HE (2000) Mononuclear Phagocytes Mediate

Blood-Brain Barrier Compromise and Neuronal Injury During HIV-1-Associated Dementia. J

Leukoc Biol 68(3):413-422.

Petry H and Luke W (1997) Infection of Macaque Monkeys With Simian Immunodeficiency

Virus: an Animal Model for Neuro-AIDS. Intervirology 40:112-121.

Piacenti FJ (2006) An Update and Review of Antiretroviral Therapy. Pharmacotherapy 26:1111-

1133.

Pistell PJ, Gupta S, Knight AG, Domingue M, Uranga RM, Ingram DK, Kheterpal I, Ruiz C,

Keller JN and Bruce-Keller AJ (2010) Metabolic and Neurologic Consequences of Chronic

Lopinavir/Ritonavir Administration to C57BL/6 Mice. Antiviral Res 88:334-342.

Poller B, Drewe J, Krahenbuhl S, Huwyler J and Gutmann H (2010) Regulation of BCRP

(ABCG2) and P-Glycoprotein (ABCB1) by Cytokines in a Model of the Human Blood-Brain

Barrier. Cell Mol Neurobiol 30:63-70.

Poller B, Gutmann H, Krahenbuhl S, Weksler B, Romero I, Couraud PO, Tuffin G, Drewe J and

Huwyler J (2008) The Human Brain Endothelial Cell Line HCMEC/D3 As a Human Blood-

Brain Barrier Model for Drug Transport Studies. J Neurochem 107:1358-1368.

Popik W and Pitha PM (1996) Binding of Human Immunodeficiency Virus Type 1 to CD4

Induces Association of Lck and Raf-1 and Activates Raf-1 by a Ras-Independent Pathway. Mol

Cell Biol 16(11):6532-6541.

Popovic M, Sarngadharan MG, Read E and Gallo RC (1984) Detection, Isolation, and

Continuous Production of Cytopathic Retroviruses (HTLV-III) From Patients With AIDS and

Pre-AIDS. Science 224:497-500.

Potschka H, Fedrowitz M and Loscher W (2003) Multidrug Resistance Protein MRP2

Contributes to Blood-Brain Barrier Function and Restricts Antiepileptic Drug Activity. J

Pharmacol Exp Ther 306:124-131.

Potula R, Poluektova L, Knipe B, Chrastil J, Heilman D, Dou H, Takikawa O, Munn DH,

Gendelman HE and Persidsky Y (2005) Inhibition of Indoleamine 2,3-Dioxygenase (IDO)

Enhances Elimination of Virus-Infected Macrophages in an Animal Model of HIV-1

Encephalitis. Blood 106:2382-2390.

Potula R, Ramirez SH, Knipe B, Leibhart J, Schall K, Heilman D, Morsey B, Mercer A,

Papugani A, Dou H and Persidsky Y (2008) Peroxisome Proliferator-Activated Receptor-

Gamma Activation Suppresses HIV-1 Replication in an Animal Model of Encephalitis. AIDS

20;22:1539-1549.

Page 226: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

207

Power C, Boisse L, Rourke S and Gill MJ (2009) NeuroAIDS: an Evolving Epidemic. Can J

Neurol Sci 36:285-295.

Pu H, Tian J, Flora G, Lee YW, Nath A, Hennig B and Toborek M (2003) HIV-1 Tat Protein

Upregulates Inflammatory Mediators and Induces Monocyte Invasion into the Brain. Mol Cell

Neurosci 24:224-237.

Pyo H, Jou I, Jung S, Hong S and Joe EH (1998) Mitogen-Activated Protein Kinases Activated

by Lipopolysaccharide and Beta-Amyloid in Cultured Rat Microglia. Neuroreport 9:871-874.

Rao VV, Dahlheimer JL, Bardgett ME, Snyder AZ, Finch RA, Sartorelli AC and Piwnica-

Worms D (1999) Choroid Plexus Epithelial Expression of MDR1 P Glycoprotein and Multidrug

Resistance-Associated Protein Contribute to the Blood-Cerebrospinal-Fluid Drug-Permeability

Barrier. Proc Natl Acad Sci U S A 96:3900-3905.

Rappa G, Lorico A, Flavell RA and Sartorelli AC (1997) Evidence That the Multidrug

Resistance Protein (MRP) Functions As a Co-Transporter of Glutathione and Natural Product

Toxins. Cancer Res 57:5232-5237.

Ratai EM, Bombardier JP, Joo CG, Annamalai L, Burdo TH, Campbell J, Fell R, Hakimelahi R,

He J, Autissier P, Lentz MR, Halpern EF, Masliah E, Williams KC, Westmoreland SV and

Gonzalez RG (2010) Proton Magnetic Resonance Spectroscopy Reveals Neuroprotection by Oral

Minocycline in a Nonhuman Primate Model of Accelerated NeuroAIDS. PLoS One 5(5):e10523.

Rausch DM, Murray EA and Eiden LE (1999) The SIV-Infected Rhesus Monkey Model for

HIV-Associated Dementia and Implications for Neurological Diseases. J Leukoc Biol 65:466-

474.

Ray AS, Cihlar T, Robinson KL, Tong L, Vela JE, Fuller MD, Wieman LM, Eisenberg EJ and

Rhodes GR (2006) Mechanism of Active Renal Tubular Efflux of Tenofovir. Antimicrob Agents

Chemother 50(10):3297-3304.

Reese TS and Karnovsky MJ (1967) Fine Structural Localization of a Blood-Brain Barrier to

Exogenous Peroxidase. J Cell Biol 34:207-217.

Regis EG, Barreto-de-Souza V, Morgado MG, Bozza MT, Leng L, Bucala R and Bou-Habib DC

(2010) Elevated Levels of Macrophage Migration Inhibitory Factor (MIF) in the Plasma of HIV-

1-Infected Patients and in HIV-1-Infected Cell Cultures: a Relevant Role on Viral Replication.

Virology 399(1):31-38.

Reid G, Wielinga P, Zelcer N, De HM, Van DL, Wijnholds J, Balzarini J and Borst P (2003)

Characterization of the Transport of Nucleoside Analog Drugs by the Human Multidrug

Resistance Proteins MRP4 and MRP5. Mol Pharmacol 63(5):1094-1103.

Reid W, Sadowska M, Denaro F, Rao S, Foulke J, Jr., Hayes N, Jones O, Doodnauth D, Davis H,

Sill A, O'Driscoll P, Huso D, Fouts T, Lewis G, Hill M, Kamin-Lewis R, Wei C, Ray P, Gallo

RC, Reitz M and Bryant J (2001) An HIV-1 Transgenic Rat That Develops HIV-Related

Pathology and Immunologic Dysfunction. Proc Natl Acad Sci U S A 98:9271-9276.

Page 227: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

208

Ricardo-Dukelow M, Kadiu I, Rozek W, Schlautman J, Persidsky Y, Ciborowski P, Kanmogne

GD and Gendelman HE (2007) HIV-1 Infected Monocyte-Derived Macrophages Affect the

Human Brain Microvascular Endothelial Cell Proteome: New Insights into Blood-Brain Barrier

Dysfunction for HIV-1-Associated Dementia. J Neuroimmunol 185:37-46.

Ries M, Pritschet K and Schmidt B (2012) Blocking Type I Interferon Production: a New

Therapeutic Option to Reduce the HIV-1-Induced Immune Activation. Clin Dev Immunol

2012:534929.

Robbins RN, Brown H, Ehlers A, Joska JA, Thomas KG, Burgess R, Byrd D and Morgello S

(2014) A Smartphone App to Screen for HIV-Related Neurocognitive Impairment. J Mob

Technol Med 3(1):23-26.

Roberts LM, Black DS, Raman C, Woodford K, Zhou M, Haggerty JE, Yan AT, Cwirla SE and

Grindstaff KK (2008) Subcellular Localization of Transporters Along the Rat Blood-Brain

Barrier and Blood-Cerebral-Spinal Fluid Barrier by in Vivo Biotinylation. Neuroscience

155:423-438.

Robillard KR, Hoque MT and Bendayan R (2014) Expression of ATP-Binding Cassette

Membrane Transporters in a HIV-1 Transgenic Rat Model. Biochem Biophys Res Commun

444(4):531-536.

Ronaldson PT, Ashraf T and Bendayan R (2010) Regulation of Multidrug Resistance Protein 1

by Tumor Necrosis Factor Alpha in Cultured Glial Cells: Involvement of Nuclear Factor-

KappaB and C-Jun N-Terminal Kinase Signaling Pathways. Mol Pharmacol 77:644-659.

Ronaldson PT, Bendayan M, Gingras D, Piquette-Miller M and Bendayan R (2004a) Cellular

Localization and Functional Expression of P-Glycoprotein in Rat Astrocyte Cultures. J

Neurochem 89:788-800.

Ronaldson PT and Bendayan R (2006) HIV-1 Viral Envelope Glycoprotein Gp120 Triggers an

Inflammatory Response in Cultured Rat Astrocytes and Regulates the Functional Expression of

P-Glycoprotein. Mol Pharmacol 70:1087-1098.

Ronaldson PT and Bendayan R (2008) HIV-1 Viral Envelope Glycoprotein Gp120 Produces

Oxidative Stress and Regulates the Functional Expression of Multidrug Resistance Protein-1

(Mrp1) in Glial Cells. J Neurochem 106:1298-1313.

Ronaldson PT, Lee G, Dallas S and Bendayan R (2004b) Involvement of P-Glycoprotein in the

Transport of Saquinavir and Indinavir in Rat Brain Microvessel Endothelial and Microglia Cell

Lines. Pharm Res 21:811-818.

Ronaldson PT, Persidsky Y and Bendayan R (2008) Regulation of ABC Membrane Transporters

in Glial Cells: Relevance to the Pharmacotherapy of Brain HIV-1 Infection. Glia 56:1711-1735.

Rosenberg MF, Kamis AB, Callaghan R, Higgins CF and Ford RC (2003) Three-Dimensional

Structures of the Mammalian Multidrug Resistance P-Glycoprotein Demonstrate Major

Page 228: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

209

Conformational Changes in the Transmembrane Domains Upon Nucleotide Binding. J Biol

Chem 278:8294-8299.

Routy JP, Angel J, Patel M, Kanagaratham C, Radzioch D, Kema I, Gilmore N, Ancuta P, Singer

J and Jenabian MA (2014) Assessment of Chloroquine As a Modulator of Immune Activation to

Improve CD4 Recovery in Immune Nonresponding HIV-Infected Patients Receiving

Antiretroviral Therapy. HIV Med10.

Roy U, Bulot C, Honer zu BK and Mondal D (2013) Specific Increase in MDR1 Mediated Drug-

Efflux in Human Brain Endothelial Cells Following Co-Exposure to HIV-1 and Saquinavir.

PLoS One 8(10):e75374.

Ryu JK, Franciosi S, Sattayaprasert P, Kim SU and McLarnon JG (2004) Minocycline Inhibits

Neuronal Death and Glial Activation Induced by Beta-Amyloid Peptide in Rat Hippocampus.

Glia 48:85-90.

Ryu JK and McLarnon JG (2006) Minocycline or INOS Inhibition Block 3-Nitrotyrosine

Increases and Blood-Brain Barrier Leakiness in Amyloid Beta-Peptide-Injected Rat

Hippocampus. Exp Neurol 198:552-557.

Sabri F, Tresoldi E, Di SM, Polo S, Monaco MC, Verani A, Fiore JR, Lusso P, Major E, Chiodi

F and Scarlatti G (1999) Nonproductive Human Immunodeficiency Virus Type 1 Infection of

Human Fetal Astrocytes: Independence From CD4 and Major Chemokine Receptors. Virology

264:370-384.

Sacktor N, Haughey N, Cutler R, Tamara A, Turchan J, Pardo C, Vargas D and Nath A (2004)

Novel Markers of Oxidative Stress in Actively Progressive HIV Dementia. J Neuroimmunol

157(1-2):176-184.

Sacktor N, Miyahara S, Deng L, Evans S, Schifitto G, Cohen BA, Paul R, Robertson K, Jarocki

B, Scarsi K, Coombs RW, Zink MC, Nath A, Smith E, Ellis RJ, Singer E, Weihe J, McCarthy S,

Hosey L and Clifford DB (2011) Minocycline Treatment for HIV-Associated Cognitive

Impairment: Results From a Randomized Trial. Neurology 77:1135-1142.

Saha RN and Pahan K (2007) Differential Regulation of Mn-Superoxide Dismutase in Neurons

and Astroglia by HIV-1 Gp120: Implications for HIV-Associated Dementia. Free Radic Biol

Med 42:1866-1878.

Salama NN, Kelly EJ, Bui T and Ho RJ (2005) The Impact of Pharmacologic and Genetic

Knockout of P-Glycoprotein on Nelfinavir Levels in the Brain and Other Tissues in Mice. J

Pharm Sci 94:1216-1225.

Saporito MS, Hudkins RL and Maroney AC (2002) Discovery of CEP-1347/KT-7515, an

Inhibitor of the JNK/SAPK Pathway for the Treatment of Neurodegenerative Diseases. Prog

Med Chem 40:23-62.:23-62.

Sas AR, Bimonte-Nelson H, Smothers CT, Woodward J and Tyor WR (2009) Interferon-Alpha

Causes Neuronal Dysfunction in Encephalitis. J Neurosci 29(12):3948-3955.

Page 229: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

210

Sasseville VG and Lackner AA (1997) Neuropathogenesis of Simian Immunodeficiency Virus

Infection in Macaque Monkeys. J Neurovirol 3:1-9.

Saunders NR, Habgood MD and Dziegielewska KM (1999) Barrier Mechanisms in the Brain, I.

Adult Brain. Clin Exp Pharmacol Physiol 26:11-19.

Savarino A, Gennero L, Chen HC, Serrano D, Malavasi F, Boelaert JR and Sperber K (2001)

Anti-HIV Effects of Chloroquine: Mechanisms of Inhibition and Spectrum of Activity. AIDS

15:2221-2229.

Savarino A, Lucia MB, Rastrelli E, Rutella S, Golotta C, Morra E, Tamburrini E, Perno CF,

Boelaert JR, Sperber K and Cauda R (2004) Anti-HIV Effects of Chloroquine: Inhibition of

Viral Particle Glycosylation and Synergism With Protease Inhibitors. J Acquir Immune Defic

Syndr 35(3):223-232.

Scheffer GL, Kool M, Heijn M, de HM, Pijnenborg AC, Wijnholds J, van HA, de Jong MC,

Hooijberg JH, Mol CA, van der LM, de Vree JM, van d, V, Elferink RP, Borst P and Scheper RJ

(2000) Specific Detection of Multidrug Resistance Proteins MRP1, MRP2, MRP3, MRP5, and

MDR3 P-Glycoprotein With a Panel of Monoclonal Antibodies. Cancer Res 60:5269-5277.

Schindler JF, Monahan JB and Smith WG (2007) P38 Pathway Kinases As Anti-Inflammatory

Drug Targets. J Dent Res 86:800-811.

Schlichter LC, Sakellaropoulos G, Ballyk B, Pennefather PS and Phipps DJ (1996) Properties of

K+ and Cl- Channels and Their Involvement in Proliferation of Rat Microglial Cells. Glia

17:225-236.

Schmitz ML, Mattioli I, Buss H and Kracht M (2004) NF-KappaB: a Multifaceted Transcription

Factor Regulated at Several Levels. Chembiochem 5:1348-1358.

Schumann RR, Pfeil D, Freyer D, Buerger W, Lamping N, Kirschning CJ, Goebel UB and

Weber JR (1998) Lipopolysaccharide and Pneumococcal Cell Wall Components Activate the

Mitogen Activated Protein Kinases (MAPK) Erk-1, Erk-2, and P38 in Astrocytes. Glia 22:295-

305.

Schweinsburg BC, Taylor MJ, Alhassoon OM, Gonzalez R, Brown GG, Ellis RJ, Letendre S,

Videen JS, McCutchan JA, Patterson TL and Grant I (2005) Brain Mitochondrial Injury in

Human Immunodeficiency Virus-Seropositive (HIV+) Individuals Taking Nucleoside Reverse

Transcriptase Inhibitors. J Neurovirol 11(4):356-364.

Segal MB (2000) The Choroid Plexuses and the Barriers Between the Blood and the

Cerebrospinal Fluid. Cell Mol Neurobiol 20:183-196.

Shah A and Kumar A (2010) HIV-1 Gp120-Mediated Increases in IL-8 Production in Astrocytes

Are Mediated Through the NF-KappaB Pathway and Can Be Silenced by Gp120-Specific

SiRNA. J Neuroinflammation 7:96.

Page 230: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

211

Shaik N, Giri N, Pan G and Elmquist WF (2007) P-Glycoprotein-Mediated Active Efflux of the

Anti-HIV1 Nucleoside Abacavir Limits Cellular Accumulation and Brain Distribution. Drug

Metab Dispos 35:2076-2085.

Shinoda C, Maruyama M, Fujishita T, Dohkan J, Oda H, Shinoda K, Yamada T, Miyabayashi K,

Hayashi R, Kawagishi Y, Fujita T, Matsui S, Sugiyama E, Muraguchi A and Kobayashi M

(2005) Doxorubicin Induces Expression of Multidrug Resistance-Associated Protein 1 in Human

Small Cell Lung Cancer Cell Lines by the C-Jun N-Terminal Kinase Pathway. Int J Cancer

20;117(1):21-31.

Sidoryk-Wegrzynowicz M, Wegrzynowicz M, Lee E, Bowman AB and Aschner M (2011) Role

of Astrocytes in Brain Function and Disease. Toxicol Pathol 39:115-123.

Sierra-Aragon S and Walter H (2012) Targets for Inhibition of HIV Replication: Entry, Enzyme

Action, Release and Maturation. Intervirology 55(2):84-97.

Simionescu M, Gafencu A and Antohe F (2002) Transcytosis of Plasma Macromolecules in

Endothelial Cells: a Cell Biological Survey. Microsc Res Tech 57:269-288.

Singh IN, Goody RJ, Dean C, Ahmad NM, Lutz SE, Knapp PE, Nath A and Hauser KF (2004)

Apoptotic Death of Striatal Neurons Induced by Human Immunodeficiency Virus-1 Tat and

Gp120: Differential Involvement of Caspase-3 and Endonuclease G. J Neurovirol 10(3):141-151.

Singh M, Singh P, Vaira D, Amand M, Rahmouni S and Moutschen M (2014) Minocycline

Attenuates HIV-1 Infection and Suppresses Chronic Immune Activation in Humanized

NOD/LtsZ-ScidIL-2Rgamma(Null) Mice. Immunology 142(4):562-572.

Sluss HK, Barrett T, Derijard B and Davis RJ (1994) Signal Transduction by Tumor Necrosis

Factor Mediated by JNK Protein Kinases. Mol Cell Biol 14:8376-8384.

Song NY, Kim DH, Kim EH, Na HK and Surh YJ (2009) 15-Deoxy-Delta 12, 14-Prostaglandin

J2 Induces Upregulation of Multidrug Resistance-Associated Protein 1 Via Nrf2 Activation in

Human Breast Cancer Cells. Ann N Y Acad Sci 1171:210-216.

Soontornmalai A, Vlaming ML and Fritschy JM (2006) Differential, Strain-Specific Cellular and

Subcellular Distribution of Multidrug Transporters in Murine Choroid Plexus and Blood-Brain

Barrier. Neuroscience 138:159-169.

Spector R and Johanson CE (1989) The Mammalian Choroid Plexus. Sci Am 261:68-74.

Sperber K, Kalb TH, Stecher VJ, Banerjee R and Mayer L (1993) Inhibition of Human

Immunodeficiency Virus Type 1 Replication by Hydroxychloroquine in T Cells and Monocytes.

AIDS Res Hum Retroviruses 9(1):91-98.

Sperber K, Louie M, Kraus T, Proner J, Sapira E, Lin S, Stecher V and Mayer L (1995)

Hydroxychloroquine Treatment of Patients With Human Immunodeficiency Virus Type 1. Clin

Ther 17:622-636.

Page 231: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

212

Speth C, Dierich MP and Sopper S (2005) HIV-Infection of the Central Nervous System: the

Tightrope Walk of Innate Immunity. Mol Immunol 42(2):213-228.

Spitzenberger TJ, Heilman D, Diekmann C, Batrakova EV, Kabanov AV, Gendelman HE,

Elmquist WF and Persidsky Y (2007) Novel Delivery System Enhances Efficacy of

Antiretroviral Therapy in Animal Model for HIV-1 Encephalitis. J Cereb Blood Flow Metab

27:1033-1042.

Su L, Cheng CY and Mruk DD (2009) Drug Transporter, P-Glycoprotein (MDR1), Is an

Integrated Component of the Mammalian Blood-Testis Barrier. Int J Biochem Cell Biol 41:2578-

2587.

Sui Z, Sniderhan LF, Schifitto G, Phipps RP, Gelbard HA, Dewhurst S and Maggirwar SB

(2007) Functional Synergy Between CD40 Ligand and HIV-1 Tat Contributes to Inflammation:

Implications in HIV Type 1 Dementia. J Immunol 178:3226-3236.

Sun S, Rao NL, Venable J, Thurmond R and Karlsson L (2007) TLR7/9 Antagonists As

Therapeutics for Immune-Mediated Inflammatory Disorders. Inflamm Allergy Drug Targets

6(4):223-235.

Sundararaj KP, Samuvel DJ, Li Y, Nareika A, Slate EH, Sanders JJ, Lopes-Virella MF and

Huang Y (2008) Simvastatin Suppresses LPS-Induced MMP-1 Expression in U937 Mononuclear

Cells by Inhibiting Protein Isoprenylation-Mediated ERK Activation. J Leukoc Biol 84(4):1120-

1129.

Sune C and Garcia-Blanco MA (1995) Transcriptional Trans Activation by Human

Immunodeficiency Virus Type 1 Tat Requires Specific Coactivators That Are Not Basal Factors.

J Virol 69:3098-3107.

Szatmari I, Vamosi G, Brazda P, Balint BL, Benko S, Szeles L, Jeney V, Ozvegy-Laczka C,

Szanto A, Barta E, Balla J, Sarkadi B and Nagy L (2006) Peroxisome Proliferator-Activated

Receptor Gamma-Regulated ABCG2 Expression Confers Cytoprotection to Human Dendritic

Cells. J Biol Chem 281:23812-23823.

Szeto GL, Brice AK, Yang HC, Barber SA, Siliciano RF and Clements JE (2010) Minocycline

Attenuates HIV Infection and Reactivation by Suppressing Cellular Activation in Human CD4+

T Cells. J Infect Dis 201:1132-1140.

Takayanagi S, Kataoka T, Ohara O, Oishi M, Kuo MT and Ishikawa T (2004) Human ATP-

Binding Cassette Transporter ABCC10: Expression Profile and P53-Dependent Upregulation. J

Exp Ther Oncol 4:239-246.

Tanaka J and Maeda N (1996) Microglial Ramification Requires Nondiffusible Factors Derived

From Astrocytes. Exp Neurol 137:367-375.

Tang H, Lu D, Pan R, Qin X, Xiong H and Dong J (2009) Curcumin Improves Spatial Memory

Impairment Induced by Human Immunodeficiency Virus Type 1 Glycoprotein 120 V3 Loop

Peptide in Rats. Life Sci 85(1-2):1-10.

Page 232: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

213

Tikka T, Fiebich BL, Goldsteins G, Keinanen R and Koistinaho J (2001) Minocycline, a

Tetracycline Derivative, Is Neuroprotective Against Excitotoxicity by Inhibiting Activation and

Proliferation of Microglia. J Neurosci 21(8):2580-2588.

Toborek M, Lee YW, Flora G, Pu H, Andras IE, Wylegala E, Hennig B and Nath A (2005)

Mechanisms of the Blood-Brain Barrier Disruption in HIV-1 Infection. Cell Mol Neurobiol

25:181-199.

Toggas SM, Masliah E, Rockenstein EM, Rall GF, Abraham CR and Mucke L (1994) Central

Nervous System Damage Produced by Expression of the HIV-1 Coat Protein Gp120 in

Transgenic Mice. Nature 367:188-193.

Tomiyasu H, Watanabe M, Sugita K, Goto-Koshino Y, Fujino Y, Ohno K, Sugano S and

Tsujimoto H (2013) Regulations of ABCB1 and ABCG2 Expression Through MAPK Pathways

in Acute Lymphoblastic Leukemia Cell Lines. Anticancer Res 33(12):5317-5323.

Tong XK, Lecrux C, Rosa-Neto P and Hamel E (2012) Age-Dependent Rescue by Simvastatin

of Alzheimer's Disease Cerebrovascular and Memory Deficits. J Neurosci 32(14):4705-4715.

Torgerson TR, Colosia AD, Donahue JP, Lin YZ and Hawiger J (1998) Regulation of NF-Kappa

B, AP-1, NFAT, and STAT1 Nuclear Import in T Lymphocytes by Noninvasive Delivery of

Peptide Carrying the Nuclear Localization Sequence of NF-Kappa B P50. J Immunol

161(11):6084-6092.

Torre D, Zeroli C, Ferraro G, Speranza F, Tambini R, Martegani R and Fiori GP (1992)

Cerebrospinal Fluid Levels of IL-6 in Patients With Acute Infections of the Central Nervous

System. Scand J Infect Dis 24(6):787-791.

Tran TA, McCoy MK, Sporn MB and Tansey MG (2008) The Synthetic Triterpenoid CDDO-

Methyl Ester Modulates Microglial Activities, Inhibits TNF Production, and Provides

Dopaminergic Neuroprotection. J Neuroinflammation 5:14.:14.

Tsai WP, Nara PL, Kung HF and Oroszlan S (1990) Inhibition of Human Immunodeficiency

Virus Infectivity by Chloroquine. AIDS Res Hum Retroviruses 6(4):481-489.

Tsiodras S, Mantzoros C, Hammer S and Samore M (2000) Effects of Protease Inhibitors on

Hyperglycemia, Hyperlipidemia, and Lipodystrophy: a 5-Year Cohort Study. Arch Intern Med

160:2050-2056.

Tsuji A, Terasaki T, Takabatake Y, Tenda Y, Tamai I, Yamashima T, Moritani S, Tsuruo T and

Yamashita J (1992) P-Glycoprotein As the Drug Efflux Pump in Primary Cultured Bovine Brain

Capillary Endothelial Cells. Life Sci 51:1427-1437.

Turriziani O, Gianotti N, Falasca F, Boni A, Vestri AR, Zoccoli A, Lazzarin A and Antonelli G

(2008) Expression Levels of MDR1, MRP1, MRP4, and MRP5 in Peripheral Blood

Mononuclear Cells From HIV Infected Patients Failing Antiretroviral Therapy. J Med Virol

80(5):766-771.

Page 233: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

214

Urquhart BL, Tirona RG and Kim RB (2007) Nuclear Receptors and the Regulation of Drug-

Metabolizing Enzymes and Drug Transporters: Implications for Interindividual Variability in

Response to Drugs. J Clin Pharmacol 47(5):566-578.

Vaccari M, Fenizia C, Ma ZM, Hryniewicz A, Boasso A, Doster MN, Miller CJ, Lindegardh N,

Tarning J, Landay AL, Shearer GM and Franchini G (2014) Transient Increase of Interferon-

Stimulated Genes and No Clinical Benefit by Chloroquine Treatment During Acute Simian

Immunodeficiency Virus Infection of Macaques. AIDS Res Hum Retroviruses 30(4):355-362.

Valcour VG (2013) HIV, Aging, and Cognition: Emerging Issues. Top Antivir Med 21(3):119-

123.

Van Bree JB, de Boer AG, Danhof M and Breimer DD (1992) Drug Transport Across the Blood-

Brain Barrier. II. Experimental Techniques to Study Drug Transport. Pharm Weekbl Sci 14:338-

348.

van dS, I, Vos CM, Nabulsi L, Blom-Roosemalen MC, Voorwinden HH, de Boer AG and

Breimer DD (2001) Assessment of Active Transport of HIV Protease Inhibitors in Various Cell

Lines and the in Vitro Blood--Brain Barrier. AIDS 15:483-491.

Vanzani MC, Iacono RF, Caccuri RL, Troncoso AR and Berria MI (2006) Regional Differences

in Astrocyte Activation in HIV-Associated Dementia. Medicina (B Aires) 66(2):108-112.

Varadi A, Szabo Z, Pomozi V, de BH, Fulop K and Aranyi T (2011) ABCC6 As a Target in

Pseudoxanthoma Elasticum. Curr Drug Targets 12:671-682.

Verwer RW, Sluiter AA, Balesar RA, Baayen JC, Noske DP, Dirven CM, Wouda J, van Dam

AM, Lucassen PJ and Swaab DF (2007) Mature Astrocytes in the Adult Human Neocortex

Express the Early Neuronal Marker Doublecortin. Brain 130(Pt 12):3321-3335.

Vincenti MP and Brinckerhoff CE (2001) The Potential of Signal Transduction Inhibitors for the

Treatment of Arthritis: Is It All Just JNK? J Clin Invest 108:181-183.

Vivithanaporn P, Heo G, Gamble J, Krentz HB, Hoke A, Gill MJ and Power C (2010)

Neurologic Disease Burden in Treated HIV/AIDS Predicts Survival: a Population-Based Study.

Neurology 75:1150-1158.

Volterra A and Meldolesi J (2005) Astrocytes, From Brain Glue to Communication Elements:

the Revolution Continues. Nat Rev Neurosci 6:626-640.

von Giesen HJ, Jander S, Koller H and Arendt G (2004) Serum and Cerebrospinal Fluid Levels

of Interleukin-18 in Human Immunodeficiency Virus Type 1-Associated Central Nervous

System Disease. J Neurovirol 10(6):383-386.

von Wedel-Parlow M, Wolte P and Galla HJ (2009) Regulation of Major Efflux Transporters

Under Inflammatory Conditions at the Blood-Brain Barrier in Vitro. J Neurochem 111:111-118.

Page 234: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

215

Waetzig V, Czeloth K, Hidding U, Mielke K, Kanzow M, Brecht S, Goetz M, Lucius R,

Herdegen T and Hanisch UK (2005) C-Jun N-Terminal Kinases (JNKs) Mediate Pro-

Inflammatory Actions of Microglia. Glia 50:235-246.

Walker DK, Abel S, Comby P, Muirhead GJ, Nedderman AN and Smith DA (2005) Species

Differences in the Disposition of the CCR5 Antagonist, UK-427,857, a New Potential Treatment

for HIV. Drug Metab Dispos 33(4):587-595.

Wang F, Zhou F, Kruh GD and Gallo JM (2010a) Influence of Blood-Brain Barrier Efflux

Pumps on the Distribution of Vincristine in Brain and Brain Tumors. Neuro Oncol 12:1043-

1049.

Wang X, Furukawa T, Nitanda T, Okamoto M, Sugimoto Y, Akiyama S and Baba M (2003a)

Breast Cancer Resistance Protein (BCRP/ABCG2) Induces Cellular Resistance to HIV-1

Nucleoside Reverse Transcriptase Inhibitors. Mol Pharmacol 63:65-72.

Wang X, Sykes DB and Miller DS (2010b) Constitutive Androstane Receptor-Mediated Up-

Regulation of ATP-Driven Xenobiotic Efflux Transporters at the Blood-Brain Barrier. Mol

Pharmacol 78:376-383.

Wang Z, Pekarskaya O, Bencheikh M, Chao W, Gelbard HA, Ghorpade A, Rothstein JD and

Volsky DJ (2003b) Reduced Expression of Glutamate Transporter EAAT2 and Impaired

Glutamate Transport in Human Primary Astrocytes Exposed to HIV-1 or Gp120. Virology

312:60-73.

Warriner EM, Rourke SB, Rourke BP, Rubenstein S, Millikin C, Buchanan L, Connelly P,

Hyrcza M, Ostrowski M, Der S and Gough K (2010) Immune Activation and Neuropsychiatric

Symptoms in HIV Infection. J Neuropsychiatry Clin Neurosci 22:321-328.

Washington CB, Wiltshire HR, Man M, Moy T, Harris SR, Worth E, Weigl P, Liang Z, Hall D,

Marriott L and Blaschke TF (2000) The Disposition of Saquinavir in Normal and P-Glycoprotein

Deficient Mice, Rats, and in Cultured Cells. Drug Metab Dispos 28:1058-1062.

Weber SM and Levitz SM (2000) Chloroquine Interferes With Lipopolysaccharide-Induced

TNF-Alpha Gene Expression by a Nonlysosomotropic Mechanism. J Immunol 165:1534-1540.

Weiss J, Theile D, Ketabi-Kiyanvash N, Lindenmaier H and Haefeli WE (2007) Inhibition of

MRP1/ABCC1, MRP2/ABCC2, and MRP3/ABCC3 by Nucleoside, Nucleotide, and Non-

Nucleoside Reverse Transcriptase Inhibitors. Drug Metab Dispos 35:340-344.

Whitmarsh AJ and Davis RJ (2000) A Central Control for Cell Growth. Nature 20;403:255-256.

Wijnholds J, deLange EC, Scheffer GL, van den Berg DJ, Mol CA, van d, V, Schinkel AH,

Scheper RJ, Breimer DD and Borst P (2000a) Multidrug Resistance Protein 1 Protects the

Choroid Plexus Epithelium and Contributes to the Blood-Cerebrospinal Fluid Barrier. J Clin

Invest 105:279-285.

Page 235: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

216

Wijnholds J, Mol CA, van DL, de HM, Scheffer GL, Baas F, Beijnen JH, Scheper RJ, Hatse S,

De CE, Balzarini J and Borst P (2000b) Multidrug-Resistance Protein 5 Is a Multispecific

Organic Anion Transporter Able to Transport Nucleotide Analogs. Proc Natl Acad Sci U S A

20;97:7476-7481.

Williams GC, Liu A, Knipp G and Sinko PJ (2002) Direct Evidence That Saquinavir Is

Transported by Multidrug Resistance-Associated Protein (MRP1) and Canalicular Multispecific

Organic Anion Transporter (MRP2). Antimicrob Agents Chemother 46:3456-3462.

Wittchen ES (2009) Endothelial Signaling in Paracellular and Transcellular Leukocyte

Transmigration. Front Biosci (Landmark Ed) 14:2522-2545.

Wozniacka A, Lesiak A, Boncela J, Smolarczyk K, McCauliffe DP and Sysa-Jedrzejowska A

(2008) The Influence of Antimalarial Treatment on IL-1beta, IL-6 and TNF-Alpha MRNA

Expression on UVB-Irradiated Skin in Systemic Lupus Erythematosus. Br J Dermatol 159:1124-

1130.

Wozniacka A, Lesiak A, Narbutt J, McCauliffe DP and Sysa-Jedrzejowska A (2006)

Chloroquine Treatment Influences Proinflammatory Cytokine Levels in Systemic Lupus

Erythematosus Patients. Lupus 15:268-275.

Wu L, LaRosa G, Kassam N, Gordon CJ, Heath H, Ruffing N, Chen H, Humblias J, Samson M,

Parmentier M, Moore JP and Mackay CR (1997) Interaction of Chemokine Receptor CCR5 With

Its Ligands: Multiple Domains for HIV-1 Gp120 Binding and a Single Domain for Chemokine

Binding. J Exp Med 20;186:1373-1381.

Yang LP, Zhu XA and Tso MO (2007) Minocycline and Sulforaphane Inhibited

Lipopolysaccharide-Mediated Retinal Microglial Activation. Mol Vis 13:1083-1093.

Yano M, Matsumura T, Senokuchi T, Ishii N, Murata Y, Taketa K, Motoshima H, Taguchi T,

Sonoda K, Kukidome D, Takuwa Y, Kawada T, Brownlee M, Nishikawa T and Araki E (2007)

Statins Activate Peroxisome Proliferator-Activated Receptor Gamma Through Extracellular

Signal-Regulated Kinase 1/2 and P38 Mitogen-Activated Protein Kinase-Dependent

Cyclooxygenase-2 Expression in Macrophages. Circ Res 100(10):1442-1451.

Yi AK and Krieg AM (1998) Rapid Induction of Mitogen-Activated Protein Kinases by Immune

Stimulatory CpG DNA. J Immunol 161(9):4493-4497.

Yi Y, Lee C, Liu QH, Freedman BD and Collman RG (2004) Chemokine Receptor Utilization

and Macrophage Signaling by Human Immunodeficiency Virus Type 1 Gp120: Implications for

Neuropathogenesis. J Neurovirol 10 Suppl 1:91-6.:91-96.

Yu C, Argyropoulos G, Zhang Y, Kastin AJ, Hsuchou H and Pan W (2008) Neuroinflammation

Activates Mdr1b Efflux Transport Through NFkappaB: Promoter Analysis in BBB Endothelia.

Cell Physiol Biochem 22:745-756.

Page 236: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

217

Zabad RK, Metz LM, Todoruk TR, Zhang Y, Mitchell JR, Yeung M, Patry DG, Bell RB and

Yong VW (2007) The Clinical Response to Minocycline in Multiple Sclerosis Is Accompanied

by Beneficial Immune Changes: a Pilot Study. Mult Scler 13(4):517-526.

Zastre JA, Chan GN, Ronaldson PT, Ramaswamy M, Couraud PO, Romero IA, Weksler B,

Bendayan M and Bendayan R (2009) Up-Regulation of P-Glycoprotein by HIV Protease

Inhibitors in a Human Brain Microvessel Endothelial Cell Line. J Neurosci Res 87:1023-1036.

Zelcer N, Saeki T, Reid G, Beijnen JH and Borst P (2001) Characterization of Drug Transport by

the Human Multidrug Resistance Protein 3 (ABCC3). J Biol Chem 276:46400-46407.

Zhang L, Meissner E, Chen J and Su L (2010) Current Humanized Mouse Models for Studying

Human Immunology and HIV-1 Immuno-Pathogenesis. Sci China Life Sci 53(2):195-203.

Zhang P, Hogan EL and Bhat NR (1998) Activation of JNK/SAPK in Primary Glial Cultures: II.

Differential Activation of Kinase Isoforms Corresponds to Their Differential Expression.

Neurochem Res 23:219-225.

Zhang P, Miller BS, Rosenzweig SA and Bhat NR (1996) Activation of C-Jun N-Terminal

Kinase/Stress-Activated Protein Kinase in Primary Glial Cultures. J Neurosci Res 46:114-121.

Zhang W, Mojsilovic-Petrovic J, Andrade MF, Zhang H, Ball M and Stanimirovic DB (2003)

The Expression and Functional Characterization of ABCG2 in Brain Endothelial Cells and

Vessels. FASEB J 17:2085-2087.

Zhang Y, Gupta A, Wang H, Zhou L, Vethanayagam RR, Unadkat JD and Mao Q (2005) BCRP

Transports Dipyridamole and Is Inhibited by Calcium Channel Blockers. Pharm Res 22:2023-

2034.

Zhang Y, Han H, Elmquist WF and Miller DW (2000) Expression of Various Multidrug

Resistance-Associated Protein (MRP) Homologues in Brain Microvessel Endothelial Cells.

Brain Res 876:148-153.

Zhang Y, Schuetz JD, Elmquist WF and Miller DW (2004) Plasma Membrane Localization of

Multidrug Resistance-Associated Protein Homologs in Brain Capillary Endothelial Cells. J

Pharmacol Exp Ther 311:449-455.

Zhao ML, Kim MO, Morgello S and Lee SC (2001) Expression of Inducible Nitric Oxide

Synthase, Interleukin-1 and Caspase-1 in HIV-1 Encephalitis. J Neuroimmunol 115:182-191.

Zheng LT, Hwang J, Ock J, Lee MG, Lee WH and Suk K (2008a) The Antipsychotic Spiperone

Attenuates Inflammatory Response in Cultured Microglia Via the Reduction of Proinflammatory

Cytokine Expression and Nitric Oxide Production. J Neurochem 107:1225-1235.

Zheng LT, Ryu GM, Kwon BM, Lee WH and Suk K (2008b) Anti-Inflammatory Effects of

Catechols in Lipopolysaccharide-Stimulated Microglia Cells: Inhibition of Microglial

Neurotoxicity. Eur J Pharmacol 588:106-113.

Page 237: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

218

Zhong Y, Hennig B and Toborek M (2010) Intact Lipid Rafts Regulate HIV-1 Tat Protein-

Induced Activation of the Rho Signaling and Upregulation of P-Glycoprotein in Brain

Endothelial Cells. J Cereb Blood Flow Metab 30:522-533.

Zhou BY, Liu Y, Kim B, Xiao Y and He JJ (2004) Astrocyte Activation and Dysfunction and

Neuron Death by HIV-1 Tat Expression in Astrocytes. Mol Cell Neurosci 27:296-305.

Zhou J, Liu M, Aneja R, Chandra R, Lage H and Joshi HC (2006) Reversal of P-Glycoprotein-

Mediated Multidrug Resistance in Cancer Cells by the C-Jun NH2-Terminal Kinase. Cancer Res

66:445-452.

Zhu F, Zheng Y, Ding YQ, Liu Y, Zhang X, Wu R, Guo X and Zhao J (2014) Minocycline and

Risperidone Prevent Microglia Activation and Rescue Behavioral Deficits Induced by Neonatal

Intrahippocampal Injection of Lipopolysaccharide in Rats. PLoS One 9(4):e93966.

Zink MC, Uhrlaub J, DeWitt J, Voelker T, Bullock B, Mankowski J, Tarwater P, Clements J and

Barber S (2005) Neuroprotective and Anti-Human Immunodeficiency Virus Activity of

Minocycline. JAMA 293(16):2003-2011.

Page 238: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

219

Appendices

Appendix A: Data not shown in chapter 2

Figure A 1: Immunoblot analysis of P-gp in primary cultures of HFAs treated with TNF-α (0.5

and 10ng/ml). MDR1 overexpressing MDCK-MDR1 cell lysate was used as positive control.

Whole cell lysates (50 µg) from primary cultures of HFAs were resolved on a 10% SDS-

polyacrylamide gel and transferred to a PVDF membrane. Results are expressed as mean ± SD of

three separate experiments. Asterisks represent data points that are significantly different from

control (*p<0.05).

Page 239: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

220

Appendix B: Data not shown in chapter 5

Sal

ine

gp120_

300n

g

gp120_

500n

g

Sal

ine

gp120_

300n

g

gp120_

500n

g

Sal

ine

gp120_

300n

g

gp120_

500n

g0

100

200

300

400

500

**

* *

Frontal cortex Hippocampus Striatum

A.

IL1b

rela

tive m

RN

A e

xp

ressio

n

(%

Co

ntr

ol)

(No

rmali

zed

to

cyclo

ph

ilin

)

Sal

ine

gp120_

300n

g

gp120_

500n

g

Sal

ine

gp120_

300n

g

gp120_

500n

g

Sal

ine

gp120_

300n

g

gp120_

500n

g0

50

100

150

B.

Frontal cortex Hippocampus Striatum

IL6 r

ela

tive m

RN

A e

xp

ressio

n

(% c

on

tro

l)

No

rmali

zed

to

cyclo

ph

ilin

Page 240: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

221

Sal

ine

gp120_

300n

g

gp120_

500n

g

Sal

ine

gp120_

300n

g

gp120_

500n

g

Sal

ine

gp120_

300n

g

gp120_

500n

g0

200

400

600

800 **

*

*

Frontal cortex Hippocampus Striatum

C.

iNO

S r

ela

tive m

RN

A e

xp

ressio

n

(% C

on

tro

l)

(No

rmali

zed

to

cyclo

ph

ilin

) )

Salin

e

gp120_

300n

g

gp120_

500n

g

Salin

e

gp120_

300n

g

gp120_

500n

g

Salin

e

gp120_

300n

g

gp120_

500n

g0

50

100

150

200

*

D.

Frontal cortex Hippocampus Striatum

TN

Fa r

ela

tive m

RN

A e

xp

ressio

n

(% C

on

tro

l)

(No

rmali

zed

to

cyclo

ph

ilin

)

Figure B 1: Effect of two different doses of gp120 (300ng or 500 ng) on the mRNA levels of A)

IL-1β, B) IL-6, C) iNOS and D) TNF-α in different brain regions of Wistar rats after ICV

administration of gp120. Saline injected animals were used as control. Results are expressed as

mean±SEM. (*) represent data point significantly different from control (p<0.05). Samples

obtained from at least six different animals were analyzed per group.

Page 241: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

222

A.

B.

Page 242: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

223

saline gp120_500ng0

1

2

3

4 Serum

TN

F-a

(p

g/m

l)

Figure B 2: ELISA analysis of A) IL-1β, B) IL-6 and C) TNF- in the serum of gp120 (500ng)

administered rats. Serum collected from saline injected animals were used as control. Results are

expressed as mean±SEM. Samples obtained from at least eight different animals were used per

group.

C.

Page 243: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

224

salin

e

gp120_

500n

g

0

10

20

30

40CSF

IL-6

(p

g/m

l)

Figure B 3: ELISA analysis of IL-6 secretion in the CSF of gp120 (500ng) administered rats.

CSF collected from saline injected animals were used as control. Results are expressed as

mean±SEM. Samples obtained from at least eight different animals were used per group.

Page 244: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

225

Brain capillaries

Occ

ludin

ZO-1

Cla

udin5

0

50

100

150Saline

gp120

Pro

tein

exp

ressio

n o

f ti

gh

t

ju

ncti

on

pro

tein

s (

% c

on

tro

l)

Figure B 4: Immunoblot (upper panel) and densitometric analysis (lower panel) of ZO-1,

occludin and claudin 5 in rat brain capillaries isolated from HIV-1 gp120 or saline administered

rats. Caco-2 cell lysate was used as control. Results are expressed as mean±SEM. Samples

obtained from eight different animals were used per group.

Page 245: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

226

Brain capillaries

P-g

p

Bcr

p

Mrp

1

0

50

100

150Saline

gp120_500ng

Pro

tein

exp

ressio

n o

f d

rug

eff

lux

tran

sp

ort

ers

(%

co

ntr

ol)

Figure B 5: Immunoblot (upper panel) and densitometric analysis (lower panel) of P-gp, Mrp1

and Bcrp in rat brain capillaries isolated from HIV-1 gp120 or saline administered rats.

Transporter overexpressing cell lines were used as positive controls. Results are expressed as

mean±SEM. Samples obtained from eight different animals were used per group.

Page 246: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

227

Hippocampus

Sal

ine

gp120

SP60

0125

+gp12

0

0

50

100

150

200*

Mrp

1 p

rote

in e

xp

ressio

n

(%

co

ntr

ol)

Figure B 6: Immunoblot (upper panel) and densitometric analysis (lower panel) of Mrp1 in

hippocampus of ICV administered gp120 rats in the presence or absence of JNK inhibitor,

SP600125. Hela-MRP1 cell lysate was used as positive control. Representative blots are shown.

Results are expressed as mean±SEM. Samples obtained from six different animals were used per

group. Asterisk represent data point significantly different from saline administered animals

(*p<0.05). Diamonds represent data point significantly different from gp120-treatment (♦♦

p<0.01).

Saline gp120_500ng

SP600125+

gp120_500ng Hela-

MRP1

190 kDa

42 kDa

Page 247: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

228

Figure B 7: Immunoblot (upper panel) and densitometric analysis (lower panel) of Mrp1 in

hippocampus of ICV administered gp120 rats with or without minocycline treatment. Hela-

MRP1 cell lysate was used as positive control. Representative blots are shown. Results are

expressed as mean±SEM. Samples obtained from six different animals were used per group.

Asterisk represent data point significantly different from saline administered animals (*p<0.05).

Diamonds represent data point significantly different from gp120-treatment (♦ p<0.05).

Page 248: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

229

� 1

-� 1

-

1

1

1

1

Contr

ol

gp120_

6H

CQ_6

H

Min

o_6H

Sim

_6H

CQ+g

p120_

6H

Min

o+gp12

0_6H

Sim

+gp12

0_6H

0

100

200

300

400

*

Primary cultures of rat astrocytes

Ph

osp

ho

-ER

K1/2

pro

tein

exp

ressio

n (

% C

on

tro

l)

Figure B 8: Immunoblot (upper panel) and densitometric analysis (lower panel) of ERK1/2 and

phospho-ERK1/2 in primary cultures of rat astrocytes treated with gp120 (1nM) in the presence

or absence of 1 µM chloroquine, 100 nM simvastatin and 60 µM minocycline. Results are

expressed as mean±SEM. Samples obtained from three different experiments were used per

group. Asterisk represent data point significantly different from control (*p<0.05) (CQ=

chloroquine, mino= minocycline, sim=simvastatin).

Page 249: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

230

Contr

ol

gp120_

6H

CQ_6

H

Min

o_6H

Sim

_6H

CQ+g

p120_

6H

Min

o+gp12

0_6H

Sim

+gp12

0_6H

0

100

200

300

400

*

Primary cultures of rat astrocytes

Pro

tein

exp

ressio

n o

f

ph

osp

ho

ryla

ted

JN

K

(%C

on

tro

l)

Figure B 9: Immunoblot (upper panel) and densitometric analysis (lower panel) of JNK and

phospho-JNK in primary cultures of rat astrocytes treated with gp120 (1nM) in the presence or

absence of 1 µM chloroquine, 100 nM simvastatin and 60 µM minocycline. Results are

expressed as mean±SEM. Samples obtained from three different experiments were used per

group. Asterisk represent data point significantly different from control (*p<0.05) (CQ=

chloroquine, mino= minocycline, sim=simvastatin).

Page 250: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

231

List of publications

Ashraf T, Jiang W, Hoque T, Henderson J, Wu C and Reina Bendayan. Role of anti-inflammatory compounds in human immunodeficiency virus-1 glycoprotein120 -mediated brain inflammation. 2014. Journal of Neuroinflammation. 11:91.

Ashraf T, Kao A and Bendayan R. Functional expression of drug transporters in glial cells: potential role on drug delivery to the CNS. 2014. In Thomas P. Davis, editor: pharmacology of the blood-brain barrier: targeting CNS disorders, vol 71, APHA, UK: Academic press; 45-111.

Ashraf T, Ronaldson PT and Bendayan R. Drug transport in brain. 2014. Chapter 16 in Drug transporters: molecular characterization and role in drug disposition. Second edition. (Guofeng Y ed) Wiley series in drug discovery and development.

Ashraf T, Robillard K, Chan G and Bendayan R. Role of CNS Transporters in the Pharmacotherapy of HIV-1 Associated Neurological Disorders. 2013. Current Pharmaceutical Design. 20(10): 1543-1563.

Ashraf T, Kis O, Banerjee N and Bendayan R. Drug transporters at brain barriers: expression and regulation by neurological disorders. 2012. Chapter 2 in Biology and Regulation of Blood-Tissue Barriers. (Cheng CY ed) Landes Bioscience.

Ashraf T, Ronaldson PT, Persidsky Y and Bendayan R. Regulation of P-glycoprotein by HIV-1 in primary cultures of human fetal astrocytes. 2011. Journal of Neuroscience Research. 89: 1773-1782.

Ronaldson PT, Ashraf T and Reina Bendayan. Regulation of Multidrug Resistance Protein 1 (Mrp1) by Tumor Necrosis Factor Alpha (TNF-α) in cultured glial cells: Involvement if Nuclear Factor- κB (NF- κB) and c-Jun N-terminal Kinase (JNK) signaling pathways.2010. Molecular Pharmacology. 77(4):644-59.

Page 251: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

232

Copyright Acknowledgements

Copyright clearance for sections 1.1, 1.2, 1.3, 1.5, 1.6, 1.7, 1.9.3 ; figures 1-1, 1-2 and tables

1-1, 1-2 and 1-3:

BENTHAM SCIENCE PUBLISHERS LICENSE

TERMS AND CONDITIONS

Sep 08, 2014

This is a License Agreement between Tamima Ashraf ("You") and Bentham Science

Publishers ("Bentham Science Publishers") provided by Copyright Clearance Center

("CCC"). The license consists of your order details, the terms and conditions provided by

Bentham Science Publishers, and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see

information listed at the bottom of this form.

License Number 3464290277235

License date Sep 08, 2014

Licensed content publisher Bentham Science Publishers

Licensed content publication Current Pharmaceutical Design

Licensed content title Role of CNS Transporters in the Pharmacotherapy of

HIV-1 Associated Neurological Disorders

Licensed copyright line Copyright © 2014, Eureka Science Ltd.

Licensed content author Tamima Ashraf, Kevin Robillard, Gary N.Y. Chan and

Reina Bendayan

Licensed content date 28 February ,2014

Type of Use Thesis/Dissertation

Requestor type Author of requested content

Format Print, Electronic

Portion chapter/article

Rights for Main product

Duration of use Life of current/future editions

Creation of copies for the

disabled no

With minor editing privileges no

Page 252: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

233

In the following language(s) Original language of publication

With incidental promotional use no

The lifetime unit quantity of new

product 0 to 499

The requesting

person/organization is: Tamima Ashraf, university of Toronto

Title of your thesis / dissertation

Regulation of pro-inflammatory cytokines and drug

efflux transporters by signal transduction pathways in

glial cells: Implications in HIV-1 neuropathogenesis and

its treatment

Expected completion date Nov 2014

Expected size (number of pages) 220

Billing Type Invoice

Billing address 1055 Southdown road, unit 403

Mississauga, ON L5J0A3

Canada

Total 0.00 USD

Terms and Conditions

STANDARD TERMS AND CONDITIONS FOR REPRODUCTION OF MATERIAL

Introduction

The publisher for this copyrighted material is Bentham Science Publishers Ltd. By clicking

"accept" in connection with completing this licensing transaction, you agree that the

following terms and conditions apply (along with the Billing and Payment terms and

conditions established by Copyright Clearance Center, Inc. ("CCC"), at the time that you

opened your CCC account and that are available at any time at

http://myaccount.copyright.com.

Limited License

Publisher hereby grants to you a non-exclusive license to use this material. Licenses are for

one-time use only with a maximum distribution equal to the number that you identified in

the licensing process; any form of republication must be completed within 180 days from the

date hereof (although copies prepared before then may be distributed thereafter); and any

electronic posting is limited to a period of 180 days.

Page 253: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

234

Geographic Rights: Scope

Licenses may be exercised anywhere in the world.

Altering/Modifying Material: Not Permitted

You may not alter or modify the material in any manner, nor may you translate the material

into another language without permission from the Publisher.

Reservation of Rights

Publisher reserves all rights not specifically granted in the combination of (i) the license

details provided by you and accepted in the course of this licensing transaction, (ii) these

terms and conditions and (iii) CCC's Billing and Payment terms and conditions.

License Contingent on Payment

While you may exercise the rights licensed immediately upon issuance of the license at the

end of the licensing process for the transaction, provided that you have disclosed complete

and accurate details of your proposed use, no license is finally effective unless and until full

payment is received from you (either by publisher or by CCC) as provided in CCC's Billing

and Payment terms and conditions. If full payment is not received on a timely basis, then

any license preliminarily granted shall be deemed automatically revoked and shall be void as

if never granted. Further, in the event that you breach any of these terms and conditions or

any of CCC's Billing and Payment terms and conditions, the license is automatically revoked

and shall be void as if never granted. Use of materials as described in a revoked license, as

well as any use of the materials beyond the scope of an unrevoked license, may constitute

copyright infringement and publisher reserves the right to take any and all action to protect

its copyright in the materials.

Copyright Notice: Disclaimer

It is a condition of this license that on all copies you republish, display or distribute you (i)

provide full bibliographical information for the licensed material, including but not limited

to author name, title and publication date of the work, volume and number if applicable,

publisher name (Eureka Science Ltd.), page reference, (ii) include the statement, "Reprinted

by permission of Eureka Science Ltd."; and (iii) include the copyright notice that appears in

Page 254: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

235

the work as published by Eureka Science Ltd..

Warranties: None

Publisher makes no representations or warranties with respect to the licensed material.

Indemnity

You hereby indemnify and agree to hold harmless publisher and CCC, and their respective

officers, directors, employees and agents, from and against any and all claims arising out of

your use of the licensed material other than as specifically authorized pursuant to this

license.

No Transfer of License

This license is personal to you and may not be sublicensed, assigned, or transferred by you

to any other person without publisher's written permission.

No Amendment Except in Writing

This license may not be amended except in a writing signed by both parties (or, in the case

of publisher, by CCC on publisher's behalf).

Objection to Contrary Terms

Publisher hereby objects to any terms contained in any purchase order, acknowledgment,

check endorsement or other writing prepared by you, which terms are inconsistent with these

terms and conditions or CCC's Billing and Payment terms and conditions. These terms and

conditions, together with CCC's Billing and Payment terms and conditions (which are

incorporated herein), comprise the entire agreement between you and publisher (and CCC)

concerning this licensing transaction. In the event of any conflict between your obligations

established by these terms and conditions and those established by CCC's Billing and

Payment terms and conditions, these terms and conditions shall control.

Jurisdiction: Not Required*

This license transaction shall be governed by and construed in accordance with the laws of

the United Arab Emirates. You hereby agree to submit to the jurisdiction of the federal and

state courts located in Dubai for purposes of resolving any disputes that may arise in

Page 255: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

236

connection with this licensing transaction.

Other Terms and Conditions: None

v1.0

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-

978-646-2777.

Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license

for your reference. No payment is required.

Page 256: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

237

Copyright clearance for section 1-4:

JOHN WILEY AND SONS LICENSE

TERMS AND CONDITIONS

Oct 28, 2014

This is a License Agreement between Tamima Ashraf ("You") and John Wiley and Sons

("John Wiley and Sons") provided by Copyright Clearance Center ("CCC"). The license

consists of your order details, the terms and conditions provided by John Wiley and Sons,

and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see

information listed at the bottom of this form.

License Number 3471391187232

License date Sep 17, 2014

Licensed content publisher John Wiley and Sons

Licensed content

publication Wiley Books

Licensed content title Drug Transporters: Molecular Characterization and Role in

Drug Disposition, 2nd Edition

Book title None

Licensed copyright line Copyright © 2014, John Wiley and Sons

Licensed content author Guofeng You (Editor), Marilyn E. Morris (Editor), Binghe

Wang (Series Editor)

Licensed content date Aug 1, 2014

Type of use Dissertation/Thesis

Requestor type University/Academic

Format Print and electronic

Portion Text extract

Number of Pages 3

Will you be translating? No

Title of your thesis /

dissertation

Regulation of pro-inflammatory cytokines and drug efflux

transporters by signal transduction pathways in glial cells:

Implications in HIV-1 neuropathogenesis and its treatment

Expected completion date Nov 2014

Page 257: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

238

Expected size (number of

pages) 220

Total 0.00 USD

Terms and Conditions

TERMS AND CONDITIONS

This copyrighted material is owned by or exclusively licensed to John Wiley & Sons, Inc.

or one of its group companies (each a"Wiley Company") or handled on behalf of a society

with which a Wiley Company has exclusive publishing rights in relation to a particular

work (collectively "WILEY"). By clicking accept in connection with completing this

licensing transaction, you agree that the following terms and conditions apply to this

transaction (along with the billing and payment terms and conditions established by the

Copyright Clearance Center Inc., ("CCC's Billing and Payment terms and conditions"), at

the time that you opened your Rightslink account (these are available at any time at

http://myaccount.copyright.com).

Terms and Conditions

The materials you have requested permission to reproduce or reuse (the "Wiley

Materials") are protected by copyright.

You are hereby granted a personal, non-exclusive, non-sub licensable (on a stand-

alone basis), non-transferable, worldwide, limited license to reproduce the Wiley

Materials for the purpose specified in the licensing process. This license is for a one-

time use only and limited to any maximum distribution number specified in the

license. The first instance of republication or reuse granted by this licence must be

completed within two years of the date of the grant of this licence (although copies

prepared before the end date may be distributed thereafter). The Wiley Materials

shall not be used in any other manner or for any other purpose, beyond what is

granted in the license. Permission is granted subject to an appropriate

acknowledgement given to the author, title of the material/book/journal and the

publisher. You shall also duplicate the copyright notice that appears in the Wiley

publication in your use of the Wiley Material. Permission is also granted on the

understanding that nowhere in the text is a previously published source

acknowledged for all or part of this Wiley Material. Any third party content is

expressly excluded from this permission.

With respect to the Wiley Materials, all rights are reserved. Except as expressly

granted by the terms of the license, no part of the Wiley Materials may be copied,

modified, adapted (except for minor reformatting required by the new Publication),

Page 258: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

239

translated, reproduced, transferred or distributed, in any form or by any means, and

no derivative works may be made based on the Wiley Materials without the prior

permission of the respective copyright owner. You may not alter, remove or

suppress in any manner any copyright, trademark or other notices displayed by the

Wiley Materials. You may not license, rent, sell, loan, lease, pledge, offer as

security, transfer or assign the Wiley Materials on a stand-alone basis, or any of the

rights granted to you hereunder to any other person.

The Wiley Materials and all of the intellectual property rights therein shall at all

times remain the exclusive property of John Wiley & Sons Inc, the Wiley

Companies, or their respective licensors, and your interest therein is only that of

having possession of and the right to reproduce the Wiley Materials pursuant to

Section 2 herein during the continuance of this Agreement. You agree that you own

no right, title or interest in or to the Wiley Materials or any of the intellectual

property rights therein. You shall have no rights hereunder other than the license as

provided for above in Section 2. No right, license or interest to any trademark, trade

name, service mark or other branding ("Marks") of WILEY or its licensors is

granted hereunder, and you agree that you shall not assert any such right, license or

interest with respect thereto.

NEITHER WILEY NOR ITS LICENSORS MAKES ANY WARRANTY OR

REPRESENTATION OF ANY KIND TO YOU OR ANY THIRD PARTY,

EXPRESS, IMPLIED OR STATUTORY, WITH RESPECT TO THE

MATERIALS OR THE ACCURACY OF ANY INFORMATION CONTAINED IN

THE MATERIALS, INCLUDING, WITHOUT LIMITATION, ANY IMPLIED

WARRANTY OF MERCHANTABILITY, ACCURACY, SATISFACTORY

QUALITY, FITNESS FOR A PARTICULAR PURPOSE, USABILITY,

INTEGRATION OR NON-INFRINGEMENT AND ALL SUCH WARRANTIES

ARE HEREBY EXCLUDED BY WILEY AND ITS LICENSORS AND WAIVED

BY YOU

WILEY shall have the right to terminate this Agreement immediately upon breach

of this Agreement by you.

You shall indemnify, defend and hold harmless WILEY, its Licensors and their

respective directors, officers, agents and employees, from and against any actual or

threatened claims, demands, causes of action or proceedings arising from any breach

of this Agreement by you.

IN NO EVENT SHALL WILEY OR ITS LICENSORS BE LIABLE TO YOU OR

ANY OTHER PARTY OR ANY OTHER PERSON OR ENTITY FOR ANY

SPECIAL, CONSEQUENTIAL, INCIDENTAL, INDIRECT, EXEMPLARY OR

PUNITIVE DAMAGES, HOWEVER CAUSED, ARISING OUT OF OR IN

CONNECTION WITH THE DOWNLOADING, PROVISIONING, VIEWING OR

USE OF THE MATERIALS REGARDLESS OF THE FORM OF ACTION,

WHETHER FOR BREACH OF CONTRACT, BREACH OF WARRANTY,

TORT, NEGLIGENCE, INFRINGEMENT OR OTHERWISE (INCLUDING,

WITHOUT LIMITATION, DAMAGES BASED ON LOSS OF PROFITS, DATA,

Page 259: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

240

FILES, USE, BUSINESS OPPORTUNITY OR CLAIMS OF THIRD PARTIES),

AND WHETHER OR NOT THE PARTY HAS BEEN ADVISED OF THE

POSSIBILITY OF SUCH DAMAGES. THIS LIMITATION SHALL APPLY

NOTWITHSTANDING ANY FAILURE OF ESSENTIAL PURPOSE OF ANY

LIMITED REMEDY PROVIDED HEREIN.

Should any provision of this Agreement be held by a court of competent jurisdiction

to be illegal, invalid, or unenforceable, that provision shall be deemed amended to

achieve as nearly as possible the same economic effect as the original provision, and

the legality, validity and enforceability of the remaining provisions of this

Agreement shall not be affected or impaired thereby.

The failure of either party to enforce any term or condition of this Agreement shall

not constitute a waiver of either party's right to enforce each and every term and

condition of this Agreement. No breach under this agreement shall be deemed

waived or excused by either party unless such waiver or consent is in writing signed

by the party granting such waiver or consent. The waiver by or consent of a party to

a breach of any provision of this Agreement shall not operate or be construed as a

waiver of or consent to any other or subsequent breach by such other party.

This Agreement may not be assigned (including by operation of law or otherwise)

by you without WILEY's prior written consent.

Any fee required for this permission shall be non-refundable after thirty (30) days

from receipt by the CCC.

These terms and conditions together with CCC’s Billing and Payment terms and

conditions (which are incorporated herein) form the entire agreement between you

and WILEY concerning this licensing transaction and (in the absence of fraud)

supersedes all prior agreements and representations of the parties, oral or written.

This Agreement may not be amended except in writing signed by both parties. This

Agreement shall be binding upon and inure to the benefit of the parties' successors,

legal representatives, and authorized assigns.

In the event of any conflict between your obligations established by these terms and

conditions and those established by CCC’s Billing and Payment terms and

conditions, these terms and conditions shall prevail.

WILEY expressly reserves all rights not specifically granted in the combination of

(i) the license details provided by you and accepted in the course of this licensing

transaction, (ii) these terms and conditions and (iii) CCC’s Billing and Payment

terms and conditions.

This Agreement will be void if the Type of Use, Format, Circulation, or Requestor

Type was misrepresented during the licensing process.

This Agreement shall be governed by and construed in accordance with the laws of

Page 260: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

241

the State of New York, USA, without regards to such states conflict of law rules.

Any legal action, suit or proceeding arising out of or relating to these Terms and

Conditions or the breach thereof shall be instituted in a court of competent

jurisdiction in New York County in the State of New York in the United States of

America and each party hereby consents and submits to the personal jurisdiction of

such court, waives any objection to venue in such court and consents to service of

process by registered or certified mail, return receipt requested, at the last known

address of such party.

WILEY OPEN ACCESS TERMS AND CONDITIONS

Wiley Publishes Open Access Articles in fully Open Access Journals and in Subscription

journals offering Online Open. Although most of the fully Open Access journals publish

open access articles under the terms of the Creative Commons Attribution (CC BY) License

only, the subscription journals and a few of the Open Access Journals offer a choice of

Creative Commons Licenses:: Creative Commons Attribution (CC-BY) license Creative

Commons Attribution Non-Commercial (CC-BY-NC) license and Creative Commons

Attribution Non-Commercial-NoDerivs (CC-BY-NC-ND) License. The license type is

clearly identified on the article.

Copyright in any research article in a journal published as Open Access under a Creative

Commons License is retained by the author(s). Authors grant Wiley a license to publish the

article and identify itself as the original publisher. Authors also grant any third party the

right to use the article freely as long as its integrity is maintained and its original authors,

citation details and publisher are identified as follows: [Title of Article/Author/Journal Title

and Volume/Issue. Copyright (c) [year] [copyright owner as specified in the Journal]. Links

to the final article on Wiley’s website are encouraged where applicable.

The Creative Commons Attribution License

The Creative Commons Attribution License (CC-BY) allows users to copy, distribute and

transmit an article, adapt the article and make commercial use of the article. The CC-BY

license permits commercial and non-commercial re-use of an open access article, as long as

the author is properly attributed.

The Creative Commons Attribution License does not affect the moral rights of authors,

Page 261: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

242

including without limitation the right not to have their work subjected to derogatory

treatment. It also does not affect any other rights held by authors or third parties in the

article, including without limitation the rights of privacy and publicity. Use of the article

must not assert or imply, whether implicitly or explicitly, any connection with, endorsement

or sponsorship of such use by the author, publisher or any other party associated with the

article.

For any reuse or distribution, users must include the copyright notice and make clear to

others that the article is made available under a Creative Commons Attribution license,

linking to the relevant Creative Commons web page.

To the fullest extent permitted by applicable law, the article is made available as is and

without representation or warranties of any kind whether express, implied, statutory or

otherwise and including, without limitation, warranties of title, merchantability, fitness for a

particular purpose, non-infringement, absence of defects, accuracy, or the presence or

absence of errors.

Creative Commons Attribution Non-Commercial License

The Creative Commons Attribution Non-Commercial (CC-BY-NC) License permits use,

distribution and reproduction in any medium, provided the original work is properly cited

and is not used for commercial purposes.(see below)

Creative Commons Attribution-Non-Commercial-NoDerivs License

The Creative Commons Attribution Non-Commercial-NoDerivs License (CC-BY-NC-ND)

permits use, distribution and reproduction in any medium, provided the original work is

properly cited, is not used for commercial purposes and no modifications or adaptations are

made. (see below)

Use by non-commercial users

Page 262: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

243

For non-commercial and non-promotional purposes, individual users may access,

download, copy, display and redistribute to colleagues Wiley Open Access articles, as well

as adapt, translate, text- and data-mine the content subject to the following conditions:

The authors' moral rights are not compromised. These rights include the right of

"paternity" (also known as "attribution" - the right for the author to be identified as

such) and "integrity" (the right for the author not to have the work altered in such a

way that the author's reputation or integrity may be impugned).

Where content in the article is identified as belonging to a third party, it is the

obligation of the user to ensure that any reuse complies with the copyright policies

of the owner of that content.

If article content is copied, downloaded or otherwise reused for non-commercial

research and education purposes, a link to the appropriate bibliographic citation

(authors, journal, article title, volume, issue, page numbers, DOI and the link to the

definitive published version on Wiley Online Library) should be maintained.

Copyright notices and disclaimers must not be deleted.

Any translations, for which a prior translation agreement with Wiley has not been

agreed, must prominently display the statement: "This is an unofficial translation of

an article that appeared in a Wiley publication. The publisher has not endorsed this

translation."

Use by commercial "for-profit" organisations

Use of Wiley Open Access articles for commercial, promotional, or marketing purposes

requires further explicit permission from Wiley and will be subject to a fee. Commercial

purposes include:

Copying or downloading of articles, or linking to such articles for further redistribution, sale

or licensing;

Copying, downloading or posting by a site or service that incorporates advertising

with such content;

The inclusion or incorporation of article content in other works or services (other

than normal quotations with an appropriate citation) that is then available for sale or

licensing, for a fee (for example, a compilation produced for marketing purposes,

inclusion in a sales pack)

Use of article content (other than normal quotations with appropriate citation) by

Page 263: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

244

for-profit organisations for promotional purposes

Linking to article content in e-mails redistributed for promotional, marketing or

educational purposes;

Use for the purposes of monetary reward by means of sale, resale, licence, loan,

transfer or other form of commercial exploitation such as marketing products

Print reprints of Wiley Open Access articles can be purchased from:

[email protected]

Further details can be found on Wiley Online Library

http://olabout.wiley.com/WileyCDA/Section/id-410895.html

Other Terms and Conditions:

v1.9

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-

978-646-2777.

Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license

for your reference. No payment is required.

Page 264: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

245

Copyright clearance for figure 1-3 and 1-4:

Your permission request falls within the STM signatory guidelines, found here: http://www.stm-

assoc.org/permissions-guidelines/ . Permission is automatically granted. Please be sure to

acknowledge the original source of the Elsevier material.

If you have any additional questions, feel free to contact us.

Thank you,

Laura

Laura Stingelin

Permissions Helpdesk Associate

Elsevier

1600 John F. Kennedy Boulevard

Suite 1800

Philadelphia, PA 19103-2899

T: (215) 239-3867

F: (215) 239-3805

Page 265: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

246

Copyright clearance for figure 1-6:

Page 266: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

247

Copyright clearance for Figures 1-5 and 1-7:

Title: Human Multidrug Resistance

ABCB and ABCG

Transporters: Participation in a

Chemoimmunity Defense

System

Author: Balázs Sarkadi,László

Homolya,Gergely

Szakács,András Váradi

Publication: Physiological Reviews

Publisher: The American Physiological

Society

Date: Oct 1, 2006

Copyright © 2006, The American

Physiological Society

Permission Not Required

Permission is not required for this type of

use.

Page 267: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

248

Copyright clearance for figure 1-8:

JOHN WILEY AND SONS LICENSE

TERMS AND CONDITIONS

Oct 28, 2014

This is a License Agreement between Tamima Ashraf ("You") and John Wiley and Sons

("John Wiley and Sons") provided by Copyright Clearance Center ("CCC"). The license

consists of your order details, the terms and conditions provided by John Wiley and Sons,

and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see

information listed at the bottom of this form.

License Number 3464281374110

License date Sep 08, 2014

Licensed content

publisher John Wiley and Sons

Licensed content

publication GLIA

Licensed content title Regulation of ABC membrane transporters in glial cells:

Relevance to the pharmacotherapy of brain HIV-1 infection

Licensed copyright line Copyright © 2008 Wiley-Liss, Inc.

Licensed content author Patrick T. Ronaldson,Yuri Persidsky,Reina Bendayan

Licensed content date Jul 22, 2008

Start page 1711

End page 1735

Type of use Dissertation/Thesis

Requestor type University/Academic

Format Print and electronic

Portion Figure/table

Number of figures/tables 1

Original Wiley

figure/table number(s) Figure 6

Will you be translating? No

Title of your thesis /

dissertation

Regulation of pro-inflammatory cytokines and drug efflux

transporters by signal transduction pathways in glial cells:

Implications in HIV-1 neuropathogenesis and its treatment

Expected completion date Nov 2014

Page 268: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

249

Expected size (number of

pages) 220

Total 0.00 USD

Terms and Conditions

TERMS AND CONDITIONS

This copyrighted material is owned by or exclusively licensed to John Wiley & Sons, Inc.

or one of its group companies (each a"Wiley Company") or handled on behalf of a society

with which a Wiley Company has exclusive publishing rights in relation to a particular

work (collectively "WILEY"). By clicking accept in connection with completing this

licensing transaction, you agree that the following terms and conditions apply to this

transaction (along with the billing and payment terms and conditions established by the

Copyright Clearance Center Inc., ("CCC's Billing and Payment terms and conditions"), at

the time that you opened your Rightslink account (these are available at any time at

http://myaccount.copyright.com).

Terms and Conditions

The materials you have requested permission to reproduce or reuse (the "Wiley

Materials") are protected by copyright.

You are hereby granted a personal, non-exclusive, non-sub licensable (on a stand-

alone basis), non-transferable, worldwide, limited license to reproduce the Wiley

Materials for the purpose specified in the licensing process. This license is for a one-

time use only and limited to any maximum distribution number specified in the

license. The first instance of republication or reuse granted by this licence must be

completed within two years of the date of the grant of this licence (although copies

prepared before the end date may be distributed thereafter). The Wiley Materials

shall not be used in any other manner or for any other purpose, beyond what is

granted in the license. Permission is granted subject to an appropriate

acknowledgement given to the author, title of the material/book/journal and the

publisher. You shall also duplicate the copyright notice that appears in the Wiley

publication in your use of the Wiley Material. Permission is also granted on the

understanding that nowhere in the text is a previously published source

acknowledged for all or part of this Wiley Material. Any third party content is

expressly excluded from this permission.

With respect to the Wiley Materials, all rights are reserved. Except as expressly

granted by the terms of the license, no part of the Wiley Materials may be copied,

modified, adapted (except for minor reformatting required by the new Publication),

translated, reproduced, transferred or distributed, in any form or by any means, and

no derivative works may be made based on the Wiley Materials without the prior

permission of the respective copyright owner. You may not alter, remove or

suppress in any manner any copyright, trademark or other notices displayed by the

Page 269: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

250

Wiley Materials. You may not license, rent, sell, loan, lease, pledge, offer as

security, transfer or assign the Wiley Materials on a stand-alone basis, or any of the

rights granted to you hereunder to any other person.

The Wiley Materials and all of the intellectual property rights therein shall at all

times remain the exclusive property of John Wiley & Sons Inc, the Wiley

Companies, or their respective licensors, and your interest therein is only that of

having possession of and the right to reproduce the Wiley Materials pursuant to

Section 2 herein during the continuance of this Agreement. You agree that you own

no right, title or interest in or to the Wiley Materials or any of the intellectual

property rights therein. You shall have no rights hereunder other than the license as

provided for above in Section 2. No right, license or interest to any trademark, trade

name, service mark or other branding ("Marks") of WILEY or its licensors is

granted hereunder, and you agree that you shall not assert any such right, license or

interest with respect thereto.

NEITHER WILEY NOR ITS LICENSORS MAKES ANY WARRANTY OR

REPRESENTATION OF ANY KIND TO YOU OR ANY THIRD PARTY,

EXPRESS, IMPLIED OR STATUTORY, WITH RESPECT TO THE

MATERIALS OR THE ACCURACY OF ANY INFORMATION CONTAINED IN

THE MATERIALS, INCLUDING, WITHOUT LIMITATION, ANY IMPLIED

WARRANTY OF MERCHANTABILITY, ACCURACY, SATISFACTORY

QUALITY, FITNESS FOR A PARTICULAR PURPOSE, USABILITY,

INTEGRATION OR NON-INFRINGEMENT AND ALL SUCH WARRANTIES

ARE HEREBY EXCLUDED BY WILEY AND ITS LICENSORS AND WAIVED

BY YOU

WILEY shall have the right to terminate this Agreement immediately upon breach

of this Agreement by you.

You shall indemnify, defend and hold harmless WILEY, its Licensors and their

respective directors, officers, agents and employees, from and against any actual or

threatened claims, demands, causes of action or proceedings arising from any breach

of this Agreement by you.

IN NO EVENT SHALL WILEY OR ITS LICENSORS BE LIABLE TO YOU OR

ANY OTHER PARTY OR ANY OTHER PERSON OR ENTITY FOR ANY

SPECIAL, CONSEQUENTIAL, INCIDENTAL, INDIRECT, EXEMPLARY OR

PUNITIVE DAMAGES, HOWEVER CAUSED, ARISING OUT OF OR IN

CONNECTION WITH THE DOWNLOADING, PROVISIONING, VIEWING OR

USE OF THE MATERIALS REGARDLESS OF THE FORM OF ACTION,

WHETHER FOR BREACH OF CONTRACT, BREACH OF WARRANTY,

TORT, NEGLIGENCE, INFRINGEMENT OR OTHERWISE (INCLUDING,

WITHOUT LIMITATION, DAMAGES BASED ON LOSS OF PROFITS, DATA,

FILES, USE, BUSINESS OPPORTUNITY OR CLAIMS OF THIRD PARTIES),

AND WHETHER OR NOT THE PARTY HAS BEEN ADVISED OF THE

POSSIBILITY OF SUCH DAMAGES. THIS LIMITATION SHALL APPLY

Page 270: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

251

NOTWITHSTANDING ANY FAILURE OF ESSENTIAL PURPOSE OF ANY

LIMITED REMEDY PROVIDED HEREIN.

Should any provision of this Agreement be held by a court of competent jurisdiction

to be illegal, invalid, or unenforceable, that provision shall be deemed amended to

achieve as nearly as possible the same economic effect as the original provision, and

the legality, validity and enforceability of the remaining provisions of this

Agreement shall not be affected or impaired thereby.

The failure of either party to enforce any term or condition of this Agreement shall

not constitute a waiver of either party's right to enforce each and every term and

condition of this Agreement. No breach under this agreement shall be deemed

waived or excused by either party unless such waiver or consent is in writing signed

by the party granting such waiver or consent. The waiver by or consent of a party to

a breach of any provision of this Agreement shall not operate or be construed as a

waiver of or consent to any other or subsequent breach by such other party.

This Agreement may not be assigned (including by operation of law or otherwise)

by you without WILEY's prior written consent.

Any fee required for this permission shall be non-refundable after thirty (30) days

from receipt by the CCC.

These terms and conditions together with CCC’s Billing and Payment terms and

conditions (which are incorporated herein) form the entire agreement between you

and WILEY concerning this licensing transaction and (in the absence of fraud)

supersedes all prior agreements and representations of the parties, oral or written.

This Agreement may not be amended except in writing signed by both parties. This

Agreement shall be binding upon and inure to the benefit of the parties' successors,

legal representatives, and authorized assigns.

In the event of any conflict between your obligations established by these terms and

conditions and those established by CCC’s Billing and Payment terms and

conditions, these terms and conditions shall prevail.

WILEY expressly reserves all rights not specifically granted in the combination of

(i) the license details provided by you and accepted in the course of this licensing

transaction, (ii) these terms and conditions and (iii) CCC’s Billing and Payment

terms and conditions.

This Agreement will be void if the Type of Use, Format, Circulation, or Requestor

Type was misrepresented during the licensing process.

This Agreement shall be governed by and construed in accordance with the laws of

the State of New York, USA, without regards to such state’s conflict of law rules.

Any legal action, suit or proceeding arising out of or relating to these Terms and

Conditions or the breach thereof shall be instituted in a court of competent

Page 271: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

252

jurisdiction in New York County in the State of New York in the United States of

America and each party hereby consents and submits to the personal jurisdiction of

such court, waives any objection to venue in such court and consents to service of

process by registered or certified mail, return receipt requested, at the last known

address of such party.

WILEY OPEN ACCESS TERMS AND CONDITIONS

Wiley Publishes Open Access Articles in fully Open Access Journals and in Subscription

journals offering Online Open. Although most of the fully Open Access journals publish

open access articles under the terms of the Creative Commons Attribution (CC BY) License

only, the subscription journals and a few of the Open Access Journals offer a choice of

Creative Commons Licenses:: Creative Commons Attribution (CC-BY) license Creative

Commons Attribution Non-Commercial (CC-BY-NC) license and Creative Commons

Attribution Non-Commercial-NoDerivs (CC-BY-NC-ND) License. The license type is

clearly identified on the article.

Copyright in any research article in a journal published as Open Access under a Creative

Commons License is retained by the author(s). Authors grant Wiley a license to publish the

article and identify itself as the original publisher. Authors also grant any third party the

right to use the article freely as long as its integrity is maintained and its original authors,

citation details and publisher are identified as follows: [Title of Article/Author/Journal Title

and Volume/Issue. Copyright (c) [year] [copyright owner as specified in the Journal]. Links

to the final article on Wiley’s website are encouraged where applicable.

The Creative Commons Attribution License

The Creative Commons Attribution License (CC-BY) allows users to copy, distribute and

transmit an article, adapt the article and make commercial use of the article. The CC-BY

license permits commercial and non-commercial re-use of an open access article, as long as

the author is properly attributed.

The Creative Commons Attribution License does not affect the moral rights of authors,

including without limitation the right not to have their work subjected to derogatory

treatment. It also does not affect any other rights held by authors or third parties in the

article, including without limitation the rights of privacy and publicity. Use of the article

must not assert or imply, whether implicitly or explicitly, any connection with, endorsement

or sponsorship of such use by the author, publisher or any other party associated with the

article.

For any reuse or distribution, users must include the copyright notice and make clear to

others that the article is made available under a Creative Commons Attribution license,

linking to the relevant Creative Commons web page.

To the fullest extent permitted by applicable law, the article is made available as is and

without representation or warranties of any kind whether express, implied, statutory or

otherwise and including, without limitation, warranties of title, merchantability, fitness for a

Page 272: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

253

particular purpose, non-infringement, absence of defects, accuracy, or the presence or

absence of errors.

Creative Commons Attribution Non-Commercial License

The Creative Commons Attribution Non-Commercial (CC-BY-NC) License permits use,

distribution and reproduction in any medium, provided the original work is properly cited

and is not used for commercial purposes.(see below)

Creative Commons Attribution-Non-Commercial-NoDerivs License

The Creative Commons Attribution Non-Commercial-NoDerivs License (CC-BY-NC-ND)

permits use, distribution and reproduction in any medium, provided the original work is

properly cited, is not used for commercial purposes and no modifications or adaptations are

made. (see below)

Use by non-commercial users

For non-commercial and non-promotional purposes, individual users may access,

download, copy, display and redistribute to colleagues Wiley Open Access articles, as well

as adapt, translate, text- and data-mine the content subject to the following conditions:

The authors' moral rights are not compromised. These rights include the right of

"paternity" (also known as "attribution" - the right for the author to be identified as

such) and "integrity" (the right for the author not to have the work altered in such a

way that the author's reputation or integrity may be impugned).

Where content in the article is identified as belonging to a third party, it is the

obligation of the user to ensure that any reuse complies with the copyright policies

of the owner of that content.

If article content is copied, downloaded or otherwise reused for non-commercial

research and education purposes, a link to the appropriate bibliographic citation

(authors, journal, article title, volume, issue, page numbers, DOI and the link to the

definitive published version on Wiley Online Library) should be maintained.

Copyright notices and disclaimers must not be deleted.

Any translations, for which a prior translation agreement with Wiley has not been

agreed, must prominently display the statement: "This is an unofficial translation of

an article that appeared in a Wiley publication. The publisher has not endorsed this

translation."

Use by commercial "for-profit" organisations

Use of Wiley Open Access articles for commercial, promotional, or marketing purposes

Page 273: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

254

requires further explicit permission from Wiley and will be subject to a fee. Commercial

purposes include:

Copying or downloading of articles, or linking to such articles for further

redistribution, sale or licensing;

Copying, downloading or posting by a site or service that incorporates advertising

with such content;

The inclusion or incorporation of article content in other works or services (other

than normal quotations with an appropriate citation) that is then available for sale or

licensing, for a fee (for example, a compilation produced for marketing purposes,

inclusion in a sales pack)

Use of article content (other than normal quotations with appropriate citation) by

for-profit organisations for promotional purposes

Linking to article content in e-mails redistributed for promotional, marketing or

educational purposes;

Use for the purposes of monetary reward by means of sale, resale, licence, loan,

transfer or other form of commercial exploitation such as marketing products

Print reprints of Wiley Open Access articles can be purchased from:

[email protected]

Further details can be found on Wiley Online Library

http://olabout.wiley.com/WileyCDA/Section/id-410895.html

Other Terms and Conditions:

v1.9

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-

978-646-2777. Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license

for your reference. No payment is required.

Page 274: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

255

Copyright clearance for chapter 2:

Copyright clearance for chapter 3:

JOHN WILEY AND SONS LICENSE

TERMS AND CONDITIONS

Oct 28, 2014

Page 275: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

256

This is a License Agreement between Tamima Ashraf ("You") and John Wiley and Sons

("John Wiley and Sons") provided by Copyright Clearance Center ("CCC"). The license

consists of your order details, the terms and conditions provided by John Wiley and Sons,

and the payment terms and conditions.

All payments must be made in full to CCC. For payment instructions, please see

information listed at the bottom of this form.

License Number 3464271107922

License date Sep 08, 2014

Licensed content

publisher John Wiley and Sons

Licensed content

publication Journal of Neuroscience Research

Licensed content title Regulation of P-glycoprotein by human immunodeficiency virus-1

in primary cultures of human fetal astrocytes

Licensed copyright line Copyright © 2011 Wiley-Liss, Inc.

Licensed content author Tamima Ashraf,Patrick T. Ronaldson,Yuri Persidsky,Reina

Bendayan

Licensed content date Aug 8, 2011

Start page 1773

End page 1782

Type of use Dissertation/Thesis

Requestor type Author of this Wiley article

Format Print

Portion Full article

Will you be translating? No

Title of your thesis /

dissertation

Regulation of pro-inflammatory cytokines and drug efflux

transporters by signal transduction pathways in glial cells:

Implications in HIV-1 neuropathogenesis and its treatment

Expected completion

date Nov 2014

Expected size (number

of pages) 220

Total 0.00 USD

Terms and Conditions

Page 276: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

257

TERMS AND CONDITIONS

This copyrighted material is owned by or exclusively licensed to John Wiley & Sons, Inc.

or one of its group companies (each a"Wiley Company") or handled on behalf of a society

with which a Wiley Company has exclusive publishing rights in relation to a particular

work (collectively "WILEY"). By clicking accept in connection with completing this

licensing transaction, you agree that the following terms and conditions apply to this

transaction (along with the billing and payment terms and conditions established by the

Copyright Clearance Center Inc., ("CCC's Billing and Payment terms and conditions"), at

the time that you opened your Rightslink account (these are available at any time at

http://myaccount.copyright.com).

Terms and Conditions

The materials you have requested permission to reproduce or reuse (the "Wiley

Materials") are protected by copyright.

You are hereby granted a personal, non-exclusive, non-sub licensable (on a stand-

alone basis), non-transferable, worldwide, limited license to reproduce the Wiley

Materials for the purpose specified in the licensing process. This license is for a one-

time use only and limited to any maximum distribution number specified in the

license. The first instance of republication or reuse granted by this licence must be

completed within two years of the date of the grant of this licence (although copies

prepared before the end date may be distributed thereafter). The Wiley Materials

shall not be used in any other manner or for any other purpose, beyond what is

granted in the license. Permission is granted subject to an appropriate

acknowledgement given to the author, title of the material/book/journal and the

publisher. You shall also duplicate the copyright notice that appears in the Wiley

publication in your use of the Wiley Material. Permission is also granted on the

understanding that nowhere in the text is a previously published source

acknowledged for all or part of this Wiley Material. Any third party content is

expressly excluded from this permission.

With respect to the Wiley Materials, all rights are reserved. Except as expressly

granted by the terms of the license, no part of the Wiley Materials may be copied,

modified, adapted (except for minor reformatting required by the new Publication),

translated, reproduced, transferred or distributed, in any form or by any means, and

no derivative works may be made based on the Wiley Materials without the prior

permission of the respective copyright owner. You may not alter, remove or

suppress in any manner any copyright, trademark or other notices displayed by the

Wiley Materials. You may not license, rent, sell, loan, lease, pledge, offer as

security, transfer or assign the Wiley Materials on a stand-alone basis, or any of the

rights granted to you hereunder to any other person.

The Wiley Materials and all of the intellectual property rights therein shall at all

times remain the exclusive property of John Wiley & Sons Inc, the Wiley

Page 277: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

258

Companies, or their respective licensors, and your interest therein is only that of

having possession of and the right to reproduce the Wiley Materials pursuant to

Section 2 herein during the continuance of this Agreement. You agree that you own

no right, title or interest in or to the Wiley Materials or any of the intellectual

property rights therein. You shall have no rights hereunder other than the license as

provided for above in Section 2. No right, license or interest to any trademark, trade

name, service mark or other branding ("Marks") of WILEY or its licensors is

granted hereunder, and you agree that you shall not assert any such right, license or

interest with respect thereto.

NEITHER WILEY NOR ITS LICENSORS MAKES ANY WARRANTY OR

REPRESENTATION OF ANY KIND TO YOU OR ANY THIRD PARTY,

EXPRESS, IMPLIED OR STATUTORY, WITH RESPECT TO THE

MATERIALS OR THE ACCURACY OF ANY INFORMATION CONTAINED IN

THE MATERIALS, INCLUDING, WITHOUT LIMITATION, ANY IMPLIED

WARRANTY OF MERCHANTABILITY, ACCURACY, SATISFACTORY

QUALITY, FITNESS FOR A PARTICULAR PURPOSE, USABILITY,

INTEGRATION OR NON-INFRINGEMENT AND ALL SUCH WARRANTIES

ARE HEREBY EXCLUDED BY WILEY AND ITS LICENSORS AND WAIVED

BY YOU

WILEY shall have the right to terminate this Agreement immediately upon breach

of this Agreement by you.

You shall indemnify, defend and hold harmless WILEY, its Licensors and their

respective directors, officers, agents and employees, from and against any actual or

threatened claims, demands, causes of action or proceedings arising from any breach

of this Agreement by you.

IN NO EVENT SHALL WILEY OR ITS LICENSORS BE LIABLE TO YOU OR

ANY OTHER PARTY OR ANY OTHER PERSON OR ENTITY FOR ANY

SPECIAL, CONSEQUENTIAL, INCIDENTAL, INDIRECT, EXEMPLARY OR

PUNITIVE DAMAGES, HOWEVER CAUSED, ARISING OUT OF OR IN

CONNECTION WITH THE DOWNLOADING, PROVISIONING, VIEWING OR

USE OF THE MATERIALS REGARDLESS OF THE FORM OF ACTION,

WHETHER FOR BREACH OF CONTRACT, BREACH OF WARRANTY,

TORT, NEGLIGENCE, INFRINGEMENT OR OTHERWISE (INCLUDING,

WITHOUT LIMITATION, DAMAGES BASED ON LOSS OF PROFITS, DATA,

FILES, USE, BUSINESS OPPORTUNITY OR CLAIMS OF THIRD PARTIES),

AND WHETHER OR NOT THE PARTY HAS BEEN ADVISED OF THE

POSSIBILITY OF SUCH DAMAGES. THIS LIMITATION SHALL APPLY

NOTWITHSTANDING ANY FAILURE OF ESSENTIAL PURPOSE OF ANY

LIMITED REMEDY PROVIDED HEREIN.

Should any provision of this Agreement be held by a court of competent jurisdiction

to be illegal, invalid, or unenforceable, that provision shall be deemed amended to

achieve as nearly as possible the same economic effect as the original provision, and

Page 278: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

259

the legality, validity and enforceability of the remaining provisions of this

Agreement shall not be affected or impaired thereby.

The failure of either party to enforce any term or condition of this Agreement shall

not constitute a waiver of either party's right to enforce each and every term and

condition of this Agreement. No breach under this agreement shall be deemed

waived or excused by either party unless such waiver or consent is in writing signed

by the party granting such waiver or consent. The waiver by or consent of a party to

a breach of any provision of this Agreement shall not operate or be construed as a

waiver of or consent to any other or subsequent breach by such other party.

This Agreement may not be assigned (including by operation of law or otherwise)

by you without WILEY's prior written consent.

Any fee required for this permission shall be non-refundable after thirty (30) days

from receipt by the CCC.

These terms and conditions together with CCC’s Billing and Payment terms and

conditions (which are incorporated herein) form the entire agreement between you

and WILEY concerning this licensing transaction and (in the absence of fraud)

supersedes all prior agreements and representations of the parties, oral or written.

This Agreement may not be amended except in writing signed by both parties. This

Agreement shall be binding upon and inure to the benefit of the parties' successors,

legal representatives, and authorized assigns.

In the event of any conflict between your obligations established by these terms and

conditions and those established by CCC’s Billing and Payment terms and

conditions, these terms and conditions shall prevail.

WILEY expressly reserves all rights not specifically granted in the combination of

(i) the license details provided by you and accepted in the course of this licensing

transaction, (ii) these terms and conditions and (iii) CCC’s Billing and Payment

terms and conditions.

This Agreement will be void if the Type of Use, Format, Circulation, or Requestor

Type was misrepresented during the licensing process.

This Agreement shall be governed by and construed in accordance with the laws of

the State of New York, USA, without regards to such state’s conflict of law rules.

Any legal action, suit or proceeding arising out of or relating to these Terms and

Conditions or the breach thereof shall be instituted in a court of competent

jurisdiction in New York County in the State of New York in the United States of

America and each party hereby consents and submits to the personal jurisdiction of

such court, waives any objection to venue in such court and consents to service of

process by registered or certified mail, return receipt requested, at the last known

address of such party.

Page 279: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

260

WILEY OPEN ACCESS TERMS AND CONDITIONS

Wiley Publishes Open Access Articles in fully Open Access Journals and in Subscription

journals offering Online Open. Although most of the fully Open Access journals publish

open access articles under the terms of the Creative Commons Attribution (CC BY) License

only, the subscription journals and a few of the Open Access Journals offer a choice of

Creative Commons Licenses:: Creative Commons Attribution (CC-BY) license Creative

Commons Attribution Non-Commercial (CC-BY-NC) license and Creative Commons

Attribution Non-Commercial-NoDerivs (CC-BY-NC-ND) License. The license type is

clearly identified on the article.

Copyright in any research article in a journal published as Open Access under a Creative

Commons License is retained by the author(s). Authors grant Wiley a license to publish the

article and identify itself as the original publisher. Authors also grant any third party the

right to use the article freely as long as its integrity is maintained and its original authors,

citation details and publisher are identified as follows: [Title of Article/Author/Journal Title

and Volume/Issue. Copyright (c) [year] [copyright owner as specified in the Journal]. Links

to the final article on Wiley’s website are encouraged where applicable.

The Creative Commons Attribution License

The Creative Commons Attribution License (CC-BY) allows users to copy, distribute and

transmit an article, adapt the article and make commercial use of the article. The CC-BY

license permits commercial and non-commercial re-use of an open access article, as long as

the author is properly attributed.

The Creative Commons Attribution License does not affect the moral rights of authors,

including without limitation the right not to have their work subjected to derogatory

treatment. It also does not affect any other rights held by authors or third parties in the

article, including without limitation the rights of privacy and publicity. Use of the article

must not assert or imply, whether implicitly or explicitly, any connection with, endorsement

or sponsorship of such use by the author, publisher or any other party associated with the

article.

For any reuse or distribution, users must include the copyright notice and make clear to

others that the article is made available under a Creative Commons Attribution license,

linking to the relevant Creative Commons web page.

To the fullest extent permitted by applicable law, the article is made available as is and

without representation or warranties of any kind whether express, implied, statutory or

otherwise and including, without limitation, warranties of title, merchantability, fitness for a

particular purpose, non-infringement, absence of defects, accuracy, or the presence or

absence of errors.

Creative Commons Attribution Non-Commercial License

The Creative Commons Attribution Non-Commercial (CC-BY-NC) License permits use,

Page 280: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

261

distribution and reproduction in any medium, provided the original work is properly cited

and is not used for commercial purposes.(see below)

Creative Commons Attribution-Non-Commercial-NoDerivs License

The Creative Commons Attribution Non-Commercial-NoDerivs License (CC-BY-NC-ND)

permits use, distribution and reproduction in any medium, provided the original work is

properly cited, is not used for commercial purposes and no modifications or adaptations are

made. (see below)

Use by non-commercial users

For non-commercial and non-promotional purposes, individual users may access,

download, copy, display and redistribute to colleagues Wiley Open Access articles, as well

as adapt, translate, text- and data-mine the content subject to the following conditions:

The authors' moral rights are not compromised. These rights include the right of

"paternity" (also known as "attribution" - the right for the author to be identified as

such) and "integrity" (the right for the author not to have the work altered in such a

way that the author's reputation or integrity may be impugned).

Where content in the article is identified as belonging to a third party, it is the

obligation of the user to ensure that any reuse complies with the copyright policies

of the owner of that content.

If article content is copied, downloaded or otherwise reused for non-commercial

research and education purposes, a link to the appropriate bibliographic citation

(authors, journal, article title, volume, issue, page numbers, DOI and the link to the

definitive published version on Wiley Online Library) should be maintained.

Copyright notices and disclaimers must not be deleted.

Any translations, for which a prior translation agreement with Wiley has not been

agreed, must prominently display the statement: "This is an unofficial translation of

an article that appeared in a Wiley publication. The publisher has not endorsed this

translation."

Use by commercial "for-profit" organisations

Use of Wiley Open Access articles for commercial, promotional, or marketing purposes

requires further explicit permission from Wiley and will be subject to a fee. Commercial

purposes include:

Copying or downloading of articles, or linking to such articles for further

redistribution, sale or licensing;

Page 281: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

262

Copying, downloading or posting by a site or service that incorporates advertising

with such content;

The inclusion or incorporation of article content in other works or services (other

than normal quotations with an appropriate citation) that is then available for sale or

licensing, for a fee (for example, a compilation produced for marketing purposes,

inclusion in a sales pack)

Use of article content (other than normal quotations with appropriate citation) by

for-profit organisations for promotional purposes

Linking to article content in e-mails redistributed for promotional, marketing or

educational purposes;

Use for the purposes of monetary reward by means of sale, resale, licence, loan,

transfer or other form of commercial exploitation such as marketing products

Print reprints of Wiley Open Access articles can be purchased from:

[email protected]

Further details can be found on Wiley Online Library

http://olabout.wiley.com/WileyCDA/Section/id-410895.html

Other Terms and Conditions:

v1.9

Questions? [email protected] or +1-855-239-3415 (toll free in the US) or +1-

978-646-2777.

Gratis licenses (referencing $0 in the Total field) are free. Please retain this printable license

for your reference. No payment is required.

Copyright clearance for chapter 4:

Manuscript: Role of anti-inflammatory compounds in human immunodeficiency virus-1

glycoprotein120-mediated brain inflammation

Authors: Tamima Ashraf, Wenlei Jiang, Md Tozammel Hoque, Jeffrey Henderson, Chiping Wu

and Reina Bendayan

Received: 7 March 2014

Accepted: 15 April 2014

Page 282: In vitro and in vivo regulation of pro-inflammatory cytokines and … › bitstream › 1807 › 69208 › ... · 2015-07-17 · Tamima Ashraf Doctor of Philosophy Graduate Department

263

Published: 16 May 2014

© 2014 Ashraf et al.; licensee BioMed Central Ltd.

This is an Open Access article distributed under the terms of the Creative Commons Attribution

License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use,

distribution, and reproduction in any medium, provided the original work is properly credited.