in vitro 71 in foot and mouth disease yan long lui... · 2015. 3. 10. · elucidating the...
TRANSCRIPT
ELUCIDATING THE HOST-PATHOGEN INTERACTIONS BETWEEN IN VITRO
HUMAN CELLS AND ENTEROVIRUS 71 IN HAND, FOOT AND MOUTH DISEASE (HFMD)
Yan Long Edmund LUI Bachelor of Science (First Class Honours) in Biochemistry
(The University of Queensland) Bachelor of Science with double majors in Biomedical Science
and Microbiology (The University of Queensland)
Submitted in partial fulfilment of the requirements for the degree of
Doctor of Philosophy
Institute of Health & Biomedical Innovation (IHBI)
School of Biomedical Sciences, Faculty of Health
Queensland University of Technology
2015
I
Keywords
Antiviral, colorectal cells, cytoskeleton, DGCR8, droplet digital PCR, enterovirus 71,
Hand, foot and mouth disease, microRNAs, transcriptomic
II
List of Publications and Manuscripts
The following is a list of publications that have been prepared in conjunction with
this thesis.
Lui, Y.L.E., Timms P, Hafner L, Tan T, Tan K, Tan E (2013)
Characterisation of enterovirus 71 replication kinetics in human colorectal
cell line, HT29. SpringerPlus 2 (1):267
Lui, Y.L.E., T.L. Tan, P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan, (2014)
Elucidating the host–pathogen interaction between human colorectal cells and
invading Enterovirus 71 using transcriptomic profiling. FEBS Open Bio 4:
426-431.
Lui, Y.L.E., T.L. Tan, W.H. Woo, P. Timms, L.M. Hafner, K.H. Tan & E.L.
Tan, (2014) Enterovirus71 (EV71) Utilise Host microRNAs to Mediate Host
Immune System Enhancing Survival during Infection. PLoS ONE 9:
e102997.
Lui, Y. L. E., Z. Y. Lin, J. J. Lee, V. T. K. Chow, C. L. Poh & E. L. Tan,
(2013) Beta-actin variant is necessary for Enterovirus 71 replication.
Biochemical and Biophysical Research Communications. 433 (4):607-610.
III
Lui, Y.L.E. & E.L. Tan, (2014) Droplet digital PCR as a useful tool for the
quantitative detection of Enterovirus 71. Journal of Virological Methods 207:
200-203.
IV
The following is a list of publications not related this thesis but generated during
PhD candidature.
I.Russell Lee*, Edmund Y. L. Lui*, Eve W. L. Chow, Sammantha D. M
Arras, Carl A Morrow and James A Fraser. Reactive Oxygen Species
Homeostasis and Virulence of the Fungal Pathogen Cryptococcus
neoformans requires an intact Proline Catabolism Pathway (2013) Genetics
194, 421-33. *These authors contributed equally.
Lee IR, Yang L, Sebetso G, Allen R, Doan THN, Blundell R, Lui EYL,
Morrow CA, Fraser JA (2013) Characterization of the Complete Uric Acid
Degradation Pathway in the Fungal Pathogen Cryptococcus neoformans.
PLoS One 8 (5).
V
Thesis-associated abstracts and presentations
Lui, Y.L.E., P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan. Type I, II and III
interferons may be a key antiviral response during enterovirus 71 infection of
in vitro colorectal cells. (Selected for Oral Presentation) Australian Society of
Microbiology Annual Scientific Meeting 2014, Melbourne, Australia (2014)
Lui, Y.L.E., P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan.. Transcriptomic
analysis of human colorectal cells in response to enterovirus 71 infection.
114th America Society of Microbiology General Meeting 2014, Boston,
United States of America (2014)
Lui, Y.L.E. & E.L. Tan, Absolute quantitative detection of enterovirus 71
using Droplet Digital PCR. Australian Society of Microbiology Annual
Scientific Meeting 2014, Melbourne, Australia (2014)
Lui, Y.L.E., T.L. Tan, W.H. Woo, P. Timms, L.M. Hafner, K.H. Tan & E.L.
Tan, Subversion of the host–pathogen interaction between human colorectal
cells and invading Enterovirus 71 in HFMD using miRNAs profiling
Singapore Health and Biomedical Congress, Singapore, Annals of the
Academy of Medicine, Singapore (AAMS) (2014).
VI
Lui, Y.L.E., Timms P, Hafner L, Tan T, Tan K, Tan E (2013) Quantitative
analysis of EV71 in Human Gastrointestinal cell line. Abstract of Human
Genome Meeting 2013 / 21st International Congress of Genetics, Singapore
(2013)
Lui, Y.L.E., Timms P, Hafner L, Tan T, Tan K, Tan E (2013) Human
colorectal adenocarcinoma cell line (HT29) as an in vitro model for EV71.
Abstract of 4th Congress of Asia Association of Medical Laboratory Scientists
(AAMLS) and 24th ASM of Singapore Association of Medical Laboratory
Sciences (SAMLS), Singapore (2013)
VII
Abstract
Hand Foot and Mouth Disease (HFMD) is a contagious viral disease that
commonly affects infants and children. HFMD, caused by a group of enteroviruses,
is characterised by various symptoms such as fever, rashes, poor appetite and
multiple ulcers in mouth. The two major etiological agents of this disease are the
coxsackievirus A16 (CA16) and enterovirus 71 (EV71). However, unlike other
HFMD causing enteroviruses, EV71 has been commonly associated with severe
clinical manifestation leading to cardiopulmonary failure and death. Such clinical
presentation is in contrast to other HFMD causing enteroviruses which are often mild
and self-limiting. However due to a lack of understanding on EV71 pathogenesis
there are currently no effective antiviral therapies or vaccines approved by the United
States of America Food and Drug Administration (FDA) to prevent HFMD.
To address this gap in the literature, this study aimed to 1) establish an in vitro model
of viral infection of human cells by using rhabdomyosarcoma (RD) cells and human
epithelial colorectal cell line (HT29), which mimic in vivo host-pathogen interactions
of EV71 virus infection of human cells and 2) integrate the results from investigating
host-pathogen interaction between human colorectal cells and invading EV71
(including miRNA and mRNA) and 3) through the examination of the effect of EV71
replication in miRNA depleted cells.
VIII
Chapter One of this thesis provides a detailed literature review of the general
background of work, explored the scientific problem being investigated and the
overall aims of the study. Chapter Two is the first of the five result chapters where
we established the human colorectal cells (HT29) as a viable and a more relevant in
vitro model to study EV71 pathogenesis. Chapter Three provides an in depth
transcriptomic analysis to elucidate the host-pathogen interaction between the
established human colorectal cells and invading enterovirus 71. Our results suggested
that types I, II and III interferon signalling pathways may be the key defence
mechanism against EV71 in intestinal epithelial cells. In Chapter Four, we evaluated
the importance of miRNAs during EV71 infection by performing a global
knockdown of miRNAs in human epithelial colorectal cells. We have demonstrated
that the global knockdown of miRNAs resulted in severe deficiency in EV71
replication which suggests that EV71 utilised miRNAs during infection and in the
absence of miRNAs, EV71 was unable to successfully mount an infection. To further
explore the involvement of miRNA during EV71 infection, we examined the changes
in miRNA profile during EV71 infection. We demonstrated that there are miRNAs
changes during EV71 pathogenesis and alteration to the host antiviral pathways
during infection.
Chapter Five, reports the comparative proteomic analyses on EV71-susceptible
and EV71-resistant cells. We demonstrated that EV71 infection may be actin
dependent. This was consistent with existing literatures that the knockdown of genes
that were important in actin polymerisation or the use of actin disrupting drug would
result in decrease of EV71 replication kinetics. In Chapter Six, we evaluated if the
droplet digital PCR was a useful tool for the detection and the absolute quantitation
IX
of EV71 viral copy number. We demonstrated that the ddPCR platform to be
generally comparable if not better to real-time PCR platform which could be used for
monitoring antiviral therapeutics in EV71 infected patients.
Finally, Chapter Seven provides an overall discussion of the key findings of
this project. Taken together, this thesis has provided further understanding of the
pathogenesis of EV71. Elucidating the host-pathogen interaction and the mechanism
that the virus uses to bypass host defence systems to establish infection will aid in the
development of potential antiviral therapeutics for HFMD patients.
X
Table of Contents
Keywords ................................................................................................................................................ I List of Publications and Manuscripts ..................................................................................................... II Thesis-associated abstracts and presentations ........................................................................................ V Abstract ............................................................................................................................................... VII Table of Contents ................................................................................................................................... X List of Figures ..................................................................................................................................... XII List of Tables ..................................................................................................................................... XIV List of Abbreviations .......................................................................................................................... XV Statement of Original Authorship .................................................................................................... XVII Acknowledgements ......................................................................................................................... XVIII CHAPTER 1: LITERATURE REVIEW ........................................................................................... 2 1.1 Infections of humans with HFMD viruses ................................................................................... 2 1.2 Clinical manifestation of EV71 infections ................................................................................... 3 1.3 Epidemiology of EV71 ................................................................................................................ 4 1.4 Picornavirdae ............................................................................................................................... 5 1.5 Genogroups of EV71 ................................................................................................................... 7 1.6 Genomic and structural characteristics of Enteroviruses ............................................................. 9 1.7 Intravenous immunoglobulin treatment ..................................................................................... 11 1.8 Development of vaccine against EV71 ...................................................................................... 12 1.9 Current antiviral therapeutics against EV71 .............................................................................. 15 1.10 EV71 pathogenesis .................................................................................................................... 17 1.11 Host pathogen interaction .......................................................................................................... 19 1.12 Host antiviral factors and signalling pathways .......................................................................... 20 1.13 microRNA and Transcriptional regulation ................................................................................ 21 1.14 Control of HFMD viral infections and the diagnosis of EV71 .................................................. 25 1.15 The Overall Objectives of the Study .......................................................................................... 28 1.16 The Specific Aims of the Study ................................................................................................. 29 1.17 An account of Scientific Progress Linking to the Scientific Papers ........................................... 30 1.18 References.................................................................................................................................. 32 CHAPTER 2: CHARACTERISATION OF ENTEROVIRUS 71 REPLICATION KINETICS IN HUMAN COLORECTAL CELL LINE, HT29 .......................................................................... 52 2.1 Introduction................................................................................................................................ 53 2.2 Materials and Methods ............................................................................................................... 55 2.3 Results ....................................................................................................................................... 59 2.4 Discussion .................................................................................................................................. 67 2.5 Conclusion ................................................................................................................................. 70 2.6 References.................................................................................................................................. 71
XI
CHAPTER 3: ELUCIDATING THE HOST-PATHOGEN INTERACTION BETWEEN HUMAN COLORECTAL CELLS AND INVADING ENTEROVIRUS71 USING TRANSCRIPTOMIC PROFILING .................................................................................................. 82 3.1 Introduction ................................................................................................................................ 83 3.2 Materials and Methods ............................................................................................................... 85 3.3 Results and Discussion .............................................................................................................. 89 3.4 Conclusion ................................................................................................................................. 98 3.5 References .................................................................................................................................. 99 CHAPTER 4: EV71 UTILISE HOST MICRORNAS TO MEDIATE HOST IMMUNE SYSTEM ENHANCING SURVIVAL DURING INFECTION .................................................... 110 4.1 Introduction .............................................................................................................................. 111 4.2 Materials and Methods ............................................................................................................. 113 4.3 Results ...................................................................................................................................... 120 4.4 Discussion ................................................................................................................................ 123 4.5 Conclusion ............................................................................................................................... 138 4.6 References ................................................................................................................................ 139 CHAPTER 5: BETA-ACTIN VARIANT IS NECESSARY FOR ENTEROVIRUS 71 REPLICATION................................................................................................................................. 151 5.1 Introduction .............................................................................................................................. 152 5.2 Materials and Methods ............................................................................................................. 153 5.3 Results and Discussion ............................................................................................................ 156 5.4 Conclusion ............................................................................................................................... 159 5.5 References ................................................................................................................................ 160 CHAPTER 6: DROPLET DIGITAL PCR AS A USEFUL TOOL FOR THE QUANTITATIVE DETECTION OF ENTEROVIRUS71 ............................................................................................ 168 6.1 Introduction .............................................................................................................................. 169 6.2 Materials and Methods ............................................................................................................. 171 6.3 Results ...................................................................................................................................... 173 6.4 Discussion ................................................................................................................................ 175 6.5 References ................................................................................................................................ 180 CHAPTER 7: GENERAL DISCUSSION ...................................................................................... 186 7.1 Overall Discussion ................................................................................................................... 186 7.2 Future Directions ..................................................................................................................... 202 7.3 References ................................................................................................................................ 204 BIBLIOGRAPHY ............................................................................................................................. 220 APPENDICES ................................................................................................................................... 248
XII
List of Figures
Figure 1.1 Geographic distributions of EV71 genogroups from 1960 to 2011.
Figure 1.2 Schematic diagram of enterovirus genome and their respective functions.
Figure 1.3 Schematic diagram of miRNA biogenesis.
Figure 2.1 Absolute quantification of EV71.
Figure 2.2 Cell viability of HT29 cells following EV71 infection.
Figure 2.3 Kinetics of EV71 replication in HT29 cells.
Figure 2.4 Kinetics of EV71 VP1 protein synthesis in HT29 cells.
Figure 2.5 Expression SCARB2 in RD and HT29 cells.
Figure 3.1 Heat map of the microarray mRNA expression profile of EV71 infected
and non-infected control colorectal cells, HT29.
Figure 3.2 Pathway analysis of differentially expressed genes of EV71 infected and
non-infected control colorectal cells, HT29.
Figure 3.3 Expression level of Type I, II and III IFN signaling pathways in response
to EV71 infection.
Figure 3.4 Expression level of interferon stimulated genes in response to EV71
infection.
Figure 3.5 Schematic illustration of the interplay between Type I, II and III IFN
pathways and invading viral pathogen-EV71.
Figure 4.1 Knockdown of DGCR8 using DsiRNA
Figure 4.2 miRNA depleted cells is not able to support EV71 replication.
Figure 4.3 Cell viability assessed 24h after transfection and throughout 72h post
EV71 infection using vital dye trypan blue.
XIII
Figure 4.4 EV71 is unable to establish infection in both RKO and RD miRNAs
depleted cells.
Figure 4.5 Heat map of the microarray miRNA expression profile of EV71 infected
and non-infected control colorectal cells, HT29.
Figure 4.6 Validation of differential expression of selected miRNAs by qPCR.
Figure 4.7 Heat map of differential expression of selected miRNAs by microarray.
Figure 4.8 EV71 is unable to down regulate host antiviral response in miRNA
depleted cells during infection.
Figure 4.9 Schematic illustration of the interplay between EV71 and host miRNAs.
Figure 5.1 Proteome of EV71 infection-resistant and susceptible RD cells.
Figure 6.1 Quantitative analysis of real-time TaqMan PCR for the detection of
EV71.
Figure 6.2 Quantitative analysis of ddPCR for the detection of EV71.
Figure 6.3 Visual representation of ddPCR results for known EV71 standards after
flow enumeration.
XIV
List of Tables
Table 1.1 Classification of human enterovirus species.
Table 1.2 EV71 vaccine candidates in clinical trials
Table 3.1 Primers used in this study
XV
List of Abbreviations
2-dimensional electrophoresis 2DE
Acute respiratory distress syndrome ARDS
Coxsackievirus A16 CA16
Central nervous system CNS
DiGeorge Syndrome Critical Region 8 DGCR8
Droplet Digital PCR ddPCR
Enzyme linked immunosorbent assay ELISA
Enterovirus 71 EV71
Fetal Bovine Serum FBS
Food and Drug Administration FDA
Human enterovirus A HEV-A
Human enterovirus B HEV-B
Human enterovirus C HEV-C
Human enterovirus D HEV-D
Hand Foot and Mouth Disease HFMD
Hours posts infection hpi
Immunofluorescence assay IFA
Interferon IFN
Interleukin IL
Internal ribosome entry site IRES
Interferon stimulated genes ISG
Intravenous immunoglobulin IVIG
XVI
MicroRNAs miRNA
Messenger RNA mRNA
NOD like receptors NLRs
Pathogen-associated molecular patterns PAMPs
Phosphate buffered saline PBS
Primate foamy virus type 1 PFV-1
quantitative polymerase chain reaction qPCR
Retinoic acid-inducible gene I RIG-1
RNA induce silencing complex RISC
Roswell Park Memorial Institute medium RMPI
RNA interference RNAi
Scavenger receptor B2 SCARB2
Small interfering RNA siRNA
Toll like receptors TLRs
Ultraviolet radiation UV
Vesicular stomatitis virus VSV
QUT Verified Signature
XVIII
Acknowledgements
First and foremost, I would like to convey my deepest gratitude to my
Principal Supervisor, Professor Louise Hafner, and my Associate Supervisor,
Professor Peter Timms, for giving me this opportunity to undertake my postgraduate
study at both the Institute of Health and Biomedical Innovation and the Queensland
University of Technology. I am very grateful for your constant support, patience and
guidance throughout these last few years. I am blessed to have both of you, Louise
and Peter, as my Advisors and for believing in me because without your faith, I
would never be able to complete this journey.
I would also like to thank my External Associate Supervisors, Dr Tan Kian
Hwa Simon and Dr Tan Eng Lee, for your endless mentoring and invaluable insight.
A special thanks to Simon for your tireless guidance throughout the course of study. I
would also like to thank Dr Adrian Yeo Chao Chuang, Dr Thomas Chai, Mdm Mah
Mon Moey, Dr Tan Tuan Lin, Dr Woo Wee Hong, Dr Shirlena Soh Wee Ling, Ms
Kwek Cheah Yee, Mr Lee Jia Jun, Ms Annabel Ang and all of my other colleagues
in Singapore Polytechnic for their advice and encouragement throughout this period
of time. In particular, I would like to thank Tuan Lin and Wee Hong for your many
insightful discussions and advice on my research.
To all my friends in Brisbane, Australia: Russel Lee, Lendl Tan, Hong Sheng
Quah, Hweeing Ng, Serene Low and everyone I know back in Brisbane who have
always been so helpful in numerous ways, especially my dear friend Dr Russel Lee.
Cheers to our everlasting friendship!!!
XIX
I acknowledge, with gratitude, Singapore Polytechnic and Queensland
University of Technology for funding this project and providing me with a
postgraduate scholarship (Queensland University of Technology Higher Degree
Research Award Scholarship).
This thesis is dedicated to Rou Wei and my family in Singapore. There are no
words that can express my appreciation for your unconditional support throughout
these last few years.
Yan Long Edmund LUI
October 2014
1
Chapter 1 Literature Review
2
Chapter 1: Literature Review
1.1 INFECTIONS OF HUMANS WITH HFMD VIRUSES
Hand Foot and Mouth Disease (HFMD) is a contagious paediatric disease
caused by a group of enteroviruses (Lui et al., 2013b, McMinn, 2002, McMinn,
2012, Ooi et al., 2010, Patel & Bergelson, 2009, Solomon et al., 2010). HFMD was
first reported in New Zealand in 1957 where approximately 60 individuals were
affected (Robinson et al., 1958). This self-limiting disease is characterised by a
variety of symptoms such as fever, rashes, poor appetite and in particular, multiple
ulceration in the mouth of the infected individual (Huang et al., 2012, Khong et al.,
2012, Lee et al., 2009, Lin et al., 2002, McMinn et al., 2001, McMinn, 2002, Ooi et
al., 2009). Other frequently encountered symptoms include poor appetite, vomiting
and lethargy (Chong et al., 2003).
The coxsackievirus A16 (CA16) and enterovirus 71 (EV71) are the two major
etiological agents of this disease with the latter being associated with significant
mortality (Wong et al., 2010, Ho et al., 2011, Huang et al., 2012). Unlike other
enteroviruses causing HFMD, EV71 has been strongly associated with severe clinical
manifestations leading to encephalitis, cardiopulmonary failure and death (Chu et al.,
2001, Lee et al., 2011, Lee & Chang, 2010, Lee et al., 2012, McMinn, 2012). Such
clinical presentation is in contrast to other HFMD causing enteroviruses which are
often mild and self-limiting (Lee et al., 2011, Lee & Chang, 2010, Lee et al., 2012,
Lee et al., 2009, McMinn et al., 2001, Muir & van Loon, 1997, Solomon et al.,
2010).
3
1.2 CLINICAL MANIFESTATION OF EV71 INFECTIONS
Clinically, EV71 pathogenesis can be distinguished into four different stages of
symptomatic progression, including: Stage 1 (herpangina- also known as mouth
blister), Stage 2 (central nervous system complications), Stage 3 (cardiopulmonary
failure) and Stage 4 (convalescence) (Lee & Chang, 2010, Lee et al., 2012). In a
large prospective study of several HFMD epidemics in Sarawak Malaysia, over a
span of seven years, approximately 10-30% of EV71 infected patients developed
neurological complications which were not observed in CA16 infected patients (Ooi
et al., 2007). Key neurological complications of the EV71 infected patients includes:
1) brainstem and/or cerebellar encephalitis (58%), 2) aseptic meningitis (36%), and
3) brainstem encephalitis (4%) (Ooi et al., 2007).
EV71-related neurological complications have been associated with clinical
manifestations including myoclonic jerks and limb weakness, which can progress to
seizures, altered consciousness, neurogenic pulmonary oedema and acute respiratory
distress syndrome (ARDS) often leading to deaths (Chen et al., 2004, Huang et al.,
1999, Khong et al., 2012, McMinn et al., 2001, Ooi et al., 2009, Prager et al., 2003,
Lu et al., 2004a). Results of studies utilising animal models to investigate this virus
are consistent with epidemiological data where approximately 10-30% of patients
presented with central nervous system complications (Chang et al., 2004, Khong et
al., 2012, Ooi et al., 2010, Ooi et al., 2009, Ooi et al., 2007).
4
1.3 EPIDEMIOLOGY OF EV71
EV71 was first identified in 1974 in California (USA) after it was isolated from
the stool of a patient with central nervous system disease in 1969 (Schmidt et al.,
1974). Recent advances on molecular evolution techniques have predicted that EV71
could have emerged in the human population as early as 1941 (Lee et al., 2012, Tee
et al., 2010, van der Sanden et al., 2009). Large fatal outbreaks first appeared in
Bulgaria in 1975 where there were 44 deaths and 451 patients reported to be
presented with neurological complications (Chumakov et al., 1979). The second
major outbreak was reported in Hungary in 1978 where there were 47 deaths and
1550 cases of patients with neurological complications (826 aseptic meningitis, 724
encephalitis) (Nagy et al., 1982).
Two decade later, EV71 re-emerged in Malaysia (1997) and Taiwan (1998)
with ensuing outbreaks, epidemics and pandemics occurring every two to three years
in the Asia Pacific countries such as Australia, China, Taiwan, Japan, Korea,
Malaysia, Vietnam, Thailand and Singapore (Schmidt et al., 1974, Chumakov et al.,
1979, McMinn et al., 2001, Huang et al., 2012). Recurrent outbreaks of HFMD
supports the urgent need to develop a vaccine or antiviral therapies against
enteroviruses for the treatment of HFMD patients. However due to the limited
understanding of EV71 pathogenesis there are currently no effective antiviral
therapies or vaccines approved by the United States of America FDA to prevent
HFMD.
5
1.4 PICORNAVIRDAE
EV71 is a positive strand RNA virus belonging to the Enterovirus genus in the
Picornaviridae family (Lui et al., 2013b, McMinn, 2002, McMinn, 2012, Ooi et al.,
2010). Picornaviruses are amongst the world’s oldest known viruses and are
classified under the family Picornaviridae. As implied by the name, Picornaviruses
are a group of very small “pico” (a unit of measurement), RNA viruses. This family
of viruses consist of five main genera – Rhinoviruses, Enteroviruses, Aphthoviruses,
Cardioviruses and Heptoviruses (REACH) (Lin et al., 2009a, Lin et al., 2009b). The
most notable member of the Picornaviridae family is the poliovirus (Lee et al., 2012,
McMinn, 2002, McMinn, 2012, Solomon et al., 2010, Wong et al., 2010, Wu et al.,
2010). With the near eradication of poliovirus (with the exception of Afghanistan,
India, Nigeria and Russia), EV71 has emerged to be the most important neurotropic
enterovirus (Huang et al., 2012, Lee et al., 2012, Wu et al., 2010). The human
enteroviruses of the Enterovirus genus are among the most common human
pathogens, infecting millions of people worldwide (Li et al., 2007, Oberste et al.,
1999a, Oberste et al., 1999b). Based on new molecular typing method based on
homology within the RNA coding region for the capsid protein VP1, the human
enteroviruses have been classified into 4 species: human enteroviruses A through to
D, with more than 100 subtypes identified to date (Table 1.1) (Lee & Chang, 2010,
Yi et al., 2011). Being a non-enveloped virus, they are stable over a wide range of
pH from 3 to 10 and are resistant to alcohol, organic solvent and freezing procedures
(Huang et al., 2012, Solomon et al., 2010). However, they can be readily inactivated
by harsh methods such as chlorination, formaldehyde treatment and ultraviolet
radiation (UV) (Huang et al., 2012, Solomon et al., 2010, Chan & Abu Bakar, 2005).
6
Table 1.1 Classification of Human Enterovirus species
Human enterovirus species Serotype
Human enterovirus A
(HEV-A)
Coxsackie A viruses (CAV) 2–8,10,12,14,16
Enteroviruses (EV) 71,76,89–91
Human enterovirus B
(HEV-B)
Coxsackie A viruses (CAV) 9, Coxsackie B viruses (CBV) 1–6
Echoviruses (E) 1–7,9,11–21,24–27,29–33
Enteroviruses (EV) 69,73–75,77–88,93,97,98,100,101,106,107
Human enterovirus C
(HEV-C)
Coxsackie A viruses (CAV) 1,11,13,17,19–22,24
Enteroviruses (EV) 95,96,99,102,104,105,109
Polioviruses (PV) 1–3
Human enterovirus D
(HEV-D)
Enteroviruses (EV) 68,70,94
HEV, human enterovirus, EV, enterovirus, CAV, coxsackie A viruses, E,
echoviruses
Adopted from Solomon et al., 2010
7
1.5 GENOGROUPS OF EV71
EV71 could be further classified into four distinct genogroups; A, B, C and D
(McMinn, 2012, Ooi et al., 2010, van der Sanden et al., 2009, van der Sanden et al.,
2010, Yi et al., 2011). Viruses from the same genogroup have approximately 92%
nucleotide sequence identity, while EV71 from different genogroups account shared
78-83% identity (McMinn, 2012, Ooi et al., 2010). The prototype BrCr first
described in 1974 is the only strain found in genotype A, while most other EV71
isolates were classified under genotypes B (B1-5) or C (C1-5). Genogroup B has five
lineages; B1 and B2 (circulating between 1970 and 1990) and B3-B5 (circulating in
Southeast Asia since 1997) (Huang et al., 2012, McMinn, 2012). B0, a progenitor
lineage has recently been proposed to have circulated between 1963 and 1967 (van
der Sanden et al., 2009, van der Sanden et al., 2010) Genogroup C also has five
lineages; C1 (dominant genogroup in Europe and America), C2 (emerged in 1995),
C3-C5 (circulating in Southeast Asia since 1997) (Figure 1.1) (Huang et al., 2012,
McMinn, 2012). Finally, genogroup D is represented by a single virus strain isolated
in India (Deshpande et al., 2003). The association between the circulating strains
during specific endemics and their role in pathogenesis of severe clinical
manifestation remain to be elucidated.
8
Figure 1.1 Geographic distributions of EV71 genogroups from 1960 to 2011.
Geographic distribution of HEV71 genogroups and subgenogroups between 1960
and 2011 From (McMinn, 2012).
9
1.6 GENOMIC AND STRUCTURAL CHARACTERISTICS OF ENTEROVIRUSES
Enteroviruses are non-enveloped viruses approximately 30nm in diameter each
with a capsid made up of 60 protomers consisting of four structural proteins: VP1,
VP2, VP3 and VP4 (Lee & Chang, 2010, McMinn, 2002, McMinn, 2012, Solomon
et al., 2010). The viral genome is composed of a single stranded, positive-polarity
RNA molecule of around 7500 nucleotides in length (Lee et al., 2009, Lin et al.,
2009a, Singh et al., 2002, Solomon et al., 2010). It comprises a 5’ untranslated
region (UTR), an open reading frame (ORF) encoding for around 2100 to 2200
amino acids residues, a 3’ UTR and it terminates with a 3’ poly (A) tail of a variable
length of 60-100 nucleotides (Bedard & Semler, 2004, Lin et al., 2009a, Lin et al.,
2009b, Ooi et al., 2010).
The 5’ UTR possesses the internal ribosome entry site (IRES) which is
important for viral RNA amplification (Bedard & Semler, 2004, McMinn, 2002,
McMinn, 2012). The ORF polyprotein can be classified into three regions; P1, P2
and P3, where P1 encodes for the four structural proteins; VP1, VP2, VP3 and VP4,
while P2 and P3 encodes for seven non-structural proteins; 2A, 2B, 2C, 3A, 3B, 3C
and 3D, that are responsible for the various stages of infection and replication in the
host (Figure 1.2) (Brown et al., 1999, Lin et al., 2009a, Yi et al., 2011). The first
three viral structural proteins (VP1-3) form the outside of the virus capsid, whilst
VP4 is located exclusively on the inner surface of the capsid. The capsid protein is
responsible for the initiation of the infection by binding to a receptor in the host
membrane (Caggana et al., 1993, Li et al., 2011, Lin et al., 2009a, Singh et al., 2002,
Solomon et al., 2010). Due to the capsid potentially being the virulent determinant
10
for enteroviruses, much research have been focused on the role of VP1 in viral
pathogenesis (Caggana et al., 1993, Li et al., 2011, Lin et al., 2009a, Singh et al.,
2002, Solomon et al., 2010).
Figure 1.2 Schematic diagram of enterovirus genome and their respective
functions. Diagrammatic representation of the enterovirus genome is shown. The 11
mature polypeptides are shown, together with the three main cleavage intermediates.
The main biological functions are included for each polypeptide. UTR, untranslated
region; IRES, internal ribosome entry site; VPg, viral protein genome-linked.
From (Lin et al., 2009a).
11
1.7 INTRAVENOUS IMMUNOGLOBULIN TREATMENT
Despite the prevalence and severity of disease in EV71 infected patients, there
are no effective antiviral therapies or vaccines approved by the United States of
America FDA to prevent HFMD. Treatment of HFMD infection in the hospital
focuses on alleviating symptom such as treatment for fever, sore throat, vomiting
and/or diarrhoea. Intravenous immunoglobulin (IVIG) is a blood product containing
pooled immunoglobulins extracted from blood donors, which can be administrated
intravenously to severe HFMD patients (Chang et al., 2004, Lin et al., 2002, Ooi et
al., 2007). This is the only approved treatment for viral encephalitis routinely used
for severe EV71 infected in patients (Chang et al., 2004, Lin et al., 2002, Ooi et al.,
2007, Wang et al., 2000, Wang et al., 2005, Wang et al., 2006).
IVIG contains cytokines such as IL-1, IL-6 and interferon which play a role in
modulating the cytokines cascade, and thus they might play a role in the therapeutic
effect of IVIG (Wang et al., 2006). However, randomised placebo controlled clinical
trials have yet to be performed to address the actual therapeutic effect of this
treatment. Although retrospective analysis of several EV71 outbreaks have shown
the benefits of IVIG treatment, including one study in Malaysia where 95% of the
severe EV71 infected patients survived after administration of IVIG treatment, the
actual therapeutic mechanism of IVIG remains highly debatable and unclear (Chang
et al., 2004, Lin et al., 2002, Ooi et al., 2007, Wang et al., 2000, Wang et al., 2005,
Wang et al., 2006).
12
1.8 DEVELOPMENT OF VACCINE AGAINST EV71
To date, a number of potential EV71 vaccine candidates, including inactivated
whole virus, live-attenuated virus, recombinant viral protein, virus-like particle and
DNA vaccines, developed by different organisation are currently in animal
preclinical trials and/or human clinical trials (Lee & Chang, 2010). The most
straightforward strategy utilises inactivated whole virus vaccines, which have been
found to confer good protection in animal models (Lee et al., 2012, Wu et al., 2010).
The first described inactivated whole virus vaccine that effectively prevents
enterovirus infection is the formaldehyde-inactivated polio vaccine developed by
Jonas Salk in 1952 for the prevention of poliovirus infection (Aylward & Heymann,
2005, Grassly, 2013, Hampton, 2009, Nossal, 2011, Sabin, 1981). The use of this
vaccine since 1955 led to a drastic decrease in paralytic poliomyelitis, however,
multiple injections are required to achieve this effect (Bek et al., 2011, Ehrenfeld et
al., 2009).
The trivalent oral poliovirus vaccine was then introduced in 1962 to replace the
formaldehyde-inactivated polio vaccine for routine use globally (Bek et al., 2011,
Ehrenfeld et al., 2009). The advantage that led to this change includes the relative
ease of oral administration, as well as the superior immunogenicity provided by
mucosal immunisation as compared to intramuscular injection (Bek et al., 2011,
Ehrenfeld et al., 2009). The trivalent oral poliovirus vaccine was a live-attenuated
vaccine made from live micro-organism with their virulent properties disabled
(Aylward & Heymann, 2005, Bek et al., 2011, Ehrenfeld et al., 2009, Halstead,
2012, Lee & Chang, 2010, Lee et al., 2012, Nossal, 2011, Wu et al., 2001).
13
However, live vaccines are genetically unstable and in rare circumstances may revert
to neurovirulence, resulting in vaccine associated paralytic poliomyelitis (Bek et al.,
2011, Ehrenfeld et al., 2009). Despite the shortcomings, these vaccines have aided in
the near eradication of polioviruses from the world (Bek et al., 2011, Ehrenfeld et al.,
2009).
Due to its tremendous impact on the public health and healthcare system, the
development of a viable vaccine or antiviral treatment against EV71 has been a
national priority in Asian countries (Lee et al., 2012). Wu and colleagues (2001)
demonstrated that formalin-inactivated and heat inactivated strains of EV71
demonstrated a protective efficacy of 80% against EV71 infection in mice (Wu et al.,
2001). Maternal immunisation with inactivated EV71 vaccine was also shown to
increase the survival of suckling mice after EV71 infection (Wu et al., 2001). In
addition, the active immunisation of 1 day old mice with avirulent EV71 strain or
CA16 via the oral route has prolonged survival rate of mice infected with EV71
infections (Wu et al., 2007). Use of live attenuated strain of EV71, developed using
genetic manipulation, has led to the limited spread of the virus (Arita et al., 2008a,
Arita et al., 2007, Arita et al., 2008b). However, these vaccines cause certain
neurological complications indicating the need for further work (Arita et al., 2008a,
Arita et al., 2007, Arita et al., 2008b, Ooi et al., 2009, Ooi et al., 2007). Furthermore,
reversion of attenuated viruses to its pathogenic form as well as the potential
mutations that could occur are considerations before the clinical use of the vaccine
for the treatment of EV71 infected patients can be approved. Owing to these
technical and safety limitations, the development of live attenuated EV71 vaccine
has not progressed significantly (McMinn, 2012). There are currently many different
14
EV71 vaccine candidates undergoing testing in various countries and using different
formulation in these clinical trials in human (Table 1.2).
Table 1.2 EV71 vaccine candidates in clinical trials. Adapted from (Lee et
al., 2012).
Organization Country Cell line Formulation
Bejing Vigoo; China
National Biotech Group
China Vero Cell line Inactivated virus (C4)
Sinovac China Vero Cell line Inactivated virus (C4)
Peking Union Medical
College
China KMB 17 Cell line Inactivated virus (C4)
National Health Research
Institutes
Taiwan Vero Cell line Inactivated virus (B4)
Inviragen Singapore Vero Cell line Inactivated virus (B)
15
1.9 CURRENT ANTIVIRAL THERAPEUTICS AGAINST EV71
In addition to the development of vaccines against HFMD, research toward
antiviral therapies at different stages of the enterovirus replication process including
virus attachment, uncoating, and synthesis of viral genome are currently underway
(Li et al., 2007, Lee & Chang, 2010). The design of antiviral compounds or the
modification of existing non-specific antiviral therapeutics inhibiting the key steps in
viral replication may be used alone or combination for the potential treatment of
HFMD.
One example of this would be the administration of milrinone, a cyclic
nucleotide phosphodiesterase inhibitor for the prevention of cardiopulmonary failure
which is routinely used for the treatment of severe HFMD patients despite the mixed
reviews on the efficacy of the treatment (Wang et al., 2005). Ribavarin, a broad
spectrum antiviral drugs has also been used as it has been demonstrated to have a
dose dependent inhibition against EV71 replication (Li et al., 2008). Ribavirin-
treated 12 to 15 days old mice have a greater survivability and exhibit a later onset
and less severe paralysis compared to control (untreated) mice (Li et al., 2008).
However, ribavirin treatment was recently shown to be ineffective in 1 day old mice
against EV71 (Zhang et al., 2012).
Another potential therapeutic approach against EV71 is the use of RNA
interference (RNAi). Small interfering RNA (siRNA) artificially synthesised against
the 5’ and the 3’ untranslated region were demonstrated to inhibit EV71 in a dose
dependent manner in vitro (Deng et al., 2012, Sim et al., 2005, Tan et al., 2007a, Tan
16
et al., 2007b). Targeting conserved regions of the virus prevents the selection of
mutants strains resulted from the sequence-specific nature of siRNA (Lu et al.,
2004b). Although the use of siRNA seems promising, the protective effect of siRNA
treatment could only be observed in mice administrated 1 day post infection (Tan et
al., 2007b). Delaying siRNA treatment resulted in significantly lower protective
effect against EV71 which may not be clinically relevant in the treatment of HFMD
patients where the incubation time is between three to seven days (Tan et al., 2007b).
Despite many molecules being designed and reported to inhibit EV71
replication in the preceding decade with the aim of eventual treatment for EV71
infected patients, none of these gained the final approval by United States of
America FDA for the prevention of HFMD. In most cases, the lack of compelling
results in addition to the toxicity issues poses great limitation for their use. In
addition, clinical application for such treatment requires little or no adverse effect as
most HFMD patients are children requiring an extremely safe drug or therapeutic. In
view of the increasing clinical relevance of EV71, there is an urgent need to develop
a specific therapeutic for EV71 infected patients. Despite extensive studies on
enterovirus infection, the exact mechanism of non-polio enterovirus (EV71)
pathogenesis remains unclear (Lee et al., 2011). Elucidating the mechanism (s) of
enterovirus pathogenesis may provide clues for the development of antiviral
therapeutics against EV71.
17
1.10 EV71 PATHOGENESIS
Human beings are the only known natural hosts of the human enteroviruses.
Similar to other enteroviruses, the EV71 replication cycle is similar to a notable
member of the family namely poliovirus (De Jesus, 2007). The virus is transmitted
from person-to-person by direct contact of vesicular fluid or droplets from the
infected individual or via the faeco-oral route (Nasri et al., 2007a, Nasri et al.,
2007b). Source of transmission may be direct contact with nose and throat
discharges, saliva, fluid from blisters and stools of infected patients (Lin et al.,
2002). The digestive and respiratory tracts of humans are the common route of
infection for enteroviruses (Wong et al., 2010, Lee et al., 2009, Liu et al., 2000,
Brown et al., 1999).
During infection, the viruses first enter the host, infect the cells in the
gastrointestinal tract, replicate, then bypass the gut barrier and pass into the skeletal
muscle cell before entering the bloodstream and the central nervous system via
retrograde axonal transport (Chen et al., 2007). Muscle cells may be responsible for
persistent infection supporting efficient virus replication (Chen et al., 2004, Chen et
al., 2007). There are numerous factors that may affect the severity of the disease and
these may be both virus specific and/or host specific (Muir & van Loon, 1997).
Secondary to the central nervous system, EV71 also affects susceptible cells in the
reticuloendothelial system such as the liver, and spleen as well as heart, lungs,
pancreas as well as the skin. Despite much speculation, the exact dissemination route
of the virus from the initial site of infection to other tissues and the central nervous
system remain elusive.
18
It was postulated that EV71 entry into susceptible cells is via specific receptors
of which several have already been identified. The identified receptors of EV71
include a ubiquitously expressed cellular receptor, scavenger receptor B2 (SCARB2),
a functional receptor, human P-selectin glycoproteinligand-1, sialic-acid-linked
glycan, dendritic cell specific intercellular adhesion molecular 3 grabbing non
integrin (CD209) and heparin sulphate glycosaminoglycan (Gerke & Moss, 2002,
Patel & Bergelson, 2009, Tan et al., 2013, Wong et al., 2010, Wu et al., 2010,
Yamayoshi et al., 2012, Yamayoshi et al., 2009). Once EV71 binds to the receptors,
it gains entry into the host cells via clathrin-mediated endocytosis which then
releases the viral RNA into host cell cytoplasm (Buss et al., 2001, Durrbach et al.,
1996, Flanagan & Lin, 1980, Hussain et al., 2011). (Ooi et al., 2010, Ooi et al., 2009,
Ooi et al., 2007). It was proposed that cytoskeletal system comprising of both actin
and microtubules may be involved during clathrin-mediated endocytosis (Buss et al.,
2001, Durrbach et al., 1996, Flanagan & Lin, 1980, Gerke & Moss, 2002, Hayes et
al., 2006, Hussain et al., 2011, Ploubidou & Way, 2001, Soldati & Schliwa, 2006,
Yang et al., 2011). Knockdown of genes that are important in actin polymerisation
(ARPC5, ARRB1, and WASF1) and the use of actin disrupting drug (cytochalasin B)
have resulted in the decrease in EV71 replication kinetics in vitro (Buss et al., 2001,
Durrbach et al., 1996, Flanagan & Lin, 1980, Gerke & Moss, 2002, Hayes et al.,
2006, Hussain et al., 2011, Ploubidou & Way, 2001, Soldati & Schliwa, 2006, Yang
et al., 2011).
After the virus has released its positive strand virion RNA into the host
cytoplasm, the viral RNA acts as a messenger RNA that is subsequently translated
into a large polypeptide (Bedard & Semler, 2004, Solomon et al., 2010, Wu et al.,
19
2010). This polypeptide is subsequently cleaved into 11 mature structural and non-
structural proteins (Caggana et al., 1993, Solomon et al., 2010, Wu et al., 2010).
Apoptosis or programmed cell death would then be triggered in the host cells by the
production of EV71 2A and 3C which activates the caspases (Chi et al., 2013, Kuo et
al., 2002, Li et al., 2002). It was also reported that EV71, in contrast does not
stimulate apoptosis but induces the production of Mitogen-activated protein
kinases/Extracellular signal-regulated kinases (MAPK/ERK) signalling very early
during infection to slow down apoptosis to facilitate virus replication (Huang et al.,
2012, Wong et al., 2005).
1.11 HOST PATHOGEN INTERACTION
The ability of the virus to cause infection in the susceptible host directly
correlates to the interaction between the host and pathogen. In order to survive and
proliferate during infection, the pathogen must be able to sense, react and adapt to
the ever-changing microenvironment inside the host. Such adaptations and the use of
the host resources to proliferate are prerequisites for the successful colonisation of
the host by the pathogen (Scaria et al., 2006, Ghosh et al., 2009, Roberts & Jopling,
2010).
Pathogens can be differentiated from commensal organisms by their abilities to
subvert host cellular process and resources to their advantage. Viruses, being obligate
intracellular parasites have developed highly sophisticated mechanisms not only to
exploit the biosynthetic machinery for replication, but also to specifically evade the
host immune system. This intricate host-pathogen interaction between the virus and
20
the host cells may play an important role in the establishment of the disease through
the regulation of viral expression and subversion of host antiviral pathways (Scaria et
al., 2006, Ghosh et al., 2009, Roberts & Jopling, 2010). Such intricate host-pathogen
interactions between the virus and the host cells creates a dilemma for the
development of antiviral drugs that must target explicit viral proteins and pathway
without killing the host cells. Hence, only a few effective antiviral drugs exist in the
market, virus resistance and drug toxicity are significant issues for all antiviral
therapeutics (Scaria et al., 2006, Ghosh et al., 2009, Roberts & Jopling, 2010).
1.12 HOST ANTIVIRAL FACTORS AND SIGNALLING PATHWAYS
Early innate and cell intrinsic response are essential to protect host cells against
pathogens such as viruses. During viral infection the host innate immune system
serves to limit virus infection and in turn the viruses have evolved to counteract with
these antiviral factors to established infection (Viswanathan et al., 2010, tenOever,
2013, Taylor & Mossman, 2013, Randall & Goodbourn, 2008, Rajsbaum & Garcia-
Sastre, 2013). The interferon (IFN) family represents a key component of the innate
immune response and is vital to mount a robust host response against viral infection
(Versteeg & Garcia-Sastre, 2010, Thompson et al., 2011, Randall & Goodbourn,
2008, Rajsbaum & Garcia-Sastre, 2013, Oudshoorn et al., 2012, de Weerd &
Nguyen, 2012, Brennan & Bowie, 2010, Boss & Renne, 2011).
The activation of IFNs begins with the recognition of pathogen-associated
molecular patterns (PAMPs) which include Toll like receptors (TLRs), nucleotide-
binding oligomerisation domain (NOD) like receptors (NLRs), and retinoic acid-
21
inducible gene I (RIG-I) like receptors (Kanarek & Ben-Neriah, 2012, Brennan &
Bowie, 2010). There are three classes of interferon namely type I, II and III which
induce IFN-stimulated genes (ISGs). This family of cytokines act in an autocrine and
paracrine manner to induce expression of transcription factors, gamma activated
sequence and IFN-stimulated response element and this results in the induction of
ISGs which function to slow down viral infection (Versteeg & Garcia-Sastre, 2010,
Thompson et al., 2011, Oudshoorn et al., 2012). ISGs slow the EV71 viral
replication by halting transcription, translation and cell division and could even
induce cell death (Munday et al., 2012). These key cytokines protect the uninfected
cells and stimulate the adaptive immune system including macrophage and dendritic
cell (Versteeg & Garcia-Sastre, 2010, Thompson et al., 2011, Randall & Goodbourn,
2008, Rajsbaum & Garcia-Sastre, 2013, Oudshoorn et al., 2012, de Weerd &
Nguyen, 2012, Brennan & Bowie, 2010, Boss & Renne, 2011).
1.13 MICRORNA AND TRANSCRIPTIONAL REGULATION
During infection, viruses can mediate host gene expression to enhance their
survival. Activities include altering the cellular microenvironment to allow
successful virus replication and evasion of the host immune system (Munday et al.,
2012). Antiviral pathways such as the programmed cell death (apoptosis) could be
activated by the host cells in an attempt to limit the infection (Munday et al., 2012).
Viruses have developed sophisticated mechanisms to evade host-immune responses
in order to establish infection in the hosts. These complex intertwined cellular
processes are orchestrated by an array of molecular signalling molecules such as
transcription factors and genes resulting in alternation to the host proteome. One of
22
the mediators for such regulation includes genes that encode for microRNA
(miRNAs) (Sullivan & Ganem, 2005, Scaria et al., 2006).
These small single-stranded RNA species (miRNAs) are of approximately 20-
24 bases in length that play a pivotal role in the post transcriptional regulation of
gene expression (Sullivan & Ganem, 2005, Scaria et al., 2006). As such, miRNAs
can contribute to the repertoire of host-pathogen interactions during infection by
modulating and directing host and viral gene expression thereby, playing a pivotal
role during infection. These small non-coding RNA were first discovered in
Caenorhabditis elegans, but were later discovered in a wide range of organisms from
uni to multi-cellular eukaryotes (Ghosh et al., 2009, Lau et al., 2001, Lee et al.,
1993).
The biogenesis of miRNAs begins when a long primary transcript known as
pri-miRNA is transcribed by RNA polymerase II (Ghosh et al., 2009, Roberts &
Jopling, 2010, Scaria et al., 2006, Skalsky & Cullen, 2010, Sullivan, 2008, Sullivan
& Ganem, 2005) (Figure 1.3). These pri-miRNAs are then processed by
microprocessor complex which consist of RNase III enzyme Drosha and the double-
stranded-RNA-binding protein, DiGeorge Syndrome Critical Region 8
(DGCR8/pasha) to become pre-miRNA (Ghosh et al., 2009, Gottwein & Cullen,
2008). Pre-miRNAs are subsequently exported to the cytosol by exportin 5 where
RNAse III-like Dicer processes these precursors to mature miRNAs (Ghosh et al.,
2009, Gottwein & Cullen, 2008). Mature miRNAs with imperfect base pairing to the
target mRNA lead to translational repression and/or mRNA degradation by guiding
RISC (RNA induce silencing complex) which is made up of an Argonaut protein
23
(Figure 1.3) (Ghosh et al., 2009, Gottwein & Cullen, 2008, Lee et al., 1993, Mack,
2007, Otsuka et al., 2007, Sullivan, 2008).
Recent findings have revealed complex interactions between viruses and host
cells involving miRNA-mediated RNA silencing pathways (Han et al., 2007, Huang
et al., 2007, Mack, 2007, Otsuka et al., 2007, Umbach & Cullen, 2009). It has been
found that certain viruses such as such as Herpes Simplex Virus 1 and 2, encode for
miRNAs that can regulate viral or cellular targets while some viruses are regulated
directly or indirectly by host miRNAs (Han et al., 2007, Huang et al., 2007, Mack,
2007, Otsuka et al., 2007, Umbach & Cullen, 2009). These miRNAs have been
reported to block host cell apoptosis and allow the viruses to evade the immune
system (Han et al., 2007, Huang et al., 2007, Mack, 2007, Otsuka et al., 2007,
Umbach & Cullen, 2009). Indeed, it has become apparent that miRNAs interactions
with the host are vital for viral survival and proliferation during pathogenesis (Scaria
et al., 2006, Umbach & Cullen, 2009).
The sophisticated means by which pathogens overcome the host barriers and
immune system to establish, replicate, persist, exit, and infect a new host is seen as
one of the most impressive evolutionary adaptation (Mack, 2007, Nathans et al.,
2009, Roberts & Jopling, 2010, Scaria et al., 2006, Skalsky & Cullen, 2010).
Elucidating the mechanism of pathogenesis that the virus undertakes to bypass the
host defence systems and establish infections would provide us with a better
understanding of the virology of EV71 and lead to the development of potential
antiviral therapeutics for HFMD patients. Given the importance of miRNAs in post
transcriptional regulation of cellular responses to viral infections of host cells as well
24
as the potential contribution to the repertoire of host-pathogen interactions during
infection by modulating host and viral gene expression, it is logical to study these
antiviral responses.
Figure 1.3 Schematic diagram of miRNA biogenesis. Schematic diagram
of the process of miRNA biogenesis. From (Kim, 2005).
25
1.14 CONTROL OF HFMD VIRAL INFECTIONS AND THE DIAGNOSIS OF EV71
Over the past decades, EV71 has became the cause of regular epidemics across
the Asia-Pacific regions in countries including Australia, China, Taiwan, Japan,
Korea, Malaysia, Vietnam, Thailand and Singapore (Schmidt et al., 1974, Chumakov
et al., 1979, McMinn et al., 2001, Huang et al., 2012). Although there are much
research into understanding EV71 pathogenesis and vaccine clinical trials are
underway, with no effective vaccine or therapeutics available, the current mode of
infection control is through public health approaches. Prevention is better than cure
and early detection of EV71 infection potentially allows for halting transmission of
virus via effective diagnosis and isolation of the patients (Ang et al., 2009, McMinn,
2012, Singh et al., 2002, Solomon et al., 2010, Tan et al., 2006, Tan et al., 2008a,
Tan et al., 2008b, Zhu et al., 2013).
Epidemic control measures primarily target the interruption of viral
transmission between individuals (Ang et al., 2009, McMinn, 2012, Solomon et al.,
2010, Yi et al., 2011). Social distancing and case isolation are transmission-reducing
measures used to prevention HFMD infection during epidemics (Ang et al., 2009,
McMinn, 2012, Solomon et al., 2010, Yi et al., 2011). Countries including China,
Hong Kong, Malaysia, Singapore and Taiwan regularly practise transmission
reducing measures such as school closure during outbreaks, although the
effectiveness of such measures in the control of HFMD remain debatable (Ang et al.,
2009, McMinn, 2012, Solomon et al., 2010, Yi et al., 2011).
26
The diagnosis for HFMD infections is often made by the medical physician
following physical examination of the patient and based upon the observation and
recording of symptoms such fevers, vomit, diarrhoea, oral ulcers and body rashes
(Ang et al., 2009, McMinn, 2012, Singh et al., 2002, Solomon et al., 2010, Tan et
al., 2006, Tan et al., 2008a, Tan et al., 2008b, Zhu et al., 2013). However, physical
examination is not conclusive enough to differentiate EV71 from other enterviruses
causing HFMD (Singh et al., 2002, Tan et al., 2006, Tan et al., 2008b, Tano et al.,
2002). As such, molecular diagnostic techniques are required for the identification
and differentiation of enterovirus-related infection (Singh et al., 2002, Tan et al.,
2006, Tan et al., 2008b, Tano et al., 2002).
There are four main methodologies to diagnose and differentiate enterovirus
infection 1) tissue culture followed by serotyping, 2) immunofluorescence assay
(IFA), 3) enzyme linked immunosorbent assay (ELISA) and 4) nucleic acid
amplification (Ho et al., 1999, Ooi et al., 2010, Ooi et al., 2009, Ooi et al., 2007,
Singh et al., 2002, Solomon et al., 2010, Tan et al., 2006, Tan et al., 2008b, Tano et
al., 2002, Wang et al., 2000). Until recently, the gold standard for identification of
enteroviruses involved propagation by cell culture, followed by neutralization with
specific antisera to confirm the serotype (Ho et al., 1999, Ooi et al., 2010, Ooi et al.,
2009, Ooi et al., 2007, Singh et al., 2002, Solomon et al., 2010, Tan et al., 2006, Tan
et al., 2008b, Tano et al., 2002, Wang et al., 2000). However, this procedure is
limited by its long turnaround time which may take a few weeks (Singh et al., 2002,
Tan et al., 2008a, Tan et al., 2008b, Tano et al., 2002). Furthermore, some
enteroviruses may proliferate sub-optimally in cell cultures, require several passages
or may not be typeable (Ho et al., 1999, Wang et al., 2000).
27
Similarly using IFA, which employs the antigen-antibody complex for the
detection of enteroviruses in cell culture prove to be unspecific and have a long
turnaround time (Yan et al., 2001). In addition, the monoclonal antibody used was
also reported to cross react with closely related viruses such as CA16 (Yan et al.,
2001). In the case for ELISA, although the detection for IgM in sera from EV71
infected patients was demonstrated to be effective, cross activity with antibodies
against other enteroviruses also resulted in false positives (Tano et al., 2002, Yan et
al., 2001).
Nucleic acid amplification using polymerase chain reaction (PCR) or real-time
quantitative PCR is now being routinely used to detect and differentiate enterovirus
infection (Ho et al., 1999, Ooi et al., 2010, Ooi et al., 2009, Ooi et al., 2007, Singh et
al., 2002, Solomon et al., 2010, Tan et al., 2006, Tan et al., 2008b, Tano et al., 2002,
Wang et al., 2000). Such molecular techniques have been shown to be more sensitive
and have shorter turnaround time when compared to other methodologies (Singh et
al., 2002, Tan et al., 2008a, Tan et al., 2008b, Tano et al., 2002). Specific primers
and probes have been designed in against various parts of the enterovirus genome to
identify specific strains of the enterovirus (Singh et al., 2002, Tan et al., 2008a, Tan
et al., 2008b). Over the past two decade, fluorescence based qPCR chemistry have
revolutionised nucleic acid diagnostics and become the gold standard for quantitation
of viral load (Henrich et al., 2012, Hayden et al., 2013). Quantitative determination
of viral load has been used to monitor the efficiency of antiviral therapy and to
determine changes in that therapy (Hindson et al., 2013, McDermott et al., 2013).
Elavated viral burdens have been used as a trigger for pre-emptive treatment to
prevent symptomatic infection (Henrich et al., 2012, Hayden et al., 2013).
28
Fast turnaround times for diagnostic techniques used to detect EV71 infections
would likely contribute to limiting the spread and the decreased spread of the disease
(Ang et al., 2009). Notwithstanding, earlier diagnosis would mean decreased health
care cost by avoiding unnecessary hospitalization, antibiotics treatment, CT scans,
magnetic resonance imaging scans and radiography of the suspected EV71 infected
patients (Ang et al., 2009, McMinn, 2012, Singh et al., 2002, Solomon et al., 2010,
Tan et al., 2006, Tan et al., 2008a, Tan et al., 2008b, Zhu et al., 2013).
1.15 THE OVERALL OBJECTIVES OF THE STUDY
The overall objective of this project was to study the mechanism (s) of EV71
viral pathogenesis. It is hypothesised in this thesis that during EV71 infection of
susceptible humans, host cellular miRNA and mRNA may play critical roles in
modulating virus replication and may indirectly correlate with viral replication.
EV71 may have evolved means to specifically up-regulate supportive miRNA and
down regulate limiting miRNA, thereby enhancing the host cellular environment for
it’s replication. To address this salient question in EV71 research, this study herein
aimed to elucidate the host-pathogen interactions between in vitro human cells and
EV71.
We aimed to do this by 1) establishing in vitro models of viral infections of
human cells by using both a rhabdomyosarcoma (RD) cell line as well as a colorectal
cell line which would mimic in vivo host-pathogen interactions of EV71 virus
infection of human cells and 2) integrating the results from investigating host cellular
29
responses (including miRNA and mRNA) following viral infections and 3)
examining the effects of EV71 replication in miRNA depleted cells.
1.16 THE SPECIFIC AIMS OF THE STUDY
In an attempt to address the overall project objective, this study therefore have
five result chapters:
Chapter 2-Aim 1: Characterisation of enterovirus 71 replication kinetics in
Human colorectal cell line, HT29
Chapter 3-Aim 2: Elucidating the host-pathogen interaction between human
colorectal cells and invading enterovirus 71 using transcriptomic profiling
Chapter 4-Aim 3: EV71 utilise host microRNAs to mediate host immune system
enhancing survival during infection
Chapter 5-Aim 4: Beta-actin Variant is Necessary for enterovirus 71
Replication
Chapter 6-Aim 5: Droplet Digital PCR as a useful tool for the quantitative
detection of enterovirus 71.
The experimental design of this study has resulted in the generation of data to
provide us with a better understanding of the pathogenesis of EV71 and may provide
clues for the development of antiviral therapeutics. Clearly, this study is medically
relevant, as EV71 is an ever-increasing public health problem with frequent and
consistent outbreaks and the potential to develop neurological complications in
infected infants and children particularly (but not exclusively) in the South East Asia
30
regions. It is therefore crucial to understand the complex interplay between the host
environment and the pathogen in order to determine what gives the virus its’ ability
to survive within the host.
1.17 AN ACCOUNT OF SCIENTIFIC PROGRESS LINKING TO THE SCIENTIFIC PAPERS
The Five Chapters of results of the present study are presented as
manuscripts/papers in this thesis that outline findings that contribute to the overall
understanding of EV71 pathogenesis. The first result chapter of this thesis, Chapter
Two, presents data obtained following the establishment of human colorectal cells
(HT29) as a viable and a more relevant in vitro model to study EV71 pathogenesis.
In Chapter Three, an in depth analysis involving transcriptomic provides data to
elucidate the host-pathogen interaction between our established human colorectal
cells and invading EV71. We identified key pathways that are altered during EV71
infection of these human cells.
In Chapter Four, we evaluate the importance of miRNAs during EV71
infection by performing a global knockdown of miRNAs in human epithelial
colorectal cells. In addition, we examine the changes in miRNA profile during EV71
infection in order to pinpoint specific key miRNAs vital for EV71 pathogenesis. We
demonstrated that there are miRNAs changes during EV71 pathogenesis and as a
result the host antiviral pathways were altered during viral infections. Chapter Five,
reports the comparative proteomic analyses on EV71-susceptible and EV71-resistant
cells. We demonstrated that EV71 infection may be actin dependent. Finally, in
31
Chapter Six, we evaluate if the droplet digital PCR was a useful tool to detect and
provide an absolute quantitation of EV71 viral copy number ; a technique that may
prove useful to monitor the effects of antiviral therapeutics in EV71-infected
patients.
Taken together, the results presented in Chapters Two to Six of this thesis
provide valuable insights into the host-pathogen interaction during EV71
pathogenesis. Elucidating the mechanism(s) that the virus uses to bypass host
defence systems and establish infections will provide us with a better understanding
of the pathogenesis mechanism of the EV71 virus and will thus aid in the
development of potential antiviral therapeutics for HFMD patients.
This thesis is written in the format of a series of manuscripts and chapters in
accordance with the Queensland University of Technology theses by submitted
manuscript guidelines. Chapter 1 is a Literature Review of the topic which
demonstrates argument to support the need for this study. Chapters Two to Six are
manuscripts accepted for publication in peer-reviewed journals. Chapter Seven is a
comprehensive discussion of the key findings of this project. The references for each
paper are presented at the end of their corresponding Chapters and formatted to
Molecular Microbiology for standardisation throughout the thesis. A complete
bibliography of the whole thesis is provided at the end of the thesis.
32
1.18 REFERENCES
Ang, L.W., B.K. Koh, K.P. Chan, L.T. Chua, L. James & K.T. Goh, (2009)
Epidemiology and control of hand, foot and mouth disease in Singapore,
2001-2007. Annals of the Academy of Medicine, Singapore 38: 106-112.
Arita, M., Y. Ami, T. Wakita & H. Shimizu, (2008a) Cooperative effect of the
attenuation determinants derived from poliovirus sabin 1 strain is essential for
attenuation of enterovirus 71 in the NOD/SCID mouse infection model. J
Virol 82: 1787-1797.
Arita, M., N. Nagata, N. Iwata, Y. Ami, Y. Suzaki, K. Mizuta, T. Iwasaki, T. Sata, T.
Wakita & H. Shimizu, (2007) An attenuated strain of enterovirus 71
belonging to genotype a showed a broad spectrum of antigenicity with
attenuated neurovirulence in cynomolgus monkeys. J Virol 81: 9386-9395.
Arita, M., T. Wakita & H. Shimizu, (2008b) Characterization of pharmacologically
active compounds that inhibit poliovirus and enterovirus 71 infectivity. J Gen
Virol 89: 2518-2530.
Aylward, R.B. & D.L. Heymann, (2005) Can We Capitalize on the Virtues of
Vaccines? Insights from the Polio Eradication Initiative. American Journal of
Public Health 95: 773-777.
Bedard, K.M. & B.L. Semler, (2004) Regulation of picornavirus gene expression.
Microbes and infection / Institut Pasteur 6: 702-713.
Bek, E.J., K.M. Hussain, P. Phuektes, C.C. Kok, Q. Gao, F. Cai, Z. Gao & P.C.
McMinn, (2011) Formalin-inactivated vaccine provokes cross-protective
immunity in a mouse model of human enterovirus 71 infection. Vaccine 29:
4829-4838.
33
Boss, I.W. & R. Renne, (2011) Viral miRNAs and immune evasion. Biochimica et
biophysica acta 1809: 708-714.
Brennan, K. & A.G. Bowie, (2010) Activation of host pattern recognition receptors
by viruses. Current opinion in microbiology 13: 503-507.
Brown, B.A., M.S. Oberste, J.P. Alexander, Jr., M.L. Kennett & M.A. Pallansch,
(1999) Molecular epidemiology and evolution of enterovirus 71 strains
isolated from 1970 to 1998. J Virol 73: 9969-9975.
Buss, F., J.P. Luzio & J. Kendrick-Jones, (2001) Myosin VI, a new force in clathrin
mediated endocytosis. FEBS letters 508: 295-299.
Caggana, M., P. Chan & A. Ramsingh, (1993) Identification of a single amino acid
residue in the capsid protein VP1 of coxsackievirus B4 that determines the
virulent phenotype. J Virol 67: 4797-4803.
Chang, L.Y., K.C. Tsao, S.H. Hsia, S.R. Shih, C.G. Huang, W.K. Chan, K.H. Hsu,
T.Y. Fang, Y.C. Huang & T.Y. Lin, (2004) Transmission and clinical features
of enterovirus 71 infections in household contacts in Taiwan. JAMA : the
journal of the American Medical Association 291: 222-227.
Chen, C.S., Y.C. Yao, S.C. Lin, Y.P. Lee, Y.F. Wang, J.R. Wang, C.C. Liu, H.Y. Lei
& C.K. Yu, (2007) Retrograde axonal transport: a major transmission route of
enterovirus 71 in mice. J Virol 81: 8996-9003.
Chen, Y.C., C.K. Yu, Y.F. Wang, C.C. Liu, I.J. Su & H.Y. Lei, (2004) A murine oral
enterovirus 71 infection model with central nervous system involvement. J
Gen Virol 85: 69-77.
Chi, C., Q. Sun, S. Wang, Z. Zhang, X. Li, C.J. Cardona, Y. Jin & Z. Xing, (2013)
Robust antiviral responses to enterovirus 71 infection in human intestinal
epithelial cells. Virus research.
34
Chong, C.Y., K.P. Chan, V.A. Shah, W.Y. Ng, G. Lau, T.E. Teo, S.H. Lai & A.E.
Ling, (2003) Hand, foot and mouth disease in Singapore: a comparison of
fatal and non-fatal cases. Acta paediatrica (Oslo, Norway : 1992) 92: 1163-
1169.
Chu, P.Y., K.H. Lin, K.P. Hwang, L.C. Chou, C.F. Wang, S.R. Shih, J.R. Wang, Y.
Shimada & H. Ishiko, (2001) Molecular epidemiology of enterovirus 71 in
Taiwan. Arch Virol 146: 589-600.
Chumakov, M., M. Voroshilova, L. Shindarov, I. Lavrova, L. Gracheva, G.
Koroleva, S. Vasilenko, I. Brodvarova, M. Nikolova, S. Gyurova, M.
Gacheva, G. Mitov, N. Ninov, E. Tsylka, I. Robinson, M. Frolova, V.
Bashkirtsev, L. Martiyanova & V. Rodin, (1979) Enterovirus 71 isolated
from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60:
329-340.
De Jesus, N.H., (2007) Epidemics to eradication: the modern history of
poliomyelitis. Virology journal 4: 70.
de Weerd, N.A. & T. Nguyen, (2012) The interferons and their receptors--
distribution and regulation. Immunology and cell biology 90: 483-491.
Deng, J.X., X.J. Nie, Y.F. Lei, C.F. Ma, D.L. Xu, B. Li, Z.K. Xu & G.C. Zhang,
(2012) The highly conserved 5' untranslated region as an effective target
towards the inhibition of Enterovirus 71 replication by unmodified and
appropriate 2'-modified siRNAs. J Biomed Sci 19: 73.
Deshpande, J., S.S. Nadkarni & P.P. Francis, (2003) Enterovirus 71 isolated from a
case of acute flaccid paralysis in India represents a new genotype. Current
Science 84: 1350-1353.
35
Durrbach, A., D. Louvard & E. Coudrier, (1996) Actin filaments facilitate two steps
of endocytosis. Journal of cell science 109 ( Pt 2): 457-465.
Ehrenfeld, E., J. Modlin & K. Chumakov, (2009) Future of polio vaccines. Expert
Rev Vaccines 8: 899-905.
Flanagan, M.D. & S. Lin, (1980) Cytochalasins block actin filament elongation by
binding to high affinity sites associated with F-actin. The Journal of
biological chemistry 255: 835-838.
Gerke, V. & S.E. Moss, (2002) Annexins: from structure to function. Physiol Rev 82:
331-371.
Ghosh, Z., B. Mallick & J. Chakrabarti, (2009) Cellular versus viral microRNAs in
host-virus interaction. Nucleic Acids Res 37: 1035-1048.
Gottwein, E. & B.R. Cullen, (2008) Viral and cellular microRNAs as determinants of
viral pathogenesis and immunity. Cell Host Microbe 3: 375-387.
Grassly, N.C., (2013) The final stages of the global eradication of poliomyelitis.
Philosophical Transactions of the Royal Society B: Biological Sciences 368.
Halstead, S.B., (2012) Dengue vaccine development: a 75% solution? Lancet 380:
1535-1536.
Hampton, L., (2009) Albert Sabin and the Coalition to Eliminate Polio From the
Americas. American Journal of Public Health 99: 34-44.
Han, Y., M. Wind-Rotolo, H.C. Yang, J.D. Siliciano & R.F. Siliciano, (2007)
Experimental approaches to the study of HIV-1 latency. Nature reviews.
Microbiology 5: 95-106.
Hayden, R.T., Z. Gu, J. Ingersoll, D. Abdul-Ali, L. Shi, S. Pounds & A.M. Caliendo,
(2013) Comparison of droplet digital PCR to real-time PCR for quantitative
detection of cytomegalovirus. J Clin Microbiol 51: 540-546.
36
Hayes, M.J., D. Shao, M. Bailly & S.E. Moss, (2006) Regulation of actin dynamics
by annexin 2. EMBO J 25: 1816-1826.
Henrich, T.J., S. Gallien, J.Z. Li, F. Pereyra & D.R. Kuritzkes, (2012) Low-level
detection and quantitation of cellular HIV-1 DNA and 2-LTR circles using
droplet digital PCR. Journal of virological methods 186: 68-72.
Hindson, C.M., J.R. Chevillet, H.A. Briggs, E.N. Gallichotte, I.K. Ruf, B.J. Hindson,
R.L. Vessella & M. Tewari, (2013) Absolute quantification by droplet digital
PCR versus analog real-time PCR. Nature methods 10: 1003-1005.
Ho, B.C., S.L. Yu, J.J. Chen, S.Y. Chang, B.S. Yan, Q.S. Hong, S. Singh, C.L. Kao,
H.Y. Chen, K.Y. Su, K.C. Li, C.L. Cheng, H.W. Cheng, J.Y. Lee, C.N. Lee
& P.C. Yang, (2011) Enterovirus-induced miR-141 contributes to shutoff of
host protein translation by targeting the translation initiation factor eIF4E.
Cell Host Microbe 9: 58-69.
Ho, M., E.R. Chen, K.H. Hsu, S.J. Twu, K.T. Chen, S.F. Tsai, J.R. Wang & S.R.
Shih, (1999) An epidemic of enterovirus 71 infection in Taiwan. Taiwan
Enterovirus Epidemic Working Group. N Engl J Med 341: 929-935.
Huang, C.C., C.C. Liu, Y.C. Chang, C.Y. Chen, S.T. Wang & T.F. Yeh, (1999)
Neurologic complications in children with enterovirus 71 infection. N Engl J
Med 341: 936-942.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Huang, J., F. Wang, E. Argyris, K. Chen, Z. Liang, H. Tian, W. Huang, K. Squires,
G. Verlinghieri & H. Zhang, (2007) Cellular microRNAs contribute to HIV-1
latency in resting primary CD4+ T lymphocytes. Nat Med 13: 1241-1247.
37
Hussain, K.M., K.L. Leong, M.M. Ng & J.J. Chu, (2011) The essential role of
clathrin-mediated endocytosis in the infectious entry of human enterovirus
71. The Journal of biological chemistry 286: 309-321.
Kanarek, N. & Y. Ben-Neriah, (2012) Regulation of NF-kappaB by ubiquitination
and degradation of the IkappaBs. Immunological reviews 246: 77-94.
Khong, W.X., B. Yan, H. Yeo, E.L. Tan, J.J. Lee, J.K. Ng, V.T. Chow & S. Alonso,
(2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibits
neurotropism, causing neurological manifestations in a novel mouse model of
EV71 infection. J Virol 86: 2121-2131.
Kim, V.N., (2005) MicroRNA biogenesis: coordinated cropping and dicing. Nature
reviews. Molecular cell biology 6: 376-385.
Kuo, R.L., S.H. Kung, Y.Y. Hsu & W.T. Liu, (2002) Infection with enterovirus 71 or
expression of its 2A protease induces apoptotic cell death. J Gen Virol 83:
1367-1376.
Lau, N.C., L.P. Lim, E.G. Weinstein & D.P. Bartel, (2001) An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science
(New York, N.Y.) 294: 858-862.
Lee, J.J., J.B. Seah, V.T. Chow, C.L. Poh & E.L. Tan, (2011) Comparative proteome
analyses of host protein expression in response to Enterovirus 71 and
Coxsackievirus A16 infections. J Proteomics 74: 2018-2024.
Lee, M.S. & L.Y. Chang, (2010) Development of enterovirus 71 vaccines. Expert
Rev Vaccines 9: 149-156.
Lee, M.S., F.C. Tseng, J.R. Wang, C.Y. Chi, P. Chong & I.J. Su, (2012) Challenges
to licensure of enterovirus 71 vaccines. PLoS neglected tropical diseases 6:
e1737.
38
Lee, R.C., R.L. Feinbaum & V. Ambros, (1993) The C. elegans heterochronic gene
lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:
843-854.
Lee, T.C., H.R. Guo, H.J. Su, Y.C. Yang, H.L. Chang & K.T. Chen, (2009) Diseases
caused by enterovirus 71 infection. Pediatr Infect Dis J 28: 904-910.
Li, C., H. Wang, S.R. Shih, T.C. Chen & M.L. Li, (2007) The efficacy of viral capsid
inhibitors in human enterovirus infection and associated diseases. Curr Med
Chem 14: 847-856.
Li, M.L., T.A. Hsu, T.C. Chen, S.C. Chang, J.C. Lee, C.C. Chen, V. Stollar & S.R.
Shih, (2002) The 3C protease activity of enterovirus 71 induces human neural
cell apoptosis. Virology 293: 386-395.
Li, Y., R. Zhu, Y. Qian, J. Deng, Y. Sun, L. Liu, F. Wang & L. Zhao, (2011)
Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide
sequences and antigenicity of recombinant proteins of VP1s and VP4s. BMC
Microbiol 11: 246.
Li, Z.H., C.M. Li, P. Ling, F.H. Shen, S.H. Chen, C.C. Liu, C.K. Yu & S.H. Chen,
(2008) Ribavirin reduces mortality in enterovirus 71-infected mice by
decreasing viral replication. J Infect Dis 197: 854-857.
Lin, J.Y., T.C. Chen, K.F. Weng, S.C. Chang, L.L. Chen & S.R. Shih, (2009a) Viral
and host proteins involved in picornavirus life cycle. J Biomed Sci 16: 103.
Lin, J.Y., M.L. Li & S.R. Shih, (2009b) Far upstream element binding protein 2
interacts with enterovirus 71 internal ribosomal entry site and negatively
regulates viral translation. Nucleic Acids Res 37: 47-59.
39
Lin, T.Y., L.Y. Chang, S.H. Hsia, Y.C. Huang, C.H. Chiu, C. Hsueh, S.R. Shih, C.C.
Liu & M.H. Wu, (2002) The 1998 enterovirus 71 outbreak in Taiwan:
pathogenesis and management. Clin Infect Dis 34 Suppl 2: S52-57.
Lu, H.K., T.Y. Lin, S.H. Hsia, C.H. Chiu, Y.C. Huang, K.C. Tsao & L.Y. Chang,
(2004a) Prognostic implications of myoclonic jerk in children with
enterovirus infection. Journal of microbiology, immunology, and infection =
Wei mian yu gan ran za zhi 37: 82-87.
Lu, W.W., Y.Y. Hsu, J.Y. Yang & S.H. Kung, (2004b) Selective inhibition of
enterovirus 71 replication by short hairpin RNAs. Biochem Biophys Res
Commun 325: 494-499.
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
Mack, G.S., (2007) MicroRNA gets down to business. Nature biotechnology 25:
631-638.
McDermott, G.P., D. Do, C.M. Litterst, D. Maar, C.M. Hindson, E.R. Steenblock,
T.C. Legler, Y. Jouvenot, S.H. Marrs, A. Bemis, P. Shah, J. Wong, S. Wang,
D. Sally, L. Javier, T. Dinio, C. Han, T.P. Brackbill, S.P. Hodges, Y. Ling, N.
Klitgord, G.J. Carman, J.R. Berman, R.T. Koehler, A.L. Hiddessen, P. Walse,
L. Bousse, S. Tzonev, E. Hefner, B.J. Hindson, T.H. Cauly, 3rd, K. Hamby,
V.P. Patel, J.F. Regan, P.W. Wyatt, G.A. Karlin-Neumann, D.P. Stumbo &
A.J. Lowe, (2013) Multiplexed target detection using DNA-binding dye
chemistry in droplet digital PCR. Analytical chemistry 85: 11619-11627.
40
McMinn, P., I. Stratov, L. Nagarajan & S. Davis, (2001) Neurological manifestations
of enterovirus 71 infection in children during an outbreak of hand, foot, and
mouth disease in Western Australia. Clin Infect Dis 32: 236-242.
McMinn, P.C., (2002) An overview of the evolution of enterovirus 71 and its clinical
and public health significance. FEMS microbiology reviews 26: 91-107.
McMinn, P.C., (2012) Recent advances in the molecular epidemiology and control of
human enterovirus 71 infection. Current opinion in virology 2: 199-205.
Muir, P. & A.M. van Loon, (1997) Enterovirus infections of the central nervous
system. Intervirology 40: 153-166.
Munday, D.C., R. Surtees, E. Emmott, B.K. Dove, P. Digard, J.N. Barr, A.
Whitehouse, D. Matthews & J.A. Hiscox, (2012) Using SILAC and
quantitative proteomics to investigate the interactions between viral and host
proteomes. Proteomics 12: 666-672.
Nagy, G., S. Takatsy, E. Kukan, I. Mihaly & I. Domok, (1982) Virological diagnosis
of enterovirus type 71 infections: experiences gained during an epidemic of
acute CNS diseases in Hungary in 1978. Arch Virol 71: 217-227.
Nasri, D., L. Bouslama, S. Omar, H. Saoudin, T. Bourlet, M. Aouni, B. Pozzetto &
S. Pillet, (2007a) Typing of human enterovirus by partial sequencing of VP2.
J Clin Microbiol 45: 2370-2379.
Nasri, D., L. Bouslama, S. Pillet, T. Bourlet, M. Aouni & B. Pozzetto, (2007b) Basic
rationale, current methods and future directions for molecular typing of
human enterovirus. Expert Rev Mol Diagn 7: 419-434.
Nathans, R., C.Y. Chu, A.K. Serquina, C.C. Lu, H. Cao & T.M. Rana, (2009)
Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol Cell
34: 696-709.
41
Nossal, G.J.V., (2011) Vaccines and future global health needs. Philosophical
Transactions of the Royal Society B: Biological Sciences 366: 2833-2840.
Oberste, M.S., K. Maher, D.R. Kilpatrick, M.R. Flemister, B.A. Brown & M.A.
Pallansch, (1999a) Typing of human enteroviruses by partial sequencing of
VP1. J Clin Microbiol 37: 1288-1293.
Oberste, M.S., K. Maher, D.R. Kilpatrick & M.A. Pallansch, (1999b) Molecular
evolution of the human enteroviruses: correlation of serotype with VP1
sequence and application to picornavirus classification. J Virol 73: 1941-
1948.
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
Ooi, M.H., S.C. Wong, A. Mohan, Y. Podin, D. Perera, D. Clear, S. del Sel, C.H.
Chieng, P.H. Tio, M.J. Cardosa & T. Solomon, (2009) Identification and
validation of clinical predictors for the risk of neurological involvement in
children with hand, foot, and mouth disease in Sarawak. BMC infectious
diseases 9: 3.
Ooi, M.H., S.C. Wong, Y. Podin, W. Akin, S. del Sel, A. Mohan, C.H. Chieng, D.
Perera, D. Clear, D. Wong, E. Blake, J. Cardosa & T. Solomon, (2007)
Human enterovirus 71 disease in Sarawak, Malaysia: a prospective clinical,
virological, and molecular epidemiological study. Clin Infect Dis 44: 646-
656.
Otsuka, M., Q. Jing, P. Georgel, L. New, J. Chen, J. Mols, Y.J. Kang, Z. Jiang, X.
Du, R. Cook, S.C. Das, A.K. Pattnaik, B. Beutler & J. Han, (2007)
Hypersusceptibility to vesicular stomatitis virus infection in Dicer1-deficient
42
mice is due to impaired miR24 and miR93 expression. Immunity 27: 123-
134.
Oudshoorn, D., G.A. Versteeg & M. Kikkert, (2012) Regulation of the innate
immune system by ubiquitin and ubiquitin-like modifiers. Cytokine & growth
factor reviews 23: 273-282.
Patel, K.P. & J.M. Bergelson, (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728-729.
Ploubidou, A. & M. Way, (2001) Viral transport and the cytoskeleton. Curr Opin
Cell Biol 13: 97-105.
Prager, P., M. Nolan, I.P. Andrews & G.D. Williams, (2003) Neurogenic pulmonary
edema in enterovirus 71 encephalitis is not uniformly fatal but causes severe
morbidity in survivors. Pediatr Crit Care Med 4: 377-381.
Rajsbaum, R. & A. Garcia-Sastre, (2013) Viral evasion mechanisms of early antiviral
responses involving regulation of ubiquitin pathways. Trends in microbiology
21: 421-429.
Randall, R.E. & S. Goodbourn, (2008) Interferons and viruses: an interplay between
induction, signalling, antiviral responses and virus countermeasures. J Gen
Virol 89: 1-47.
Roberts, A.P. & C.L. Jopling, (2010) Targeting viral infection by microRNA
inhibition. Genome Biol 11: 201.
Scaria, V., M. Hariharan, S. Maiti, B. Pillai & S.K. Brahmachari, (2006) Host-virus
interaction: a new role for microRNAs. Retrovirology 3: 68.
Schmidt, N.J., E.H. Lennette & H.H. Ho, (1974) An apparently new enterovirus
isolated from patients with disease of the central nervous system. J Infect Dis
129: 304-309.
43
Sim, A.C., A. Luhur, T.M. Tan, V.T. Chow & C.L. Poh, (2005) RNA interference
against enterovirus 71 infection. Virology 341: 72-79.
Singh, S., V.T. Chow, M.C. Phoon, K.P. Chan & C.L. Poh, (2002) Direct detection
of enterovirus 71 (EV71) in clinical specimens from a hand, foot, and mouth
disease outbreak in Singapore by reverse transcription-PCR with universal
enterovirus and EV71-specific primers. J Clin Microbiol 40: 2823-2827.
Skalsky, R.L. & B.R. Cullen, (2010) Viruses, microRNAs, and host interactions.
Annual review of microbiology 64: 123-141.
Soldati, T. & M. Schliwa, (2006) Powering membrane traffic in endocytosis and
recycling. Nature reviews. Molecular cell biology 7: 897-908.
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Sullivan, C.S., (2008) New roles for large and small viral RNAs in evading host
defences. Nature reviews. Genetics 9: 503-507.
Sullivan, C.S. & D. Ganem, (2005) MicroRNAs and viral infection. Mol Cell 20: 3-
7.
Tan, C.W., C.L. Poh, I.C. Sam & Y.F. Chan, (2013) Enterovirus 71 uses cell surface
heparan sulfate glycosaminoglycan as an attachment receptor. J Virol 87:
611-620.
Tan, E.L., V.T. Chow, G. Kumarasinghe, R.T. Lin, I.M. Mackay, T.P. Sloots & C.L.
Poh, (2006) Specific detection of enterovirus 71 directly from clinical
specimens using real-time RT-PCR hybridization probe assay. Molecular and
cellular probes 20: 135-140.
44
Tan, E.L., V.T. Chow, S.H. Quak, W.C. Yeo & C.L. Poh, (2008a) Development of
multiplex real-time hybridization probe reverse transcriptase polymerase
chain reaction for specific detection and differentiation of Enterovirus 71 and
Coxsackievirus A16. Diagn Microbiol Infect Dis 61: 294-301.
Tan, E.L., T.M. Tan, V.T. Chow & C.L. Poh, (2007a) Enhanced potency and
efficacy of 29-mer shRNAs in inhibition of Enterovirus 71. Antiviral research
74: 9-15.
Tan, E.L., T.M. Tan, V. Tak Kwong Chow & C.L. Poh, (2007b) Inhibition of
enterovirus 71 in virus-infected mice by RNA interference. Molecular
therapy : the journal of the American Society of Gene Therapy 15: 1931-
1938.
Tan, E.L., L.L. Yong, S.H. Quak, W.C. Yeo, V.T. Chow & C.L. Poh, (2008b) Rapid
detection of enterovirus 71 by real-time TaqMan RT-PCR. Journal of clinical
virology : the official publication of the Pan American Society for Clinical
Virology 42: 203-206.
Tano, Y., H. Shimizu, M. Shiomi, T. Nakano & T. Miyamura, (2002) Rapid
serological diagnosis of enterovirus 71 infection by IgM ELISA. Jpn J Infect
Dis 55: 133-135.
Taylor, K.E. & K.L. Mossman, (2013) Recent advances in understanding viral
evasion of type I interferon. Immunology 138: 190-197.
Tee, K.K., T.T. Lam, Y.F. Chan, J.M. Bible, A. Kamarulzaman, C.Y. Tong, Y.
Takebe & O.G. Pybus, (2010) Evolutionary genetics of human enterovirus
71: origin, population dynamics, natural selection, and seasonal periodicity of
the VP1 gene. J Virol 84: 3339-3350.
45
tenOever, B.R., (2013) RNA viruses and the host microRNA machinery. Nature
reviews. Microbiology 11: 169-180.
Thompson, M.R., J.J. Kaminski, E.A. Kurt-Jones & K.A. Fitzgerald, (2011) Pattern
recognition receptors and the innate immune response to viral infection.
Viruses 3: 920-940.
Umbach, J.L. & B.R. Cullen, (2009) The role of RNAi and microRNAs in animal
virus replication and antiviral immunity. Genes Dev 23: 1151-1164.
van der Sanden, S., M. Koopmans, G. Uslu & H. van der Avoort, (2009)
Epidemiology of enterovirus 71 in the Netherlands, 1963 to 2008. J Clin
Microbiol 47: 2826-2833.
van der Sanden, S., H. van der Avoort, P. Lemey, G. Uslu & M. Koopmans, (2010)
Evolutionary trajectory of the VP1 gene of human enterovirus 71 genogroup
B and C viruses. J Gen Virol 91: 1949-1958.
Versteeg, G.A. & A. Garcia-Sastre, (2010) Viral tricks to grid-lock the type I
interferon system. Current opinion in microbiology 13: 508-516.
Viswanathan, K., K. Fruh & V. DeFilippis, (2010) Viral hijacking of the host
ubiquitin system to evade interferon responses. Current opinion in
microbiology 13: 517-523.
Wang, J.N., C.T. Yao, C.N. Yeh, C.C. Huang, S.M. Wang, C.C. Liu & J.M. Wu,
(2006) Critical management in patients with severe enterovirus 71 infection.
Pediatrics international : official journal of the Japan Pediatric Society 48:
250-256.
Wang, J.R., H.P. Tsai, P.F. Chen, Y.J. Lai, J.J. Yan, D. Kiang, K.H. Lin, C.C. Liu &
I.J. Su, (2000) An outbreak of enterovirus 71 infection in Taiwan, 1998. II.
Laboratory diagnosis and genetic analysis. Journal of clinical virology : the
46
official publication of the Pan American Society for Clinical Virology 17: 91-
99.
Wang, S.M., H.Y. Lei, M.C. Huang, J.M. Wu, C.T. Chen, J.N. Wang, J.R. Wang &
C.C. Liu, (2005) Therapeutic efficacy of milrinone in the management of
enterovirus 71-induced pulmonary edema. Pediatric pulmonology 39: 219-
223.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
Wong, W.R., Y.Y. Chen, S.M. Yang, Y.L. Chen & J.T. Horng, (2005)
Phosphorylation of PI3K/Akt and MAPK/ERK in an early entry step of
enterovirus 71. Life sciences 78: 82-90.
Wu, C.N., Y.C. Lin, C. Fann, N.S. Liao, S.R. Shih & M.S. Ho, (2001) Protection
against lethal enterovirus 71 infection in newborn mice by passive
immunization with subunit VP1 vaccines and inactivated virus. Vaccine 20:
895-904.
Wu, K.X., M.M. Ng & J.J. Chu, (2010) Developments towards antiviral therapies
against enterovirus 71. Drug discovery today 15: 1041-1051.
Wu, T.C., Y.F. Wang, Y.P. Lee, J.R. Wang, C.C. Liu, S.M. Wang, H.Y. Lei, I.J. Su
& C.K. Yu, (2007) Immunity to avirulent enterovirus 71 and coxsackie A16
virus protects against enterovirus 71 infection in mice. J Virol 81: 10310-
10315.
Yamayoshi, S., K. Fujii & S. Koike, (2012) Scavenger receptor b2 as a receptor for
hand, foot, and mouth disease and severe neurological diseases. Frontiers in
microbiology 3: 32.
47
Yamayoshi, S., Y. Yamashita, J. Li, N. Hanagata, T. Minowa, T. Takemura & S.
Koike, (2009) Scavenger receptor B2 is a cellular receptor for enterovirus 71.
Nat Med 15: 798-801.
Yan, J.J., I.J. Su, P.F. Chen, C.C. Liu, C.K. Yu & J.R. Wang, (2001) Complete
genome analysis of enterovirus 71 isolated from an outbreak in Taiwan and
rapid identification of enterovirus 71 and coxsackievirus A16 by RT-PCR. J
Med Virol 65: 331-339.
Yang, S.L., Y.T. Chou, C.N. Wu & M.S. Ho, (2011) Annexin II binds to capsid
protein VP1 of enterovirus 71 and enhances viral infectivity. J Virol 85:
11809-11820.
Yi, L., J. Lu, H.F. Kung & M.L. He, (2011) The virology and developments toward
control of human enterovirus 71. Crit Rev Microbiol 37: 313-327.
Zhang, G., F. Zhou, B. Gu, C. Ding, D. Feng, F. Xie, J. Wang, C. Zhang, Q. Cao, Y.
Deng, W. Hu & K. Yao, (2012) In vitro and in vivo evaluation of ribavirin
and pleconaril antiviral activity against enterovirus 71 infection. Arch Virol
157: 669-679.
Zhu, F.C., Z.L. Liang, X.L. Li, H.M. Ge, F.Y. Meng, Q.Y. Mao, Y.T. Zhang, Y.M.
Hu, Z.Y. Zhang, J.X. Li, F. Gao, Q.H. Chen, Q.Y. Zhu, K. Chu, X. Wu, X.
Yao, H.J. Guo, X.Q. Chen, P. Liu, Y.Y. Dong, F.X. Li, X.L. Shen & J.Z.
Wang, (2013) Immunogenicity and safety of an enterovirus 71 vaccine in
healthy Chinese children and infants: a randomised, double-blind, placebo-
controlled phase 2 clinical trial. Lancet 381: 1037-1045.
48
Chapter 2 Characterisation of enterovirus 71 replication kinetics in Human colorectal cell line, HT29
49
Title: Characterisation of enterovirus 71 replication kinetics in Human
colorectal cell line, HT29
Author names and affiliations:
Yan Long Edmund Lui1, 2, 3, Peter Timms, 2, 3, Louise Marie Hafner 2, 3*, Tuan Lin
Tan4, Kian Hwa Tan1, Eng Lee Tan1, 5
1Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singapore
2School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology, Brisbane, Australia
3Institute of Health and Biomedical Innovation, Queensland University of
Technology, Brisbane, Australia
4School of Chemical and Life Sciences, Singapore Polytechnic, Singapore
5Department of Paediatrics, University Children's Medical Institute, National
University Hospital, Singapore
50
Statement of Contribution of Co-Authors for
Thesis by Published Paper
The following is the format for the required declaration provided at the start of
any thesis chapter which includes a co-authored publication.
The authors listed below have certified* that:
1. they meet the criteria for authorship in that they have participated in the
conception, execution, or interpretation, of at least that part of the publication in
their field of expertise;
2. they take public responsibility for their part of the publication, except for the
responsible author who accepts overall responsibility for the publication;
3. there are no other authors of the publication according to these criteria;
4. potential conflicts of interest have been disclosed to (a) granting bodies, (b) the
editor or publisher of journals or other publications, and (c) the head of the
responsible academic unit, and
5. they agree to the use of the publication in the student’s thesis and its publication
on the QUT ePrints database consistent with any limitations set by publisher
requirements.
In the case of this chapter:
Lui, Y., P. Timms, L. Hafner, T. Tan, K. Tan & E. Tan, (2013) Characterisation
of enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
51
Contributor Statement of contribution*
Lui Yan Long Edmund
(Ph.D. Candidate) Contributed to the majority of the laboratory work in the project,
conducted the data analysis and the interpretation of the data and
wrote the manuscript. Signature
Date
Peter Timms
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Louise M Hafner
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Tuan Lin
Contributed to the laboratory work and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Kian Hwa
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Eng Lee
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
52
Chapter 2: Characterisation of enterovirus 71 replication kinetics in Human colorectal cell line, HT29
Abstract
Hand, Foot and Mouth Disease (HFMD), a contagious viral disease that
commonly affects infants and children with blisters and flu like symptoms, is caused
by a group of enteroviruses such as Enterovirus 71 (EV71) and coxsackievirus A16
(CA16). However some HFMD caused by EV71 may further develop into severe
neurological complications such as encephalitis and meningitis. The route of
transmission was postulated that the virus transmit from one person to another
through direct contact of vesicular fluid or droplet from the infected or via faecal-oral
route. To this end, this study utilised a human colorectal adenocarcinoma cell line
(HT29) with epithelioid morphology as an in vitro model for the investigation of
EV71 replication kinetics. Using qPCR, viral RNA was first detected in HT29 cells
as early as 12h post infection (hpi) while viral protein was first detected at 48hpi. A
significant change in HT29 cells’ morphology was also observed after 48hpi.
Furthermore HT29 cell viability also significantly decreased at 72hpi. Together, data
from this study demonstrated that co-culture of HT29 with EV71 is a useful in vitro
model to study the pathogenesis of EV71.
53
2.1 INTRODUCTION
Hand, Foot and Mouth Disease (HFMD), a contagious viral disease that
commonly affects infants and children, are caused by a group of enteroviruses such
as enterovirus 71 (EV71) and coxsackievirus A16 (CA16) (Brown et al., 1999,
Cardosa et al., 2003, Lee et al., 2009, Prager et al., 2003). This self-limiting disease
is characterised by fever, rashes, poor appetite and multiple ulcers in mouth (Brown
et al., 1999, Cardosa et al., 2003, Lee et al., 2009, Prager et al., 2003). However,
patients infected with EV71 may further develop severe neurological complications
such as aseptic meningitis and brainstem/cerebellar encephalitis (Lee & Chang,
2010, Lee et al., 2009, Singh et al., 2002, Solomon et al., 2010, McMinn, 2002).
EV71, a member from the Enterovirus genus of the Picornaviridae family, is a
non-enveloped, positive sense, single stranded, RNA virus with genomic RNA of
approximately 7400bp in length (Lee & Chang, 2010, Oberste et al., 1999a, Oberste
et al., 1999b). EV71 was first isolated from HFMD patients with central nervous
system disease in 1969 (Schmidt et al., 1974). Large fatal EV71 outbreaks of HFMD
first appeared in Bulgaria in 1975, and disease outbreaks were subsequently
identified in Hungary in 1978 and re-emerged in Malaysia in 1997 and Taiwan in
1998 (Chumakov et al., 1979, Nagy et al., 1982, Ho et al., 1999, Lu et al., 2002,
Solomon et al., 2010). HFMD epidemics and pandemics have been periodically
reported worldwide with outbreaks occurring every two to three years in countries
including Australia, China, Taiwan, Japan, Korea, Malaysia, Vietnam, Thailand and
Singapore (Schmidt et al., 1974, Chumakov et al., 1979, McMinn et al., 2001,
Huang et al., 2012). The consistent presence and outbreaks of HFMD push for an
urgent need to develop a vaccine or antiviral therapies against enteroviruses
54
(Pourianfar et al., 2012, McMinn et al., 2001, Tan et al., 2007a, Tan et al., 2007b,
Tan et al., 2010). Currently, there are no available antiviral therapies or vaccines
approved by the United States of America Food and Drug Administration (FDA) to
prevent HFMD infections (Li et al., 2007).
The route of transmission of EV71 was postulated to happen via direct contact
of vesicular fluid or droplets from the infected or via faecal-oral route (Wong et al.,
2010, Lee et al., 2009, Liu et al., 2000, Brown et al., 1999). EV71 was shown to
replicate within the gastrointestinal tract, bypass the gut barrier and infect the skeletal
muscle cell before entering into the bloodstream and the central nervous system
(Wong et al., 2010, Lee et al., 2009, Liu et al., 2000, Brown et al., 1999). Indeed
various studies had shown in in vivo models such as mouse that the intestine was the
initial site of infection for EV71 infection with the muscle cells responsible for
persistent infection, supporting efficient virus replication (Chen et al., 2007, Chen et
al., 2004, Khong et al., 2012). Therefore, we hypothesised that it is relevant to study
EV71 using an in vitro model of a human gastrointestinal cell type origin during the
initial stages of infection.
In this study, we used a human colorectal adenocarcinoma cell line (HT29)
with epithelioid morphology as an in vitro model for the investigation of EV71
replication kinetics. To characterise the virus replication in HT29 cells, the viral VP1
RNA and protein were monitored using qPCR and western blot respectively. In
addition, the cell viability of HT29 to EV71 infection was monitored throughout the
time course of 72 hours posts infection (hpi).
55
2.2 MATERIALS AND METHODS
Cell culture and virus propagation
Human colorectal cell line (HT29) (ATCC® catalog no. HTB-38™) was
maintained in Roswell Park Memorial Institute medium (RPMI 1640) (PAA
Laboratories, Austria) supplemented with 10% (v/v) Fetal Bovine Serum (FBS)
(PAA Laboratories, Austria) and 2% penicillin–streptomycin (PAA Laboratories,
Austria) at 37°C with 5% CO2. The EV71 strain used in this study was isolated from
a fatal case of HFMD during the October 2000 outbreak in Singapore, the
Enterovirus 5865/sin/000009 strain (accession number 316321; hereby designated as
Strain 41) from subgenogroup B4. The virus stock was prepared by propagation of
viruses using 90% confluent HT29 cell monolayers in RPMI 1640 with 10% FBS
and 2% penicillin–streptomycin at 37°C with 5% CO2. The virus titres were
determined using 50% tissue culture infective dose (TCID50) per millilitre (mL) and
the multiplicity of infection (MOI) was performed according to Reed and Muench
method (Reed & Muench, 1938).
Viral infection
HT29 cells were seeded at a concentration of 2 × 106 cells/ml in 6-well plates
and incubated for 24h at 37°C with 5% CO2. Cells were washed twice with
phosphate buffered saline (PBS) and infected with EV71 at multiplicity of infection
(MOI) of 1 or nil respectively. Following infection for 1h, the culture media were
removed and replaced with 2 mL of fresh RPMI 1640 medium. Micrographs were
then taken using phase contrast microscopy at different time points, after which the
cells were trypsinised (PAA Laboratories, Austria) and harvested at 12h, 24h, 48h
56
and 72h to isolate RNA and proteins for qPCR reactions and western blots
respectively.
Cell viability and counts
Cell count and viability was performed on the LunaTM Automated Cell
Counter system (Logos Biosystem, USA) in accordance to the manufacturer’s
instructions. Briefly, the cells were trypsinised at different time points (12h, 24h, 48h
and 72h). The trypsinised cells were then topped up with fresh media to a total
volume of 1000μl media and 10μl of this cell suspension were mixed with 10μl of
trypan blue. 10μl of this diluted cell suspension were then loaded onto the LunaTM
counting slide for analysis.
RNA isolation and cDNA synthesis
The total cellular RNA of HT29 cells were extracted using the miRNeasy
mini kit (Qiagen, Hilden, Germany) in accordance to the manufacturer’s instructions.
Briefly, the cells were lysed and homogenise using the lyse solution provided
(Qiagen, Hilden, Germany). Total RNA was harvested using the RNeasy spin
column and washed twice before elution (Qiagen, Hilden, Germany). Harvested total
RNA was quantitated using Nanodrop 100 spectrophotometer (ThermoScientific,
Waltham, USA) and 1ng of the total RNA was then reverse transcripted using the
iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, CA, USA) in accordance to
the manufacturer’s instructions. Briefly, 1ng of the extracted RNA was mixed with
enzyme reverse transcriptase and buffer to a volume of 20μl and subjected to thermal
profile of 25ºC for 5m, 42ºC for 30m followed by 85ºC for 5m in accordance to the
manufacturer’s instructions.
57
Quantitative real time polymerase chain reaction
The EV71 specific primers targeting the conserved VP1 regions were 5′-
GCTCTATAGGAGATAGTGTGAGTAGGG-3′ and the reverse primer 5′-
ATGACTGCTCACCTGCGTGTT-3′ (Tan et al., 2008a). Primers for SCARB2
receptors were 5′- CCAATACGTCAGACAATGCC-3′ and the reverse primer 5′-
ACCATTCTTGCAGATGCTGA-3′ were designed to span exon-exon boundaries.
The primers for the house-keeping gene actin (β-ACT) used were 5′-
ACCAACTGGGACGACATGGAGAAA-3′ and the reverse primer 5′-
TAGCACAGCCTGGATAGCAACGTA-3′. The quantitative real time polymerase
chain reaction (qPCR) was performed using the iQ™ SYBR® Green Supermix (Bio-
Rad Laboratories, CA, USA) on the BioRad CFX96TM Real-Time PCR system (Bio-
Rad Laboratories, CA, USA). Briefly, 1μl of cDNA and 1 μl of the forward and the
reverse primers were added to iQ™ SYBR® Green Supermix. The reaction mix was
then subjected to thermal cycling profile of denaturation at 95ºC for 10m, followed
by amplification and quantification in 40 cycles at 95ºC for 10s, 60ºC for 30s
followed by 50ºC for 30s. At the end of amplification cycles, melting temperature
analysis was performed by the BioRad CFX96TM Real-Time PCR system (Bio-Rad
Laboratories, CA, USA).
For absolute quantification of EV71, conventional PCR was carried out to
amplify nt2466 to nt2669 within the VP1 region of EV71 (strain 41). The PCR
product (204bp) was then cloned into the pGEM-T plasmid vector (Promega,
Wisconsin, USA) and subsequently transformed into E.coli JM109 competent cells.
RNA was synthesized in vitro from the recombinant plasmids and the concentration
was measured spectrophotometrically at 260nm. The number of viral copies was then
58
calculated. A series of ten-fold dilutions were then prepared, yielding a series of viral
copies ranging from 5 X 100 copies to 5 X 109 copies (Figure 2.1). Relative gene
expression was quantified based on the formula: 2(Ct of gene−Ct of ACT).
Western blot
Total cellular protein extraction for HT29 cells and control cells were
performed using a lysis mix in mammalian cell lysis solution – CelLytic M (Sigma-
Aldrich Pte Ltd, USA) in accordance with manufacturer’s instructions. Equal protein
concentration (20μg) from each samples were added into SDS PAGE, 10% Mini-
PROTEAN® TGX™ (Bio-Rad Laboratories, CA, USA) and separated by
electrophoresis. Separated proteins were transferred onto polyvinylidene diflouride
membranes (Invitrogen, California, USA) using iBlot® Western Detection kit
(Invitrogen, California, USA) in accordance to manufacturer instructions. Ponceau S
staining was performed to ensure equal level of protein present in all lanes according
to Romero-Calvo et al (2010) (Romero-Calvo et al., 2010). Briefly, membranes were
stained with Ponceau S (Sigma-Aldrich Pte Ltd, USA) for 1m and washed three
times with water to remove stain. Western blot was then performed using
WesternBreeze® Chromogenic Kit–Anti-Mouse (Invitrogen, California, USA) in
accordance to manufacturer instructions. Briefly, the membranes were incubated
with mouse anti EV71 antibody (AbD serotech, Oxford, UK) or anti Tubulin
antibody (Santa Cruz Biotechnology inc, California, USA) respectively in shaker for
an hour. The membranes were washed three times before and incubating with
secondary antibodies (Invitrogen, California, USA) for 30m. The membranes were
then washed three times and incubated with chromogen substrate till purple bands
were developed in 1h. The membranes were left to air dry then placed into the
59
densitometer and scanned using the Quantity One software (Bio-Rad Laboratories,
CA, USA). The picture was analysed using Image J (National Institutes of Health,
USA).
Statistical analysis
All statistical analysis was performed on GraphPad Prism Version 6.0c
(GraphPad Software, USA). Student’s t test was used to compare two groups. p
values of < 0.05 were considered statistically significant.
2.3 RESULTS
This study aims to characterise the viral replication in an in vitro model of
HFMD for EV71 pathogenesis study. To this end a human colorectal
adenocarcinoma cell line (HT29) with epithelioid morphology was infected with
EV71 over the time course of 72h.
Cytopathic effects and cell viability of HT29 cells during EV71 infection
There are no changes between control and infected cells at 12hpi, 24hpi and
48hpi (Figure 2.2). However at 72hpi there was a statistically significant decrease of
approximately 60% of the number of infected cells (17.6%) compared to control
(77.5%). There are no apparent change in morphology between infected and control
cells at 12hpi and 24hpi. However, at 48hpi and 72hpi, cells were observed to lose its
adherence and round up, which suggest cells are under stress (Figure 2.2) with
cytopathic effects observed. At 72hpi, in comparison with the control and infected
60
cells, there was a higher number of floating cells in the media which correlate to the
decrease in live cells count (Figure 2.2).
Viral kinetics of EV71 replication
To further study EV71 replication kinetics in HT29 cells, the viral RNA
expression and protein synthesis was monitored over 72h. Using established
protocols, the kinetics of EV71 RNA synthesis in infected HT29 cells were examined
quantitatively using qPCR at various time points (12hr, 24hr, 48hr and 72hr) (Tan et
al., 2008b). Control cells show no viral RNA present (Figure 2.3). There was an
expected exponential increase in viral RNA copy number of the infected cells as
measured by qPCR. Viral RNA was first detected at 12hpi. Approximately 5 million
virus copy number was detected at 12hpi, which then doubles at 24hpi to
approximately 10 million virus copy number. Subsequently at 48hpi, it increased 20
fold to a copy number of approximately 200 million virus copy number. Finally at
72hpi, it increased 5 fold to 1000 million virus copy number. The viral copy number
quantitated had exponential increased at every time point except 72hpi, where there
was only a 5 fold increase in virus copy number (Figure 2.3).
Viral kinetics of EV71 VP1 protein synthesis
In addition to the detection of viral RNA, the kinetics of EV71 VP1 protein
synthesis in infected HT29 cells was monitored using western immunoblotting blot
with antibody specific to EV71 (Figure 2.4). Relative expression of EV71 VP1
protein of infected and control cells were analysed using Image J and a statistically
significant amount of virus protein were only detected at 48hpi and 72hpi.
61
Cellular receptor SCARB2 is present in both HT29 and RD cells
Receptor binding is an essential and vital process during viral infection of the
cells (Patel & Bergelson, 2009, Yamayoshi et al., 2012). Cellular receptor play an
important role in the pathogenicity of viruses, particularly during the internalisation
of virus during infection. As such we quantified the relative expression of a
functional receptor, scavenger receptor class B, member 2 (SCARB2) based on the
formula: 2(Ct of gene−Ct of ACT). Primers for SCARB2 and ACT were designed to span
exon-exon boundaries to give a single PCR product of 89bp and 198bp respectively
(Figure 2.5). HT29 was found to express SCARB2 at the expression level of
approximately 20.2 as compared with RD cells of approximately 26.9. The presence
of SCARB2 in HT29 further supports HT29 cells as a viable in vitro model to study
EV71 pathogenesis.
62
Figure 2.1 Absolute quantification of EV71. A series of ten-fold dilutions
were then prepared, yielding a series of viral copies ranging from 5 X 100 copies to 5
X 109 copies (n=3).
63
Figure 2.2 Cell viability of HT29 cells following EV71 infection. Confluent
HT29 cells were infected with or without EV71 (MOI of 1). (A) HT29 cells were
harvested at different time points and cell viability assessed using vital dye trypan
blue. (n=3, *= p values of < 0.05) (B) Micrograph of confluent HT29 cell cultures
were taken at a magnification of 20X at different time points for 72h.
64
Figure 2.3 Kinetics of EV71 replication in HT29 cells. Confluent HT29 cells
were infected with or without EV71 (MOI of 1). Total intracellular RNA was
harvested at various time points, converted to cDNA and measured by quantitative
real time polymerase chain reaction (qPCR) with primers specific to viral VP1. (n=3,
*= p values of < 0.05) As observed, there was an increase in viral copy number
through increasingly time points.
65
Figure 2.4 Kinetics of EV71 VP1 protein synthesis in HT29 cells. Confluent
HT29 cells were infected with or without EV71 (MOI of 1). Total intracellular
protein was harvested at various time points and measured by western blot and
captured using Quantity One software. (n=3, *= p values of < 0.05) The results were
then analysed using Image J. As observed, it trends the results we observed by viral
RNA amplification. (A) Intracellular viral VP1 measured by Western blotting with
Ponceau S staining control of membrane (B) Relative expression of viral VP1
protein.
66
Figure 2.5 Expression SCARB2 in RD and HT29 cells. Total intracellular
RNA was harvested from RD and HT29 cells, converted to cDNA and measured by
quantitative real time polymerase chain reaction (qRT-PCR) with primers specific to
SCARB2 and β-ACTB. Primers for SCARB2 and ACT (β-actin) were designed to
span exon-exon boundaries to give a single PCR product of 89bp and 198bp
respectively. The presence of SCARB2 in HT29 further supports HT29 cells as a
viable in vitro model to study EV71 pathogenesis.
67
2.4 DISCUSSION
Viral replication kinetics play an important role in the understanding of virus
pathogenesis (Baccam et al., 2006, Chang et al., 2006, Major et al., 2004). The
kinetics of various viruses such as hepatitis C, Nipah virus and influenza virus have
been reported in various studies and have provided valuable information particularly
in response to antiviral therapeutics which aid in understanding the host pathogen
interaction (Baccam et al., 2006, Chang et al., 2006, Major et al., 2004). In
comparison, the only information reported for EV71 virus kinetics was by Lu et al
(2011) who demonstrated EV71 proliferation in rhabdomyosarcoma (RD) cells, of
muscle cells origin as an in vitro model (Lu et al., 2011).
In a clinical context, this may not be a good representative model during EV71
infection of a human host. Various studies have demonstrated in animal model that
the gastrointestinal tract, such as the intestine was the first site for EV71 proliferation
(Chen et al., 2007, Chen et al., 2004, Khong et al., 2012). Furthermore, Khong et al
(2012) reported that mice that were administrated with EV71 via the intraperitoneal
route exhibited 100% mortality, as compared to mice that were administrated with
EV71 via the oral route, with 10-30% mortality (Khong et al., 2012). Interestingly,
the mortality rate of mice administrated with EV71 via the oral route (gastrointestinal
tract) reported by Khong et al (2012) corresponded to the percentage of EV71
infected human patient with central nervous system complications. This suggests the
relevance of studying EV71 in colorectal cell line (oral route), using HT29 as an in
vitro model (Ooi et al., 2010, Ooi et al., 2009, Ooi et al., 2007).
68
In this study, we have demonstrated that upon EV71 infection in human
epithelial colorectal cell line (HT29), significant cell death only occurs at 72hpi. This
was varies from the rhabdomyosarcoma (RD) cells previously reported by Lu et al
(2011) where most cell death occurs within 24hpi. Similarly Chen et al (2007) and
Khong et al (2012) proposed that skeletal muscle cells such as RD cells are more
effective in supporting viral replication which allows persistent enterovirus infection
to represent viral source of entry into the central nervous system (CNS) (Chen et al.,
2007, Khong et al., 2012). In comparison with EV71 RNA synthesis, RNA was first
detected at 12hpi. Viral protein synthesis was only observed at a later stage during
the infection possibly due to translation time required. Lu et al (2011) showed a
similar trend, that viral RNA was first detected at 3hpi while viral protein was
observed at 6hpi. We believe that such differences could be due to the fact that it
takes three times longer for the virus to kill HT29 cells in comparison with RD cells.
Receptor binding is an essential and vital process during virus infection of the
cells (Patel & Bergelson, 2009, Tan et al., 2013, Yamayoshi et al., 2012). Cellular
receptors, therefore, play an important role in the pathogenicity of viruses.
Notwithstanding, viruses have been found to utilise multiple receptors for the
facilitation of entry into susceptible cells (Patel & Bergelson, 2009, Hayes et al.,
2006, Yamayoshi et al., 2009). Thus the identification and characterisation of
cellular receptors plays a critical role in the understanding of EV71 pathogenesis.
Scavenger receptor class B, member 2 (SCARB2) was first reported by Yamayoshi
et al (2009) to be a receptor for all EV71 strains and expressed in the sites of EV71
replication in vivo (Hayes et al., 2006, Yamayoshi et al., 2009). It is composed of 478
amino acids and belongs to the CD36 family (Yamayoshi et al., 2012). SCARB2 is
69
commonly found in abundant in the lysosomal membrane of the cell and assist in the
internalisation of EV71 into the host cell via clathrin mediated endocytosis (Hussain
et al., 2011, Lui et al., 2013b, Yamayoshi et al., 2012). . The presence of SCARB2 in
HT29 further supports HT29 cells as a viable in vitro model to study EV71
pathogenesis.
Considering that different cell types have varying cellular content such as
cytoskeleton and endoplasmic reticulum network which would potentially plays a
role in virus replication, the virus replication kinetics may differ betwen cell types.
Indeed, Hussain et al (2011) has demonstrated that the cytoskeletal system
comprising of both actin and microtubules were involved endocytic kinetics (Buss et
al., 2001, Durrbach et al., 1996, Flanagan & Lin, 1980, Hussain et al., 2011). The
knockdown of genes involves in cytoskeleton formation such as ARPC5, ARRB1,
and WASF1 and the use of drug disrupting the cytoskeleton network such as
cytochalasin B, have resulted in the decrease in EV71 replication kinetics (Hussain et
al., 2011, Lui et al., 2013b).
Furthermore, the incubation period for HFMD is between three to seven days
(Khong et al., 2012, Ooi et al., 2010, Ooi et al., 2009, Ooi et al., 2007). This may
correspond to the number of days the virus requires to pass through the
gastrointestinal tract before spreading throughout the body (Khong et al., 2012, Ooi
et al., 2010, Ooi et al., 2009, Ooi et al., 2007). Therefore, the in vitro model of
human epithelial colorectal cell line (HT29) and EV71 may be more clinically
relevant and mimics the mechanism of pathogenesis of EV71 closer.
70
2.5 CONCLUSION
In conclusion, we have established the use of HT29 cells as a clinically
relevant in vitro model of EV71 replication. We have demonstrated for the first time
an increase of viral concentration in a time course of 72 hours upon infection with
the use of cell viability, qPCR and western blot. In addition, this is the first report on
the presence of SCARB2 in HT29 cells, an essential receptor for all EV71 strains
which established HT29 cells as a viable in vitro model to study EV71 pathogenesis.
Our study has provided valuable knowledge toward the study of EV71 pathogenesis
and virus-host interaction and this could lead to future investigation for the
development of antiviral therapeutics against EV71. Therapeutic agents against
EV71 could be developed by potentially inhibiting several key stages of the viral life
cycle such as viral attachment, translation, polyprotein processing and RNA
replication with the use of HT29 as an in vitro model for EV71 replication (Chen et
al., 2008).
71
2.6 REFERENCES
Baccam, P., C. Beauchemin, C.A. Macken, F.G. Hayden & A.S. Perelson, (2006)
Kinetics of influenza A virus infection in humans. J Virol 80: 7590-7599.
Brown, B.A., M.S. Oberste, J.P. Alexander, Jr., M.L. Kennett & M.A. Pallansch,
(1999) Molecular epidemiology and evolution of enterovirus 71 strains
isolated from 1970 to 1998. J Virol 73: 9969-9975.
Buss, F., J.P. Luzio & J. Kendrick-Jones, (2001) Myosin VI, a new force in clathrin
mediated endocytosis. FEBS letters 508: 295-299.
Cardosa, M.J., D. Perera, B.A. Brown, D. Cheon, H.M. Chan, K.P. Chan, H. Cho &
P. McMinn, (2003) Molecular epidemiology of human enterovirus 71 strains
and recent outbreaks in the Asia-Pacific region: comparative analysis of the
VP1 and VP4 genes. Emerg Infect Dis 9: 461-468.
Chang, L.Y., A.R. Ali, S.S. Hassan & S. AbuBakar, (2006) Quantitative estimation
of Nipah virus replication kinetics in vitro. Virology journal 3: 47.
Chen, C.S., Y.C. Yao, S.C. Lin, Y.P. Lee, Y.F. Wang, J.R. Wang, C.C. Liu, H.Y. Lei
& C.K. Yu, (2007) Retrograde axonal transport: a major transmission route of
enterovirus 71 in mice. J Virol 81: 8996-9003.
Chen, T.C., K.F. Weng, S.C. Chang, J.Y. Lin, P.N. Huang & S.R. Shih, (2008)
Development of antiviral agents for enteroviruses. J Antimicrob Chemother
62: 1169-1173.
Chen, Y.C., C.K. Yu, Y.F. Wang, C.C. Liu, I.J. Su & H.Y. Lei, (2004) A murine oral
enterovirus 71 infection model with central nervous system involvement. J
Gen Virol 85: 69-77.
Chumakov, M., M. Voroshilova, L. Shindarov, I. Lavrova, L. Gracheva, G.
Koroleva, S. Vasilenko, I. Brodvarova, M. Nikolova, S. Gyurova, M.
72
Gacheva, G. Mitov, N. Ninov, E. Tsylka, I. Robinson, M. Frolova, V.
Bashkirtsev, L. Martiyanova & V. Rodin, (1979) Enterovirus 71 isolated
from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60:
329-340.
Durrbach, A., D. Louvard & E. Coudrier, (1996) Actin filaments facilitate two steps
of endocytosis. Journal of cell science 109 ( Pt 2): 457-465.
Flanagan, M.D. & S. Lin, (1980) Cytochalasins block actin filament elongation by
binding to high affinity sites associated with F-actin. The Journal of
biological chemistry 255: 835-838.
Hayes, M.J., D. Shao, M. Bailly & S.E. Moss, (2006) Regulation of actin dynamics
by annexin 2. EMBO J 25: 1816-1826.
Ho, M., E.R. Chen, K.H. Hsu, S.J. Twu, K.T. Chen, S.F. Tsai, J.R. Wang & S.R.
Shih, (1999) An epidemic of enterovirus 71 infection in Taiwan. Taiwan
Enterovirus Epidemic Working Group. N Engl J Med 341: 929-935.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Hussain, K.M., K.L. Leong, M.M. Ng & J.J. Chu, (2011) The essential role of
clathrin-mediated endocytosis in the infectious entry of human enterovirus
71. The Journal of biological chemistry 286: 309-321.
Khong, W.X., B. Yan, H. Yeo, E.L. Tan, J.J. Lee, J.K. Ng, V.T. Chow & S. Alonso,
(2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibits
neurotropism, causing neurological manifestations in a novel mouse model of
EV71 infection. J Virol 86: 2121-2131.
Lee, M.S. & L.Y. Chang, (2010) Development of enterovirus 71 vaccines. Expert
Rev Vaccines 9: 149-156.
73
Lee, T.C., H.R. Guo, H.J. Su, Y.C. Yang, H.L. Chang & K.T. Chen, (2009) Diseases
caused by enterovirus 71 infection. Pediatr Infect Dis J 28: 904-910.
Li, C., H. Wang, S.R. Shih, T.C. Chen & M.L. Li, (2007) The efficacy of viral capsid
inhibitors in human enterovirus infection and associated diseases. Curr Med
Chem 14: 847-856.
Liu, C.C., H.W. Tseng, S.M. Wang, J.R. Wang & I.J. Su, (2000) An outbreak of
enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical
manifestations. Journal of clinical virology : the official publication of the
Pan American Society for Clinical Virology 17: 23-30.
Lu, C.Y., C.Y. Lee, C.L. Kao, W.Y. Shao, P.I. Lee, S.J. Twu, C.C. Yeh, S.C. Lin,
W.Y. Shih, S.I. Wu & L.M. Huang, (2002) Incidence and case-fatality rates
resulting from the 1998 enterovirus 71 outbreak in Taiwan. J Med Virol 67:
217-223.
Lu, J., Y.Q. He, L.N. Yi, H. Zan, H.F. Kung & M.L. He, (2011) Viral kinetics of
enterovirus 71 in human abdomyosarcoma cells. World J Gastroenterol 17:
4135-4142.
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
Major, M.E., H. Dahari, K. Mihalik, M. Puig, C.M. Rice, A.U. Neumann & S.M.
Feinstone, (2004) Hepatitis C virus kinetics and host responses associated
with disease and outcome of infection in chimpanzees. Hepatology
(Baltimore, Md.) 39: 1709-1720.
74
McMinn, P., I. Stratov, L. Nagarajan & S. Davis, (2001) Neurological manifestations
of enterovirus 71 infection in children during an outbreak of hand, foot, and
mouth disease in Western Australia. Clin Infect Dis 32: 236-242.
McMinn, P.C., (2002) An overview of the evolution of enterovirus 71 and its clinical
and public health significance. FEMS microbiology reviews 26: 91-107.
Nagy, G., S. Takatsy, E. Kukan, I. Mihaly & I. Domok, (1982) Virological diagnosis
of enterovirus type 71 infections: experiences gained during an epidemic of
acute CNS diseases in Hungary in 1978. Arch Virol 71: 217-227.
Oberste, M.S., K. Maher, D.R. Kilpatrick, M.R. Flemister, B.A. Brown & M.A.
Pallansch, (1999a) Typing of human enteroviruses by partial sequencing of
VP1. J Clin Microbiol 37: 1288-1293.
Oberste, M.S., K. Maher, D.R. Kilpatrick & M.A. Pallansch, (1999b) Molecular
evolution of the human enteroviruses: correlation of serotype with VP1
sequence and application to picornavirus classification. J Virol 73: 1941-
1948.
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
Ooi, M.H., S.C. Wong, A. Mohan, Y. Podin, D. Perera, D. Clear, S. del Sel, C.H.
Chieng, P.H. Tio, M.J. Cardosa & T. Solomon, (2009) Identification and
validation of clinical predictors for the risk of neurological involvement in
children with hand, foot, and mouth disease in Sarawak. BMC infectious
diseases 9: 3.
Ooi, M.H., S.C. Wong, Y. Podin, W. Akin, S. del Sel, A. Mohan, C.H. Chieng, D.
Perera, D. Clear, D. Wong, E. Blake, J. Cardosa & T. Solomon, (2007)
75
Human enterovirus 71 disease in Sarawak, Malaysia: a prospective clinical,
virological, and molecular epidemiological study. Clin Infect Dis 44: 646-
656.
Patel, K.P. & J.M. Bergelson, (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728-729.
Pourianfar, H.R., C.L. Poh, J. Fecondo & L. Grollo, (2012) In vitro evaluation of the
antiviral activity of heparan sulfate mimetic compounds against Enterovirus
71. Virus research 169: 22-29.
Prager, P., M. Nolan, I.P. Andrews & G.D. Williams, (2003) Neurogenic pulmonary
edema in enterovirus 71 encephalitis is not uniformly fatal but causes severe
morbidity in survivors. Pediatr Crit Care Med 4: 377-381.
Reed, L.J. & H. Muench, (1938) A simple method of estimating fifty percent
endpoints. The American Journal of Hygiene 27: 493–497.
Romero-Calvo, I., B. Ocón, P. Martínez-Moya, M.D. Suárez, A. Zarzuelo, O.
Martínez-Augustin & F.S. de Medina, (2010) Reversible Ponceau staining as
a loading control alternative to actin in Western blots. Analytical
Biochemistry 401: 318-320.
Schmidt, N.J., E.H. Lennette & H.H. Ho, (1974) An apparently new enterovirus
isolated from patients with disease of the central nervous system. J Infect Dis
129: 304-309.
Singh, S., V.T. Chow, M.C. Phoon, K.P. Chan & C.L. Poh, (2002) Direct detection
of enterovirus 71 (EV71) in clinical specimens from a hand, foot, and mouth
disease outbreak in Singapore by reverse transcription-PCR with universal
enterovirus and EV71-specific primers. J Clin Microbiol 40: 2823-2827.
76
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Tan, C.W., C.L. Poh, I.C. Sam & Y.F. Chan, (2013) Enterovirus 71 uses cell surface
heparan sulfate glycosaminoglycan as an attachment receptor. J Virol 87:
611-620.
Tan, E.L., V.T. Chow, S.H. Quak, W.C. Yeo & C.L. Poh, (2008a) Development of
multiplex real-time hybridization probe reverse transcriptase polymerase
chain reaction for specific detection and differentiation of Enterovirus 71 and
Coxsackievirus A16. Diagn Microbiol Infect Dis 61: 294-301.
Tan, E.L., T.M. Tan, V.T. Chow & C.L. Poh, (2007a) Enhanced potency and
efficacy of 29-mer shRNAs in inhibition of Enterovirus 71. Antiviral
research 74: 9-15.
Tan, E.L., T.M. Tan, V. Tak Kwong Chow & C.L. Poh, (2007b) Inhibition of
enterovirus 71 in virus-infected mice by RNA interference. Molecular
therapy : the journal of the American Society of Gene Therapy 15: 1931-
1938.
Tan, E.L., A.P. Wong & C.L. Poh, (2010) Development of potential antiviral strategy
against coxsackievirus B4. Virus research 150: 85-92.
Tan, E.L., L.L. Yong, S.H. Quak, W.C. Yeo, V.T. Chow & C.L. Poh, (2008b) Rapid
detection of enterovirus 71 by real-time TaqMan RT-PCR. Journal of clinical
virology : the official publication of the Pan American Society for Clinical
Virology 42: 203-206.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
77
Yamayoshi, S., K. Fujii & S. Koike, (2012) Scavenger receptor b2 as a receptor for
hand, foot, and mouth disease and severe neurological diseases. Frontiers in
microbiology 3: 32.
Yamayoshi, S., Y. Yamashita, J. Li, N. Hanagata, T. Minowa, T. Takemura & S.
Koike, (2009) Scavenger receptor B2 is a cellular receptor for enterovirus 71.
Nat Med 15: 798-801.
78
Chapter 3
Elucidating the host-pathogen interaction between human colorectal cells and invading enterovirus71 using transcriptomic profiling
79
Title: Elucidating the host-pathogen interaction between human colorectal cells
and invading enterovirus71 using transcriptomic profiling
Author names and affiliations:
Yan Long Edmund Lui 1, 2, 3, 4, Tuan Lin Tan 3, Peter Timms 1, 2, 5, Louise Marie
Hafner 1, 2, Kian Hwa Tan 3, Eng Lee Tan 4, 6
1School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology, Queensland, Australia
2Institute of Health and Biomedical Innovation, Queensland University of
Technology, Queensland, Australia
3School of Chemical and Life Sciences, Singapore Polytechnic, Singapore
4Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singapore
5Faculty of Science, Health, Education & Engineering, University of the Sunshine
Coast, Queensland, Australia
6Department of Paediatrics, University Children's Medical Institute, National
University Hospital, Singapore
80
Statement of Contribution of Co-Authors for
Thesis by Published Paper
The following is the format for the required declaration provided at the start of
any thesis chapter which includes a co-authored publication.
The authors listed below have certified* that:
1. they meet the criteria for authorship in that they have participated in the
conception, execution, or interpretation, of at least that part of the publication in
their field of expertise;
2. they take public responsibility for their part of the publication, except for the
responsible author who accepts overall responsibility for the publication;
3. there are no other authors of the publication according to these criteria;
4. potential conflicts of interest have been disclosed to (a) granting bodies, (b) the
editor or publisher of journals or other publications, and (c) the head of the
responsible academic unit, and
5. they agree to the use of the publication in the student’s thesis and its publication
on the QUT ePrints database consistent with any limitations set by publisher
requirements.
In the case of this chapter:
Lui, Y.L.E., T.L. Tan, P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan, (2014)
Elucidating the host–pathogen interaction between human colorectal cells and
invading Enterovirus 71 using transcriptomic profiling. FEBS Open Bio 4: 426-
431.
81
Contributor Statement of contribution*
Lui Yan Long Edmund
(Ph.D. Candidate) Contributed to all of the laboratory work in the project, conducted
the data analysis and the interpretation of the data and wrote the
manuscript. Signature
Date
Tan Tuan Lin
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Peter Timms
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Louise M Hafner
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Kian Hwa
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Eng Lee
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
82
Chapter 3: Elucidating the host-pathogen interaction between human colorectal cells and invading enterovirus71 using transcriptomic profiling
Abstract
Enterovirus 71 (EV71) is one of the main etiological agents for Hand, Foot and
Mouth Disease (HFMD) which has been shown to be associated with severe clinical
manifestations. Currently, due to a lack in understanding of EV71 pathogenesis,
there are no antiviral therapeutics for the treatment of HFMD patients. This study
seeks to elucidate the transcriptomic changes as the results of EV71 infection.
Human whole genome microarray was employed to monitor changes in genomic
profiles between infected and uninfected cells. The results reveal altered expression
of human genes involved in critical pathways including immune response and stress
response. Together, data from this study provides valuable insights on the host-
pathogen interaction between human colorectal cells and EV71.
83
3.1 INTRODUCTION
Enterovirus71 (EV71) is a positive sense, single stranded, non-enveloped RNA
virus belonging to Enterovirus genus of the Picornaviridae family (Lui et al., 2013b,
McMinn, 2002, McMinn, 2012, Ooi et al., 2010). It is one of the main etiological
agents for Hand, Foot and Mouth Disease (HFMD) which commonly affects infants
and children. This disease is usually self-limiting, characterised by various symptoms
such as fever, rashes, poor appetite and multiple ulcers in mouth (Wong et al., 2010,
Ho et al., 2011, Huang et al., 2012). The route of transmission of EV71 was
postulated to happen via direct contact of vesicular fluid, or droplet from the infected
or via faecal-oral route (Wong et al., 2010, Lee et al., 2009, Liu et al., 2000, Brown
et al., 1999). EV71 was shown to replicate within the gastrointestinal tract, bypass
the gut barrier and infect skeletal muscle cells before entering into the bloodstream
and the central nervous system (Wong et al., 2010, Lee et al., 2009, Liu et al., 2000,
Brown et al., 1999). However, unlike other HFMD causing enteroviruses, EV71
have been commonly associated with severe clinical diseases, including neurological
diseases leading to cardiopulmonary failure and death.
EV71 was first described in 1974 in California (USA) after it was isolated from
patients with central nervous system disease in 1969 (Schmidt et al., 1974). Recent
molecular evolution studies have predicted that EV71 could have emerged in the
human population as early as 1941 (Lee et al., 2012, Tee et al., 2010, van der Sanden
et al., 2009). Large fatal outbreaks of HFMD first appeared in Bulgaria in 1975, and
disease outbreaks were subsequently identified in Hungary in 1978 and re-emerged
after two decades in Malaysia in 1997 and Taiwan in 1998 (Chumakov et al., 1979,
Nagy et al., 1982, Ho et al., 1999, Lu et al., 2002, Solomon et al., 2010). Since then,
84
there have been various outbreaks, epidemics and pandemics that have periodically
been reported worldwide with outbreaks occurring every two to three years in
countries including Australia, China, Taiwan, Japan, Korea, Malaysia, Vietnam,
Thailand and Singapore (Schmidt et al., 1974, Chumakov et al., 1979, McMinn et
al., 2001, Huang et al., 2012).
Currently and due in part to a lack of understanding of viral pathogenesis of
EV71 causing HFMD, there are no effective antiviral therapies or vaccines approved
by the United States of America Food and Drug Administration (FDA) to prevent
HFMD. There is therefore a need to gain a better understanding of the mechanism of
EV71 pathogenesis. The ability to cause infection directly correlates to the
interaction between the host and pathogen. In order to survive and proliferate during
infection, the pathogen must be able to sense, react and adapt to the ever-changing
microenvironment within the host. Such adaptations and the use of the host resources
to proliferate are prerequisites for the successful colonisation of the host and
establish disease. Viruses, being obligate intracellular parasites have developed
highly sophisticated mechanisms not only to exploit the biosynthetic machinery for
replication, but also to specifically evade the host immune system.
During infection, viruses regulate host gene expression to enhance their
survival. Such activities include altering the cellular microenvironment to allow
successful virus replication and evasion of the host immune system (Scaria et al.,
2006, Ghosh et al., 2009, Roberts & Jopling, 2010). Elucidating the mechanism that
the virus uses to bypass host defence systems and establish infections will provide us
with a better understanding of the pathogenesis mechanism of the EV71 virus and
85
will thus aid in the development of potential antiviral therapeutics for HFMD
patients. In this study, transcriptomic profiling was performed using colorectal cells
infected with EV71 using mRNA microarray.
3.2 MATERIALS AND METHODS
Cell culture and virus propagation
Human colorectal cell line (HT29) (ATCC® catalog no. HTB-38™) was
maintained in Roswell Park Memorial Institute medium 1640 (RPMI) (PAA
Laboratories, Austria) supplemented with 10% (v/v) Fetal Bovine Serum (FBS)
(PAA Laboratories, Austria) and 2% penicillin–streptomycin (PAA Laboratories,
Austria) at 37°C with 5% CO2. The EV71 strain used in this study was isolated from
a fatal case of HFMD during October 2000 outbreak in Singapore, Enterovirus
5865/sin/000009 strain from subgenogroup B4 (accession number 316321; hereby
designated as Strain 41). The virus stock was prepared by propagation of viruses
using 90% confluent HT29 cells monolayer in RPMI 1640 with 10% FBS at 37°C
with 5% CO2. The virus titres were determined using 50% tissue culture infective
dose (TCID50) per millilitre (mL) according to Reed and Muench method (Reed &
Muench, 1938).
EV71 infection for mRNA profiling
HT29 cells were seeded at a concentration of 5 × 105 cells/ml in each well of
a 6-well plate and incubated for 24h at 37°C with 5% CO2. Cells were washed twice
with phosphate buffered saline (PBS) and infected with EV71 at multiplicity of
infection (MOI) of 1 or nil respectively. The culture media were removed and
86
replaced with 2 mL fresh RPMI 1640 medium after 1h of incubation at 37°C with
5% CO2. The respective infected cells were harvested at 36 hours posts infection
(hpi). The total cellular RNA of HT29 cells were extracted using the miRNeasy mini
kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Briefly,
the cells were lysed and homogenised using the lyses solution provided (Qiagen,
Hilden, Germany). Total RNA were purified using the RNeasy spin column and
eluted (Qiagen, Hilden, Germany). Harvested total RNA was quantitated using
Nanodrop 100 spectrophotometer (ThermoScientific, Waltham, USA).
mRNA microarray analysis
Extracted total RNA were labelled with GeneChip HT 3' IVT Express Kit
following manufacturer’s instruction. Hybridization to GeneChip PrimeView Human
Gene Expression Array was performed in accordance to manufacturer’s
recommendations. Every chip was scanned at a high resolution by the Affymetrix
GeneChip Scanner 3000 according to the GeneChip Expression Analysis Technical
Manual procedures (Affymetrix, Santa Clara, CA). Briefly, total extracted RNA
underwent two rounds of cDNA synthesis prior to in vitro transcription to synthesise
biotin-modified amplified RNA (Affymetrix, Santa Clara, CA). The amplified RNA
was purified and fragment for the hybridisation onto the GeneChip PrimeView
Human Gene Expression Array (Affymetrix, Santa Clara, CA). Raw data for the
microarray were analysed with the Partek® Genomics Suite (Partek Incorporated,
Saint Louis, USA) where p<0.05 is considered statistically significant.
87
cDNA synthesis and Quantitative real time polymerase chain reaction
For the conversion of mRNA to cDNA, 1μg of the total RNA was reverse
transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, CA,
USA) in accordance to the manufacturer’s instructions. Briefly, 1μg of the extracted
RNA was mixed with enzyme reverse transcriptase and buffer to a volume of 20μl
and subjected to thermal profile of 25ºC for 5m, 42ºC for 30m followed by 85ºC for
5m in accordance to the manufacturer’s instructions.
The quantitative real time polymerase chain reaction (qPCR) was performed using
the iTaq™ Universal SYBR® Green Supermix (Bio-Rad Laboratories, CA, USA) on
the BioRad CFX96TM Real-Time PCR system (Bio-Rad Laboratories, CA, USA).
The primers used in this study are listed in Table 3.1. Briefly, 1μl cDNA and 1μl of
the forward and the reverse primers were added to iTaq™ Universal SYBR® Green
Supermix. The reaction mix was then subjected to thermal cycling profile of
denaturation at 95ºC for 30s, followed by amplification and quantification in 40
cycles at 95ºC for 5s followed by 60ºC for 30s. At the end of amplification cycles,
melting temperature analysis was performed by the BioRad CFX96TM Real-Time
PCR system (Bio-Rad Laboratories, CA, USA). Relative gene expression was
quantified based on 2-∆∆CT method using the housekeeping gene β-actin as the
reference gene (Livak & Schmittgen, 2001).
Data analysis
All statistical analysis was performed on GraphPad Prism Version 6.0c
(GraphPad Software, USA). Student’s t test was used to compare two groups. p
values of < 0.05 were considered statistically significant.
88
Table 3.1 Primers used in this study
Primers 5′-3'
EV71-VP1-Reverse GCTCTATAGGAGATAGTGTGAGTAGGG
EV71-VP1-Forward ATGACTGCTCACCTGCGTGTT
IL29/IFN lambda1-Forward ACCGTGGTGCTGGTGACTT
IL29/IFN lambda1-Reverse CTAGCTCCTGTGGTGACAGA
IFN beta1-Forward ATGACCAACAAGTGTCTCCTCC
IFN beta1-Reverse GGAATCCAAGCAAGTTGTAGCTC
IFN gamma1-Forward TCTTTGGGTCAGAGTTAAAGCCA
IFN gamma1-Reverse TTCCATCTCGGCATACAGCAA
ISG54-Forward AAGCACCTCAAAGGGCAAAAC
ISG54-Reverse TCGGCCCATGTGATAGTAGAC
ISG56-Forward TTGATGACGATGAAATGCCTGA
ISG56-Reverse CAGGTCACCAGACTCCTCAC
β-actin Forward ACCAACTGGGACGACATGGAGAAA
β-actin Reverse TAGCACAGCCTGGATAGCAACGTA
89
3.3 RESULTS AND DISCUSSION
Systemic analyses of host response to EV71 provide critical clues to
understand the molecular mechanism of EV71 pathogenesis during infection of a
human host. Regulation and alteration of the host cellular system can also be
monitored by studying the host cellular transcriptomic change following enterovirus
infection. Transcriptomic analysis via RNA-sequencing, mRNA microarray and PCR
array have been previously used to analyse host gene expression (Fook & Chow,
2010, Leong & Chow, 2006, Xu et al., 2013). However, these studies have been
performed on rhabdomyosarcoma (RD) cells or SH-SY5Y cells, of muscle cells or
neuronal origin respectively. In a clinical context, this may not be a good
representative model during EV71 infection of a human host, as various studies have
demonstrated that the gastrointestinal tract is the first site for EV71 proliferation
(Chen et al., 2007, Chen et al., 2004, Khong et al., 2012). Considering that different
cell types have varying cellular content, host-pathogen interaction may differ
between cell types (Lu et al., 2011, Lui et al., 2013a, Lui et al., 2013b). We have
previously reported a human colorectal adenocarcinoma cell line (HT29) with
epithelioid morphology as a useful in vitro model to study the pathogenesis of EV71
(Lui et al., 2013a). To this end, this study utilised HT29 as a model for the
transcriptomic analysis of host response to EV71 infection.
Identification of deregulated mRNAs during EV71 infection
To identify the differentially transcribed mRNAs in HT29 during EV71
infection, we perform mRNAs profiling using GeneChip PrimeView Human Gene
Expression Array. Comparative mRNAs expression between EV71 infected cells and
control non-infected cells were performed. Microarray hybridisation identified 699
90
genes being differentially expressed significantly during EV71 infection (p<0.05)
(Figure 3.1). Using Partek® Genomics Suite, 699 differentially transcribed genes
between EV71 infected and control non-infected HT29 were further analyses to
generate pathways with enrichment score of <2 (Figure 3.2). These differentially
transcribed genes were involved in critical pathways including immune response,
stress response, metabolism, cytotoxicity, cytokines and cytoskeleton network etc
(Figure 3.2).
In response to viral infection, cells were known to induce an immunological
response to combat invading pathogens. In particular, immune response cytokines
IL29 / interferon (IFN)-λ1 and IFN-β1 were significantly up-regulated in EV71
infected cells (Appendix A). The microarray results were validated using qPCR. In
line with the microarray findings, qPCR revealed that both IL29 and IFN-β1 were
significantly up-regulated by approximately 20 fold and 3 fold in EV71 infected cells
respectively (Figure 3.3a and 3.3b). This is not surprising as that both IL29 and IFN-
β1 are cytokines which play important roles in host antiviral responses (Park et al.,
2012, Osterlund et al., 2005, Pagliaccetti et al., 2008). In addition, IL29 has been
previously reported to be up regulated during viral infections such as influenza A,
hepatitis C virus and Sendai viruses (Park et al., 2012, Osterlund et al., 2005,
Pagliaccetti et al., 2008). A key characteristic of cytokines is the ability to interact
with one another to establish coordinated defence mechanism against invading
pathogens. IL29 functions by binding to a unique receptor, through a signalling
pathway identical to IFN-β1 and IFN-γ1 receptors inducing cellular antiviral activity
to inhibit virus replication (Park et al., 2012, Osterlund et al., 2005, Pagliaccetti et
al., 2008). Synergetic effects between IL29, IFN-β1 and IFN-γ1 were shown to
91
promote cellular antiviral response (Park et al., 2012, Osterlund et al., 2005,
Pagliaccetti et al., 2008). Indeed, the use of IL29, IFN-β1 and IFN-γ1 as antiviral
treatments has been shown to inhibit various viruses including herpes simplex-1
virus, mouse hepatitis virus type 2, human T-lymphotropic virus-1, cytomegalovirus
and hepatitis C virus (Sainz & Halford, 2002, Pierce et al., 2005, Fuchizaki et al.,
2003, D'Onofrio et al., 1992, Sainz et al., 2005, Okuse et al., 2005, Larkin et al.,
2003). As such during EV71 infection, HT29 may up regulate cytokines such as
IL29, IFN-β1 and IFN-γ1 (type I, II and III IFN) to induce interferon stimulated
genes (ISG) as part of cellular antiviral response to slow down virus replication.
To verify this hypothesis, we performed qPCR on IFN-gamma1 receptors,
ISG54 and ISG56 to investigate if these genes have been up regulated during EV71
infection. In agreement with our hypothesis, our qPCR results show significant up
regulation of these cytokines in response to EV71 infection (Figure 3.3c, 3.4a and
3.4b). This supports the notion that the host colorectal cells up-regulate cytokines
such as IL29, IFN-β1 and IFN-γ1 (type I, II and III IFN) possibly by a series of JAK-
STAT signalling pathways to induce ISG such as ISG54 and ISG56 (Figure 3.5).
However, Lei et al (2010, 2011, 2013) previously reported that EV71 3C protein
suppressed the host immune response such as type I interferon during infection in
RD cells (muscle cells) (Lei et al., 2010, Lei et al., 2011, Lei et al., 2013). As such,
the mechanism whereby EV71 mediates host immune system may differ between
cell types. To support this hypothesis, Chi et al (2013) have compared the expression
of IFN-signalling pathway between intestinal epithelial cells and muscle cells, and
demonstrated that intestinal cells have indeed a significant higher expression of
cytokines in response to infection in comparison with muscle cells (Chi et al., 2013).
92
This may explain the fact it takes three times longer for the virus to kill HT29 cells in
comparison with RD cells (Lu et al., 2011, Lui et al., 2013a). In addition, IFN
signalling pathways such as type I interferon was previously demonstrated to play an
important role during EV71 pathogenesis (Liu et al., 2005).
Effectively, the intestinal epithelial immune system, being the initial site of
infection plays a critical role in the disease progression and clinical prognosis.
Impaired or immature immunity has previously been associated with increased
morbidity and mortality in EV71 of young children and immune deficient adults (Liu
et al., 2005). The ability to eliminate viral pathogen such as EV71 at the initial site of
infection is critical as a weaker immune response results in a higher viral titre leading
to a systemic spread with more serve complication (Chi et al., 2013). One of the key
antiviral responses that the intestinal epithelial immune system utilises may be the
type I, II and III IFN to eliminate invading EV71 (Figure 3.5).
93
Figu
re 3
.1 H
eat m
ap o
f the
mic
roar
ray
mR
NA
exp
ress
ion
prof
ile o
f EV
71 in
fect
ed a
nd n
on-in
fect
ed c
ontr
ol c
olor
ecta
l cel
ls, H
T29
. The
two-
way
hie
rarc
hica
l clu
ster
hea
t map
sho
ws
diff
eren
tially
exp
ress
ed m
RN
As
from
two
grou
ps o
f sam
ples
. The
mR
NA
s w
ere
chos
en a
ccor
ding
to th
e cu
t off
p<
0.05
whe
re b
lue
repr
esen
ts m
RN
As
with
dec
reas
ed e
xpre
ssio
n an
d re
d re
pres
ent m
RN
As
with
incr
ease
d ex
pres
sion
. (n=
3, *
= p
valu
es o
f < 0
.05)
.
94
Figu
re 3
.2 P
athw
ay a
naly
sis
of d
iffer
entia
lly e
xpre
ssed
gen
es o
f EV
71 in
fect
ed a
nd n
on-in
fect
ed c
ontr
ol c
olor
ecta
l cel
ls, H
T29
. Pat
hway
s
with
enr
ichm
ent s
core
of <
2 w
as g
ener
ated
usi
ng P
arte
k® G
enom
ics S
uite
(Par
tek
Inco
rpor
ated
, Sai
nt L
ouis
, USA
) (n=
3).
95
Figure 3.3 Expression level of Type I, II and III IFN signalling pathways in
response to EV71 infection. Confluent HT29 cells were infected with or without
EV71 (MOI of 1). Total intracellular RNA were harvested 36hpi, converted to cDNA
and measured by quantitative real time polymerase chain reaction (qPCR). (A)
Expression of IL29/ IFN-λ1 (B) Expression of IFN-β1 (C) Expression of IFN-γ1
(n=3, *= p values of < 0.05).
96
Figure 3.4 Expression level of interferon stimulated genes in response to EV71
infection. Confluent HT29 cells were infected with or without EV71 (MOI of 1).
Total intracellular RNA were harvested 36hpi, converted to cDNA and measured by
quantitative real time polymerase chain reaction (qPCR). (A) Expression of ISG54
(B) Expression of ISG56 (n=3, *= p values of < 0.05).
97
Figure 3.5 Schematic illustration of the interplay between Type I, II and III IFN
pathways and invading viral pathogen-EV71. Following EV71 infection, host
activate Type I, II and III IFN pathways through a series of JAK-STAT signalling
cascade to mobilise interferon stimulated genes such as ISG54 and ISG56 in attempt
to slow down virus replication.
98
3.4 CONCLUSION
In conclusion, this study utilised HT29 as an in vitro model to investigate the
transcriptomic changes in human colorectal cells in response to EV71 infection.
Human whole genome microarray was employed to monitor changes in profiles
between EV71 infected cells and uninfected control cells. The result reveals altered
expression of human mRNAs in selected pathways including immune response,
stress response, metabolism, cytotoxicity, cytokines and cytoskeleton network.
Interestingly, our results shows significant up regulation of type I, II and III IFN
which suggest that during EV71 infection, this may be the key antiviral response
HT29 cells undertake to eliminate invading EV71. Taken together, data from this
study provide valuable fundamental information toward understanding of host-
pathogen interaction between human colorectal cells and invading EV71. Elucidating
the mechanism that the virus uses to bypass host defence systems and establish
infections will provide us with a better understanding of the pathogenesis mechanism
of the EV71 virus and will thus aid in the development of potential antiviral
therapeutics for HFMD patients.
99
3.5 REFERENCES
Brown, B.A., M.S. Oberste, J.P. Alexander, Jr., M.L. Kennett & M.A. Pallansch,
(1999) Molecular epidemiology and evolution of enterovirus 71 strains
isolated from 1970 to 1998. J Virol 73: 9969-9975.
Chen, C.S., Y.C. Yao, S.C. Lin, Y.P. Lee, Y.F. Wang, J.R. Wang, C.C. Liu, H.Y. Lei
& C.K. Yu, (2007) Retrograde axonal transport: a major transmission route of
enterovirus 71 in mice. J Virol 81: 8996-9003.
Chen, Y.C., C.K. Yu, Y.F. Wang, C.C. Liu, I.J. Su & H.Y. Lei, (2004) A murine oral
enterovirus 71 infection model with central nervous system involvement. J
Gen Virol 85: 69-77.
Chi, C., Q. Sun, S. Wang, Z. Zhang, X. Li, C.J. Cardona, Y. Jin & Z. Xing, (2013)
Robust antiviral responses to enterovirus 71 infection in human intestinal
epithelial cells. Virus research.
Chumakov, M., M. Voroshilova, L. Shindarov, I. Lavrova, L. Gracheva, G.
Koroleva, S. Vasilenko, I. Brodvarova, M. Nikolova, S. Gyurova, M.
Gacheva, G. Mitov, N. Ninov, E. Tsylka, I. Robinson, M. Frolova, V.
Bashkirtsev, L. Martiyanova & V. Rodin, (1979) Enterovirus 71 isolated
from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60:
329-340.
D'Onofrio, C., O. Franzese, A. Puglianiello, E. Peci, G. Lanzilli & E. Bonmassar,
(1992) Antiviral activity of individual versus combined treatments with
interferon alpha, beta and gamma on early infection with HTLV-I in vitro.
International journal of immunopharmacology 14: 1069-1079.
100
Fook, L.W. & V.T. Chow, (2010) Transcriptome profiling of host-microbe
interactions by differential display RT-PCR. Methods in molecular biology
(Clifton, N.J.) 630: 33-47.
Fuchizaki, U., S. Kaneko, Y. Nakamoto, Y. Sugiyama, K. Imagawa, M. Kikuchi &
K. Kobayashi, (2003) Synergistic antiviral effect of a combination of mouse
interferon-alpha and interferon-gamma on mouse hepatitis virus. J Med Virol
69: 188-194.
Ghosh, Z., B. Mallick & J. Chakrabarti, (2009) Cellular versus viral microRNAs in
host-virus interaction. Nucleic Acids Res 37: 1035-1048.
Ho, B.C., S.L. Yu, J.J. Chen, S.Y. Chang, B.S. Yan, Q.S. Hong, S. Singh, C.L. Kao,
H.Y. Chen, K.Y. Su, K.C. Li, C.L. Cheng, H.W. Cheng, J.Y. Lee, C.N. Lee
& P.C. Yang, (2011) Enterovirus-induced miR-141 contributes to shutoff of
host protein translation by targeting the translation initiation factor eIF4E.
Cell Host Microbe 9: 58-69.
Ho, M., E.R. Chen, K.H. Hsu, S.J. Twu, K.T. Chen, S.F. Tsai, J.R. Wang & S.R.
Shih, (1999) An epidemic of enterovirus 71 infection in Taiwan. Taiwan
Enterovirus Epidemic Working Group. N Engl J Med 341: 929-935.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Khong, W.X., B. Yan, H. Yeo, E.L. Tan, J.J. Lee, J.K. Ng, V.T. Chow & S. Alonso,
(2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibits
neurotropism, causing neurological manifestations in a novel mouse model of
EV71 infection. J Virol 86: 2121-2131.
Larkin, J., L. Jin, M. Farmen, D. Venable, Y. Huang, S.L. Tan & J.I. Glass, (2003)
Synergistic antiviral activity of human interferon combinations in the
101
hepatitis C virus replicon system. Journal of interferon & cytokine research :
the official journal of the International Society for Interferon and Cytokine
Research 23: 247-257.
Lee, M.S., F.C. Tseng, J.R. Wang, C.Y. Chi, P. Chong & I.J. Su, (2012) Challenges
to licensure of enterovirus 71 vaccines. PLoS neglected tropical diseases 6:
e1737.
Lee, T.C., H.R. Guo, H.J. Su, Y.C. Yang, H.L. Chang & K.T. Chen, (2009) Diseases
caused by enterovirus 71 infection. Pediatr Infect Dis J 28: 904-910.
Lei, X., X. Liu, Y. Ma, Z. Sun, Y. Yang, Q. Jin, B. He & J. Wang, (2010) The 3C
protein of enterovirus 71 inhibits retinoid acid-inducible gene I-mediated
interferon regulatory factor 3 activation and type I interferon responses. J
Virol 84: 8051-8061.
Lei, X., Z. Sun, X. Liu, Q. Jin, B. He & J. Wang, (2011) Cleavage of the adaptor
protein TRIF by enterovirus 71 3C inhibits antiviral responses mediated by
Toll-like receptor 3. J Virol 85: 8811-8818.
Lei, X., X. Xiao, Q. Xue, Q. Jin, B. He & J. Wang, (2013) Cleavage of interferon
regulatory factor 7 by enterovirus 71 3C suppresses cellular responses. J
Virol 87: 1690-1698.
Leong, W.F. & V.T. Chow, (2006) Transcriptomic and proteomic analyses of
rhabdomyosarcoma cells reveal differential cellular gene expression in
response to enterovirus 71 infection. Cellular microbiology 8: 565-580.
Liu, C.C., H.W. Tseng, S.M. Wang, J.R. Wang & I.J. Su, (2000) An outbreak of
enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical
manifestations. Journal of clinical virology : the official publication of the
Pan American Society for Clinical Virology 17: 23-30.
102
Liu, M.L., Y.P. Lee, Y.F. Wang, H.Y. Lei, C.C. Liu, S.M. Wang, I.J. Su, J.R. Wang,
T.M. Yeh, S.H. Chen & C.K. Yu, (2005) Type I interferons protect mice
against enterovirus 71 infection. J Gen Virol 86: 3263-3269.
Livak, K.J. & T.D. Schmittgen, (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25: 402-408.
Lu, C.Y., C.Y. Lee, C.L. Kao, W.Y. Shao, P.I. Lee, S.J. Twu, C.C. Yeh, S.C. Lin,
W.Y. Shih, S.I. Wu & L.M. Huang, (2002) Incidence and case-fatality rates
resulting from the 1998 enterovirus 71 outbreak in Taiwan. J Med Virol 67:
217-223.
Lu, J., Y.Q. He, L.N. Yi, H. Zan, H.F. Kung & M.L. He, (2011) Viral kinetics of
enterovirus 71 in human abdomyosarcoma cells. World J Gastroenterol 17:
4135-4142.
Lui, Y., P. Timms, L. Hafner, T. Tan, K. Tan & E. Tan, (2013a) Characterisation of
enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013b) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
McMinn, P., I. Stratov, L. Nagarajan & S. Davis, (2001) Neurological manifestations
of enterovirus 71 infection in children during an outbreak of hand, foot, and
mouth disease in Western Australia. Clin Infect Dis 32: 236-242.
McMinn, P.C., (2002) An overview of the evolution of enterovirus 71 and its clinical
and public health significance. FEMS microbiology reviews 26: 91-107.
103
McMinn, P.C., (2012) Recent advances in the molecular epidemiology and control of
human enterovirus 71 infection. Current opinion in virology 2: 199-205.
Nagy, G., S. Takatsy, E. Kukan, I. Mihaly & I. Domok, (1982) Virological diagnosis
of enterovirus type 71 infections: experiences gained during an epidemic of
acute CNS diseases in Hungary in 1978. Arch Virol 71: 217-227.
Okuse, C., J.A. Rinaudo, K. Farrar, F. Wells & B.E. Korba, (2005) Enhancement of
antiviral activity against hepatitis C virus in vitro by interferon combination
therapy. Antiviral research 65: 23-34.
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
Osterlund, P., V. Veckman, J. Siren, K.M. Klucher, J. Hiscott, S. Matikainen & I.
Julkunen, (2005) Gene expression and antiviral activity of alpha/beta
interferons and interleukin-29 in virus-infected human myeloid dendritic
cells. J Virol 79: 9608-9617.
Pagliaccetti, N.E., R. Eduardo, S.H. Kleinstein, X.J. Mu, P. Bandi & M.D. Robek,
(2008) Interleukin-29 functions cooperatively with interferon to induce
antiviral gene expression and inhibit hepatitis C virus replication. The Journal
of biological chemistry 283: 30079-30089.
Park, H., E. Serti, O. Eke, B. Muchmore, L. Prokunina-Olsson, S. Capone, A. Folgori
& B. Rehermann, (2012) IL-29 is the dominant type III interferon produced
by hepatocytes during acute hepatitis C virus infection. Hepatology
(Baltimore, Md.) 56: 2060-2070.
Pierce, A.T., J. DeSalvo, T.P. Foster, A. Kosinski, S.K. Weller & W.P. Halford,
(2005) Beta interferon and gamma interferon synergize to block viral DNA
104
and virion synthesis in herpes simplex virus-infected cells. J Gen Virol 86:
2421-2432.
Reed, L.J. & H. Muench, (1938) A simple method of estimating fifty percent
endpoints. The American Journal of Hygiene 27: 493–497.
Roberts, A.P. & C.L. Jopling, (2010) Targeting viral infection by microRNA
inhibition. Genome Biol 11: 201.
Sainz, B., Jr. & W.P. Halford, (2002) Alpha/Beta interferon and gamma interferon
synergize to inhibit the replication of herpes simplex virus type 1. J Virol 76:
11541-11550.
Sainz, B., Jr., H.L. LaMarca, R.F. Garry & C.A. Morris, (2005) Synergistic
inhibition of human cytomegalovirus replication by interferon-alpha/beta and
interferon-gamma. Virology journal 2: 14.
Scaria, V., M. Hariharan, S. Maiti, B. Pillai & S.K. Brahmachari, (2006) Host-virus
interaction: a new role for microRNAs. Retrovirology 3: 68.
Schmidt, N.J., E.H. Lennette & H.H. Ho, (1974) An apparently new enterovirus
isolated from patients with disease of the central nervous system. J Infect Dis
129: 304-309.
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Tee, K.K., T.T. Lam, Y.F. Chan, J.M. Bible, A. Kamarulzaman, C.Y. Tong, Y.
Takebe & O.G. Pybus, (2010) Evolutionary genetics of human enterovirus
71: origin, population dynamics, natural selection, and seasonal periodicity of
the VP1 gene. J Virol 84: 3339-3350.
105
van der Sanden, S., M. Koopmans, G. Uslu & H. van der Avoort, (2009)
Epidemiology of enterovirus 71 in the Netherlands, 1963 to 2008. J Clin
Microbiol 47: 2826-2833.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
Xu, L.J., T. Jiang, F.J. Zhang, J.F. Han, J. Liu, H. Zhao, X.F. Li, R.J. Liu, Y.Q.
Deng, X.Y. Wu, S.Y. Zhu, E.D. Qin & C.F. Qin, (2013) Global
transcriptomic analysis of human neuroblastoma cells in response to
enterovirus type 71 infection. PLoS One 8: e65948.
106
Chapter 4
EV71 utilise host microRNAs to mediate host immune system enhancing survival during
infection
107
Title: Enterovirus71 (EV71) utilise host microRNAs to mediate host immune
system enhancing survival during infection
Author names and affiliations:
Yan Long Edmund Lui 1, 2, 3, 4*, Tuan Lin Tan 3, Wee Hong Woo 3, Peter Timms 1, 2,
5, Louise Marie Hafner 1, 2**, Kian Hwa Tan 3, Eng Lee Tan 4, 6
1School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology, Queensland, Australia
2Institute of Health and Biomedical Innovation, Queensland University of
Technology, Queensland, Australia
3School of Chemical and Life Sciences, Singapore Polytechnic, Singapore
4Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singapore
5Faculty of Science, Health, Education & Engineering, University of the Sunshine
Coast, Queensland, Australia
6Department of Paediatrics, University Children's Medical Institute, National
University Hospital, Singapore
108
Statement of Contribution of Co-Authors for
Thesis by Published Paper
The following is the format for the required declaration provided at the start of
any thesis chapter which includes a co-authored publication.
The authors listed below have certified* that:
1. they meet the criteria for authorship in that they have participated in the
conception, execution, or interpretation, of at least that part of the publication in
their field of expertise;
2. they take public responsibility for their part of the publication, except for the
responsible author who accepts overall responsibility for the publication;
3. there are no other authors of the publication according to these criteria;
4. potential conflicts of interest have been disclosed to (a) granting bodies, (b) the
editor or publisher of journals or other publications, and (c) the head of the
responsible academic unit, and
5. they agree to the use of the publication in the student’s thesis and its publication
on the QUT ePrints database consistent with any limitations set by publisher
requirements.
In the case of this chapter:
Lui, Y.L.E., T.L. Tan, W.H. Woo, P. Timms, L.M. Hafner, K.H. Tan & E.L.
Tan, (2014) Enterovirus71 (EV71) Utilise Host microRNAs to Mediate Host
Immune System Enhancing Survival during Infection. PLoS ONE 9: e102997.
109
Contributor Statement of contribution*
Lui Yan Long Edmund
(Ph.D. Candidate) Contributed to the majority of the laboratory work in the project,
conducted the data analysis and the interpretation of the data and
wrote the manuscript. Signature
Date
Tan Tuan Lin
Contributed to the laboratory work and critically revised the
manuscript and approved the final draft of the manuscript.
Woo Wee Hong
Contributed to the design of the study and approved the final draft
of the manuscript.
Peter Timms
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Louise M Hafner
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Kian Hwa
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
Tan Eng Lee
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
110
Chapter 4: EV71 utilise host microRNAs to mediate host immune system enhancing survival during infection
Abstract
Hand, Foot and Mouth Disease (HFMD) is a self-limiting viral disease that
mainly affects infants and children. In contrast with other HFMD causing
enteroviruses, Enterovirus71 (EV71) has commonly been associated with severe
clinical manifestation leading to death. Currently, due to a lack in understanding of
EV71 pathogenesis, there are no antiviral therapeutics for the treatment of HFMD
patients. Therefore, the need to better understand the mechanism of EV71
pathogenesis is warranted. We have previously reported a human colorectal
adenocarcinoma cell line (HT29) based model to study the pathogenesis of EV71.
Using this system, we showed that knockdown of DGCR8, an essential cofactor for
microRNAs biogenesis, resulted in a reduction of EV71 replication. We also
demonstrated that there are miRNAs changes during EV71 pathogenesis and EV71
utilise host miRNAs to attenuate antiviral pathways during infection. Together, data
from this study provide critical information on the role of miRNAs during EV71
infection.
111
4.1 INTRODUCTION
Hand, Foot and Mouth Disease (HFMD) is a contagious viral disease that
commonly affects infants and children, with blisters and flu like symptoms (Lui et
al., 2013b, McMinn, 2002, McMinn, 2012, Ooi et al., 2010, Patel & Bergelson,
2009, Solomon et al., 2010). HFMD is caused by a group of enteroviruses such as
enterovirus 71 (EV71) and coxsackievirus A16 (CA16) (Wong et al., 2010, Ho et al.,
2011, Huang et al., 2012). However, unlike other HFMD causing enteroviruses,
EV71 is also commonly associated with severe clinical diseases, including
neurological diseases such as aseptic meningitis, brainstem and cerebellar
encephalitis leading to cardiopulmonary failure and death (Chu et al., 2001, Lee et
al., 2011, Lee & Chang, 2010, Lee et al., 2012, McMinn, 2012). Due in part to a lack
of understanding of viral pathogenesis of EV71 causing HFMD, there are no antiviral
therapies or vaccines approved by the United States of America Food and Drug
Administration (FDA) to prevent HFMD infections. There is therefore a need to gain
a better understanding of the mechanism of EV71 pathogenesis. During infection,
viruses attenuate host gene expression to enhance their survival (Viswanathan et al.,
2010, tenOever, 2013, Taylor & Mossman, 2013, Randall & Goodbourn, 2008,
Rajsbaum & Garcia-Sastre, 2013). Such activities include altering the cellular
microenvironment to allow successful virus replication and evasion of the host
immune system (Munday et al., 2012).
The host innate system is the first line of defence with the interferon (IFNs)
being a key component against viral infection (Versteeg & Garcia-Sastre, 2010,
Thompson et al., 2011, Randall & Goodbourn, 2008, Rajsbaum & Garcia-Sastre,
2013, Oudshoorn et al., 2012, de Weerd & Nguyen, 2012, Brennan & Bowie, 2010,
112
Boss & Renne, 2011). The release of IFNs begins with the recognition of pathogen-
associated molecular patterns (PAMPs) which include Toll like receptors (TLRs),
NOD like receptors (NLRs), retinoic acid-inducible gene I (RIG-I) like receptors
(Kanarek & Ben-Neriah, 2012, Brennan & Bowie, 2010). This family of cytokines
act in an autocrine and paracrine manner to induce expression of transcription
factors, gamma activated sequence and IFN stimulated response element and the
consequent induction of IFN-stimulated genes (ISGs) which function to slow down
viral infection (Versteeg & Garcia-Sastre, 2010, Thompson et al., 2011, Oudshoorn
et al., 2012). Antiviral pathways such as the programmed cell death (apoptosis) could
also be activated by the host cells in attempt to control the infection by limiting viral
replication (Munday et al., 2012).
Many viruses have evolved to counteract with strategies by host cells to
establish infection. One of the mediators for such regulation includes genes that
encode for microRNA (miRNAs). microRNAs are small single-stranded RNA
species of approximately 20-24 bases in length that play a pivotal role in the post
transcriptional regulation of gene expression (Sullivan & Ganem, 2005, Scaria et al.,
2006). These small RNA were first discovered in Caenorhabditis elegans, but were
later discovered in a wide range of organisms from uni to multicellular eukaryotes
(Ghosh et al., 2009, Lau et al., 2001, Lee et al., 1993). miRNAs are found to regulate
many cellular functions including cell proliferation, differentiation, homeostasis,
immune activation and apoptosis (Skalsky & Cullen, 2010, Scaria et al., 2006,
Nathans et al., 2009, Mack, 2007, Ghosh et al., 2009). As such, miRNAs can
contribute to the repertoire of host-pathogen interactions during infection by
modulating and directing host and viral gene expression thereby playing a pivotal
113
role during infection. Elucidating the mechanism that the virus uses to bypass host
defence systems and establish infections will provide us with a better understanding
of the pathogenesis mechanism of the EV71 virus, allowing development of potent
antiviral therapeutics for HFMD patients.
In this study, we explore the role of miRNAs in the pathogenesis of EV71
infected HT29 cells and identified key miRNA changes due to EV71 infection which
might play a key role during EV71 pathogenesis.
4.2 MATERIALS AND METHODS
Cell culture and virus propagation
The EV71 strain used in this study was isolated from a fatal case of HFMD
during October 2000 outbreak in Singapore, Enterovirus 5865/sin/000009 strain from
subgenogroup B4 (accession number 316321; hereby designated as Strain 41) ( a gift
from Mrs Phoon Meng Chee, Department of Microbiology, National University of
Singapore). Human colorectal cell line (HT29) (ATCC catalog no. HTB-38™) was
maintained in Roswell Park Memorial Institute medium 1640 (RPMI) (PAA
Laboratories, Austria) supplemented with 10% (v/v) Fetal Bovine Serum (FBS)
(PAA Laboratories, Austria) and 2% penicillin–streptomycin (PAA Laboratories,
Austria) at 37 °C with 5% CO2. Human skeleton muscle cell line (RD) (ATCC
catalog no. CCL-136™) and Human colorectal cell line (RKO) (ATCC catalog no.
CRL-2577™) were maintained in Eagle’s minimum essential medium (EMEM)
(PAA Laboratories, Austria) supplemented with 10% (v/v) Fetal Bovine Serum
(FBS) (PAA Laboratories, Austria) and 2% penicillin–streptomycin (PAA
114
Laboratories, Austria) at 37 °C with 5% CO2. The virus stock was prepared by
propagation of viruses using 90% confluent HT29 cells monolayer in RPMI with
10% FBS at 37 °C with 5% CO2. The virus titres were determined using 50% tissue
culture infective dose (TCID50) per millilitre (mL) according to Reed and Muench
method (Reed & Muench, 1938).
DsiRNA transfection and EV71 infection
HT29, RD and RKO cells were seeded at a concentration of 2 × 105 cells/ml
in 6-well plates and incubated for 8 h at 37 °C with 5% CO2. Cells were washed
twice with phosphate buffered saline (PBS) and transfected using Lipofectamine
RNAiMAX (Invitrogen Corporation, CA, USA) with TriFECTa™ Dicer-Substrate
RNAi KIT (Integrated DNA Technology, Coralville, IA, USA). Briefly, 10nM of
DGCR8 DsiRNA (NM_001190326 duplex 2), NC1, negative control duplex -
scrambled DsiRNA (NM_001190326) and TYE™ 563 DS Transfection Control,
fluorescent-labeled transfection control duplex (NM_001190326) were used to
transfect the cells respectively (Integrated DNA Technology, Coralville, IA, USA).
24 h after transfection, cells were washed twice with PBS and infected with EV71 at
multiplicity of infection (MOI) of 1. The culture media were removed and replaced
with 2mL of fresh RPMI 1640 medium after 1 h of incubation at 37°C with 5% CO2.
EV71 infection for miRNA profiling
HT29 cells were seeded at a concentration of 5 × 105 cells/ml in 6-well plates
and incubated for 24 h at 37 °C with 5% CO2. Cells were washed twice with
phosphate buffered saline (PBS) and infected with EV71 at multiplicity of infection
115
(MOI) of 1 or nil respectively. The culture media were removed and replaced with 2
mL of fresh RPMI medium after 1 h of incubation at 37 °C with 5% CO2.
Total cellular RNA extraction
The respective infected cells were harvested at 12 or 36 hours posts infection
(hpi) respectively. The total cellular RNA from HT29, RD and RKO cells were
extracted using the miRNeasy mini kit (Qiagen, Hilden, Germany) in accordance to
the manufacturer’s instructions. Briefly, the cells were lysed and homogenised using
lyses solution provided (Qiagen, Hilden, Germany). Total RNA was harvested using
the RNeasy spin column and washed twice before elution (Qiagen, Hilden,
Germany). Harvested total RNA was quantitated using Nanodrop 100
spectrophotometer (ThermoScientific, Waltham, USA).
miRNA microarray analysis
The extracted total RNA was labelled with FlashTag™ Biotin HSR RNA
Labeling Kits for the Affymetrix GeneChip miRNA array according to
manufacturer’s instruction. Briefly, one microgram of total RNA was incubated with
ATP and Poly A polymerase at 37 °C for 15m to add a 3′ polyA tail. A ligation
reaction was performed to covalently attach to the miRNA population a multiple-
biotin molecule containing a 3DNA dendrimer. Labelled samples will subsequently
be processed according to manufacturer's instructions for the Affymetrix miRNA
Array 2.0 (Affymetrix, Santa Clara, CA). After hybridisation for 16 h at 48 °C, the
arrays were washed and stained in an Affymetrix Fluidics station 450, then scanned
in an Affymetrix 3000 7G scanner. Raw data for the microarray (GSE57372) was
116
analysed with Partek Genomics Suite (Partek Incorporated, Saint Louis, USA) where
p<0.05 is considered significant.
cDNA synthesis
For the conversion of mRNA to cDNA, 1μg of the total RNA was reverse
transcripted using RT2 First Strand kit (Qiagen, Hilden, Germany) in accordance to
the manufacturer’s instructions. Briefly, 1 μg of the extracted RNA was first mixed
with Buffer GE to a total volume of 10 μl for genomic DNA elimination and
incubated at 42ºC for 5 m and on ice for 1 m. Reverse-transcription mix which
consist of enzyme reverse transcriptase and buffer was then added to a volume of 20
μl and subjected to thermal profile of 42 ºC for 15 m followed by 95 ºC for 5 m. 91
μl of RNase free water was then added to each reaction in accordance to the
manufacturer’s instructions.
For conversion of microRNA to cDNA, 10 ng of the total RNA was reverse
transcribed using the Universal cDNA Synthesis kit (Exiqon, Denmark) the
manufacturer’s instructions. Briefly, 10ng of the extracted RNA was mixed with
enzyme reverse transcriptase and buffer to a volume of 10 μl. The reaction mix was
then subject to a thermal cycling profile of 25 ºC for 5 m, 42 ºC for 30 m followed by
85 ºC for 5 m according to the manufacturer’s instructions.
Quantitative real time polymerase chain reaction
The EV71 specific primers targeting the conserved VP1 regions were 5′-
GCTCTATAGGAGATAGTGTGAGTAGGG-3′ and the reverse primer 5′-
ATGACTGCTCACCTGCGTGTT-3′ (Tan et al., 2008a). Primers for DGCR8 were
117
5′- ACTTGTGCATGTTAGCTGTGTAGA-3′ and the reverse primer 5′-
GCTTAAGACTAGTTTACAAGACCAGAGT-3′ were designed to span exon-exon
boundaries. The primers for the house keeping gene actin (β-ACT) used were 5′-
ACCAACTGGGACGACATGGAGAAA-3′ and the reverse primer 5′-
TAGCACAGCCTGGATAGCAACGTA-3′. The qPCR was performed using the
iTaq™ Universal SYBR Green Supermix (Bio-Rad Laboratories, CA, USA) on the
BioRad CFX96 Real-Time PCR system (Bio-Rad Laboratories, CA, USA). Briefly,
1 μl of cDNA and 1μl of the forward and the reverse primers were added iTaq™
Universal SYBR Green Supermix. The reaction mix was then subjected to thermal
cycling profile of denaturation at 95 ºC for 30s, followed by amplification and
quantification in 40 cycles at 95 ºC for 5s followed by 60 ºC for 30 s. At the end of
amplification cycles, melting temperature analysis was performed by the BioRad
CFX96 Real-Time PCR system (Bio-Rad Laboratories, CA, USA). Relative gene
expression was quantified based on 2-∆∆CT method (Livak & Schmittgen, 2001).
For RT2 profiler PCR array, PCR arrays were performed with customized
PCR containing pre-dispensed primers to monitor Human antiviral response PAHS-
122ZD-2 (Qiagen, Hilden, Germany). qPCR was performed using RT2 SYBR Green
qPCR mastermix (Qiagen, Hilden, Germany). Briefly, a total volume of 25 μl of
cDNA and RT2 SYBR Green qPCR mastermix were added into each well of the
Human antiviral response array 96 wells plate PAHS-122ZD-2 (Qiagen, Hilden,
Germany) in accordance to the manufacturer’s instructions. The reaction mix was
then subjected to thermal profile of denaturation at 95 ºC for 10m, followed by
amplification and quantification in 40 cycles at 95ºC for 15 s followed by 60 ºC for
118
1m. At the end of amplification cycles, melting temperature analysis was performed
by the BioRad CFX96 Real-Time PCR system (Bio-Rad Laboratories, CA, USA).
For the detection of microRNA, qPCR was performed using the ExiLENT
SYBR Green Master mix (Exiqon, Denmark) on the BioRad CFX96 Real-Time PCR
system (Bio-Rad Laboratories, CA, USA). Briefly, 2.5 μl of cDNA and 1 μl of the
forward and the reverse primers was added to ExiLENT SYBR Green Master mix
(Exiqon, Denmark) according to the manufacturer’s instructions. The reaction mix
will then subjected to thermal cycling profile of denaturation at 95 ºC for 10 m,
followed by amplification and quantification in 40 cycles at 95 ºC for 10 s, 60 ºC for
30 s followed by 50 ºC for 30 s. At the end of amplification cycles, melting
temperature analysis was performed by the BioRad CFX96 Real-Time PCR system
(Bio-Rad Laboratories, CA, USA). Primers for microRNA qPCR were designed and
purchased from Exiqon, Denmark. U6snRNA was used as reference RNA for the
normalization of microRNA (miRNA) qPCR data. Relative gene expression was
quantified based on 2-∆∆CT method (Livak & Schmittgen, 2001).
Western blot
Total cellular protein for HT29 cells and control cells were collected using a
lysis mix in mammalian cell lysis solution – CelLytic M (Sigma-Aldrich Pte Ltd,
USA) in accordance with manufacturer’s instructions. Equal protein concentrations
(20 μg) from each samples were added onto 10% Mini-PROTEAN TGX™ (Bio-Rad
Laboratories, CA, USA) and separated by electrophoresis. Separated proteins were
transferred onto nitrocellulose membrane (Bio-Rad Laboratories, CA, USA). The
membranes were incubated with mouse anti EV71 antibody (AbD serotech, Oxford,
119
UK) or anti-tubulin antibody (Santa Cruz Biotechnology inc, California, USA)
respectively in shaker 4 ºC overnight. The membranes were washed three times in
Tris-buffered saline with 0.05% tween-20 and incubatted with secondary antibodies
conjugated to horseradish peroxidase (HRP) for 30m. (ThermoScientific, Waltham,
USA). After three washes with Tris-buffered saline and 0.05% tween-20, membrane
was subjected to Clarity™ Western ECL Substrate (Bio-Rad Laboratories, CA,
USA) in accordance with manufacturer’s instructions. The membranes were then
scanned using the LI-COR C-DiGit Blot Scanner (LI-COR Biosciences, Lincoln,
Nebraska, USA).
Cell viability and counts
Cell count and viability was performed at 0 h, 48 h and 72 h on the Luna
Automated Cell Counter system (Logos Biosystem, USA) in accordance to the
manufacturer’s instructions. Briefly, the cells were trypsinised and topped up with
fresh media to a total volume of 1000 μl of media and 10 μl of this cell suspension
were mixed with 10 μl of trypan blue. 10 μl of this diluted cell suspension were then
loaded onto the Luna counting slide for analysis.
Statistical analysis
All statistical analysis was performed on GraphPad Prism Version 6.0c
(GraphPad Software, USA). Student’s t test was used to compare two groups. p
values of < 0.05 were considered statistically significant.
120
4.3 RESULTS
We have previously reported a human colorectal adenocarcinoma cell line
(HT29) with epithelioid morphology as a useful model to study the pathogenesis of
EV71 (Lui et al., 2013a). Utilising the HT29 as a model, this study further elucidate
the role of miRNAs during EV71 infection.
Knockdown of DGCR8 resulted in the reduction of EV71 replication
In order to characterise the role of miRNAs during EV71 pathogenesis,
DGCR8 expression was knocked down prior to infection. HT29 cells were
transfected with DsiRNA specific to DGCR8, an essential cofactor for miRNAs
biogenesis. As control, HT29 cells were transfected with NC1, negative control
duplex-scrambled DsiRNA. Knockdown of DGCR8 was verified using qPCR
(Figure 4.1a). Transfection was shown to be successful using TYE™ 563 DS
Transfection Control, fluorescent-labelled transfection control duplex (Figure 4.1b).
miRNAs is essential for EV71 replication
To investigate the role of miRNAs in EV71 infection, we compared EV71
replication in miRNA-depleted HT29 cells against control cells (scrambled
DsiRNA). Using established protocols, the kinetics of EV71 RNA synthesis in both
infected DGCR8 knockdown cells and control cells were examined quantitatively
using real time quantitative polymerase chain reaction (qPCR) at 36h post infection
(hpi). Interestingly, DGCR8 knockdown (miRNAs depleted) HT29 cells were
unable to support EV71 proliferation compared to control cells (Figure 4.2). There is
a significant decrease in viral RNA between DGCR8 knockdown HT29 cell in
contrast with control cells (scrambled DsiRNA) (Figure 4.2a). Consistent with our
121
qPCR analysis, protein analysis of viral VP1 protein representation of EV71
replication, were shown to be highly downregulated in EV71 infected DGCR8
knockdown cells (Figure 4.2b).
To further elucidate the effect of miRNAs during EV71 infection, we asked if
the host cells survivability was enhanced in EV71 infected miRNAs depleted cells.
Indeed, it was observed that at 72hpi, there was a statistically significant percentage
of living cells in EV71 infected DGCR8 knockdown cells compared to control cells
infected with EV71 (Figure 4.2c and Figure 4.3). In order to validate our findings in
HT29 cells, we further tested this on another colorectal cell line (RKO) and skeleton
muscle cell line (RD) where we knocked down DGCR8 and examined the effect on
EV71 replication (Figure 4.4). Consistent with our findings in HT29 model, EV71 is
unable to establish infection in miRNAs depleted cells (HT29, RKO and RD cells)
(Figure 4.2 and 4.4).
Taken together, DGCR8 or rather miRNAs affected EV71 replication and
recused its detrimental phenotype.
Identification of deregulated miRNAs during EV71 infection
To pinpoint the differentially transcribed miRNAs used by EV71 during
infection, we performed profiling using Affymetrix GeneChip miRNA array.
Specifically, comparative miRNAs expression between EV71 infected cells and
control non-infected cells were performed. Microarray hybridisation identified 78
miRNAs being differentially expressed during EV71 infection (p<0.05) (Figure 4.5
and Appendix B). To confirm the microarray results, relative abundance of the
122
selected miRNAs were assayed using qPCR. The expression pattern from 10 selected
miRNAs qPCR data showed similar direction of response in microarray analysis data
with both methodologies showing similar trends (Figure 4.6 and 4.7). This indicates
high quality and reliability of the microarray data analysis.
EV71 down regulates host immune system using host miRNAs during infection
To understand why miRNA-depleted cells resulted in the inability of EV71 to
established infection; we examined the expression of 84 key genes involved in the
innate antiviral immune response between EV71 infected miRNAs depleted HT29
cells in comparison with control cells (scrambled DsiRNA). In particular, we
examined the host antiviral expression profile between infected DGCR8 knockdown
cells against control cells. Using qPCR, quantitative expression of 52 antiviral genes
from various antiviral signalling pathways such as Toll-like receptor signalling, Nod-
like receptor signalling, RIG-1-like receptor signalling and type 1 interferon
signalling were statistically significantly up regulated in DGCR8 knockdown cells
(Figure 4.8a, 4.8b 4.8c, 4.8d). Of note, CASP1, OAS2, DDX58, DHX58, CCL5,
CXCL10, CXCL11, IRF7, IFBB1, ISG15, MX1 and STAT1 were increased 10-550
fold (Figure 4.8a, 4.8b 4.8c, 4.8d).
123
4.4 DISCUSSION
Viruses have developed highly sophisticated gene-silencing mechanisms to
evade host-immune response in order to establish infection. One of such mediators
used by viruses is miRNAs. miRNAs are a new paradigm of RNA-directed gene
expression regulation which contribute to the repertoire of host-pathogen interactions
during viral infection. Cellular miRNAs could be involved during viral infection with
either positive or negative effects on viral replication kinetics (Berkhout & Jeang,
2007, Lecellier et al., 2005). Indeed, computational prediction reveal that one
miRNAs may regulate hundreds of genes, while one gene may be in turn regulated
by hundreds of miRNAs (Gottwein & Cullen, 2008). However, the role of cellular
miRNAs in the defence against viral infection has remained elusive. Given the scope
of miRNA-mediated gene regulation in the mammalian system, cellular miRNAs
may directly or indirectly affect virus pathogenesis. Cellular miRNA expression
could be remodelled by viral infection, which can alter the host cellular
microenvironment and attributing to both host antiviral defence and viral factors
(Sullivan, 2008, Berkhout & Jeang, 2007, Boss & Renne, 2011, Boss & Renne, 2010,
Skalsky & Cullen, 2010).
The biogenesis of miRNAs begins with the transcription of a long primary
transcript known as pri-miRNA by RNA polymerase II (Ghosh et al., 2009, Roberts
& Jopling, 2010, Scaria et al., 2006, Skalsky & Cullen, 2010, Sullivan, 2008,
Sullivan & Ganem, 2005). Pri-miRNAs are cleaved/processed by RNase III enzyme
(Drosha), double-stranded-RNA-binding protein, (DiGeorge Syndrome Critical
Region; DGCR8) and RNAse III-like Dicer to become functional miRNAs. In this
study, we have demonstrated that abolishing functional miRNAs in human epithelial
124
colorectal cell line (HT29) impair EV71 replication while this was not observed in
control cells treated with scrambled DsiRNA. On the contrary, global knockdown of
miRNAs has been previously shown to enhance HIV-1 infection (Chable-Bessia et
al., 2009, Triboulet et al., 2007). Knock down of DGCR8, a precursor to miRNAs
biogensis was shown to enhance human immunodeficiency virus (HIV) replication
(Chable-Bessia et al., 2009, Triboulet et al., 2007). This implies that EV71 utilises
miRNAs during infection and in the absence of miRNAs, EV71 was unable to
successfully mount the infection.
Another study reported by Otsuka and colleagues showed a similar finding in
Vesicular stomatitis virus (VSV) infection (Otsuka et al., 2007). Otsuka and
colleagues observed that impaired miRNA production in dicer-deficient mice
resulted in the hypersensitivity toward infection by VSV (Otsuka et al., 2007). It was
observed there is no alteration of interferon-mediated antiviral response by dicer
deficiency, instead the change in virus replication is due to miR-24 and miR-93
(Otsuka et al., 2007). Otsuka and colleagues shown that miR-24 and miR-93 could
target VSV viral protein and thus in miRNA depleted cells, VSV replication was
enhanced in the absence of miR-24 and miR-93 (Otsuka et al., 2007).
In recent years, there are reported evidence of specific host-cellular miRNAs
modulating host-pathogen interaction (Buck et al., 2010, Cameron et al., 2008,
Huang et al., 2007, Jopling et al., 2008, Lanford et al., 2010, Martinez et al., 2008,
Otsuka et al., 2007, Yoshikawa et al., 2012). Cytomegalovirus (CMV) for example
was observed to down regulate miR-27a (Buck et al., 2010). Overexpression of miR-
27a using miRNAs mimics was shown to inhibit CMV proliferation and virus titres
125
suggesting that miR-27a or miR-27a-regulated genes plays a role during CMV
infection (Buck et al., 2010, Wiertz et al., 1997). Hepatitis C virus (HCV), an
enveloped RNA virus of the Flavivirus family, responsible for both acute and chronic
hepatitis in humans induced a liver-specific cellular miRNA, miR-122 for the
facilitation of HCV replication (Jopling et al., 2006, Jopling et al., 2008, Jopling et
al., 2005, Randall et al., 2007, Randall & Goodbourn, 2008, Yoshikawa et al., 2012).
It was suggested that miR-122 is a valuable target for antiviral intervention and
therapeutics. In vivo treatment of HCV-infected chimpanzees with antisense miR-
122 successfully reduced HCV virus titres demonstrating promising antiviral
treatment against virus induced diseases (Jopling et al., 2006, Jopling et al., 2008,
Jopling et al., 2005, Lanford et al., 2010).
Indeed, various miRNAs have been identified to play a role during EV71
pathogenesis. Recent publications of investigations into the role of miRNA in
enterovirus infection have reported that enterovirus-induced miRNAs such as miR-
23b, miR-296-5p, miR-141 and miR-146a play a role in EV71 replication (Ho et al.,
2011, Wen et al., 2013, Zheng et al., 2013, Ho et al., 2014). The use of miRNA
inhibitors or mimics have demonstrated that miRNAs plays an important role in
EV71 pathogenesis. miRNA inhibitors or mimics on these miRNAs either inhibited
or enhanced EV71 replication during infection.
In particular, our results revealed miR-548 to be significantly up regulated in
EV71 infected cells at 36hpi in comparison with control non-infected cells. Further
bioinformatics analysis revealed that miR-548 was involved in antiviral response
during infection (de Weerd & Nguyen, 2012, Randall & Goodbourn, 2008, Li et al.,
126
2013, Gottwein & Cullen, 2008, Boss & Renne, 2011). Consistent with our findings,
Li and colleagues have recently identified the involvement of miR-548 in IFN
signalling pathways during viral infection (Li et al., 2013). Li and colleagues
demonstrated that miR-548 down-regulates host antiviral response via direct
targeting of IFN-λ1 (Li et al., 2013). In contrast, in EV71 infected
rhabdomyosarcoma (RD) cells, miR-548 was observed to decrease in a time
dependent manner (Li et al., 2013). In view that the host innate system is the first
line of defence, with IFNs being a key player during viral infection, it is atypical that
miR-548 was up regulated to down regulate the host immune system (Versteeg &
Garcia-Sastre, 2010, Thompson et al., 2011, Randall & Goodbourn, 2008, Rajsbaum
& Garcia-Sastre, 2013, Oudshoorn et al., 2012, de Weerd & Nguyen, 2012, Brennan
& Bowie, 2010, Boss & Renne, 2011). The use of miR-548 mimics and inhibitors
were shown to enhance or inhibit EV71 replication in RD cells respectively (Li et al.,
2013).
The innate immune system has evolved an arsenal of mechanism to sense and
destroy invading pathogens. An interesting question that arises is whether EV71 is
able to regulate host cellular miRNA transcription and processing during infection
thereby leading to the down-regulation of deleterious cellular miRNA and/or the up-
regulation of advantageous cellular miRNAs to enhance its replication in the host
cells. To add to this intriguing interplay between cellular miRNAs and viral
pathogens, Huang and colleagues have demonstrated that HIV, an enveloped RNA
virus of the Retreoviridae family utilise host cellular miR-28, miR-125b, miR-150,
miR-223 and miR-382 to control viral protein synthesis in order to evade host
immune system (Huang et al., 2007). Epstein-Barr virus (EBV), a DNA virus of the
127
Herpes family, for example induce the expression of miR-29b, miR-155 and miR-
146a to mediate the down regulation of innate immune response and IFN signalling
pathways to enhances its survival (Cameron et al., 2008, Lo et al., 2007, Xiao &
Rajewsky, 2009). Lecellier and colleagues have shown that in primate foamy virus
type 1 (PFV-1), overexpression of cellular miRNA miR-32 could induce an antiviral
response to inhibit virus replication (Lecellier et al., 2005).
To test this reasoning that EV71 down regulate host miRNAs during infection
to enhance its survival, we next ask if the innate response and signalling pathways
were altered in EV71 infected miRNA-depleted cells. Therefore, we analysed the
expression of 84 key genes involved in the innate antiviral immune response between
EV71 infected miRNAs depleted HT29 cells in comparison with control cells
(scrambled DsiRNA). Quantitative analysis \ revealed 52 antiviral genes from
various antiviral signalling pathways such as Toll-like receptor signalling, Nod-like
receptor signalling, RIG-1-like receptor signalling and type 1 interferon signalling
were significantly up regulated in EV71 infected miRNAs depleted HT29 cells. In
particular, CASP1, OAS2, DDX58, DHX58, CCL5, CXCL10, CXCL11, IRF7,
IFBB1, ISG15, MX1 and STAT1 were increased 10-550 fold. The enhanced host
antiviral response in miRNA-depleted cells during EV71 infection may result in the
inability for EV71 to replicate during infection (Figure 4.9).
The host immune response is responsible for the eradication of invading
pathogens, as such viruses has developed means to counteract with the induction,
signalling and antiviral pathways (Thompson et al., 2011, Taylor & Mossman, 2013,
Boss & Renne, 2011, Boss & Renne, 2010, Versteeg & Garcia-Sastre, 2010). RNA
128
viruses generally block and inhibit IFN and antiviral molecules detrimental to virus
replication (Brennan & Bowie, 2010, Versteeg & Garcia-Sastre, 2010). Despite all
the sophisticated mechanism used by viruses to inhibit host immune system, host has
been under evolutionary pressure against viral antagonism of IFN system (Brennan
& Bowie, 2010, Thompson et al., 2011, Boss & Renne, 2010, Versteeg & Garcia-
Sastre, 2010). Our result suggests that EV71 attenuate host miRNAs to mediate host
immune system during infection (Figure 4.9). As a result of DGCR8 knockdown,
EV71 is unable to regulate host miRNAs to enhance cellular microenvironment
leading to the inability to establish infection (Figure 4.9). Notwithstanding, IFN
signalling molecules such as type I interferon were previously demonstrated to play
an important role during EV71 pathogenesis (Liu et al., 2005, Lui et al., 2014b).
These results warrant further studies for the identification of specific miRNAs which
play a pivotal role during EV71 pathogenesis specifically targeting the host antiviral
signalling pathway.
129
Figure 4.1 Knockdown of DGCR8 using DsiRNA. (A) Relative expression of
DGCR8 gene measured by qPCR verifying knockdown. (n=3, ****= p values of <
0.0001) (B) Transfection Control using fluorescent-labeled transfection control
duplex TYE™ 563 DS to monitor transfection efficiency.
130
Figure 4.2 miRNA depleted cells are not able to support EV71 replication.
DGCR8 knockdown cells and control cells (scrambled DsiRNA) were infected with
EV71 (MOI of 1). Total intracellular RNA was harvested at 36hpi, converted to
cDNA and measured by qPCR with primers specific to viral VP1. Total intracellular
protein were harvested at at 36hpi and measured by Western blot (A) Relative
expression of EV71 viral RNA measured by qPCR. (n=3, ****= p values of <
0.0001) (B) Western blot analysis for EV71 VP1 viral protein. (C) Cell viability
assessed at 72hpi using vital dye trypan blue. (n=3, **= p values of < 0.01).
131
Figure 4.3 Cell viability assessed 24h after transfection and throughout 72h post
EV71 infection using vital dye trypan blue. (n=3, *= p values of < 0.05).
132
Figure 4.4 EV71 is unable to establish infection in both RKO and RD miRNAs
depleted cells. DGCR8 knockdown cells and control cells (scrambled DsiRNA) in
both RKO and RD cell line were infected with EV71 (MOI of 1). Total intracellular
RNA were harvested at 12hpi, converted to cDNA and measured by qPCR with
primers specific to viral VP1. (A) Relative expression of DGCR8 gene in miRNAs
depleted RKO cells measured by qPCR verifying knockdown. (n=3, *= p values of <
0.05) (B) Relative expression of DGCR8 gene in miRNAs depleted RD cells
measured by qPCR verifying knockdown. (n=3, *= p values of < 0.05) (C) Relative
expression of EV71 viral RNA in miRNAs depleted RKO cells measured by qPCR.
(n=3, *= p values of < 0.05) (D) Relative expression of EV71 viral RNA in miRNAs
depleted RKO cells measured by qPCR. (n=3, *= p values of < 0.05)
133
Figu
re 4
.5 H
eat m
ap o
f the
mic
roar
ray
miR
NA
exp
ress
ion
prof
ile o
f EV
71 in
fect
ed a
nd n
on-in
fect
ed c
ontr
ol c
olor
ecta
l cel
ls, H
T29
. The
two-
way
hie
rarc
hica
l clu
ster
hea
t map
show
ed d
iffer
entia
l exp
ress
ed m
iRN
As o
f tw
o gr
oups
of s
ampl
es. T
he m
iRN
As w
ere
chos
en a
ccor
ding
to
the
cut o
ff p
< 0.
05 w
here
blu
e re
pres
ents
miR
NA
s w
ith d
ecre
ased
exp
ress
ion
and
red
repr
esen
t miR
NA
s w
ith in
crea
sed
expr
essi
on. (
n=3,
*=
p
valu
es o
f < 0
.05)
.
134
Figu
re 4
.6 V
alid
atio
n of
diff
eren
tial e
xpre
ssio
n of
sel
ecte
d m
iRN
As
by q
PCR
. Ten
exp
ress
ion
leve
ls o
f sel
ecte
d m
iRN
As
from
mic
roar
ray
assa
y w
ere
valid
ated
usi
ng q
PCR
. U6s
nRN
A w
as u
sed
as r
efer
ence
RN
A f
or th
e no
rmal
izat
ion
of m
iRN
As
and
rela
tive
gene
exp
ress
ion
was
quan
tifie
d ba
sed
on 2
-∆∆C
T . (n=
3, *
= p
valu
es o
f < 0
.05)
.
135
Figu
re 4
.7 H
eat
map
of
diff
eren
tial
expr
essi
on o
f se
lect
ed m
iRN
As
by m
icro
arra
y. T
he t
wo-
way
hie
rarc
hica
l cl
uste
r he
at m
ap s
how
ed
diff
eren
tial e
xpre
ssed
sel
ecte
d m
iRN
As
of tw
o gr
oups
of s
ampl
es. T
he m
iRN
As
from
bot
h m
etho
dolo
gy q
PCR
dat
a sh
owed
sim
ilar d
irect
ion
of
resp
onse
in m
icro
arra
y an
alys
is d
ata
with
bot
h m
etho
dolo
gies
sho
win
g si
mila
r tre
nds
whe
re b
lue
repr
esen
ts m
iRN
As
with
dec
reas
ed e
xpre
ssio
n
and
red
repr
esen
t miR
NA
s with
incr
ease
d ex
pres
sion
.
136
Figu
re 4
.8 E
V71
is u
nabl
e to
dow
n re
gula
te h
ost
antiv
iral
res
pons
e in
miR
NA
dep
lete
d ce
lls d
urin
g in
fect
ion.
DG
CR
8 kn
ockd
own
cells
and
cont
rol c
ells
(scr
ambl
ed D
siR
NA
) wer
e in
fect
ed w
ith E
V71
(MO
I of 1
). To
tal i
ntra
cellu
lar R
NA
was
har
vest
ed a
t 36h
pi, c
onve
rted
to c
DN
A
and
mea
sure
d by
qua
ntita
tive
real
tim
e po
lym
eras
e ch
ain
reac
tion
(qPC
R)
(n=3
, *=
p va
lues
of
< 0.
05).
A)
Rel
ativ
e ex
pres
sion
of
Toll-
like
rece
ptor
sign
allin
g m
easu
red
by q
PCR
. (B
) Rel
ativ
e ex
pres
sion
of R
IG-1
like
rece
ptor
sign
allin
g m
easu
red
by q
PCR
. (C
) Rel
ativ
e ex
pres
sion
of
Nod
-like
rece
ptor
sign
allin
g m
easu
red
by q
PCR
. (D
) Rel
ativ
e ex
pres
sion
of T
ype
1 in
terf
eron
sign
allin
g m
easu
red
by q
PCR
.
137
Figu
re 4
.9 S
chem
atic
illu
stra
tion
of th
e in
terp
lay
betw
een
EV
71 a
nd h
ost m
iRN
As.
EV71
alte
red
host
miR
NA
s su
ch a
s ha
s-m
iR-5
48 to
man
ipul
ate
host
ant
ivira
l res
pons
es s
uch
as T
oll-l
ike
sign
allin
g, N
OD
-like
sig
nalli
ng, R
IG-1
sign
allin
g an
d Ty
pe I
inte
rfer
on p
athw
ays t
o en
hanc
e its
surv
ival
dur
ing
path
ogen
esis
.
138
4.5 CONCLUSION
In conclusion, we provided evidence for an intricate physiological interplay
between host miRNAs machinery and invading pathogen, EV71. We reported three
salient findings. First, DGCR8, an essential cofactor for microRNAs biogenesis
contributes to a central role during EV71 pathogenesis. We have shown that EV71 is
not able to replicate efficiently in miRNAs depleted cells. Secondly, our results
suggest that EV71 may remodel the cellular miRNAs composition thereby utilising
the host cellular miRNAs to enhance cellular microenvironment for viral replication.
Specifically, our result suggests that EV71 may be at least partially responsible for
the up regulation of host miR-548 to enhance cellular microenvironment for viral
replication. Thirdly, remodelling of miRNAs during EV71 infection plays a
significant role specifically in the antiviral response. We have demonstrated that in
EV71 infected miRNA-depleted cells, host antiviral responses from various antiviral
signalling pathways such as Toll-like receptor signalling, Nod-like receptor
signalling, RIG-1-like receptor signalling and type 1 interferon signalling were
significantly upregulated in comparison with EV71-infected control cells. This may
explain our result on the inability for EV71 to infect miRNA-depleted cells given the
enhanced host antiviral response. Taken together, our study has provided valuable
knowledge toward the study of host-pathogen interaction during EV71 pathogenesis
and this could lead to future investigation for the development of antiviral
therapeutics using miRNAs inhibitors against EV71. This will open the door toward
novel host-defence mechanism that exists in mammalian cells as well as to the
antiviral mechanisms employed during EV71 pathogenesis.
139
4.6 REFERENCES
Berkhout, B. & K.T. Jeang, (2007) RISCy business: MicroRNAs, pathogenesis, and
viruses. The Journal of biological chemistry 282: 26641-26645.
Boss, I.W. & R. Renne, (2010) Viral miRNAs: tools for immune evasion. Current
opinion in microbiology 13: 540-545.
Boss, I.W. & R. Renne, (2011) Viral miRNAs and immune evasion. Biochimica et
biophysica acta 1809: 708-714.
Brennan, K. & A.G. Bowie, (2010) Activation of host pattern recognition receptors
by viruses. Current opinion in microbiology 13: 503-507.
Buck, A.H., J. Perot, M.A. Chisholm, D.S. Kumar, L. Tuddenham, V. Cognat, L.
Marcinowski, L. Dolken & S. Pfeffer, (2010) Post-transcriptional regulation
of miR-27 in murine cytomegalovirus infection. RNA 16: 307-315.
Cameron, J.E., Q. Yin, C. Fewell, M. Lacey, J. McBride, X. Wang, Z. Lin, B.C.
Schaefer & E.K. Flemington, (2008) Epstein-Barr virus latent membrane
protein 1 induces cellular MicroRNA miR-146a, a modulator of lymphocyte
signaling pathways. J Virol 82: 1946-1958.
Chable-Bessia, C., O. Meziane, D. Latreille, R. Triboulet, A. Zamborlini, A.
Wagschal, J.-M. Jacquet, J. Reynes, Y. Levy, A. Saib, Y. Bennasser & M.
Benkirane, (2009) Suppression of HIV-1 replication by microRNA effectors.
Retrovirology 6: 26.
Chu, P.Y., K.H. Lin, K.P. Hwang, L.C. Chou, C.F. Wang, S.R. Shih, J.R. Wang, Y.
Shimada & H. Ishiko, (2001) Molecular epidemiology of enterovirus 71 in
Taiwan. Arch Virol 146: 589-600.
140
de Weerd, N.A. & T. Nguyen, (2012) The interferons and their receptors--
distribution and regulation. Immunology and cell biology 90: 483-491.
Ghosh, Z., B. Mallick & J. Chakrabarti, (2009) Cellular versus viral microRNAs in
host-virus interaction. Nucleic Acids Res 37: 1035-1048.
Gottwein, E. & B.R. Cullen, (2008) Viral and cellular microRNAs as determinants of
viral pathogenesis and immunity. Cell Host Microbe 3: 375-387.
Ho, B.C., S.L. Yu, J.J. Chen, S.Y. Chang, B.S. Yan, Q.S. Hong, S. Singh, C.L. Kao,
H.Y. Chen, K.Y. Su, K.C. Li, C.L. Cheng, H.W. Cheng, J.Y. Lee, C.N. Lee
& P.C. Yang, (2011) Enterovirus-induced miR-141 contributes to shutoff of
host protein translation by targeting the translation initiation factor eIF4E.
Cell Host Microbe 9: 58-69.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Huang, J., F. Wang, E. Argyris, K. Chen, Z. Liang, H. Tian, W. Huang, K. Squires,
G. Verlinghieri & H. Zhang, (2007) Cellular microRNAs contribute to HIV-1
latency in resting primary CD4+ T lymphocytes. Nat Med 13: 1241-1247.
Jopling, C.L., K.L. Norman & P. Sarnow, (2006) Positive and negative modulation
of viral and cellular mRNAs by liver-specific microRNA miR-122. Cold
Spring Harbor symposia on quantitative biology 71: 369-376.
Jopling, C.L., S. Schutz & P. Sarnow, (2008) Position-dependent function for a
tandem microRNA miR-122-binding site located in the hepatitis C virus
RNA genome. Cell Host Microbe 4: 77-85.
Jopling, C.L., M. Yi, A.M. Lancaster, S.M. Lemon & P. Sarnow, (2005) Modulation
of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science
(New York, N.Y.) 309: 1577-1581.
141
Kanarek, N. & Y. Ben-Neriah, (2012) Regulation of NF-kappaB by ubiquitination
and degradation of the IkappaBs. Immunological reviews 246: 77-94.
Lanford, R.E., E.S. Hildebrandt-Eriksen, A. Petri, R. Persson, M. Lindow, M.E.
Munk, S. Kauppinen & H. Orum, (2010) Therapeutic silencing of
microRNA-122 in primates with chronic hepatitis C virus infection. Science
(New York, N.Y.) 327: 198-201.
Lau, N.C., L.P. Lim, E.G. Weinstein & D.P. Bartel, (2001) An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science
(New York, N.Y.) 294: 858-862.
Lecellier, C.H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A.
Saib & O. Voinnet, (2005) A cellular microRNA mediates antiviral defense
in human cells. Science (New York, N.Y.) 308: 557-560.
Lee, J.J., J.B. Seah, V.T. Chow, C.L. Poh & E.L. Tan, (2011) Comparative proteome
analyses of host protein expression in response to Enterovirus 71 and
Coxsackievirus A16 infections. J Proteomics 74: 2018-2024.
Lee, M.S. & L.Y. Chang, (2010) Development of enterovirus 71 vaccines. Expert
Rev Vaccines 9: 149-156.
Lee, M.S., F.C. Tseng, J.R. Wang, C.Y. Chi, P. Chong & I.J. Su, (2012) Challenges
to licensure of enterovirus 71 vaccines. PLoS neglected tropical diseases 6:
e1737.
Lee, R.C., R.L. Feinbaum & V. Ambros, (1993) The C. elegans heterochronic gene
lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:
843-854.
142
Li, Y., J. Xie, X. Xu, J. Wang, F. Ao, Y. Wan & Y. Zhu, (2013) MicroRNA-548
down-regulates host antiviral response via direct targeting of IFN-lambda1.
Protein & cell 4: 130-141.
Liu, M.L., Y.P. Lee, Y.F. Wang, H.Y. Lei, C.C. Liu, S.M. Wang, I.J. Su, J.R. Wang,
T.M. Yeh, S.H. Chen & C.K. Yu, (2005) Type I interferons protect mice
against enterovirus 71 infection. J Gen Virol 86: 3263-3269.
Livak, K.J. & T.D. Schmittgen, (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25: 402-408.
Lo, A.K., K.F. To, K.W. Lo, R.W. Lung, J.W. Hui, G. Liao & S.D. Hayward, (2007)
Modulation of LMP1 protein expression by EBV-encoded microRNAs.
Proceedings of the National Academy of Sciences of the United States of
America 104: 16164-16169.
Lui, Y., P. Timms, L. Hafner, T. Tan, K. Tan & E. Tan, (2013a) Characterisation of
enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013b) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
Mack, G.S., (2007) MicroRNA gets down to business. Nature biotechnology 25:
631-638.
Martinez, I., A.S. Gardiner, K.F. Board, F.A. Monzon, R.P. Edwards & S.A. Khan,
(2008) Human papillomavirus type 16 reduces the expression of microRNA-
218 in cervical carcinoma cells. Oncogene 27: 2575-2582.
143
McMinn, P.C., (2002) An overview of the evolution of enterovirus 71 and its clinical
and public health significance. FEMS microbiology reviews 26: 91-107.
McMinn, P.C., (2012) Recent advances in the molecular epidemiology and control of
human enterovirus 71 infection. Current opinion in virology 2: 199-205.
Munday, D.C., R. Surtees, E. Emmott, B.K. Dove, P. Digard, J.N. Barr, A.
Whitehouse, D. Matthews & J.A. Hiscox, (2012) Using SILAC and
quantitative proteomics to investigate the interactions between viral and host
proteomes. Proteomics 12: 666-672.
Nathans, R., C.Y. Chu, A.K. Serquina, C.C. Lu, H. Cao & T.M. Rana, (2009)
Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol Cell
34: 696-709.
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
Otsuka, M., Q. Jing, P. Georgel, L. New, J. Chen, J. Mols, Y.J. Kang, Z. Jiang, X.
Du, R. Cook, S.C. Das, A.K. Pattnaik, B. Beutler & J. Han, (2007)
Hypersusceptibility to vesicular stomatitis virus infection in Dicer1-deficient
mice is due to impaired miR24 and miR93 expression. Immunity 27: 123-134.
Oudshoorn, D., G.A. Versteeg & M. Kikkert, (2012) Regulation of the innate
immune system by ubiquitin and ubiquitin-like modifiers. Cytokine & growth
factor reviews 23: 273-282.
Patel, K.P. & J.M. Bergelson, (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728-729.
144
Rajsbaum, R. & A. Garcia-Sastre, (2013) Viral evasion mechanisms of early antiviral
responses involving regulation of ubiquitin pathways. Trends in microbiology
21: 421-429.
Randall, G., M. Panis, J.D. Cooper, T.L. Tellinghuisen, K.E. Sukhodolets, S. Pfeffer,
M. Landthaler, P. Landgraf, S. Kan, B.D. Lindenbach, M. Chien, D.B. Weir,
J.J. Russo, J. Ju, M.J. Brownstein, R. Sheridan, C. Sander, M. Zavolan, T.
Tuschl & C.M. Rice, (2007) Cellular cofactors affecting hepatitis C virus
infection and replication. Proceedings of the National Academy of Sciences of
the United States of America 104: 12884-12889.
Randall, R.E. & S. Goodbourn, (2008) Interferons and viruses: an interplay between
induction, signalling, antiviral responses and virus countermeasures. J Gen
Virol 89: 1-47.
Reed, L.J. & H. Muench, (1938) A simple method of estimating fifty percent
endpoints. The American Journal of Hygiene 27: 493–497.
Roberts, A.P. & C.L. Jopling, (2010) Targeting viral infection by microRNA
inhibition. Genome Biol 11: 201.
Scaria, V., M. Hariharan, S. Maiti, B. Pillai & S.K. Brahmachari, (2006) Host-virus
interaction: a new role for microRNAs. Retrovirology 3: 68.
Skalsky, R.L. & B.R. Cullen, (2010) Viruses, microRNAs, and host interactions.
Annual review of microbiology 64: 123-141.
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Sullivan, C.S., (2008) New roles for large and small viral RNAs in evading host
defences. Nature reviews. Genetics 9: 503-507.
145
Sullivan, C.S. & D. Ganem, (2005) MicroRNAs and viral infection. Mol Cell 20: 3-
7.
Tan, E.L., V.T. Chow, S.H. Quak, W.C. Yeo & C.L. Poh, (2008) Development of
multiplex real-time hybridization probe reverse transcriptase polymerase
chain reaction for specific detection and differentiation of Enterovirus 71 and
Coxsackievirus A16. Diagn Microbiol Infect Dis 61: 294-301.
Taylor, K.E. & K.L. Mossman, (2013) Recent advances in understanding viral
evasion of type I interferon. Immunology 138: 190-197.
tenOever, B.R., (2013) RNA viruses and the host microRNA machinery. Nature
reviews. Microbiology 11: 169-180.
Thompson, M.R., J.J. Kaminski, E.A. Kurt-Jones & K.A. Fitzgerald, (2011) Pattern
recognition receptors and the innate immune response to viral infection.
Viruses 3: 920-940.
Triboulet, R., B. Mari, Y. Lin, C. Chable-Bessia, Y. Bennasser, K. Lebrigand, B.
Cardinaud, T. Maurin, P. Barbry, V. Baillat, J. Reynes, P. Corbeau, K. Jeang
& M. Benkirane, (2007) Suppression of microRNA-silencing pathway by
HIV-1 during virus replication. Science (New York, N.Y.) 315: 1579 - 1582.
Versteeg, G.A. & A. Garcia-Sastre, (2010) Viral tricks to grid-lock the type I
interferon system. Current opinion in microbiology 13: 508-516.
Viswanathan, K., K. Fruh & V. DeFilippis, (2010) Viral hijacking of the host
ubiquitin system to evade interferon responses. Current opinion in
microbiology 13: 517-523.
Wen, B.P., H.J. Dai, Y.H. Yang, Y. Zhuang & R. Sheng, (2013) MicroRNA-23b
Inhibits Enterovirus 71 Replication through Downregulation of EV71 VPl
Protein. Intervirology 56: 195-200.
146
Wiertz, E., A. Hill, D. Tortorella & H. Ploegh, (1997) Cytomegaloviruses use
multiple mechanisms to elude the host immune response. Immunology letters
57: 213-216.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
Xiao, C. & K. Rajewsky, (2009) MicroRNA control in the immune system: basic
principles. Cell 136: 26-36.
Yoshikawa, T., A. Takata, M. Otsuka, T. Kishikawa, K. Kojima, H. Yoshida & K.
Koike, (2012) Silencing of microRNA-122 enhances interferon-alpha
signaling in the liver through regulating SOCS3 promoter methylation.
Scientific reports 2: 637.
Zheng, Z., X. Ke, M. Wang, S. He, Q. Li, C. Zheng, Z. Zhang, Y. Liu & H. Wang,
(2013) Human microRNA hsa-miR-296-5p suppresses Enterovirus 71
replication by targeting the viral genome. J Virol.
147
Chapter 5 Beta-actin Variant is Necessary for
enterovirus71 Replication
148
Title: Beta-actin Variant is Necessary for Enterovirus 71 Replication
Author names and affiliations:
Yan Long Edmund Lui1, 3, 4, Zhi Yang Lin5, Jia Jun Lee1, Vincent Tak Kwong
Chow6, Chit Laa Poh7, Eng Lee Tan1, 2*
1Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singapore
2Department of Paediatrics, University Children's Medical Institute, National
University Hospital, Singapore
3School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology, Australia
4Institute of Health and Biomedical Innovation, Queensland University of
Technology, Australia
5College of Medicine, Biology and Environment, Australian National University,
Canberra, Australia
6Department of Microbiology, Yong Loo Lin School of Medicine, National
University of Singapore, Singapore
7School of Health and Natural Sciences, Sunway University, Selangor, Malaysia
149
Statement of Contribution of Co-Authors for
Thesis by Published Paper
The following is the format for the required declaration provided at the start of
any thesis chapter which includes a co-authored publication.
The authors listed below have certified* that:
1. they meet the criteria for authorship in that they have participated in the
conception, execution, or interpretation, of at least that part of the publication in
their field of expertise;
2. they take public responsibility for their part of the publication, except for the
responsible author who accepts overall responsibility for the publication;
3. there are no other authors of the publication according to these criteria;
4. potential conflicts of interest have been disclosed to (a) granting bodies, (b) the
editor or publisher of journals or other publications, and (c) the head of the
responsible academic unit, and
5. they agree to the use of the publication in the student’s thesis and its publication
on the QUT ePrints database consistent with any limitations set by publisher
requirements.
In the case of this chapter:
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013) Beta-
actin variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
150
Contributor Statement of contribution*
Lui Yan Long Edmund
(Ph.D. Candidate) Contributed to the laboratory work in the project, conducted the
data analysis and the interpretation of the data and wrote the
manuscript. Signature
Date
Lin Zhi Yang
Contributed to the laboratory work, conducted the data analysis
and the interpretation of the data and approved the final draft of the
manuscript.
Lee Jia Jun
Contributed to the laboratory work, conducted the data analysis
and the interpretation of the data and approved the final draft of the
manuscript.
Chow Tak Kwong Vincent
Contributed to the design of the study and approved the final draft
of the manuscript.
Poh Chit Laa
Contributed to the design of the study and approved the final draft
of the manuscript.
Tan Eng Lee
Contributed to the design of the study and critically revised the
manuscript and approved the final draft of the manuscript.
151
Chapter 5: Beta-actin Variant is Necessary for enterovirus 71 Replication
Abstract
Enterovirus 71 (EV71) is one of the main etiological agents of Hand, Foot and
Mouth Disease (HFMD) and has been known to cause fatal neurological
complications such as herpangina, aseptic meningitis, poliomyelitis-like paralysis
and encephalitis. EV71 is endemic in the asia pacific region and causes occasional
epidemics. In order to better understand EV71 infection, we compared the proteome
between EV71-susceptible and EV71-resistant human rhabdomyosarcoma (RD) cell
line. We found significant differences in the β-actin variants between the EV71-
susceptible RD cells and EV71-resistant RD cells, suggesting that β-actin, in
association with other proteins such as annexin 2 is required in vesicular transport of
EV71. This finding further support our previous study that actin potentially plays a
role in pathogenesis and the establishment of the disease in HFMD.
152
5.1 INTRODUCTION
Enterovirus 71 (EV71) is a positive sense, single stranded, non-enveloped
RNA virus belonging to Enterovirus genus of the Picornaviridae family (Nasri et al.,
2007a, Nasri et al., 2007b). It is one of the main etiological agents of the Hand, Foot
and Mouth Disease (HFMD) which commonly infects infants and children (Shimizu
et al., 1999, Nasri et al., 2007a, Nasri et al., 2007b). The virus is usually spread from
one person to another through direct contact of vesicular fluid or droplets from the
infected or via faecal-oral route (Wong et al., 2010, Lee et al., 2009, Liu et al., 2000,
Brown et al., 1999). Symptoms of EV71 infection include persistent high fever,
repeated vomiting, myoclonic jerks, persistent drowsiness or sudden limb weakness
(Lee et al., 2009, Liu et al., 2000). In addition, EV71 infection has been known to
cause fatal neurological complications like aseptic meningitis, poliomyelitis-like
paralysis and encephalitis (Liu et al., 2000, Shimizu et al., 1999, Brown et al., 1999).
EV71 was first described in 1974 in California (USA) after it was isolated from
a patient with central nervous system disease in 1969 (Schmidt et al., 1974). Since
then, there have been periodic outbreaks, epidemics and pandemics reported
worldwide every two to three years in various countries such as Australia, China,
Taiwan, Japan, Korea, Malaysia, Vietnam, Thailand and Singapore (Huang et al.,
2012, McMinn et al., 2001, Chu et al., 2001, Chumakov et al., 1979, Schmidt et al.,
1974). Large fatal outbreaks first occurred in Bulgaria in 1975 and subsequently re-
emerged in Hungary in 1978, Malaysia in 1997 and Taiwan in 1998 (Solomon et al.,
2010, Lu et al., 2002, Ho et al., 1999, Nagy et al., 1982, Chumakov et al., 1979,
Schmidt et al., 1974). In the recent years there has been several large epidemics of
153
HFMD in the Asian-Pacific region, including Singapore, resulting in sudden deaths
among young children due to EV71 infections (Singh et al., 2002, Chu et al., 2001).
Although EV71 has been widely studied, the exact mechanism of pathogenesis
remains unknown with particular debates on the mode of entry and viral shuttling in
the host cell.
In order to better understand EV71 infection, we performed proteomic analyses
between EV71-susceptible and EV71-resistant human rhabdomyosarcoma (RD) cell
line, using 2-dimensional electrophoresis (2DE).
5.2 MATERIALS AND METHODS
Infection of Cell Line
The RD cell line (ATCC® catalog no. CCL-136™) was maintained in T75
flasks using Minimum Essential Medium (MEM) supplemented with 10% fetal
bovine serum and 2% penicillin–streptomycin at 37°C with 5% CO2 in a humidified
incubator. The EV71 resistant cells were obtained by continuous passaging to an
estimated 100 times. Cells were confirmed to be resistant by their inability to show
cytopathic effects after infection with EV71 for 2 days (data not shown). The
EV71viral strain used was 5865/sin/000009 (accession number 316321; designated
as Strain 41) isolated from a fatal case from a HFMD patient during the outbreak in
Singapore in October 2000. When seeded cells reach approximately 95% confluency,
they were infected with the virus at a MOI of 10 and harvested 2 hours post
infection.
154
Protein Extraction and 2-Dimensional Electrophoresis
Cellular proteins were extracted using ProteoExtract Complete Mammalian
Proteome Extraction Kit (Merck, Darmstadt, Germany) according to the
manufacturer's instruction. The samples were then used to perform two-dimensional
gel electrophoresis (2DE). Protein concentration were first quantitated using
Nanodrop 100 spectrophotometer (ThermoScientific, Waltham, USA) and then
diluted to 100mg/ml with rehydration buffer (Bio-Rad Laboratories, CA, USA)
before applying it to the pH 4-7 ReadyStrip IPG Strips (11cm, Bio-Rad Laboratories,
CA, USA). After a 12 hours passive rehydration process, isoelectric focusing (IEF)
was performed using the Protean IEF cell (Bio-Rad Laboratories, CA, USA) at the
following conditions; 250 V for 20 min with linear ramp, 8,000 V for 2.5 hours with
linear ramp and finally 8,000 V for 25,000 v-hours with rapid ramping.
After IEF, the IPG strips were equilibrated with equilibration buffers (Bio-
Rad Laboratories, CA, USA) before applying it to the second-dimensional SDS-
PAGE at 200 V for 65mins using 12.5% Tris–HCl Criterion gel (Bio-Rad
Laboratories, CA, USA). After gel electrophoresis, the gels were stained with
InstantBlue ultrafast protein stain (ExpedeonTM, Cambridge, UK) for 2 hours before
imaging them using VersaDocTM Imaging System (4000MP, Bio-Rad Laboratories,
CA, USA). Protein spots of interest were excised and washed twice with water as
previously described by (Lee et al., 2011). The gels were first destained in 100μl of
50mM ammonium bicarbonate / 50% (v/v) acetonitrile for 5 min. The destaining
stage was then repeated twice followed by an addition of 50μl acetonitrile. Reduction
was then performed by covering the gel in freshly prepared 100mM ammonium
bicarbonate containing 10mM DTT after drying down using a vacuum centrifuge.
155
Following incubation at 56°C for 1 hour, alkylation was performed using 55mM
iodoacetamide (Sigma Aldrich, St Louis, USA) in 100 mM ammonium bicarbonate.
The gel was subsequently dehydrated with acetonitrile and dried with a vacuum
centrifuge. Digestion was performed with the use of 12.5ng/μl of sequencing grade
modified trypsin (Promega, Wisconsin, USA) in 50mM ammonium bicarbonate and
incubated for 30 min at 4°C. The peptides were extracted three times using 25μl of
5% formic acid in 50% aqueous acetonitrile. The extracts were incubated for 10 min
and concentrated by centrifugation.
The trypsin-digested peptides were mixed with freshly prepared matrix
solution (10mg of CHCA in 1 ml of 0.5% TFA and 50% acetonitrile) in a 1:1 (v/v)
ratio. The peptides were then analysed using the ABI 4700 Proteomics Analyzer with
TOF/TOF™ optics (Applied Biosystems, CA, USA). Peptide tolerance was set at
100 ppm with fixed modification of cysteine carbamidomethyl, variable modification
of methionine oxidated and permitted missed cleavage of up to 1. Trypsin cleavage
of the protein is at the C-terminal side of KR unless next residue is P. The proteins
were identified by searching in the National Center for Biotechnology Information
nonredundant (NCBInr) database using MASCOT program
(http://www.matrixscience.com). The experiment was performed with triplicates to
ensure reproducibility.
156
5.3 RESULTS AND DISCUSSION
Comparison of the proteomes of EV71-susceptible and EV71-resistant RD cell
lines showed a significant difference (Figure 5.1). In particular, two variants of β-
actin, labelled as β1 (BAD96752.1, BLAST score 785, identity 100%) and β2
(BAD96645.1, BLAST score 721, identity 93%), were found in the EV71-
susceptible RD cells, compared to EV71-resistant RD cells that contains only one
variant β1. The variant form of actin, β1 and β2 differ from each other by a domain
comprising of ATP, gelsolin and profiling binding sites that spans 24 amino acids. In
addition, the intensity of γ-actin (NP_001605.1, BLAST score 750, identity 100%)
and β-actin variant β1 were also shown to be lower in the EV71-resistant RD cell.
Although the specific function of the different β-actin variants in response to
EV71 infection awaits discovery, it is tempting to propose that EV71 infection is
dependent on a specific variant of β-actin. For example, viruses such as adenovirus
and HIV were reported to enter host in an actin-dependent manner (Ploubidou &
Way, 2001). Furthermore, an actin-binding protein, annexin 2, was previously
reported to bind to the VP1 capsid protein of EV71 and is necessary for the
propagation of infection (Yang et al., 2011).
Annexin 2 binds to cytoplasmic F-actin and is responsible for organization of
cytoplasmic actins and intracellular vesicular transport (Lee et al., 2011, Hayes et al.,
2006, Gerke & Moss, 2002). Therefore, we proposed that β2 is one of the actin
isoforms that annexin 2 binds to and possibly harnesses for vesicular transport in
normal cell processes. In the EV71-resistant cells, the loss of β2 variant result in the
157
failure of the virus to be transported into the cytoplasm after binding to annexin 2.
The ability of EV71-resistant cells to survive and retain its morphology might also be
due to the presence of other cytoplasmic actins such as γ-actin and β-actin variants.
This finding further support our previous report in which actin plays a role in
pathogenesis and the establishment of the disease in an in vitro system (Lee et al.,
2011).
In addition, Hussain and colleagues (2011) also demonstrated that the
cytoskeletal system comprising both actin and microtubules were involved endocytic
kinetics (Buss et al., 2001, Durrbach et al., 1996, Flanagan & Lin, 1980, Hussain et
al., 2011). The knockdown of genes such as ARPC5, ARRB1, and WASF1 that were
important in actin polymerisation, and the use of actin disrupting drug such as
cytochalasin B, have resulted in the decrease in EV71 replication kinetics (Buss et
al., 2001, Durrbach et al., 1996, Flanagan & Lin, 1980, Gerke & Moss, 2002, Hayes
et al., 2006, Hussain et al., 2011, Ploubidou & Way, 2001, Soldati & Schliwa, 2006,
Yang et al., 2011).
158
Figure 5.1 Proteome of EV71 infection-resistant and susceptible RD cells. (A)
Proteome of mock infected RD cells. (B) Proteome of EV71 infected RD cells
harvested at 2hpi. (C) Proteome of EV71 infection resistant RD cells harvested at
2hpi. γ denotes γ-actin, β1 and β2 denotes β-actin variants .
159
5.4 CONCLUSION
In conclusion, we demonstrated that RD cells resistant to EV71 infection lack a
variant of β-actin, compared to EV71-susceptible RD cells. EV71 infection may be
actin dependent and might involve an actin-binding protein, annexin 2. The further
characterisation of the identified protein in this study may pave way for the
elucidation of the mechanism of pathogenesis of EV71 in HFMD and uncover
antiviral therapeutics targets for the treatment of HFMD patients.
160
5.5 REFERENCES
Brown, B.A., M.S. Oberste, J.P. Alexander, Jr., M.L. Kennett & M.A. Pallansch,
(1999) Molecular epidemiology and evolution of enterovirus 71 strains
isolated from 1970 to 1998. J Virol 73: 9969-9975.
Buss, F., J.P. Luzio & J. Kendrick-Jones, (2001) Myosin VI, a new force in clathrin
mediated endocytosis. FEBS letters 508: 295-299.
Chu, P.Y., K.H. Lin, K.P. Hwang, L.C. Chou, C.F. Wang, S.R. Shih, J.R. Wang, Y.
Shimada & H. Ishiko, (2001) Molecular epidemiology of enterovirus 71 in
Taiwan. Arch Virol 146: 589-600.
Chumakov, M., M. Voroshilova, L. Shindarov, I. Lavrova, L. Gracheva, G.
Koroleva, S. Vasilenko, I. Brodvarova, M. Nikolova, S. Gyurova, M.
Gacheva, G. Mitov, N. Ninov, E. Tsylka, I. Robinson, M. Frolova, V.
Bashkirtsev, L. Martiyanova & V. Rodin, (1979) Enterovirus 71 isolated
from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60:
329-340.
Durrbach, A., D. Louvard & E. Coudrier, (1996) Actin filaments facilitate two steps
of endocytosis. Journal of cell science 109 ( Pt 2): 457-465.
Flanagan, M.D. & S. Lin, (1980) Cytochalasins block actin filament elongation by
binding to high affinity sites associated with F-actin. The Journal of
biological chemistry 255: 835-838.
Gerke, V. & S.E. Moss, (2002) Annexins: from structure to function. Physiol Rev 82:
331-371.
Hayes, M.J., D. Shao, M. Bailly & S.E. Moss, (2006) Regulation of actin dynamics
by annexin 2. EMBO J 25: 1816-1826.
161
Ho, M., E.R. Chen, K.H. Hsu, S.J. Twu, K.T. Chen, S.F. Tsai, J.R. Wang & S.R.
Shih, (1999) An epidemic of enterovirus 71 infection in Taiwan. Taiwan
Enterovirus Epidemic Working Group. N Engl J Med 341: 929-935.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Hussain, K.M., K.L. Leong, M.M. Ng & J.J. Chu, (2011) The essential role of
clathrin-mediated endocytosis in the infectious entry of human enterovirus
71. The Journal of biological chemistry 286: 309-321.
Lee, J.J., J.B. Seah, V.T. Chow, C.L. Poh & E.L. Tan, (2011) Comparative proteome
analyses of host protein expression in response to Enterovirus 71 and
Coxsackievirus A16 infections. J Proteomics 74: 2018-2024.
Lee, T.C., H.R. Guo, H.J. Su, Y.C. Yang, H.L. Chang & K.T. Chen, (2009) Diseases
caused by enterovirus 71 infection. Pediatr Infect Dis J 28: 904-910.
Liu, C.C., H.W. Tseng, S.M. Wang, J.R. Wang & I.J. Su, (2000) An outbreak of
enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical
manifestations. Journal of clinical virology : the official publication of the
Pan American Society for Clinical Virology 17: 23-30.
Lu, C.Y., C.Y. Lee, C.L. Kao, W.Y. Shao, P.I. Lee, S.J. Twu, C.C. Yeh, S.C. Lin,
W.Y. Shih, S.I. Wu & L.M. Huang, (2002) Incidence and case-fatality rates
resulting from the 1998 enterovirus 71 outbreak in Taiwan. J Med Virol 67:
217-223.
McMinn, P., I. Stratov, L. Nagarajan & S. Davis, (2001) Neurological manifestations
of enterovirus 71 infection in children during an outbreak of hand, foot, and
mouth disease in Western Australia. Clin Infect Dis 32: 236-242.
162
Nagy, G., S. Takatsy, E. Kukan, I. Mihaly & I. Domok, (1982) Virological diagnosis
of enterovirus type 71 infections: experiences gained during an epidemic of
acute CNS diseases in Hungary in 1978. Arch Virol 71: 217-227.
Nasri, D., L. Bouslama, S. Omar, H. Saoudin, T. Bourlet, M. Aouni, B. Pozzetto &
S. Pillet, (2007a) Typing of human enterovirus by partial sequencing of VP2.
J Clin Microbiol 45: 2370-2379.
Nasri, D., L. Bouslama, S. Pillet, T. Bourlet, M. Aouni & B. Pozzetto, (2007b) Basic
rationale, current methods and future directions for molecular typing of
human enterovirus. Expert Rev Mol Diagn 7: 419-434.
Ploubidou, A. & M. Way, (2001) Viral transport and the cytoskeleton. Curr Opin
Cell Biol 13: 97-105.
Schmidt, N.J., E.H. Lennette & H.H. Ho, (1974) An apparently new enterovirus
isolated from patients with disease of the central nervous system. J Infect Dis
129: 304-309.
Shimizu, H., A. Utama, K. Yoshii, H. Yoshida, T. Yoneyama, M. Sinniah, M.A.
Yusof, Y. Okuno, N. Okabe, S.R. Shih, H.Y. Chen, G.R. Wang, C.L. Kao,
K.S. Chang, T. Miyamura & A. Hagiwara, (1999) Enterovirus 71 from fatal
and nonfatal cases of hand, foot and mouth disease epidemics in Malaysia,
Japan and Taiwan in 1997-1998. Jpn J Infect Dis 52: 12-15.
Singh, S., V.T. Chow, M.C. Phoon, K.P. Chan & C.L. Poh, (2002) Direct detection
of enterovirus 71 (EV71) in clinical specimens from a hand, foot, and mouth
disease outbreak in Singapore by reverse transcription-PCR with universal
enterovirus and EV71-specific primers. J Clin Microbiol 40: 2823-2827.
Soldati, T. & M. Schliwa, (2006) Powering membrane traffic in endocytosis and
recycling. Nature reviews. Molecular cell biology 7: 897-908.
163
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
Yang, S.L., Y.T. Chou, C.N. Wu & M.S. Ho, (2011) Annexin II binds to capsid
protein VP1 of enterovirus 71 and enhances viral infectivity. J Virol 85:
11809-11820.
164
Chapter 6 Droplet Digital PCR as a useful tool for the
quantitative detection of Enterovirus 71
165
Title: Droplet Digital PCR as a useful tool for the quantitative detection of
Enterovirus 71
Author names and affiliations:
Yan Long Edmund Lui 1, 2, 3, 4*, Eng Lee Tan 2, 5
1School of Chemical and Life Sciences, Singapore Polytechnic, Singapore
2Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singapore
3School of Biomedical Sciences, Faculty of Health, Queensland University of
Technology, Queensland, Australia
4Institute of Health and Biomedical Innovation, Queensland University of
Technology, Queensland, Australia
5Department of Paediatrics, University Children's Medical Institute, National
University Hospital, Singapore
166
Statement of Contribution of Co-Authors for
Thesis by Published Paper
The following is the format for the required declaration provided at the start of
any thesis chapter which includes a co-authored publication.
The authors listed below have certified* that:
1. they meet the criteria for authorship in that they have participated in the
conception, execution, or interpretation, of at least that part of the publication in
their field of expertise;
2. they take public responsibility for their part of the publication, except for the
responsible author who accepts overall responsibility for the publication;
3. there are no other authors of the publication according to these criteria;
4. potential conflicts of interest have been disclosed to (a) granting bodies, (b) the
editor or publisher of journals or other publications, and (c) the head of the
responsible academic unit, and
5. they agree to the use of the publication in the student’s thesis and its publication
on the QUT ePrints database consistent with any limitations set by publisher
requirements.
In the case of this chapter:
Lui, Y.L.E & E.L. Tan, (2014) Droplet digital PCR as a useful tool for the
quantitative detection of Enterovirus 71. Journal of Virological Methods 207:
200-203.
167
Contributor Statement of contribution*
Lui Yan Long Edmund
(Ph.D. Candidate) Contributed to all the laboratory work in the project, conducted the
data analysis and the interpretation of the data and wrote the
manuscript. Signature
Date
Tan Eng Lee
Contributed to the design of the study and approved the final draft
of the manuscript.
168
Chapter 6: Droplet Digital PCR as a useful tool for the quantitative detection of Enterovirus71
Abstract
Hand, Foot and Mouth Disease (HFMD) is a contagious viral disease that
frequently affects infants and children and present with blisters and flu-like
symptoms. This disease is caused by a group of enteroviruses such as enterovirus 71
(EV71) and coxsackievirus A16 (CA16). However, unlike other HFMD causing
enteroviruses, EV71 have also been shown to be associated with more severe clinical
manifestation such as aseptic meningitis, brainstem and cerebellar encephalitis which
may lead to cardiopulmonary failure and death. Clinically, HFMD caused by EV71
is indistinguishable from other HFMD causing enteroviruses such as CA16.
Molecular diagnosis methods such as the use of real-time PCR has been used
commonly for the identification of EV71. In this study, two platforms namely the
real-time PCR and the droplet digital PCR were compared for the detection
quantitation of known EV71 viral copy number. The results reveal accurate and
consistent results between the two platforms. In summary, the droplet digital PCR
was demonstrated to be a promising technology for the identification and
quantitation of EV71 viral copy number.
169
6.1 INTRODUCTION
Enterovirus71 (EV71) is a positive sense, single stranded, non-enveloped RNA
virus of the Picornaviridae family (Nasri et al., 2007a, Nasri et al., 2007b). EV71 is
one of the main etiological agents for Hand Foot and Mouth Disease (HFMD) that
commonly affects infants and children (Lui et al., 2013b, McMinn, 2002, McMinn,
2012, Ooi et al., 2010, Patel & Bergelson, 2009, Solomon et al., 2010). This disease
is caused by a group of enteroviruses and is usually self-limiting, characterised by
various symptoms such as fever, rashes, poor appetite and multiple ulcers in mouth
(Wong et al., 2010, Ho et al., 2011, Huang et al., 2012). However, unlike other
HFMD causing enteroviruses, EV71 been commonly associated with severe clinical
diseases, including neurological diseases such as aseptic meningitis, brainstem and
cerebellar encephalitis leading to cardiopulmonary failure and death (Chu et al.,
2001, Lee et al., 2011, Lee & Chang, 2010, Lee et al., 2012, McMinn, 2012).
Clinically, HFMD caused by EV71 is indistinguishable from other HFMD causing
enteroviruses such as coxsackievirus A16 (CA16) (Lui et al., 2013b, McMinn, 2002,
McMinn, 2012, Ooi et al., 2010, Patel & Bergelson, 2009, Solomon et al., 2010, Lui
et al., 2014a, Lui et al., 2014b).
Currently, the gold standard for identification of enteroviruses involves
propagation by cell culture followed by neutralisation with specific antisera to
confirm the serotype (Tan et al., 2006, Tan et al., 2008b). However, this procedure is
limited by its long turnaround time which may take a few weeks. Furthermore, some
enteroviruses may proliferate sub-optimally in cell cultures, require several passages
or may not be typeable (Tan et al., 2006, Tan et al., 2008a, Tan et al., 2008b). Recent
170
technological advances have resulted in the development of molecular methods e.g.
such as PCR and real-time PCR, which are more sensitive and have shorter
turnaround time (Mackay et al., 2002). Quantitative real-time PCR (qPCR) has been
widely implemented and use to determine viral load in both clinical and research
laboratories (Mackay et al., 2002).
Over the past two decade, fluorescence based qPCR chemistry have
revolutionised nucleic acid diagnostics and become the gold standard for quantitation
of viral load (Henrich et al., 2012, Hayden et al., 2013). Quantitative determination
of viral load has been used to monitor the efficiency of antiviral therapy and to
determine changes in that therapy (Hindson et al., 2013, McDermott et al., 2013).
Rising viral burden has been used as a trigger for pre-emptive treatment to prevent
symptomatic infection (Henrich et al., 2012, Hayden et al., 2013). Although qPCR
has made major impact in the advance of disease diagnostics, this technology has
notable limitation (Palmer, 2013, Sanders et al., 2013).
Quantitative determination of the viral load in the real-time PCR cycler is
dependent on a series of known standards across a linear range compared to an
unknown sample to determine the concentration to that of the calibration curve
(Henrich et al., 2012, Hayden et al., 2013, Sanders et al., 2013, Sedlak & Jerome,
2013). However, the variation in performance and material in the assay lead to
disagreement between different laboratories (Henrich et al., 2012, Hayden et al.,
2013, Sanders et al., 2013, Sedlak & Jerome, 2013). The use of international
standards made by the World Health Organisation (WHO) mitigates the issue
however these standards are only available for a few common targets (Hayden et al.,
171
2013). As such, Droplet digital PCR (ddPCR), an emerging nucleic acid detection
methodology that provides absolute quantitation of targeted sequence would be a
useful tool to resolve this issue. This method relinquishes the need for
calibration/standard curve and the reliance of rate-based measurement (Ct values)
(Hayden et al., 2013). Since the establishment of this technology, this platform has
been used to determine the presence of microorganisms such as HIV,
cytomegaloviruses and other viral pathogens in patients to monitor antiviral
therapeutics and the quality of water (Henrich et al., 2012, Hayden et al., 2013,
Palmer, 2013, Strain et al., 2013, Racki et al., 2014). The objective of this study is to
evaluate if ddPCR is a comparable platform for the detection and quantitation of
EV71.
6.2 MATERIALS AND METHODS
Quantitation of EV71
The standard used in this study was generated and used previously in the
laboratory (Tan et al., 2006). The EV71 strain used in this study was isolated from a
fatal case of HFMD during October 2000 outbreak in Singapore, Enterovirus
5865/sin/000009 strain from subgenogroup B4 (accession number 316321; hereby
designated as Strain 41). Briefly the standard was generated by conventional PCR to
amplify a 204 bp VP1 fragment using forward primer 5′-
GAGAGTTCTATAGGGGACAGT-3′, and the reverse primer 5′-
AGCTGTGCTATGTGAATTAGGAA-3′ from within the VP1 region of EV71
(nt2466 to nt2669). The PCR product (204bp) was then cloned into the pGEM-T
plasmid vector and subsequently transformed into E.coli JM109 competent cells
172
(Promega, USA). RNA was synthesized in vitro from the recombinant plasmids and
the concentration was measured spectrophotometrically at 260nm. The number of
viral copies was then calculated. A series of ten-fold dilutions were then prepared,
yielding a series of viral copies ranging from 2.5 X 100 copies to 2.5 X 107 copies.
Quantitative real time polymerase chain reaction
The quantitative real time polymerase chain reaction (qPCR) was performed
using the iQ™ Multiplex Powermix (Bio-Rad Laboratories, CA, USA) on the
BioRad CFX96TM Real-Time PCR system (Bio-Rad Laboratories, CA, USA). The
EV71 specific primers targeting the conserve VP1 regions were 5′-
GAGAGTTCTATAGGGGACAGT-3′, Taqman probe 5′-HEX-
GATGACTGCTCACCTGTGTGTTTTGACC-BHQ-1 and the reverse primer 5′-
AGCTGTGCTATGTGAATTAGGAA-3′ (Tan et al., 2006). Briefly, standard of
viral copies ranging of from 2.5 X 100 copies to 2.5 X 106 copies were added with
primers and probe to iQ™ Multiplex Powermix (Lui et al., 2013a, Lui et al., 2013b,
Tan et al., 2008a, Tan et al., 2008b). The reaction mix was then subjected to thermal
profile of denaturation at 95ºC for 10m, followed by amplification and quantification
in 40 cycles at 95ºC for 10s, 60ºC for 30s followed by 50ºC for 30s. At the end of
amplification cycles, melting temperature analysis was performed by the BioRad
CFX96TM Real-Time PCR system (Bio-Rad Laboratories, CA, USA).
Droplet digital PCR
The droplet digital polymerase chain reaction (ddPCR) was performed using
the ddPCR mastermix (Bio-Rad Laboratories, CA, USA) on the BioRad QX100
droplet digital PCR system (Bio-Rad Laboratories, CA, USA). Briefly, standard of
173
viral copies ranging of from 2.5 X 100 copies to 2.5 X 103 copies were added with
primers and probe to the ddPCR in a final volume of 20 μl in accordance to the
manufacturer’s instructions (Bio-Rad Laboratories, CA, USA). The reaction mixture
was then processed with a 70 μl of droplet generation oil (Bio-Rad Laboratories, CA,
USA) using the droplet generator (Bio-Rad Laboratories, CA, USA). The droplets
generated were then transferred into a 96 well plate (Eppendorf, Germany) and PCR
amplification was performed with a thermal cycling profile of denaturation at 95ºC
for 10m, followed by 40 cycles at 94ºC for 30s, 60ºC for 60s followed by 98ºC for
10m on a T100 thermal cycler (Bio-Rad Laboratories, CA, USA). Finally, the plate
was loaded onto the droplet reader (Bio-Rad Laboratories, CA, USA) and the data
was generated and analysed using the QuantaSoft analysis software (Bio-Rad
Laboratories, CA, USA).
Data analysis
GraphPad Prism Version 6.0c (GraphPad Software, USA) was used to
generate standard curve from real-time PCR and ddPCR data. All statistical analysis
was performed on GraphPad Prism Version 6.0c (GraphPad Software, USA).
6.3 RESULTS
Viral load testing procedures has been used extensively in research laboratories
and are now integrated to a diverse setting ranging from drug companies to clinical
diagnostics laboratories. Quantitative values have been used to monitor the efficacy
of antiviral treatment and/or to determine changes in the therapy (Sedlak & Jerome,
2013, Kiselinova et al., 2014). Despite the advances and the use of a highly
174
established platforms like real-time PCR, challenges in viral load testing remains due
to the intrinsic limitation of the method which are central to the issues of precision,
accuracy and standardisation (Hayden et al., 2013, Hindson et al., 2013, Sanders et
al., 2013, Sedlak & Jerome, 2013, Strain et al., 2013, Kiselinova et al., 2014).
ddPCR, a direct measurement of target molecules which relinquishes the need for
calibration/standard curve and obviates the need for developing costly international
standards is an attractive tool for viral load testing (Henrich et al., 2012, Sanders et
al., 2013, Sedlak & Jerome, 2013).
To investigate if ddPCR is a comparable platform for the detection and
quantitation of EV71, real-time PCR and ddPCR were performed using known
standards of EV71 (Tan et al., 2006, Tan et al., 2008b). Known standards of EV71
viral copies were used for the determination of linear regression correlation
coefficients (R2) for the log transformed copy number obtain from both real-time
PCR and ddPCR data. The expected copy numbers measured both methods from
real-time PCR and ddPCR shows R2 values (close to 1) of 0.9951 and 0.9923
respectively (Figure 6.1 and 6.2). ddPCR was performed by partitioning the whole
PCR reaction into 20,000 droplets. Each droplet would ideally contains 1 or less
copies of targeted DNA. Following PCR amplification, enumeration of both the
fluorescence and non- fluorescence droplets would allow the absolute quantification
of target molecules in the original sample. An example of the visual readout of
positive and negative individual ddPCR was generated using QuantaSoft analysis
software (Bio-Rad Laboratories, CA, USA) (Figure 6.3).
175
6.4 DISCUSSION
One of the key limitations of ddPCR in comparison to real-time PCR is the
need to perform dilution to samples as concentration of more than 75,000 copies of
target molecules lead to significant loss of linearity at high concentration/
“overloading” (Hayden et al., 2013, Henrich et al., 2012). In order to solve this issue,
ddPCR was performed on standards ranging from 2.5 X 100 copies to 2.5 X 103
copies (Figure 6.2 and 6.3). Despite this limitation, ddPCR is a promising platform to
monitor EV71 viral replication as it show good correlation to the real-time PCR. The
large scale partitioning involved in ddPCR allows a greater precision and sensitivity
in comparison with real-time PCR (Hayden et al., 2013).
The positive counts could then be used together with the Poisson’s distribution
to determine a direct high confidence measurement of the targeted molecules
(Hindson et al., 2013, Palmer, 2013, Sanders et al., 2013, Kiselinova et al., 2014,
Racki et al., 2014). In addition, partitioning reactions in picoliter droplet allow
ddPCR to have less interference with PCR inhibitors and be able to handle larger
amount of input DNA (Sanders et al., 2013). As a result, ddPCR is a promising
platform for the investigation of low viral count in diagnostics. Other studies on low
viremia in HIV-patients demonstrated that the low detection of HIV-1 viral load as a
useful tool in the prediction of the retroviral therapy in HIV-infected patients
(Henrich et al., 2012, Kiselinova et al., 2014, Palmer, 2013).
The move toward absolute quantitation of viral load is driven by the need to
monitor the efficiency of antiviral therapy without the variability in material and the
176
availability international standards. In this study, ddPCR platforms was demonstrated
to be generally comparable to real-time PCR for the detection and quantitation of
EV71 viral copy number.
177
Figure 6.1 Quantitative analysis of real-time TaqMan PCR for the detection of
EV71. The standard curve was obtained by plotting the Ct values against the starting
concentration. The correlation coefficients (R2) and the linear equation are as shown
(n=3, *= p values of < 0.05).
178
Figure 6.2 Quantitative analysis of ddPCR for the detection of EV71. The
standard curve was obtained by plotting the positive count against the starting
concentration. The correlation coefficients (R2) and the linear equation are as shown
(n=3, *= p values of < 0.05).
179
Figure 6.3 Visual representation of ddPCR results for known EV71 standards
after flow enumeration. Positive droplets (Upper cluster) and negative droplets
(lower cluster) are shown for 4 serially diluted EV71 standards and negative control
(n=3). The Y axis represents the fluorescent intensity and X axis represents the total
number of event in each dilution.
180
6.5 REFERENCES
Chu, P.Y., K.H. Lin, K.P. Hwang, L.C. Chou, C.F. Wang, S.R. Shih, J.R. Wang, Y.
Shimada & H. Ishiko, (2001) Molecular epidemiology of enterovirus 71 in
Taiwan. Arch Virol 146: 589-600.
Hayden, R.T., Z. Gu, J. Ingersoll, D. Abdul-Ali, L. Shi, S. Pounds & A.M. Caliendo,
(2013) Comparison of droplet digital PCR to real-time PCR for quantitative
detection of cytomegalovirus. J Clin Microbiol 51: 540-546.
Henrich, T.J., S. Gallien, J.Z. Li, F. Pereyra & D.R. Kuritzkes, (2012) Low-level
detection and quantitation of cellular HIV-1 DNA and 2-LTR circles using
droplet digital PCR. Journal of virological methods 186: 68-72.
Hindson, C.M., J.R. Chevillet, H.A. Briggs, E.N. Gallichotte, I.K. Ruf, B.J. Hindson,
R.L. Vessella & M. Tewari, (2013) Absolute quantification by droplet digital
PCR versus analog real-time PCR. Nature methods 10: 1003-1005.
Ho, B.C., S.L. Yu, J.J. Chen, S.Y. Chang, B.S. Yan, Q.S. Hong, S. Singh, C.L. Kao,
H.Y. Chen, K.Y. Su, K.C. Li, C.L. Cheng, H.W. Cheng, J.Y. Lee, C.N. Lee
& P.C. Yang, (2011) Enterovirus-induced miR-141 contributes to shutoff of
host protein translation by targeting the translation initiation factor eIF4E.
Cell Host Microbe 9: 58-69.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Kiselinova, M., A.O. Pasternak, W. De Spiegelaere, D. Vogelaers, B. Berkhout & L.
Vandekerckhove, (2014) Comparison of Droplet Digital PCR and Seminested
181
Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA. PLoS
One 9: e85999.
Lee, J.J., J.B. Seah, V.T. Chow, C.L. Poh & E.L. Tan, (2011) Comparative proteome
analyses of host protein expression in response to Enterovirus 71 and
Coxsackievirus A16 infections. J Proteomics 74: 2018-2024.
Lee, M.S. & L.Y. Chang, (2010) Development of enterovirus 71 vaccines. Expert
Rev Vaccines 9: 149-156.
Lee, M.S., F.C. Tseng, J.R. Wang, C.Y. Chi, P. Chong & I.J. Su, (2012) Challenges
to licensure of enterovirus 71 vaccines. PLoS neglected tropical diseases 6:
e1737.
Lui, Y., P. Timms, L. Hafner, T. Tan, K. Tan & E. Tan, (2013a) Characterisation of
enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
Lui, Y.L., T.L. Tan, P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan, (2014a)
Elucidating the host-pathogen interaction between human colorectal cells and
invading Enterovirus 71 using transcriptomics profiling. FEBS Open Bio 4:
426-431.
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013b) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
Lui, Y.L.E., T.L. Tan, W.H. Woo, P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan,
(2014b) Enterovirus71 (EV71) Utilise Host microRNAs to Mediate Host
182
Immune System Enhancing Survival during Infection. PLoS ONE 9:
e102997.
Mackay, I.M., K.E. Arden & A. Nitsche, (2002) Real-time PCR in virology. Nucleic
Acids Res 30: 1292-1305.
McDermott, G.P., D. Do, C.M. Litterst, D. Maar, C.M. Hindson, E.R. Steenblock,
T.C. Legler, Y. Jouvenot, S.H. Marrs, A. Bemis, P. Shah, J. Wong, S. Wang,
D. Sally, L. Javier, T. Dinio, C. Han, T.P. Brackbill, S.P. Hodges, Y. Ling, N.
Klitgord, G.J. Carman, J.R. Berman, R.T. Koehler, A.L. Hiddessen, P. Walse,
L. Bousse, S. Tzonev, E. Hefner, B.J. Hindson, T.H. Cauly, 3rd, K. Hamby,
V.P. Patel, J.F. Regan, P.W. Wyatt, G.A. Karlin-Neumann, D.P. Stumbo &
A.J. Lowe, (2013) Multiplexed target detection using DNA-binding dye
chemistry in droplet digital PCR. Analytical chemistry 85: 11619-11627.
McMinn, P.C., (2002) An overview of the evolution of enterovirus 71 and its clinical
and public health significance. FEMS microbiology reviews 26: 91-107.
McMinn, P.C., (2012) Recent advances in the molecular epidemiology and control of
human enterovirus 71 infection. Current opinion in virology 2: 199-205.
Nasri, D., L. Bouslama, S. Omar, H. Saoudin, T. Bourlet, M. Aouni, B. Pozzetto &
S. Pillet, (2007a) Typing of human enterovirus by partial sequencing of VP2.
J Clin Microbiol 45: 2370-2379.
Nasri, D., L. Bouslama, S. Pillet, T. Bourlet, M. Aouni & B. Pozzetto, (2007b) Basic
rationale, current methods and future directions for molecular typing of
human enterovirus. Expert Rev Mol Diagn 7: 419-434.
183
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
Palmer, S., (2013) Advances in detection and monitoring of plasma viremia in HIV-
infected individuals receiving antiretroviral therapy. Current opinion in HIV
and AIDS 8: 87-92.
Patel, K.P. & J.M. Bergelson, (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728-729.
Racki, N., D. Morisset, I. Gutierrez-Aguirre & M. Ravnikar, (2014) One-step RT-
droplet digital PCR: a breakthrough in the quantification of waterborne RNA
viruses. Analytical and bioanalytical chemistry 406: 661-667.
Sanders, R., D.J. Mason, C.A. Foy & J.F. Huggett, (2013) Evaluation of digital PCR
for absolute RNA quantification. PLoS One 8: e75296.
Sedlak, R.H. & K.R. Jerome, (2013) Viral diagnostics in the era of digital
polymerase chain reaction. Diagn Microbiol Infect Dis 75: 1-4.
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Strain, M.C., S.M. Lada, T. Luong, S.E. Rought, S. Gianella, V.H. Terry, C.A. Spina,
C.H. Woelk & D.D. Richman, (2013) Highly precise measurement of HIV
DNA by droplet digital PCR. PLoS One 8: e55943.
Tan, E.L., V.T. Chow, G. Kumarasinghe, R.T. Lin, I.M. Mackay, T.P. Sloots & C.L.
Poh, (2006) Specific detection of enterovirus 71 directly from clinical
184
specimens using real-time RT-PCR hybridization probe assay. Molecular and
cellular probes 20: 135-140.
Tan, E.L., V.T. Chow, S.H. Quak, W.C. Yeo & C.L. Poh, (2008a) Development of
multiplex real-time hybridization probe reverse transcriptase polymerase
chain reaction for specific detection and differentiation of Enterovirus 71 and
Coxsackievirus A16. Diagn Microbiol Infect Dis 61: 294-301.
Tan, E.L., L.L. Yong, S.H. Quak, W.C. Yeo, V.T. Chow & C.L. Poh, (2008b) Rapid
detection of enterovirus 71 by real-time TaqMan RT-PCR. Journal of clinical
virology : the official publication of the Pan American Society for Clinical
Virology 42: 203-206.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
185
Chapter 7 General Discussion
186
Chapter 7: General Discussion
7.1 OVERALL DISCUSSION
Over the past few decades, with the near eradication of poliovirus, EV71 has
emerged to become the most important of the neurotropic enteroviruses (Huang et
al., 2012, Lee et al., 2012, Wu et al., 2010). Since its first discovery in 1974 in
California (USA), after being isolated from patients with central nervous system
disease in 1969, EV71 has periodically been reported worldwide (Schmidt et al.,
1974, Chumakov et al., 1979, McMinn et al., 2001, Huang et al., 2012). Outbreaks
of disease caused by EV71 (HFMD) occurs every two to three years in countries
including Australia, China, Taiwan, Japan, Korea, Malaysia, Vietnam, Thailand and
Singapore (Schmidt et al., 1974, Chumakov et al., 1979, McMinn et al., 2001,
Huang et al., 2012). Although the consistent presence and outbreaks of HFMD push
for an urgent need to develop a vaccine or antiviral therapies against enteroviruses,
there are no available antiviral therapies or vaccines approved by the United States of
America FDA to prevent HFMD infections (Pourianfar et al., 2012, McMinn et al.,
2001, Tan et al., 2007a, Tan et al., 2007b, Tan et al., 2010).
The ability to further understand the pathogenesis of EV71 has been
hampered by the lack of a relevant infection model in humans for this enterovirus.
Although in vivo models of viral infections using rhesus and cynomolgus monkeys
have been reported with EV71, the use of these models is not highly relevant at the
experimental level as only approximately 10% of the infected animals develop
neurological complications and this finding is in agreement with epidemiological
187
data (Khong et al., 2012, Ooi et al., 2009, Ooi et al., 2007). Notwithstanding, the use
of primate models has been limited due to economical and ethical reasons
(Hashimoto & Hagiwara, 1983, Khong et al., 2012, Liu et al., 2011, Nagata et al.,
2004, Zhang et al., 2011).
The use of a mouse model of EV71 infection has also been reported using 1
day old mouse neonates subjected to high doses of EV71 (Chen et al., 2007, Sasaki
et al., 1986, Tan et al., 2007b). Although results from such studies do provide novel
insight into EV71 infections of host cells, they might not accurately mimic the actual
EV71 pathogenesis mechanisms used by the virus in a human host (Khong et al.,
2011, Khong et al., 2012). The maturity of the immune system using such models
also needs to be taken into consideration (Khong et al., 2011, Khong et al., 2012). In
addition, this murine model is also not suitable for EV71 drug testing as the
susceptibility window is only a few days and passive immunity from the mothers in
combination with the high dosage of EV71 as well as the size of a neonatal mouse
makes it a less than ideal model for studying EV71 pathogenesis (Khong et al., 2011,
Khong et al., 2012). Studies of EV71 frequently make use of in vitro models using
human and animal cell lines such as rhabdomyosarcoma (RD), HeLa, Vero and
Primary Monkey Kidney (D P Schnurr., 1999). These cells were derived from
various human tissues including muscle, cervix and kidney. However, the natural
route of transmission of EV71 is postulated as being by direct contact of infected
vesicular fluid via the faecal-oral route (Wong et al., 2010, Lee et al., 2009, Liu et
al., 2000, Brown et al., 1999). EV71 was shown in vivo (mice) to replicate within the
gastrointestinal tract, bypass the gut barrier and infect into the skeletal muscle cell
before entering into the bloodstream and the central nervous system (Wong et al.,
188
2010, Lee et al., 2009, Liu et al., 2000, Brown et al., 1999). Taking into
consideration that the gastrointestinal tract is the initial site of infection, we
hypothesised that it is more relevant and necessary to study EV71 using an in vitro
model using cells (e.g. HT29) derived from the human gastrointestinal tract.
The kinetics of viral replication plays an important role in the understanding
of viral pathogenesis (Baccam et al., 2006, Chang et al., 2006, Major et al., 2004).
The replication kinetics of viruses such as hepatitis C, Nipah and influenza have been
reported in various studies and have provided valuable information, particularly
regarding responses to antiviral therapeutics, that can contribute to the understanding
of host-pathogen interactions (Baccam et al., 2006, Chang et al., 2006, Major et al.,
2004). By comparison, the only information on the replication kinetics of EV71 was
reported by Lu et al (2011) who demonstrated that EV71 proliferated in an in vitro
model of rhabdomyosarcoma (RD) muscle cells (Lu et al., 2011). In a clinical
context, this human muscle cell model may not be a good representative model for
EV71 infections of humans considering gastrointestinal tract is the initial site of
infection. In Chapter two, we sought to set up an EV71 infection model using human
colorectal cells (HT29) and we succeeded in establishing EV71 replication kinetics
as evidence by results presented in Chapter two of this thesis. We demonstrated that
upon EV71 infection of human epithelial colorectal cancer cells (HT29), significant
cell death only occurs at 72hpi. This varies from the rhabdomyosarcoma (RD) cells
previously reported by Lu et al (2011) where most host cell death occurred within
24hpi with EV71.
189
Similarly Chen et al (2007) and Khong et al (2012) proposed that skeletal
muscle cells compared to other cell types are more effective in supporting viral
replication which allow persistent enterovirus infection to represent viral source of
entry into the central nervous system (CNS) (Chen et al., 2007, Khong et al., 2012).
In contrast to EV71 RNA synthesis, RNA was first detected at 12hpi while viral
protein synthesis was only observed at a later stage during the infection. This may be
possibly due to the translation time required. Lu et al (2011) showed a similar trend
where virus RNA was first detected at 3hpi while virus protein was observed at 6hpi
in the RD model. Correlating to HFMD, the onset of disease and the incubation
period for HFMD is between three to seven days (Khong et al., 2012, Ooi et al.,
2010, Ooi et al., 2009, Ooi et al., 2007). This may correspond to the number of days
the virus requires to pass through the gastrointestinal tract before spreading
throughout the body (Khong et al., 2012, Ooi et al., 2010, Ooi et al., 2009, Ooi et al.,
2007). Therefore the in vitro model of EV71 infection of the human epithelial
colorectal cell line (HT29) may be more clinically relevant than the EV71-RD model
for studying the pathogenesis of this virus and may more closely mimic what occurs
in vivo in human infections with this enterovirus.
Receptor binding is another essential and vital process of the virus infection
of host cells (Patel & Bergelson, 2009, Tan et al., 2013, Yamayoshi et al., 2012).
Host cellular receptors therefore play an important role in the pathogenicity of
viruses, since viruses have been found to use multiple receptors for entry into
susceptible host cells (Patel & Bergelson, 2009, Hayes et al., 2006, Yamayoshi et al.,
2009). Thus the identification and characterisation of cellular receptors displayed on
host cells for viral attachment would also be likely to be important to assist in our
190
understanding of EV71 pathogenesis. One host cell receptor, defined as Scavenger
Receptor Class B, member 2 (SCARB2) was first reported by Yamayoshi et al.,
(2009) to be a receptor for all EV71 strains and expressed at the sites of EV71
replication in vivo (Hayes et al., 2006, Yamayoshi et al., 2009). SCARB2 is
composed of 478 amino acids and belongs to the CD36 family of cell receptors
(Yamayoshi et al., 2012). SCARB2 is commonly found in abundance on the
lysosomal membrane of the cell and it assists in internalising the EV71 virus in host
cells via clathrin-mediated endocytosis (Hussain et al., 2011, Lui et al., 2013b,
Yamayoshi et al., 2012). In line with this, we detected the presence of SCARB2 in
our EV71-HT29 in vitro model, data that further supports our proposal for the use of
the HT29 cell line as a viable in vitro model to more closely mimic EV71
pathogenesis in vivo.
During infections of susceptible host cells, viruses can regulate the expression
of certain host genes to enhance their survival (Scaria et al., 2006, Ghosh et al.,
2009, Roberts & Jopling, 2010). Such activities can include viral regulation of host
genes that may alter the cellular microenvironment to allow the virus to successfully
replicate and evade the host immune system (Scaria et al., 2006, Ghosh et al., 2009,
Roberts & Jopling, 2010). Elucidating the mechanism(s) that viruses use to bypass
host defence systems and establish infection is likely to provide us with a better
understanding of the pathogenesis mechanisms of the EV71 virus and aid in the
development of antiviral therapeutics with higher efficacy for HFMD patients.
Systemic analyses of host responses to EV71 infections provide us with critical clues
to understand the molecular mechanisms of EV71 pathogenesis during infections of
human hosts. Regulation and alteration of the host cellular system can also be
191
elucidated by examining changes in the host cellular transcriptomes following EV71
infection. Transcriptomic analysis via RNA-sequencing, mRNA microarray and PCR
array have previously been used to analyse the expression of host genes following
viral infections (Fook & Chow, 2010, Leong & Chow, 2006, Xu et al., 2013). Again,
these studies have been done using rhabdomyosarcoma (RD) cells or SH-SY5Y
cells, of muscle cells and neuronal origin respectively. Although various pathways
were found to be altered during EV71 infection of these afore-mentioned host cells,
in a clinical context, these may not be good representative models for EV71 infection
of humans, as the gastrointestinal tract is the first in vivo site for EV71 proliferation
(Chen et al., 2007, Chen et al., 2004, Khong et al., 2012).
To investigate the regulation and alteration of host cellular systems following
viral infection and replication in vitro, we used our HT29-EV71 in vitro system to
generate data to provide an in-depth transcriptomic analysis to elucidate the host-
pathogen interaction between our established human colorectal cells and invading
EV71. The results of these investigation are presented and discussed in Chapter
Three. Comparing the mRNA expression between EV71-infected host cells and non-
infected host cells identified 699 genes that were significantly differentially
expressed during EV71 infection (p<0.05). These differentially expressed genes were
involved in critical pathways in the host cells including pathways involved in
immune response, stress response, metabolism, cytotoxicity, cytokines and
cytoskeleton network. In particular, expression of genes for IL29/IFN-λ1, IFN-β1
and IFN-γ1 (type I, II and III IFN) were significantly up regulated.
192
A key characteristic of cytokines is the ability to interact with one another to
establish coordinated defence mechanism against invading pathogens. IL29 functions
by binding to a unique receptor through a pathway identical to IFN-β1 and IFN-γ1
receptors, inducing cellular antiviral activity to inhibit virus replication (Park et al.,
2012, Osterlund et al., 2005, Pagliaccetti et al., 2008). Synergetic effects between
IL29, IFN-β1 and IFN-γ1 were shown to promote cellular antiviral responses (Park et
al., 2012, Osterlund et al., 2005, Pagliaccetti et al., 2008). Indeed, the use of IL29,
IFN-β1 and IFN-γ1 as antiviral treatments has been shown to be able to successfully
inhibit replication in various viruses, both in vitro and in vivo including herpes
simplex-1 virus, mouse hepatitis virus type 2, human T-lymphotropic virus-1,
cytomegalovirus and hepatitis C virus (Sainz & Halford, 2002, Pierce et al., 2005,
Fuchizaki et al., 2003, D'Onofrio et al., 1992, Sainz et al., 2005, Okuse et al., 2005,
Larkin et al., 2003).
We proposed that in EV71 infection of susceptible host cells, infected cells
may up-regulate cytokines such as IL29, IFN-β1 and IFN-γ1 to induce interferon
stimulated genes (ISG) as part of the cellular antiviral response to slow down viral
replication. In agreement with our hypothesis, our qPCR results demonstrated
significant up-regulation of ISG54 and ISG56 in response to EV71 infection of the
host cell. We proposed that following EV71 infections the host colorectal cells up-
regulate the expression of cytokines such as IL29, IFN-β1 and IFN-γ1 (type I, II and
III IFN) by a series of JAK-STAT signalling pathways to induce ISG such as ISG54
and ISG56 as part of cellular antiviral response to slow down virus replication.
193
Lei et al., (2010, 2011, 2013) previously reported that EV71 3C protein
suppressed the host immune system such as type I interferon during infection in RD
cells (muscle cells) (Lei et al., 2010, Lei et al., 2011, Lei et al., 2013). On the other
hand, Chi et al., (2013) have compared the expression of the IFN-signalling pathway
between intestinal epithelial cells and muscle cells and their results demonstrated that
intestinal cells indeed have a significantly higher expression of cytokines in response
to EV71 infection in comparison with the expression levels of cytokines from muscle
cells following enterovirus infections (Chi et al., 2013). In addition, IFN signalling
pathways such as those involving type I interferons previously were demonstrated to
play important roles during EV71 infections (Liu et al., 2005). Therefore it would
appear that the mechanisms by which EV71 virus mediates changes in the host
immune systems may differ between host cell types. This may therefore explain the
phenomenon we observed in our study where it took three times longer for the virus
to lyse HT29 cells in comparison with viral–induced lysis of host RD cells (Lu et
al., 2011, Lui et al., 2013a). The intestinal epithelial cells, HT29 derived cancer cells
were able to respond to EV71infection by inducing host cellular antiviral responses
to slow down virus replication in these cells; this is in contrast with what occurs
following viral infections of RD (muscle) cells (Chi et al., 2013, Lu et al., 2011, Lui
et al., 2013a).
The innate system of the host is the first line of immune defence against
invading pathogens with the interferons (IFNs) being a key component against viral
infection (Versteeg & Garcia-Sastre, 2010, Thompson et al., 2011, Randall &
Goodbourn, 2008, Rajsbaum & Garcia-Sastre, 2013, Oudshoorn et al., 2012, de
Weerd & Nguyen, 2012, Brennan & Bowie, 2010, Boss & Renne, 2011). The release
194
of IFNs begins with the recognition of pathogen-associated molecular patterns
(PAMPs) which include Toll like receptors (TLRs), NOD like receptors (NLRs),
retinoic acid-inducible gene I (RIG-I) like receptors (Kanarek & Ben-Neriah, 2012,
Brennan & Bowie, 2010). This family of cytokines acts both in an autocrine and
paracrine manner to induce the expression of transcription factors, gamma activated
sequence and IFN stimulated response elements and the consequent induction of
IFN-stimulated genes (ISGs) which function to slow down viral infection (Versteeg
& Garcia-Sastre, 2010, Thompson et al., 2011, Oudshoorn et al., 2012). Antiviral
pathways such as the programmed cell death or apoptosis could also be activated by
the host cells in attempt to control the infection by limiting viral replication (Munday
et al., 2012).
However, what triggers these differences in cellular immune response against
EV71 infection remains unknown. Many viruses have evolved mechanisms to
counteract the host immune response with strategies by host cells to establish
infection (Versteeg & Garcia-Sastre, 2010, Thompson et al., 2011, Oudshoorn et al.,
2012). One of the mediators for such regulation includes genes that encode for
miRNAs. miRNAs are a new paradigm in the regulation of RNA-directed gene
expression that contribute to the repertoire of host-pathogen interactions during viral
infection (Skalsky & Cullen, 2010, Scaria et al., 2006, Nathans et al., 2009, Mack,
2007, Ghosh et al., 2009). Cellular miRNAs could be involved during viral infection
with either positive or negative effects on viral replication kinetics (Berkhout &
Jeang, 2007, Lecellier et al., 2005). Indeed, computational predictions reveal that a
single miRNA may regulate hundreds of genes while one gene may be in turn
regulated by hundreds of miRNAs (Gottwein & Cullen, 2008). However, the role of
195
cellular miRNAs in the defence against viral infection has thus remained elusive.
Given the scope of miRNA-mediated gene regulation in the mammalian system,
cellular miRNAs may directly or indirectly affect virus pathogenesis (Bartel, 2009,
Lindsay, 2008, Xiao & Rajewsky, 2009). Cellular miRNA expression could be
attenuated by viral infection, which can alter the host cellular microenvironment
attributing both to host antiviral defence and to viral factors (Sullivan, 2008,
Berkhout & Jeang, 2007, Boss & Renne, 2011, Boss & Renne, 2010, Skalsky &
Cullen, 2010).
To evaluate the importance of miRNA during EV71 pathogenesis, we
knocked-down DGCR8, an essential cofactor for miRNA biogenesis to create
miRNA-depleted cells (Chapter Four). Surprisingly, EV71 is not able to replicate
efficiently in miRNA-depleted cells. This is in contrast with other reported studies
where the global knockdown of miRNAs has previously been shown to enhance
human immunodeficiency virus (HIV) replication (Chable-Bessia et al., 2009,
Triboulet et al., 2007). This implies that EV71 utilise host miRNAs during infection
and in the absence of miRNAs, EV71 was unable to successfully replicate in the host
cells. Indeed, various miRNAs have been identified to play roles during EV71
pathogenesis (Ho et al., 2011, Wen et al., 2013, Zheng et al., 2013). Recent results
from investigations into the role of miRNA in enterovirus infections by use of
miRNA inhibitors or mimics have shown that enterovirus-induced miRNAs such as
miR-23b, miR-296-5p and miR-141 each play a role in EV71 replication (Ho et al.,
2011, Wen et al., 2013, Zheng et al., 2013).
196
Considering that host miRNAs play such critical roles during EV71
pathogenesis, we undertook miRNA profiling of EV71 infected host cells in our in
vitro model of infection in an attempt to identify any differentially-expressed
miRNAs that may play key roles during EV71 infections. Results showed that 78
miRNAs that were differentially expressed during EV71 infection of our host cells
(p<0.05). Our results revealed miR-548 to be significantly up regulated in EV71
infected cells at 36hpi in comparison with non-infected control cells. Interestingly,
miR-548 has previously been implicated in antiviral responses during viral infections
of susceptible host cells (de Weerd & Nguyen, 2012, Randall & Goodbourn, 2008, Li
et al., 2013, Gottwein & Cullen, 2008, Boss & Renne, 2011).
Consistent with our findings, Li and colleagues recently identified the
involvement of miR-548 in IFN signalling pathways during viral infection (Li et al.,
2013). Briefly, Li and colleagues demonstrated that miR-548 down-regulates host
antiviral response via direct targeting of IFN- λ1 (Li et al., 2013). In contrast to that,
in EV71 infected rhabdomyosarcoma (RD) cells, miR-548 was observed to decrease
in a time-dependent manner (Li et al., 2013). In view that the host innate system is
the first line of defence with IFNs being a key player during viral infection, it is
atypical that miR-548 was up regulated to negatively regulate the host immune
system (Versteeg & Garcia-Sastre, 2010, Thompson et al., 2011, Randall &
Goodbourn, 2008, Rajsbaum & Garcia-Sastre, 2013, Oudshoorn et al., 2012, de
Weerd & Nguyen, 2012, Brennan & Bowie, 2010, Boss & Renne, 2011).
An interesting question that arises is whether EV71 is able to regulate host
cellular miRNA transcription and processing during infection, thereby leading to the
197
down-regulation of deleterious cellular miRNA and/or the up-regulation of
advantageous cellular miRNA to enhance its replication in the host cells.
Specifically, could EV71 up regulate specific miRNAs to alter the host antiviral
response? Striking examples of the interplay between cellular miRNAs and viral
pathogens includes; HIV-1, an enveloped RNA virus of the Retreoviridae family
utilising host cellular miR-28, miR-125b, miR-150, miR-223 and miR-382 to control
viral protein synthesis in order to evade host immune system (Huang et al., 2007).
Epstein-Barr virus (EBV), a DNA virus of the Herpes family, for example induce the
expression of miR-29b, miR-155 and miR-146a to mediate the down regulation of
innate immune response and IFN signalling pathways to enhances its survival
(Cameron et al., 2008, Lo et al., 2007, Xiao & Rajewsky, 2009). Lecellier and
colleagues have shown in primate studies that overexpression of cellular miRNA
miR-32 could induce an antiviral response to inhibit virus replication in foamy virus
type 1 (PFV-1) infections (Lecellier et al., 2005).
Therefore, we asked the question “Could EV71 manipulate specific host
miRNAs in a similar manner to change the host microenvironment for enhanced viral
survival?” To test this question we investigated whether or not the innate response
and signalling pathways were altered in EV71 infected miRNA-depleted HT29 cells.
We analysed the transcriptomes of miRNA-depleted, EV71-infected HT29 cells and
compared the results with transcriptomes taken from control (i.e. non-miRNA-
depleted) EV71-infected HT29 cells. Quantitative analysis of the transcriptome from
miRNA depleted- EV71 –infected cells revealed 52 antiviral genes from various
antiviral signalling pathways, such as Toll-like receptor signalling, Nod-like receptor
signalling, RIG-1-like receptor signalling and type 1 interferon signalling, which
198
were significantly up regulated. The enhanced antiviral response by miRNA-depleted
cells during EV71 infection may result in the inability for EV71 to replicate during
infection. A similar finding was reported by Otsuka and colleagues following
Vesicular stomatitis virus (VSV) infection of host cells (Otsuka et al., 2007). Otsuka
and colleagues observed in a murine model that impaired miRNA production in mice
with Dicer deficiencies resulted in hypersensitivity toward infection by VSV (Otsuka
et al., 2007). However, it was also observed there was no alteration of interferon-
mediated antiviral response by Dicer deficiency (Otsuka et al., 2007). Instead the
change in virus replication was due to host miR-24 and miR-93 targeting VSV viral
protein. As such, in miRNA depleted cells, VSV replication was enhanced in the
absence of miR-24 and miR-93 (Otsuka et al., 2007).
The inherent complexity of EV71 lies in its ability to manipulate host
miRNAs to enhance its microcellular environment thereby allowing it to exert
pathogenic effects on its host. Alteration of host miRNAs to down-regulate host
immune response and specifically the host antiviral signalling pathway may be
unique to EV71. It would be interesting to delineate the specific miRNAs governing
the antiviral pathways vital for the elimination of EV71 (Bartel, 2009, Lindsay, 2008,
Xiao & Rajewsky, 2009). Effectively, intestinal epithelial cells, being the initial sites
of EV71 infection and the immune responses induced in the viral-infected host cells
are proposed (from results of this study) to both play critical roles in the disease
progression and clinical prognosis in human infections with EV71. Interestingly,
impaired or immature host immunity previously has been associated with increased
morbidity and mortality of young children and immune deficient adults following
EV71 infections (Liu et al., 2005).
199
The ability of the host to eliminate viral pathogens such as EV71 at the initial
site of infection is critical in the control of disease progression as a weaker immune
response results in a higher viral titre leading to a systemic spread as well as more
serve complications (Chi et al., 2013). Furthermore, Khong et al (2012) reported that
mice that were adminstered EV71 via the intraperitoneal route exhibited 100%
mortality as compared to mice that were adminstered with EV71 via the oral route
that only showed 10-30% mortality (Khong et al., 2012). The key differences may be
the inability of other cell types to induce a robust antiviral response against EV71.
Interestingly the mortality results of mice adminstered EV71 via the oral route
(gastrointestinal tract) reported by Khong et al (2012) corresponded to the percentage
of EV71 infected human patient with central nervous system complications (Khong
et al., 2012).
Comparative proteomic analyses were performed on EV71-susceptible and
EV71-resistant host cells (Chapter Five). We have demonstrated that cells resistant to
EV71 infection lack a variant of β-actin, compared to EV71-susceptible cells. As
such, EV71 infection may be actin dependent and might involve an actin-binding
protein, annexin 2. During viral infection, the host cellular cytoskeleton network is
subjected to reconfiguration and reorganisation by the viruses in every stage of the
infection to optimise viral replication and virion production (Bockhorn et al., 2013,
Buss et al., 2001, Durrbach et al., 1996, Pellegrino et al., 2013, Ploubidou & Way,
2001, Taylor et al., 2011, Valastyan & Weinberg, 2011). The degree of
cytoskeletonal reorganisation varies between different viral pathogens and the types
of cell they invade (Ploubidou & Way, 2001, Taylor et al., 2011).
200
Consistent with our hypothesis, Hussain and colleagues (2011) also
demonstrated that the cytoskeletal system comprising of both actin and microtubules
play a key role during EV71 infection (Buss et al., 2001, Durrbach et al., 1996,
Flanagan & Lin, 1980, Hussain et al., 2011). Knockdown of genes such as ARPC5,
ARRB1, and WASF1 that were important in actin polymerisation and the use of
actin disrupting drug such as cytochalasin B, have resulted in the decrease in EV71
replication kinetics (Buss et al., 2001, Durrbach et al., 1996, Flanagan & Lin, 1980,
Gerke & Moss, 2002, Hayes et al., 2006, Hussain et al., 2011, Ploubidou & Way,
2001, Soldati & Schliwa, 2006, Yang et al., 2011).
Viral load testing procedures have been used extensively in research
laboratories and are now integrated for use in diverse settings ranging from drug
companies to clinical diagnostics laboratories (Hayden et al., 2013, Hindson et al.,
2013, Sanders et al., 2013, Sedlak & Jerome, 2013, Strain et al., 2013, Kiselinova et
al., 2014). Quantitative values have been used to monitor the efficacy of antiviral
treatments and/or to determine changes in antiviral therapy (Sedlak & Jerome, 2013,
Kiselinova et al., 2014). Despite the advances and the use of a highly established
platforms such as real-time PCR, challenges in viral load testing remain due to the
intrinsic limitation of the method which centres on the issue of precision, accuracy
and standardisation (Hayden et al., 2013, Hindson et al., 2013, Sanders et al., 2013,
Sedlak & Jerome, 2013, Strain et al., 2013, Kiselinova et al., 2014). ddPCR, a direct
measurement of target molecules which relinquishes the need for calibration/standard
curve and obviates the need to develop costly international standards is an attractive
201
tool for viral load testing (Henrich et al., 2012, Sanders et al., 2013, Sedlak &
Jerome, 2013).
The move toward absolute quantitation of viral load is driven by the need to
monitor the efficiency of antiviral therapy without the variability in material and the
availability international standards. In Chapter Six, we demonstrated that the ddPCR
platform was generally comparable, if not better, than real-time PCR for the
detection and absolute quantitation of EV71 viral copy number.
One of the limitation of this study was the use of carcinoma cell lines for in
vitro work on EV71 pathogenesis. Carcinoma cell lines could have acquired various
mutations which might not be the best representative of the in vivo human
gastrointestinal cells. The host-pathogen interaction between the gastrointestinal cells
and EV71 may be better represented using in vivo models such as non-cancerous
cells – human gastrointestinal primary cell lines or even the use of in vivo clinical
samples from severe EV71-infected patients. However, the ease of using cancerous
cell lines for the in vitro study of virus pathogenesis and the challenges in obtaining
clinical samples (gastrointestinal cells) from patients resulted in a mammoth tasks for
the use of an “ideal model” for EV71 pathogenesis. An alternate method would be a
combination of both models where in vivo clinical samples could be used to screen
for the key mRNAs and/or miRNAs. Subsequently, functional assay such as gene
silencing or the use of miRNAs mimics/inhibitors could be performed to validate the
importance of the gene and/or miRNAs during EV71 infection of a human host.
202
7.2 FUTURE DIRECTIONS
Owing to the diverse clinical outcomes following EV71 infection, the ability
to administer specific miRNA mimics or inhibitors to attenuate the host antiviral
response in an attempt to impair EV71 replication during infection of a human host
may be invaluable. One of the enigmatic features of miRNAs is the complexity
where one miRNAs may regulate hundreds of genes while one gene may be in turn
regulated by hundreds of miRNAs. Based on evidences from our study, future
studies should therefore be focused on the identification of key miRNAs which could
be used as therapeutics against EV71 infection. One of the limitation of this study
was the use of carcinoma cell lines for in vitro work on EV71 pathogenesis. The use
of primary cell line (in vitro) or clinical samples from EV71-infected HFMD patients
(in vivo) would be a useful platform for the screening of key miRNAs which may
play a role during EV71 infection of a human host. The challenging identification
and development of miRNAs mimics or inhibitors would play a key role in the
treatment of HFMD patients.
Another promising strategy that could be utilised for EV71 infections is the
attenuation of EV71 to create a live attenuated vaccine for EV71 (Barnes et al., 2008,
McMinn, 2012). The incorporation of miRNA homology sequence could be
engineered into EV71 thus creating an avirulent EV71 strain (Barnes et al., 2008,
McMinn, 2012, Vignuzzi et al., 2008). The resulting engineered EV71 with
203
deleterious miRNAs sequence would render it susceptible, thereby losing its ability
to replicate during EV71 infection. Using polioviruses as an example, Barnes and
colleagues (2008) have demonstrated that the insertion of a homologous sequence of
miRNA to limit viral replication results in a strong protective immunity in mice
without causing disease (Barnes et al., 2008, McMinn, 2012).
EV71 is an existing public health problem with frequent/consistent outbreaks
and the potential to cause severe complications in South East Asia Pacific regions. It
is therefore crucial to understand the complex interplay between the host
environment and the pathogen in order to determine what gives the microbe its
ability to survive within the host. The work in this thesis has provided valuable
knowledge toward the study of host-pathogen interaction during EV71 pathogenesis
and will open the door to use of the knowledge of novel host-defence mechanisms
that exist in mammalian cells as well as to the antiviral mechanisms employed during
EV71 pathogenesis. This could also lead to future investigations for the development
of antiviral therapeutics or EV71 vaccines using miRNA inhibitors against EV71
and/or the creation of a live attenuated vaccine (an avirluent EV71 through the
incorporation of deleterious miRNA homology sequence) respectively.
204
7.3 REFERENCES
Baccam, P., C. Beauchemin, C.A. Macken, F.G. Hayden & A.S. Perelson, (2006)
Kinetics of influenza A virus infection in humans. J Virol 80: 7590-7599.
Barnes, D., M. Kunitomi, M. Vignuzzi, K. Saksela & R. Andino, (2008) Harnessing
endogenous miRNAs to control virus tissue tropism as a strategy for
developing attenuated virus vaccines. Cell Host Microbe 4: 239-248.
Bartel, D.P., (2009) MicroRNAs: target recognition and regulatory functions. Cell
136: 215-233.
Berkhout, B. & K.T. Jeang, (2007) RISCy business: MicroRNAs, pathogenesis, and
viruses. The Journal of biological chemistry 282: 26641-26645.
Bockhorn, J., K. Yee, Y.F. Chang, A. Prat, D. Huo, C. Nwachukwu, R. Dalton, S.
Huang, K.E. Swanson, C.M. Perou, O.I. Olopade, M.F. Clarke, G.L. Greene
& H. Liu, (2013) MicroRNA-30c targets cytoskeleton genes involved in
breast cancer cell invasion. Breast cancer research and treatment 137: 373-
382.
Boss, I.W. & R. Renne, (2010) Viral miRNAs: tools for immune evasion. Current
opinion in microbiology 13: 540-545.
Boss, I.W. & R. Renne, (2011) Viral miRNAs and immune evasion. Biochimica et
biophysica acta 1809: 708-714.
Brennan, K. & A.G. Bowie, (2010) Activation of host pattern recognition receptors
by viruses. Current opinion in microbiology 13: 503-507.
Brown, B.A., M.S. Oberste, J.P. Alexander, Jr., M.L. Kennett & M.A. Pallansch,
(1999) Molecular epidemiology and evolution of enterovirus 71 strains
isolated from 1970 to 1998. J Virol 73: 9969-9975.
205
Buss, F., J.P. Luzio & J. Kendrick-Jones, (2001) Myosin VI, a new force in clathrin
mediated endocytosis. FEBS letters 508: 295-299.
Cameron, J.E., Q. Yin, C. Fewell, M. Lacey, J. McBride, X. Wang, Z. Lin, B.C.
Schaefer & E.K. Flemington, (2008) Epstein-Barr virus latent membrane
protein 1 induces cellular MicroRNA miR-146a, a modulator of lymphocyte
signaling pathways. J Virol 82: 1946-1958.
Chable-Bessia, C., O. Meziane, D. Latreille, R. Triboulet, A. Zamborlini, A.
Wagschal, J.-M. Jacquet, J. Reynes, Y. Levy, A. Saib, Y. Bennasser & M.
Benkirane, (2009) Suppression of HIV-1 replication by microRNA effectors.
Retrovirology 6: 26.
Chang, L.Y., A.R. Ali, S.S. Hassan & S. AbuBakar, (2006) Quantitative estimation
of Nipah virus replication kinetics in vitro. Virology journal 3: 47.
Chang, L.Y., K.C. Tsao, S.H. Hsia, S.R. Shih, C.G. Huang, W.K. Chan, K.H. Hsu,
T.Y. Fang, Y.C. Huang & T.Y. Lin, (2004) Transmission and clinical features
of enterovirus 71 infections in household contacts in Taiwan. JAMA : the
journal of the American Medical Association 291: 222-227.
Chen, C.S., Y.C. Yao, S.C. Lin, Y.P. Lee, Y.F. Wang, J.R. Wang, C.C. Liu, H.Y. Lei
& C.K. Yu, (2007) Retrograde axonal transport: a major transmission route of
enterovirus 71 in mice. J Virol 81: 8996-9003.
Chen, Y.C., C.K. Yu, Y.F. Wang, C.C. Liu, I.J. Su & H.Y. Lei, (2004) A murine oral
enterovirus 71 infection model with central nervous system involvement. J
Gen Virol 85: 69-77.
Chi, C., Q. Sun, S. Wang, Z. Zhang, X. Li, C.J. Cardona, Y. Jin & Z. Xing, (2013)
Robust antiviral responses to enterovirus 71 infection in human intestinal
epithelial cells. Virus research.
206
Chumakov, M., M. Voroshilova, L. Shindarov, I. Lavrova, L. Gracheva, G.
Koroleva, S. Vasilenko, I. Brodvarova, M. Nikolova, S. Gyurova, M.
Gacheva, G. Mitov, N. Ninov, E. Tsylka, I. Robinson, M. Frolova, V.
Bashkirtsev, L. Martiyanova & V. Rodin, (1979) Enterovirus 71 isolated
from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60:
329-340.
D'Onofrio, C., O. Franzese, A. Puglianiello, E. Peci, G. Lanzilli & E. Bonmassar,
(1992) Antiviral activity of individual versus combined treatments with
interferon alpha, beta and gamma on early infection with HTLV-I in vitro.
International journal of immunopharmacology 14: 1069-1079.
D P Schnurr., (1999) Laboratory Diagnosis of Viral Infections, Enteroviruses,
Chapter 8. Marcel Dekker, Inc. , Madison Avenue, New York.
de Weerd, N.A. & T. Nguyen, (2012) The interferons and their receptors--
distribution and regulation. Immunology and cell biology 90: 483-491.
Durrbach, A., D. Louvard & E. Coudrier, (1996) Actin filaments facilitate two steps
of endocytosis. Journal of cell science 109 ( Pt 2): 457-465.
Flanagan, M.D. & S. Lin, (1980) Cytochalasins block actin filament elongation by
binding to high affinity sites associated with F-actin. The Journal of
biological chemistry 255: 835-838.
Fook, L.W. & V.T. Chow, (2010) Transcriptome profiling of host-microbe
interactions by differential display RT-PCR. Methods in molecular biology
(Clifton, N.J.) 630: 33-47.
Fuchizaki, U., S. Kaneko, Y. Nakamoto, Y. Sugiyama, K. Imagawa, M. Kikuchi &
K. Kobayashi, (2003) Synergistic antiviral effect of a combination of mouse
207
interferon-alpha and interferon-gamma on mouse hepatitis virus. J Med Virol
69: 188-194.
Gerke, V. & S.E. Moss, (2002) Annexins: from structure to function. Physiol Rev 82:
331-371.
Ghosh, Z., B. Mallick & J. Chakrabarti, (2009) Cellular versus viral microRNAs in
host-virus interaction. Nucleic Acids Res 37: 1035-1048.
Gottwein, E. & B.R. Cullen, (2008) Viral and cellular microRNAs as determinants of
viral pathogenesis and immunity. Cell Host Microbe 3: 375-387.
Hashimoto, I. & A. Hagiwara, (1983) Comparative studies on the neurovirulence of
temperature-sensitive and temperature-resistant viruses of enterovirus 71 in
monkeys. Acta neuropathologica 60: 266-270.
Hayden, R.T., Z. Gu, J. Ingersoll, D. Abdul-Ali, L. Shi, S. Pounds & A.M. Caliendo,
(2013) Comparison of droplet digital PCR to real-time PCR for quantitative
detection of cytomegalovirus. J Clin Microbiol 51: 540-546.
Hayes, M.J., D. Shao, M. Bailly & S.E. Moss, (2006) Regulation of actin dynamics
by annexin 2. EMBO J 25: 1816-1826.
Henrich, T.J., S. Gallien, J.Z. Li, F. Pereyra & D.R. Kuritzkes, (2012) Low-level
detection and quantitation of cellular HIV-1 DNA and 2-LTR circles using
droplet digital PCR. Journal of virological methods 186: 68-72.
Hindson, C.M., J.R. Chevillet, H.A. Briggs, E.N. Gallichotte, I.K. Ruf, B.J. Hindson,
R.L. Vessella & M. Tewari, (2013) Absolute quantification by droplet digital
PCR versus analog real-time PCR. Nature methods 10: 1003-1005.
Ho, B.C., S.L. Yu, J.J. Chen, S.Y. Chang, B.S. Yan, Q.S. Hong, S. Singh, C.L. Kao,
H.Y. Chen, K.Y. Su, K.C. Li, C.L. Cheng, H.W. Cheng, J.Y. Lee, C.N. Lee
& P.C. Yang, (2011) Enterovirus-induced miR-141 contributes to shutoff of
208
host protein translation by targeting the translation initiation factor eIF4E.
Cell Host Microbe 9: 58-69.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Huang, J., F. Wang, E. Argyris, K. Chen, Z. Liang, H. Tian, W. Huang, K. Squires,
G. Verlinghieri & H. Zhang, (2007) Cellular microRNAs contribute to HIV-1
latency in resting primary CD4+ T lymphocytes. Nat Med 13: 1241-1247.
Hussain, K.M., K.L. Leong, M.M. Ng & J.J. Chu, (2011) The essential role of
clathrin-mediated endocytosis in the infectious entry of human enterovirus
71. The Journal of biological chemistry 286: 309-321.
Kanarek, N. & Y. Ben-Neriah, (2012) Regulation of NF-kappaB by ubiquitination
and degradation of the IkappaBs. Immunological reviews 246: 77-94.
Khong, W.X., D.G. Foo, S.L. Trasti, E.L. Tan & S. Alonso, (2011) Sustained high
levels of interleukin-6 contribute to the pathogenesis of enterovirus 71 in a
neonate mouse model. J Virol 85: 3067-3076.
Khong, W.X., B. Yan, H. Yeo, E.L. Tan, J.J. Lee, J.K. Ng, V.T. Chow & S. Alonso,
(2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibits
neurotropism, causing neurological manifestations in a novel mouse model of
EV71 infection. J Virol 86: 2121-2131.
Kiselinova, M., A.O. Pasternak, W. De Spiegelaere, D. Vogelaers, B. Berkhout & L.
Vandekerckhove, (2014) Comparison of Droplet Digital PCR and Seminested
Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA. PLoS
One 9: e85999.
Larkin, J., L. Jin, M. Farmen, D. Venable, Y. Huang, S.L. Tan & J.I. Glass, (2003)
Synergistic antiviral activity of human interferon combinations in the
209
hepatitis C virus replicon system. Journal of interferon & cytokine research :
the official journal of the International Society for Interferon and Cytokine
Research 23: 247-257.
Lecellier, C.H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A.
Saib & O. Voinnet, (2005) A cellular microRNA mediates antiviral defense
in human cells. Science (New York, N.Y.) 308: 557-560.
Lee, M.S. & L.Y. Chang, (2010) Development of enterovirus 71 vaccines. Expert
Rev Vaccines 9: 149-156.
Lee, M.S., F.C. Tseng, J.R. Wang, C.Y. Chi, P. Chong & I.J. Su, (2012) Challenges
to licensure of enterovirus 71 vaccines. PLoS neglected tropical diseases 6:
e1737.
Lee, T.C., H.R. Guo, H.J. Su, Y.C. Yang, H.L. Chang & K.T. Chen, (2009) Diseases
caused by enterovirus 71 infection. Pediatr Infect Dis J 28: 904-910.
Lei, X., X. Liu, Y. Ma, Z. Sun, Y. Yang, Q. Jin, B. He & J. Wang, (2010) The 3C
protein of enterovirus 71 inhibits retinoid acid-inducible gene I-mediated
interferon regulatory factor 3 activation and type I interferon responses. J
Virol 84: 8051-8061.
Lei, X., Z. Sun, X. Liu, Q. Jin, B. He & J. Wang, (2011) Cleavage of the adaptor
protein TRIF by enterovirus 71 3C inhibits antiviral responses mediated by
Toll-like receptor 3. J Virol 85: 8811-8818.
Lei, X., X. Xiao, Q. Xue, Q. Jin, B. He & J. Wang, (2013) Cleavage of interferon
regulatory factor 7 by enterovirus 71 3C suppresses cellular responses. J
Virol 87: 1690-1698.
210
Leong, W.F. & V.T. Chow, (2006) Transcriptomic and proteomic analyses of
rhabdomyosarcoma cells reveal differential cellular gene expression in
response to enterovirus 71 infection. Cellular microbiology 8: 565-580.
Li, Y., J. Xie, X. Xu, J. Wang, F. Ao, Y. Wan & Y. Zhu, (2013) MicroRNA-548
down-regulates host antiviral response via direct targeting of IFN-lambda1.
Protein & cell 4: 130-141.
Lindsay, M.A., (2008) microRNAs and the immune response. Trends in immunology
29: 343-351.
Liu, C.C., H.W. Tseng, S.M. Wang, J.R. Wang & I.J. Su, (2000) An outbreak of
enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical
manifestations. Journal of clinical virology : the official publication of the
Pan American Society for Clinical Virology 17: 23-30.
Liu, L., H. Zhao, Y. Zhang, J. Wang, Y. Che, C. Dong, X. Zhang, R. Na, H. Shi, L.
Jiang, L. Wang, Z. Xie, P. Cui, X. Xiong, Y. Liao, S. Zhao, J. Gao, D. Tang
& Q. Li, (2011) Neonatal rhesus monkey is a potential animal model for
studying pathogenesis of EV71 infection. Virology 412: 91-100.
Liu, M.L., Y.P. Lee, Y.F. Wang, H.Y. Lei, C.C. Liu, S.M. Wang, I.J. Su, J.R. Wang,
T.M. Yeh, S.H. Chen & C.K. Yu, (2005) Type I interferons protect mice
against enterovirus 71 infection. J Gen Virol 86: 3263-3269.
Lo, A.K., K.F. To, K.W. Lo, R.W. Lung, J.W. Hui, G. Liao & S.D. Hayward, (2007)
Modulation of LMP1 protein expression by EBV-encoded microRNAs.
Proceedings of the National Academy of Sciences of the United States of
America 104: 16164-16169.
211
Lu, J., Y.Q. He, L.N. Yi, H. Zan, H.F. Kung & M.L. He, (2011) Viral kinetics of
enterovirus 71 in human abdomyosarcoma cells. World J Gastroenterol 17:
4135-4142.
Lui, Y., P. Timms, L. Hafner, T. Tan, K. Tan & E. Tan, (2013a) Characterisation of
enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013b) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
Mack, G.S., (2007) MicroRNA gets down to business. Nature biotechnology 25:
631-638.
Major, M.E., H. Dahari, K. Mihalik, M. Puig, C.M. Rice, A.U. Neumann & S.M.
Feinstone, (2004) Hepatitis C virus kinetics and host responses associated
with disease and outcome of infection in chimpanzees. Hepatology
(Baltimore, Md.) 39: 1709-1720.
McMinn, P., I. Stratov, L. Nagarajan & S. Davis, (2001) Neurological manifestations
of enterovirus 71 infection in children during an outbreak of hand, foot, and
mouth disease in Western Australia. Clin Infect Dis 32: 236-242.
McMinn, P.C., (2012) Recent advances in the molecular epidemiology and control of
human enterovirus 71 infection. Current opinion in virology 2: 199-205.
Munday, D.C., R. Surtees, E. Emmott, B.K. Dove, P. Digard, J.N. Barr, A.
Whitehouse, D. Matthews & J.A. Hiscox, (2012) Using SILAC and
quantitative proteomics to investigate the interactions between viral and host
proteomes. Proteomics 12: 666-672.
212
Nagata, N., T. Iwasaki, Y. Ami, Y. Tano, A. Harashima, Y. Suzaki, Y. Sato, H.
Hasegawa, T. Sata, T. Miyamura & H. Shimizu, (2004) Differential
localization of neurons susceptible to enterovirus 71 and poliovirus type 1 in
the central nervous system of cynomolgus monkeys after intravenous
inoculation. J Gen Virol 85: 2981-2989.
Nathans, R., C.Y. Chu, A.K. Serquina, C.C. Lu, H. Cao & T.M. Rana, (2009)
Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol Cell
34: 696-709.
Okuse, C., J.A. Rinaudo, K. Farrar, F. Wells & B.E. Korba, (2005) Enhancement of
antiviral activity against hepatitis C virus in vitro by interferon combination
therapy. Antiviral research 65: 23-34.
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
Ooi, M.H., S.C. Wong, A. Mohan, Y. Podin, D. Perera, D. Clear, S. del Sel, C.H.
Chieng, P.H. Tio, M.J. Cardosa & T. Solomon, (2009) Identification and
validation of clinical predictors for the risk of neurological involvement in
children with hand, foot, and mouth disease in Sarawak. BMC infectious
diseases 9: 3.
Ooi, M.H., S.C. Wong, Y. Podin, W. Akin, S. del Sel, A. Mohan, C.H. Chieng, D.
Perera, D. Clear, D. Wong, E. Blake, J. Cardosa & T. Solomon, (2007)
Human enterovirus 71 disease in Sarawak, Malaysia: a prospective clinical,
virological, and molecular epidemiological study. Clin Infect Dis 44: 646-
656.
213
Osterlund, P., V. Veckman, J. Siren, K.M. Klucher, J. Hiscott, S. Matikainen & I.
Julkunen, (2005) Gene expression and antiviral activity of alpha/beta
interferons and interleukin-29 in virus-infected human myeloid dendritic
cells. J Virol 79: 9608-9617.
Otsuka, M., Q. Jing, P. Georgel, L. New, J. Chen, J. Mols, Y.J. Kang, Z. Jiang, X.
Du, R. Cook, S.C. Das, A.K. Pattnaik, B. Beutler & J. Han, (2007)
Hypersusceptibility to vesicular stomatitis virus infection in Dicer1-deficient
mice is due to impaired miR24 and miR93 expression. Immunity 27: 123-134.
Oudshoorn, D., G.A. Versteeg & M. Kikkert, (2012) Regulation of the innate
immune system by ubiquitin and ubiquitin-like modifiers. Cytokine & growth
factor reviews 23: 273-282.
Pagliaccetti, N.E., R. Eduardo, S.H. Kleinstein, X.J. Mu, P. Bandi & M.D. Robek,
(2008) Interleukin-29 functions cooperatively with interferon to induce
antiviral gene expression and inhibit hepatitis C virus replication. The Journal
of biological chemistry 283: 30079-30089.
Park, H., E. Serti, O. Eke, B. Muchmore, L. Prokunina-Olsson, S. Capone, A. Folgori
& B. Rehermann, (2012) IL-29 is the dominant type III interferon produced
by hepatocytes during acute hepatitis C virus infection. Hepatology
(Baltimore, Md.) 56: 2060-2070.
Patel, K.P. & J.M. Bergelson, (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728-729.
Pellegrino, L., J. Stebbing, V.M. Braga, A.E. Frampton, J. Jacob, L. Buluwela, L.R.
Jiao, M. Periyasamy, C.D. Madsen, M.P. Caley, S. Ottaviani, L. Roca-
Alonso, M. El-Bahrawy, R.C. Coombes, J. Krell & L. Castellano, (2013)
214
miR-23b regulates cytoskeletal remodeling, motility and metastasis by
directly targeting multiple transcripts. Nucleic Acids Res 41: 5400-5412.
Pierce, A.T., J. DeSalvo, T.P. Foster, A. Kosinski, S.K. Weller & W.P. Halford,
(2005) Beta interferon and gamma interferon synergize to block viral DNA
and virion synthesis in herpes simplex virus-infected cells. J Gen Virol 86:
2421-2432.
Ploubidou, A. & M. Way, (2001) Viral transport and the cytoskeleton. Curr Opin
Cell Biol 13: 97-105.
Pourianfar, H.R., C.L. Poh, J. Fecondo & L. Grollo, (2012) In vitro evaluation of the
antiviral activity of heparan sulfate mimetic compounds against Enterovirus
71. Virus research 169: 22-29.
Rajsbaum, R. & A. Garcia-Sastre, (2013) Viral evasion mechanisms of early antiviral
responses involving regulation of ubiquitin pathways. Trends in microbiology
21: 421-429.
Randall, R.E. & S. Goodbourn, (2008) Interferons and viruses: an interplay between
induction, signalling, antiviral responses and virus countermeasures. J Gen
Virol 89: 1-47.
Roberts, A.P. & C.L. Jopling, (2010) Targeting viral infection by microRNA
inhibition. Genome Biol 11: 201.
Sainz, B., Jr. & W.P. Halford, (2002) Alpha/Beta interferon and gamma interferon
synergize to inhibit the replication of herpes simplex virus type 1. J Virol 76:
11541-11550.
Sainz, B., Jr., H.L. LaMarca, R.F. Garry & C.A. Morris, (2005) Synergistic
inhibition of human cytomegalovirus replication by interferon-alpha/beta and
interferon-gamma. Virology journal 2: 14.
215
Sanders, R., D.J. Mason, C.A. Foy & J.F. Huggett, (2013) Evaluation of digital PCR
for absolute RNA quantification. PLoS One 8: e75296.
Sasaki, O., T. Karaki & J. Imanishi, (1986) Protective effect of interferon on
infections with hand, foot, and mouth disease virus in newborn mice. J Infect
Dis 153: 498-502.
Scaria, V., M. Hariharan, S. Maiti, B. Pillai & S.K. Brahmachari, (2006) Host-virus
interaction: a new role for microRNAs. Retrovirology 3: 68.
Schmidt, N.J., E.H. Lennette & H.H. Ho, (1974) An apparently new enterovirus
isolated from patients with disease of the central nervous system. J Infect Dis
129: 304-309.
Sedlak, R.H. & K.R. Jerome, (2013) Viral diagnostics in the era of digital
polymerase chain reaction. Diagn Microbiol Infect Dis 75: 1-4.
Skalsky, R.L. & B.R. Cullen, (2010) Viruses, microRNAs, and host interactions.
Annual review of microbiology 64: 123-141.
Soldati, T. & M. Schliwa, (2006) Powering membrane traffic in endocytosis and
recycling. Nature reviews. Molecular cell biology 7: 897-908.
Strain, M.C., S.M. Lada, T. Luong, S.E. Rought, S. Gianella, V.H. Terry, C.A. Spina,
C.H. Woelk & D.D. Richman, (2013) Highly precise measurement of HIV
DNA by droplet digital PCR. PLoS One 8: e55943.
Sullivan, C.S., (2008) New roles for large and small viral RNAs in evading host
defences. Nature reviews. Genetics 9: 503-507.
Tan, C.W., C.L. Poh, I.C. Sam & Y.F. Chan, (2013) Enterovirus 71 uses cell surface
heparan sulfate glycosaminoglycan as an attachment receptor. J Virol 87:
611-620.
216
Tan, E.L., T.M. Tan, V.T. Chow & C.L. Poh, (2007a) Enhanced potency and
efficacy of 29-mer shRNAs in inhibition of Enterovirus 71. Antiviral
research 74: 9-15.
Tan, E.L., T.M. Tan, V. Tak Kwong Chow & C.L. Poh, (2007b) Inhibition of
enterovirus 71 in virus-infected mice by RNA interference. Molecular
therapy : the journal of the American Society of Gene Therapy 15: 1931-
1938.
Tan, E.L., A.P. Wong & C.L. Poh, (2010) Development of potential antiviral strategy
against coxsackievirus B4. Virus research 150: 85-92.
Taylor, M.P., O.O. Koyuncu & L.W. Enquist, (2011) Subversion of the actin
cytoskeleton during viral infection. Nature reviews. Microbiology 9: 427-439.
Thompson, M.R., J.J. Kaminski, E.A. Kurt-Jones & K.A. Fitzgerald, (2011) Pattern
recognition receptors and the innate immune response to viral infection.
Viruses 3: 920-940.
Triboulet, R., B. Mari, Y. Lin, C. Chable-Bessia, Y. Bennasser, K. Lebrigand, B.
Cardinaud, T. Maurin, P. Barbry, V. Baillat, J. Reynes, P. Corbeau, K. Jeang
& M. Benkirane, (2007) Suppression of microRNA-silencing pathway by
HIV-1 during virus replication. Science (New York, N.Y.) 315: 1579 - 1582.
Valastyan, S. & R.A. Weinberg, (2011) Roles for microRNAs in the regulation of
cell adhesion molecules. Journal of cell science 124: 999-1006.
Versteeg, G.A. & A. Garcia-Sastre, (2010) Viral tricks to grid-lock the type I
interferon system. Current opinion in microbiology 13: 508-516.
Vignuzzi, M., E. Wendt & R. Andino, (2008) Engineering attenuated virus vaccines
by controlling replication fidelity. Nat Med 14: 154-161.
217
Wen, B.P., H.J. Dai, Y.H. Yang, Y. Zhuang & R. Sheng, (2013) MicroRNA-23b
Inhibits Enterovirus 71 Replication through Downregulation of EV71 VPl
Protein. Intervirology 56: 195-200.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
Wu, K.X., M.M. Ng & J.J. Chu, (2010) Developments towards antiviral therapies
against enterovirus 71. Drug discovery today 15: 1041-1051.
Xiao, C. & K. Rajewsky, (2009) MicroRNA control in the immune system: basic
principles. Cell 136: 26-36.
Xu, L.J., T. Jiang, F.J. Zhang, J.F. Han, J. Liu, H. Zhao, X.F. Li, R.J. Liu, Y.Q.
Deng, X.Y. Wu, S.Y. Zhu, E.D. Qin & C.F. Qin, (2013) Global
transcriptomic analysis of human neuroblastoma cells in response to
enterovirus type 71 infection. PLoS One 8: e65948.
Yamayoshi, S., K. Fujii & S. Koike, (2012) Scavenger receptor b2 as a receptor for
hand, foot, and mouth disease and severe neurological diseases. Frontiers in
microbiology 3: 32.
Yamayoshi, S., Y. Yamashita, J. Li, N. Hanagata, T. Minowa, T. Takemura & S.
Koike, (2009) Scavenger receptor B2 is a cellular receptor for enterovirus 71.
Nat Med 15: 798-801.
Yang, S.L., Y.T. Chou, C.N. Wu & M.S. Ho, (2011) Annexin II binds to capsid
protein VP1 of enterovirus 71 and enhances viral infectivity. J Virol 85:
11809-11820.
Zhang, Y., W. Cui, L. Liu, J. Wang, H. Zhao, Y. Liao, R. Na, C. Dong, L. Wang, Z.
Xie, J. Gao, P. Cui, X. Zhang & Q. Li, (2011) Pathogenesis study of
218
enterovirus 71 infection in rhesus monkeys. Laboratory investigation; a
journal of technical methods and pathology 91: 1337-1350.
Zheng, Z., X. Ke, M. Wang, S. He, Q. Li, C. Zheng, Z. Zhang, Y. Liu & H. Wang,
(2013) Human microRNA hsa-miR-296-5p suppresses Enterovirus 71
replication by targeting the viral genome. J Virol.
219
Bibliography
220
Bibliography
Ang, L.W., B.K. Koh, K.P. Chan, L.T. Chua, L. James & K.T. Goh, (2009)
Epidemiology and control of hand, foot and mouth disease in Singapore,
2001-2007. Annals of the Academy of Medicine, Singapore 38: 106-112.
Arita, M., Y. Ami, T. Wakita & H. Shimizu, (2008a) Cooperative effect of the
attenuation determinants derived from poliovirus sabin 1 strain is essential for
attenuation of enterovirus 71 in the NOD/SCID mouse infection model. J
Virol 82: 1787-1797.
Arita, M., N. Nagata, N. Iwata, Y. Ami, Y. Suzaki, K. Mizuta, T. Iwasaki, T. Sata, T.
Wakita & H. Shimizu, (2007) An attenuated strain of enterovirus 71
belonging to genotype a showed a broad spectrum of antigenicity with
attenuated neurovirulence in cynomolgus monkeys. J Virol 81: 9386-9395.
Arita, M., T. Wakita & H. Shimizu, (2008b) Characterization of pharmacologically
active compounds that inhibit poliovirus and enterovirus 71 infectivity. J Gen
Virol 89: 2518-2530.
Aylward, R.B. & D.L. Heymann, (2005) Can We Capitalize on the Virtues of
Vaccines? Insights from the Polio Eradication Initiative. American Journal of
Public Health 95: 773-777.
Baccam, P., C. Beauchemin, C.A. Macken, F.G. Hayden & A.S. Perelson, (2006)
Kinetics of influenza A virus infection in humans. J Virol 80: 7590-7599.
Barnes, D., M. Kunitomi, M. Vignuzzi, K. Saksela & R. Andino, (2008) Harnessing
endogenous miRNAs to control virus tissue tropism as a strategy for
developing attenuated virus vaccines. Cell Host Microbe 4: 239-248.
221
Bartel, D.P., (2009) MicroRNAs: target recognition and regulatory functions. Cell
136: 215-233.
Bedard, K.M. & B.L. Semler, (2004) Regulation of picornavirus gene expression.
Microbes and infection / Institut Pasteur 6: 702-713.
Bek, E.J., K.M. Hussain, P. Phuektes, C.C. Kok, Q. Gao, F. Cai, Z. Gao & P.C.
McMinn, (2011) Formalin-inactivated vaccine provokes cross-protective
immunity in a mouse model of human enterovirus 71 infection. Vaccine 29:
4829-4838.
Berkhout, B. & K.T. Jeang, (2007) RISCy business: MicroRNAs, pathogenesis, and
viruses. The Journal of biological chemistry 282: 26641-26645.
Bockhorn, J., K. Yee, Y.F. Chang, A. Prat, D. Huo, C. Nwachukwu, R. Dalton, S.
Huang, K.E. Swanson, C.M. Perou, O.I. Olopade, M.F. Clarke, G.L. Greene
& H. Liu, (2013) MicroRNA-30c targets cytoskeleton genes involved in
breast cancer cell invasion. Breast cancer research and treatment 137: 373-
382.
Boss, I.W. & R. Renne, (2010) Viral miRNAs: tools for immune evasion. Current
opinion in microbiology 13: 540-545.
Boss, I.W. & R. Renne, (2011) Viral miRNAs and immune evasion. Biochimica et
biophysica acta 1809: 708-714.
Brennan, K. & A.G. Bowie, (2010) Activation of host pattern recognition receptors
by viruses. Current opinion in microbiology 13: 503-507.
Brown, B.A., M.S. Oberste, J.P. Alexander, Jr., M.L. Kennett & M.A. Pallansch,
(1999) Molecular epidemiology and evolution of enterovirus 71 strains
isolated from 1970 to 1998. J Virol 73: 9969-9975.
222
Buck, A.H., J. Perot, M.A. Chisholm, D.S. Kumar, L. Tuddenham, V. Cognat, L.
Marcinowski, L. Dolken & S. Pfeffer, (2010) Post-transcriptional regulation
of miR-27 in murine cytomegalovirus infection. RNA 16: 307-315.
Buss, F., J.P. Luzio & J. Kendrick-Jones, (2001) Myosin VI, a new force in clathrin
mediated endocytosis. FEBS letters 508: 295-299.
Caggana, M., P. Chan & A. Ramsingh, (1993) Identification of a single amino acid
residue in the capsid protein VP1 of coxsackievirus B4 that determines the
virulent phenotype. J Virol 67: 4797-4803.
Cameron, J.E., Q. Yin, C. Fewell, M. Lacey, J. McBride, X. Wang, Z. Lin, B.C.
Schaefer & E.K. Flemington, (2008) Epstein-Barr virus latent membrane
protein 1 induces cellular MicroRNA miR-146a, a modulator of lymphocyte
signaling pathways. J Virol 82: 1946-1958.
Cardosa, M.J., D. Perera, B.A. Brown, D. Cheon, H.M. Chan, K.P. Chan, H. Cho &
P. McMinn, (2003) Molecular epidemiology of human enterovirus 71 strains
and recent outbreaks in the Asia-Pacific region: comparative analysis of the
VP1 and VP4 genes. Emerg Infect Dis 9: 461-468.
Chable-Bessia, C., O. Meziane, D. Latreille, R. Triboulet, A. Zamborlini, A.
Wagschal, J.-M. Jacquet, J. Reynes, Y. Levy, A. Saib, Y. Bennasser & M.
Benkirane, (2009) Suppression of HIV-1 replication by microRNA effectors.
Retrovirology 6: 26.
Chan, Y.F. & S. Abu Bakar, (2005) Virucidal activity of Virkon S on human
enterovirus. The Medical journal of Malaysia 60: 246-248.
Chang, L.Y., A.R. Ali, S.S. Hassan & S. AbuBakar, (2006) Quantitative estimation
of Nipah virus replication kinetics in vitro. Virology journal 3: 47.
223
Chang, L.Y., K.C. Tsao, S.H. Hsia, S.R. Shih, C.G. Huang, W.K. Chan, K.H. Hsu,
T.Y. Fang, Y.C. Huang & T.Y. Lin, (2004) Transmission and clinical features
of enterovirus 71 infections in household contacts in Taiwan. JAMA : the
journal of the American Medical Association 291: 222-227.
Chen, C.S., Y.C. Yao, S.C. Lin, Y.P. Lee, Y.F. Wang, J.R. Wang, C.C. Liu, H.Y. Lei
& C.K. Yu, (2007) Retrograde axonal transport: a major transmission route of
enterovirus 71 in mice. J Virol 81: 8996-9003.
Chen, T.C., K.F. Weng, S.C. Chang, J.Y. Lin, P.N. Huang & S.R. Shih, (2008)
Development of antiviral agents for enteroviruses. J Antimicrob Chemother
62: 1169-1173.
Chen, Y.C., C.K. Yu, Y.F. Wang, C.C. Liu, I.J. Su & H.Y. Lei, (2004) A murine oral
enterovirus 71 infection model with central nervous system involvement. J
Gen Virol 85: 69-77.
Chi, C., Q. Sun, S. Wang, Z. Zhang, X. Li, C.J. Cardona, Y. Jin & Z. Xing, (2013)
Robust antiviral responses to enterovirus 71 infection in human intestinal
epithelial cells. Virus research.
Chong, C.Y., K.P. Chan, V.A. Shah, W.Y. Ng, G. Lau, T.E. Teo, S.H. Lai & A.E.
Ling, (2003) Hand, foot and mouth disease in Singapore: a comparison of
fatal and non-fatal cases. Acta paediatrica (Oslo, Norway : 1992) 92: 1163-
1169.
Chu, P.Y., K.H. Lin, K.P. Hwang, L.C. Chou, C.F. Wang, S.R. Shih, J.R. Wang, Y.
Shimada & H. Ishiko, (2001) Molecular epidemiology of enterovirus 71 in
Taiwan. Arch Virol 146: 589-600.
Chumakov, M., M. Voroshilova, L. Shindarov, I. Lavrova, L. Gracheva, G.
Koroleva, S. Vasilenko, I. Brodvarova, M. Nikolova, S. Gyurova, M.
224
Gacheva, G. Mitov, N. Ninov, E. Tsylka, I. Robinson, M. Frolova, V.
Bashkirtsev, L. Martiyanova & V. Rodin, (1979) Enterovirus 71 isolated
from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 60:
329-340.
D'Onofrio, C., O. Franzese, A. Puglianiello, E. Peci, G. Lanzilli & E. Bonmassar,
(1992) Antiviral activity of individual versus combined treatments with
interferon alpha, beta and gamma on early infection with HTLV-I in vitro.
International journal of immunopharmacology 14: 1069-1079.
D P Schnurr., (1999) Laboratory Diagnosis of Viral Infections, Enteroviruses,
Chapter 8. Marcel Dekker, Inc. , Madison Avenue, New York.
De Jesus, N.H., (2007) Epidemics to eradication: the modern history of
poliomyelitis. Virology journal 4: 70.
de Weerd, N.A. & T. Nguyen, (2012) The interferons and their receptors--
distribution and regulation. Immunology and cell biology 90: 483-491.
Deng, J.X., X.J. Nie, Y.F. Lei, C.F. Ma, D.L. Xu, B. Li, Z.K. Xu & G.C. Zhang,
(2012) The highly conserved 5' untranslated region as an effective target
towards the inhibition of Enterovirus 71 replication by unmodified and
appropriate 2'-modified siRNAs. J Biomed Sci 19: 73.
Deshpande, J., S.S. Nadkarni & P.P. Francis, (2003) Enterovirus 71 isolated from a
case of acute flaccid paralysis in India represents a new genotype. Current
Science 84: 1350-1353.
Durrbach, A., D. Louvard & E. Coudrier, (1996) Actin filaments facilitate two steps
of endocytosis. Journal of cell science 109 ( Pt 2): 457-465.
Ehrenfeld, E., J. Modlin & K. Chumakov, (2009) Future of polio vaccines. Expert
Rev Vaccines 8: 899-905.
225
Flanagan, M.D. & S. Lin, (1980) Cytochalasins block actin filament elongation by
binding to high affinity sites associated with F-actin. The Journal of
biological chemistry 255: 835-838.
Fook, L.W. & V.T. Chow, (2010) Transcriptome profiling of host-microbe
interactions by differential display RT-PCR. Methods in molecular biology
(Clifton, N.J.) 630: 33-47.
Fuchizaki, U., S. Kaneko, Y. Nakamoto, Y. Sugiyama, K. Imagawa, M. Kikuchi &
K. Kobayashi, (2003) Synergistic antiviral effect of a combination of mouse
interferon-alpha and interferon-gamma on mouse hepatitis virus. J Med Virol
69: 188-194.
Gerke, V. & S.E. Moss, (2002) Annexins: from structure to function. Physiol Rev 82:
331-371.
Ghosh, Z., B. Mallick & J. Chakrabarti, (2009) Cellular versus viral microRNAs in
host-virus interaction. Nucleic Acids Res 37: 1035-1048.
Gottwein, E. & B.R. Cullen, (2008) Viral and cellular microRNAs as determinants of
viral pathogenesis and immunity. Cell Host Microbe 3: 375-387.
Grassly, N.C., (2013) The final stages of the global eradication of poliomyelitis.
Philosophical Transactions of the Royal Society B: Biological Sciences 368.
Halstead, S.B., (2012) Dengue vaccine development: a 75% solution? Lancet 380:
1535-1536.
Hampton, L., (2009) Albert Sabin and the Coalition to Eliminate Polio From the
Americas. American Journal of Public Health 99: 34-44.
Han, Y., M. Wind-Rotolo, H.C. Yang, J.D. Siliciano & R.F. Siliciano, (2007)
Experimental approaches to the study of HIV-1 latency. Nature reviews.
Microbiology 5: 95-106.
226
Hashimoto, I. & A. Hagiwara, (1983) Comparative studies on the neurovirulence of
temperature-sensitive and temperature-resistant viruses of enterovirus 71 in
monkeys. Acta neuropathologica 60: 266-270.
Hayden, R.T., Z. Gu, J. Ingersoll, D. Abdul-Ali, L. Shi, S. Pounds & A.M. Caliendo,
(2013) Comparison of droplet digital PCR to real-time PCR for quantitative
detection of cytomegalovirus. J Clin Microbiol 51: 540-546.
Hayes, M.J., D. Shao, M. Bailly & S.E. Moss, (2006) Regulation of actin dynamics
by annexin 2. EMBO J 25: 1816-1826.
Henrich, T.J., S. Gallien, J.Z. Li, F. Pereyra & D.R. Kuritzkes, (2012) Low-level
detection and quantitation of cellular HIV-1 DNA and 2-LTR circles using
droplet digital PCR. Journal of virological methods 186: 68-72.
Hindson, C.M., J.R. Chevillet, H.A. Briggs, E.N. Gallichotte, I.K. Ruf, B.J. Hindson,
R.L. Vessella & M. Tewari, (2013) Absolute quantification by droplet digital
PCR versus analog real-time PCR. Nature methods 10: 1003-1005.
Ho, B.C., I.S. Yu, L.F. Lu, A. Rudensky, H.Y. Chen, C.W. Tsai, Y.L. Chang, C.T.
Wu, L.Y. Chang, S.R. Shih, S.W. Lin, C.N. Lee, P.C. Yang & S.L. Yu,
(2014) Inhibition of miR-146a prevents enterovirus-induced death by
restoring the production of type I interferon. Nature communications 5: 3344.
Ho, B.C., S.L. Yu, J.J. Chen, S.Y. Chang, B.S. Yan, Q.S. Hong, S. Singh, C.L. Kao,
H.Y. Chen, K.Y. Su, K.C. Li, C.L. Cheng, H.W. Cheng, J.Y. Lee, C.N. Lee
& P.C. Yang, (2011) Enterovirus-induced miR-141 contributes to shutoff of
host protein translation by targeting the translation initiation factor eIF4E.
Cell Host Microbe 9: 58-69.
227
Ho, M., E.R. Chen, K.H. Hsu, S.J. Twu, K.T. Chen, S.F. Tsai, J.R. Wang & S.R.
Shih, (1999) An epidemic of enterovirus 71 infection in Taiwan. Taiwan
Enterovirus Epidemic Working Group. N Engl J Med 341: 929-935.
Huang, C.C., C.C. Liu, Y.C. Chang, C.Y. Chen, S.T. Wang & T.F. Yeh, (1999)
Neurologic complications in children with enterovirus 71 infection. N Engl J
Med 341: 936-942.
Huang, H.I., K.F. Weng & S.R. Shih, (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467-479.
Huang, J., F. Wang, E. Argyris, K. Chen, Z. Liang, H. Tian, W. Huang, K. Squires,
G. Verlinghieri & H. Zhang, (2007) Cellular microRNAs contribute to HIV-1
latency in resting primary CD4+ T lymphocytes. Nat Med 13: 1241-1247.
Hussain, K.M., K.L. Leong, M.M. Ng & J.J. Chu, (2011) The essential role of
clathrin-mediated endocytosis in the infectious entry of human enterovirus
71. The Journal of biological chemistry 286: 309-321.
Jopling, C.L., K.L. Norman & P. Sarnow, (2006) Positive and negative modulation
of viral and cellular mRNAs by liver-specific microRNA miR-122. Cold
Spring Harbor symposia on quantitative biology 71: 369-376.
Jopling, C.L., S. Schutz & P. Sarnow, (2008) Position-dependent function for a
tandem microRNA miR-122-binding site located in the hepatitis C virus
RNA genome. Cell Host Microbe 4: 77-85.
Jopling, C.L., M. Yi, A.M. Lancaster, S.M. Lemon & P. Sarnow, (2005) Modulation
of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science
(New York, N.Y.) 309: 1577-1581.
Kanarek, N. & Y. Ben-Neriah, (2012) Regulation of NF-kappaB by ubiquitination
and degradation of the IkappaBs. Immunological reviews 246: 77-94.
228
Khong, W.X., D.G. Foo, S.L. Trasti, E.L. Tan & S. Alonso, (2011) Sustained high
levels of interleukin-6 contribute to the pathogenesis of enterovirus 71 in a
neonate mouse model. J Virol 85: 3067-3076.
Khong, W.X., B. Yan, H. Yeo, E.L. Tan, J.J. Lee, J.K. Ng, V.T. Chow & S. Alonso,
(2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibits
neurotropism, causing neurological manifestations in a novel mouse model of
EV71 infection. J Virol 86: 2121-2131.
Kim, V.N., (2005) MicroRNA biogenesis: coordinated cropping and dicing. Nature
reviews. Molecular cell biology 6: 376-385.
Kiselinova, M., A.O. Pasternak, W. De Spiegelaere, D. Vogelaers, B. Berkhout & L.
Vandekerckhove, (2014) Comparison of Droplet Digital PCR and Seminested
Real-Time PCR for Quantification of Cell-Associated HIV-1 RNA. PLoS
One 9: e85999.
Kuo, R.L., S.H. Kung, Y.Y. Hsu & W.T. Liu, (2002) Infection with enterovirus 71 or
expression of its 2A protease induces apoptotic cell death. J Gen Virol 83:
1367-1376.
Lanford, R.E., E.S. Hildebrandt-Eriksen, A. Petri, R. Persson, M. Lindow, M.E.
Munk, S. Kauppinen & H. Orum, (2010) Therapeutic silencing of
microRNA-122 in primates with chronic hepatitis C virus infection. Science
(New York, N.Y.) 327: 198-201.
Larkin, J., L. Jin, M. Farmen, D. Venable, Y. Huang, S.L. Tan & J.I. Glass, (2003)
Synergistic antiviral activity of human interferon combinations in the
hepatitis C virus replicon system. Journal of interferon & cytokine research :
the official journal of the International Society for Interferon and Cytokine
Research 23: 247-257.
229
Lau, N.C., L.P. Lim, E.G. Weinstein & D.P. Bartel, (2001) An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science
(New York, N.Y.) 294: 858-862.
Lecellier, C.H., P. Dunoyer, K. Arar, J. Lehmann-Che, S. Eyquem, C. Himber, A.
Saib & O. Voinnet, (2005) A cellular microRNA mediates antiviral defense
in human cells. Science (New York, N.Y.) 308: 557-560.
Lee, J.J., J.B. Seah, V.T. Chow, C.L. Poh & E.L. Tan, (2011) Comparative proteome
analyses of host protein expression in response to Enterovirus 71 and
Coxsackievirus A16 infections. J Proteomics 74: 2018-2024.
Lee, M.S. & L.Y. Chang, (2010) Development of enterovirus 71 vaccines. Expert
Rev Vaccines 9: 149-156.
Lee, M.S., F.C. Tseng, J.R. Wang, C.Y. Chi, P. Chong & I.J. Su, (2012) Challenges
to licensure of enterovirus 71 vaccines. PLoS neglected tropical diseases 6:
e1737.
Lee, R.C., R.L. Feinbaum & V. Ambros, (1993) The C. elegans heterochronic gene
lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:
843-854.
Lee, T.C., H.R. Guo, H.J. Su, Y.C. Yang, H.L. Chang & K.T. Chen, (2009) Diseases
caused by enterovirus 71 infection. Pediatr Infect Dis J 28: 904-910.
Lei, X., X. Liu, Y. Ma, Z. Sun, Y. Yang, Q. Jin, B. He & J. Wang, (2010) The 3C
protein of enterovirus 71 inhibits retinoid acid-inducible gene I-mediated
interferon regulatory factor 3 activation and type I interferon responses. J
Virol 84: 8051-8061.
230
Lei, X., Z. Sun, X. Liu, Q. Jin, B. He & J. Wang, (2011) Cleavage of the adaptor
protein TRIF by enterovirus 71 3C inhibits antiviral responses mediated by
Toll-like receptor 3. J Virol 85: 8811-8818.
Lei, X., X. Xiao, Q. Xue, Q. Jin, B. He & J. Wang, (2013) Cleavage of interferon
regulatory factor 7 by enterovirus 71 3C suppresses cellular responses. J
Virol 87: 1690-1698.
Leong, W.F. & V.T. Chow, (2006) Transcriptomic and proteomic analyses of
rhabdomyosarcoma cells reveal differential cellular gene expression in
response to enterovirus 71 infection. Cellular microbiology 8: 565-580.
Li, C., H. Wang, S.R. Shih, T.C. Chen & M.L. Li, (2007) The efficacy of viral capsid
inhibitors in human enterovirus infection and associated diseases. Curr Med
Chem 14: 847-856.
Li, M.L., T.A. Hsu, T.C. Chen, S.C. Chang, J.C. Lee, C.C. Chen, V. Stollar & S.R.
Shih, (2002) The 3C protease activity of enterovirus 71 induces human neural
cell apoptosis. Virology 293: 386-395.
Li, Y., J. Xie, X. Xu, J. Wang, F. Ao, Y. Wan & Y. Zhu, (2013) MicroRNA-548
down-regulates host antiviral response via direct targeting of IFN-lambda1.
Protein & cell 4: 130-141.
Li, Y., R. Zhu, Y. Qian, J. Deng, Y. Sun, L. Liu, F. Wang & L. Zhao, (2011)
Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide
sequences and antigenicity of recombinant proteins of VP1s and VP4s. BMC
Microbiol 11: 246.
Li, Z.H., C.M. Li, P. Ling, F.H. Shen, S.H. Chen, C.C. Liu, C.K. Yu & S.H. Chen,
(2008) Ribavirin reduces mortality in enterovirus 71-infected mice by
decreasing viral replication. J Infect Dis 197: 854-857.
231
Lin, J.Y., T.C. Chen, K.F. Weng, S.C. Chang, L.L. Chen & S.R. Shih, (2009a) Viral
and host proteins involved in picornavirus life cycle. J Biomed Sci 16: 103.
Lin, J.Y., M.L. Li & S.R. Shih, (2009b) Far upstream element binding protein 2
interacts with enterovirus 71 internal ribosomal entry site and negatively
regulates viral translation. Nucleic Acids Res 37: 47-59.
Lin, T.Y., L.Y. Chang, S.H. Hsia, Y.C. Huang, C.H. Chiu, C. Hsueh, S.R. Shih, C.C.
Liu & M.H. Wu, (2002) The 1998 enterovirus 71 outbreak in Taiwan:
pathogenesis and management. Clin Infect Dis 34 Suppl 2: S52-57.
Lindsay, M.A., (2008) microRNAs and the immune response. Trends in immunology
29: 343-351.
Liu, C.C., H.W. Tseng, S.M. Wang, J.R. Wang & I.J. Su, (2000) An outbreak of
enterovirus 71 infection in Taiwan, 1998: epidemiologic and clinical
manifestations. Journal of clinical virology : the official publication of the
Pan American Society for Clinical Virology 17: 23-30.
Liu, L., H. Zhao, Y. Zhang, J. Wang, Y. Che, C. Dong, X. Zhang, R. Na, H. Shi, L.
Jiang, L. Wang, Z. Xie, P. Cui, X. Xiong, Y. Liao, S. Zhao, J. Gao, D. Tang
& Q. Li, (2011) Neonatal rhesus monkey is a potential animal model for
studying pathogenesis of EV71 infection. Virology 412: 91-100.
Liu, M.L., Y.P. Lee, Y.F. Wang, H.Y. Lei, C.C. Liu, S.M. Wang, I.J. Su, J.R. Wang,
T.M. Yeh, S.H. Chen & C.K. Yu, (2005) Type I interferons protect mice
against enterovirus 71 infection. J Gen Virol 86: 3263-3269.
Livak, K.J. & T.D. Schmittgen, (2001) Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25: 402-408.
232
Lo, A.K., K.F. To, K.W. Lo, R.W. Lung, J.W. Hui, G. Liao & S.D. Hayward, (2007)
Modulation of LMP1 protein expression by EBV-encoded microRNAs.
Proceedings of the National Academy of Sciences of the United States of
America 104: 16164-16169.
Lu, C.Y., C.Y. Lee, C.L. Kao, W.Y. Shao, P.I. Lee, S.J. Twu, C.C. Yeh, S.C. Lin,
W.Y. Shih, S.I. Wu & L.M. Huang, (2002) Incidence and case-fatality rates
resulting from the 1998 enterovirus 71 outbreak in Taiwan. J Med Virol 67:
217-223.
Lu, H.K., T.Y. Lin, S.H. Hsia, C.H. Chiu, Y.C. Huang, K.C. Tsao & L.Y. Chang,
(2004a) Prognostic implications of myoclonic jerk in children with
enterovirus infection. Journal of microbiology, immunology, and infection =
Wei mian yu gan ran za zhi 37: 82-87.
Lu, J., Y.Q. He, L.N. Yi, H. Zan, H.F. Kung & M.L. He, (2011) Viral kinetics of
enterovirus 71 in human abdomyosarcoma cells. World J Gastroenterol 17:
4135-4142.
Lu, W.W., Y.Y. Hsu, J.Y. Yang & S.H. Kung, (2004b) Selective inhibition of
enterovirus 71 replication by short hairpin RNAs. Biochem Biophys Res
Commun 325: 494-499.
Lui, Y., P. Timms, L. Hafner, T. Tan, K. Tan & E. Tan, (2013a) Characterisation of
enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
Lui, Y.L., T.L. Tan, P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan, (2014a)
Elucidating the host-pathogen interaction between human colorectal cells and
invading Enterovirus 71 using transcriptomics profiling. FEBS Open Bio 4:
426-431.
233
Lui, Y.L.E., Z. Lin, J.J. Lee, V.T.K. Chow, C.L. Poh & E.L. Tan, (2013b) Beta-actin
variant is necessary for Enterovirus 71 replication. Biochemical and
Biophysical Research Communications 433: 607-610.
Lui, Y.L.E., T.L. Tan, W.H. Woo, P. Timms, L.M. Hafner, K.H. Tan & E.L. Tan,
(2014b) Enterovirus71 (EV71) Utilise Host microRNAs to Mediate Host
Immune System Enhancing Survival during Infection. PLoS ONE 9:
e102997.
Mack, G.S., (2007) MicroRNA gets down to business. Nature biotechnology 25:
631-638.
Mackay, I.M., K.E. Arden & A. Nitsche, (2002) Real-time PCR in virology. Nucleic
Acids Res 30: 1292-1305.
Major, M.E., H. Dahari, K. Mihalik, M. Puig, C.M. Rice, A.U. Neumann & S.M.
Feinstone, (2004) Hepatitis C virus kinetics and host responses associated
with disease and outcome of infection in chimpanzees. Hepatology
(Baltimore, Md.) 39: 1709-1720.
Martinez, I., A.S. Gardiner, K.F. Board, F.A. Monzon, R.P. Edwards & S.A. Khan,
(2008) Human papillomavirus type 16 reduces the expression of microRNA-
218 in cervical carcinoma cells. Oncogene 27: 2575-2582.
McDermott, G.P., D. Do, C.M. Litterst, D. Maar, C.M. Hindson, E.R. Steenblock,
T.C. Legler, Y. Jouvenot, S.H. Marrs, A. Bemis, P. Shah, J. Wong, S. Wang,
D. Sally, L. Javier, T. Dinio, C. Han, T.P. Brackbill, S.P. Hodges, Y. Ling, N.
Klitgord, G.J. Carman, J.R. Berman, R.T. Koehler, A.L. Hiddessen, P. Walse,
L. Bousse, S. Tzonev, E. Hefner, B.J. Hindson, T.H. Cauly, 3rd, K. Hamby,
V.P. Patel, J.F. Regan, P.W. Wyatt, G.A. Karlin-Neumann, D.P. Stumbo &
234
A.J. Lowe, (2013) Multiplexed target detection using DNA-binding dye
chemistry in droplet digital PCR. Analytical chemistry 85: 11619-11627.
McMinn, P., I. Stratov, L. Nagarajan & S. Davis, (2001) Neurological manifestations
of enterovirus 71 infection in children during an outbreak of hand, foot, and
mouth disease in Western Australia. Clin Infect Dis 32: 236-242.
McMinn, P.C., (2002) An overview of the evolution of enterovirus 71 and its clinical
and public health significance. FEMS microbiology reviews 26: 91-107.
McMinn, P.C., (2012) Recent advances in the molecular epidemiology and control of
human enterovirus 71 infection. Current opinion in virology 2: 199-205.
Muir, P. & A.M. van Loon, (1997) Enterovirus infections of the central nervous
system. Intervirology 40: 153-166.
Munday, D.C., R. Surtees, E. Emmott, B.K. Dove, P. Digard, J.N. Barr, A.
Whitehouse, D. Matthews & J.A. Hiscox, (2012) Using SILAC and
quantitative proteomics to investigate the interactions between viral and host
proteomes. Proteomics 12: 666-672.
Nagata, N., T. Iwasaki, Y. Ami, Y. Tano, A. Harashima, Y. Suzaki, Y. Sato, H.
Hasegawa, T. Sata, T. Miyamura & H. Shimizu, (2004) Differential
localization of neurons susceptible to enterovirus 71 and poliovirus type 1 in
the central nervous system of cynomolgus monkeys after intravenous
inoculation. J Gen Virol 85: 2981-2989.
Nagy, G., S. Takatsy, E. Kukan, I. Mihaly & I. Domok, (1982) Virological diagnosis
of enterovirus type 71 infections: experiences gained during an epidemic of
acute CNS diseases in Hungary in 1978. Arch Virol 71: 217-227.
235
Nasri, D., L. Bouslama, S. Omar, H. Saoudin, T. Bourlet, M. Aouni, B. Pozzetto &
S. Pillet, (2007a) Typing of human enterovirus by partial sequencing of VP2.
J Clin Microbiol 45: 2370-2379.
Nasri, D., L. Bouslama, S. Pillet, T. Bourlet, M. Aouni & B. Pozzetto, (2007b) Basic
rationale, current methods and future directions for molecular typing of
human enterovirus. Expert Rev Mol Diagn 7: 419-434.
Nathans, R., C.Y. Chu, A.K. Serquina, C.C. Lu, H. Cao & T.M. Rana, (2009)
Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol Cell
34: 696-709.
Nossal, G.J.V., (2011) Vaccines and future global health needs. Philosophical
Transactions of the Royal Society B: Biological Sciences 366: 2833-2840.
Oberste, M.S., K. Maher, D.R. Kilpatrick, M.R. Flemister, B.A. Brown & M.A.
Pallansch, (1999a) Typing of human enteroviruses by partial sequencing of
VP1. J Clin Microbiol 37: 1288-1293.
Oberste, M.S., K. Maher, D.R. Kilpatrick & M.A. Pallansch, (1999b) Molecular
evolution of the human enteroviruses: correlation of serotype with VP1
sequence and application to picornavirus classification. J Virol 73: 1941-
1948.
Okuse, C., J.A. Rinaudo, K. Farrar, F. Wells & B.E. Korba, (2005) Enhancement of
antiviral activity against hepatitis C virus in vitro by interferon combination
therapy. Antiviral research 65: 23-34.
Ooi, M.H., S.C. Wong, P. Lewthwaite, M.J. Cardosa & T. Solomon, (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet neurology 9:
1097-1105.
236
Ooi, M.H., S.C. Wong, A. Mohan, Y. Podin, D. Perera, D. Clear, S. del Sel, C.H.
Chieng, P.H. Tio, M.J. Cardosa & T. Solomon, (2009) Identification and
validation of clinical predictors for the risk of neurological involvement in
children with hand, foot, and mouth disease in Sarawak. BMC infectious
diseases 9: 3.
Ooi, M.H., S.C. Wong, Y. Podin, W. Akin, S. del Sel, A. Mohan, C.H. Chieng, D.
Perera, D. Clear, D. Wong, E. Blake, J. Cardosa & T. Solomon, (2007)
Human enterovirus 71 disease in Sarawak, Malaysia: a prospective clinical,
virological, and molecular epidemiological study. Clin Infect Dis 44: 646-
656.
Osterlund, P., V. Veckman, J. Siren, K.M. Klucher, J. Hiscott, S. Matikainen & I.
Julkunen, (2005) Gene expression and antiviral activity of alpha/beta
interferons and interleukin-29 in virus-infected human myeloid dendritic
cells. J Virol 79: 9608-9617.
Otsuka, M., Q. Jing, P. Georgel, L. New, J. Chen, J. Mols, Y.J. Kang, Z. Jiang, X.
Du, R. Cook, S.C. Das, A.K. Pattnaik, B. Beutler & J. Han, (2007)
Hypersusceptibility to vesicular stomatitis virus infection in Dicer1-deficient
mice is due to impaired miR24 and miR93 expression. Immunity 27: 123-134.
Oudshoorn, D., G.A. Versteeg & M. Kikkert, (2012) Regulation of the innate
immune system by ubiquitin and ubiquitin-like modifiers. Cytokine & growth
factor reviews 23: 273-282.
Pagliaccetti, N.E., R. Eduardo, S.H. Kleinstein, X.J. Mu, P. Bandi & M.D. Robek,
(2008) Interleukin-29 functions cooperatively with interferon to induce
antiviral gene expression and inhibit hepatitis C virus replication. The Journal
of biological chemistry 283: 30079-30089.
237
Palmer, S., (2013) Advances in detection and monitoring of plasma viremia in HIV-
infected individuals receiving antiretroviral therapy. Current opinion in HIV
and AIDS 8: 87-92.
Park, H., E. Serti, O. Eke, B. Muchmore, L. Prokunina-Olsson, S. Capone, A. Folgori
& B. Rehermann, (2012) IL-29 is the dominant type III interferon produced
by hepatocytes during acute hepatitis C virus infection. Hepatology
(Baltimore, Md.) 56: 2060-2070.
Patel, K.P. & J.M. Bergelson, (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728-729.
Pellegrino, L., J. Stebbing, V.M. Braga, A.E. Frampton, J. Jacob, L. Buluwela, L.R.
Jiao, M. Periyasamy, C.D. Madsen, M.P. Caley, S. Ottaviani, L. Roca-
Alonso, M. El-Bahrawy, R.C. Coombes, J. Krell & L. Castellano, (2013)
miR-23b regulates cytoskeletal remodeling, motility and metastasis by
directly targeting multiple transcripts. Nucleic Acids Res 41: 5400-5412.
Pierce, A.T., J. DeSalvo, T.P. Foster, A. Kosinski, S.K. Weller & W.P. Halford,
(2005) Beta interferon and gamma interferon synergize to block viral DNA
and virion synthesis in herpes simplex virus-infected cells. J Gen Virol 86:
2421-2432.
Ploubidou, A. & M. Way, (2001) Viral transport and the cytoskeleton. Curr Opin
Cell Biol 13: 97-105.
Pourianfar, H.R., C.L. Poh, J. Fecondo & L. Grollo, (2012) In vitro evaluation of the
antiviral activity of heparan sulfate mimetic compounds against Enterovirus
71. Virus research 169: 22-29.
238
Prager, P., M. Nolan, I.P. Andrews & G.D. Williams, (2003) Neurogenic pulmonary
edema in enterovirus 71 encephalitis is not uniformly fatal but causes severe
morbidity in survivors. Pediatr Crit Care Med 4: 377-381.
Racki, N., D. Morisset, I. Gutierrez-Aguirre & M. Ravnikar, (2014) One-step RT-
droplet digital PCR: a breakthrough in the quantification of waterborne RNA
viruses. Analytical and bioanalytical chemistry 406: 661-667.
Rajsbaum, R. & A. Garcia-Sastre, (2013) Viral evasion mechanisms of early antiviral
responses involving regulation of ubiquitin pathways. Trends in microbiology
21: 421-429.
Randall, G., M. Panis, J.D. Cooper, T.L. Tellinghuisen, K.E. Sukhodolets, S. Pfeffer,
M. Landthaler, P. Landgraf, S. Kan, B.D. Lindenbach, M. Chien, D.B. Weir,
J.J. Russo, J. Ju, M.J. Brownstein, R. Sheridan, C. Sander, M. Zavolan, T.
Tuschl & C.M. Rice, (2007) Cellular cofactors affecting hepatitis C virus
infection and replication. Proceedings of the National Academy of Sciences of
the United States of America 104: 12884-12889.
Randall, R.E. & S. Goodbourn, (2008) Interferons and viruses: an interplay between
induction, signalling, antiviral responses and virus countermeasures. J Gen
Virol 89: 1-47.
Reed, L.J. & H. Muench, (1938) A simple method of estimating fifty percent
endpoints. The American Journal of Hygiene 27: 493–497.
Roberts, A.P. & C.L. Jopling, (2010) Targeting viral infection by microRNA
inhibition. Genome Biol 11: 201.
Romero-Calvo, I., B. Ocón, P. Martínez-Moya, M.D. Suárez, A. Zarzuelo, O.
Martínez-Augustin & F.S. de Medina, (2010) Reversible Ponceau staining as
239
a loading control alternative to actin in Western blots. Analytical
Biochemistry 401: 318-320.
Sabin, A.B., (1981) Paralytic poliomyelitis: Old dogmas and new perspectives.
Reviews of infectious diseases 3: 543-564.
Sainz, B., Jr. & W.P. Halford, (2002) Alpha/Beta interferon and gamma interferon
synergize to inhibit the replication of herpes simplex virus type 1. J Virol 76:
11541-11550.
Sainz, B., Jr., H.L. LaMarca, R.F. Garry & C.A. Morris, (2005) Synergistic
inhibition of human cytomegalovirus replication by interferon-alpha/beta and
interferon-gamma. Virology journal 2: 14.
Sanders, R., D.J. Mason, C.A. Foy & J.F. Huggett, (2013) Evaluation of digital PCR
for absolute RNA quantification. PLoS One 8: e75296.
Sasaki, O., T. Karaki & J. Imanishi, (1986) Protective effect of interferon on
infections with hand, foot, and mouth disease virus in newborn mice. J Infect
Dis 153: 498-502.
Scaria, V., M. Hariharan, S. Maiti, B. Pillai & S.K. Brahmachari, (2006) Host-virus
interaction: a new role for microRNAs. Retrovirology 3: 68.
Schmidt, N.J., E.H. Lennette & H.H. Ho, (1974) An apparently new enterovirus
isolated from patients with disease of the central nervous system. J Infect Dis
129: 304-309.
Sedlak, R.H. & K.R. Jerome, (2013) Viral diagnostics in the era of digital
polymerase chain reaction. Diagn Microbiol Infect Dis 75: 1-4.
Shimizu, H., A. Utama, K. Yoshii, H. Yoshida, T. Yoneyama, M. Sinniah, M.A.
Yusof, Y. Okuno, N. Okabe, S.R. Shih, H.Y. Chen, G.R. Wang, C.L. Kao,
K.S. Chang, T. Miyamura & A. Hagiwara, (1999) Enterovirus 71 from fatal
240
and nonfatal cases of hand, foot and mouth disease epidemics in Malaysia,
Japan and Taiwan in 1997-1998. Jpn J Infect Dis 52: 12-15.
Sim, A.C., A. Luhur, T.M. Tan, V.T. Chow & C.L. Poh, (2005) RNA interference
against enterovirus 71 infection. Virology 341: 72-79.
Singh, S., V.T. Chow, M.C. Phoon, K.P. Chan & C.L. Poh, (2002) Direct detection
of enterovirus 71 (EV71) in clinical specimens from a hand, foot, and mouth
disease outbreak in Singapore by reverse transcription-PCR with universal
enterovirus and EV71-specific primers. J Clin Microbiol 40: 2823-2827.
Skalsky, R.L. & B.R. Cullen, (2010) Viruses, microRNAs, and host interactions.
Annual review of microbiology 64: 123-141.
Soldati, T. & M. Schliwa, (2006) Powering membrane traffic in endocytosis and
recycling. Nature reviews. Molecular cell biology 7: 897-908.
Solomon, T., P. Lewthwaite, D. Perera, M.J. Cardosa, P. McMinn & M.H. Ooi,
(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.
Lancet Infect Dis 10: 778-790.
Strain, M.C., S.M. Lada, T. Luong, S.E. Rought, S. Gianella, V.H. Terry, C.A. Spina,
C.H. Woelk & D.D. Richman, (2013) Highly precise measurement of HIV
DNA by droplet digital PCR. PLoS One 8: e55943.
Sullivan, C.S., (2008) New roles for large and small viral RNAs in evading host
defences. Nature reviews. Genetics 9: 503-507.
Sullivan, C.S. & D. Ganem, (2005) MicroRNAs and viral infection. Mol Cell 20: 3-
7.
Tan, C.W., C.L. Poh, I.C. Sam & Y.F. Chan, (2013) Enterovirus 71 uses cell surface
heparan sulfate glycosaminoglycan as an attachment receptor. J Virol 87:
611-620.
241
Tan, E.L., V.T. Chow, G. Kumarasinghe, R.T. Lin, I.M. Mackay, T.P. Sloots & C.L.
Poh, (2006) Specific detection of enterovirus 71 directly from clinical
specimens using real-time RT-PCR hybridization probe assay. Molecular and
cellular probes 20: 135-140.
Tan, E.L., V.T. Chow, S.H. Quak, W.C. Yeo & C.L. Poh, (2008a) Development of
multiplex real-time hybridization probe reverse transcriptase polymerase
chain reaction for specific detection and differentiation of Enterovirus 71 and
Coxsackievirus A16. Diagn Microbiol Infect Dis 61: 294-301.
Tan, E.L., T.M. Tan, V.T. Chow & C.L. Poh, (2007a) Enhanced potency and
efficacy of 29-mer shRNAs in inhibition of Enterovirus 71. Antiviral
research 74: 9-15.
Tan, E.L., T.M. Tan, V. Tak Kwong Chow & C.L. Poh, (2007b) Inhibition of
enterovirus 71 in virus-infected mice by RNA interference. Molecular
therapy : the journal of the American Society of Gene Therapy 15: 1931-
1938.
Tan, E.L., A.P. Wong & C.L. Poh, (2010) Development of potential antiviral strategy
against coxsackievirus B4. Virus research 150: 85-92.
Tan, E.L., L.L. Yong, S.H. Quak, W.C. Yeo, V.T. Chow & C.L. Poh, (2008b) Rapid
detection of enterovirus 71 by real-time TaqMan RT-PCR. Journal of clinical
virology : the official publication of the Pan American Society for Clinical
Virology 42: 203-206.
Tano, Y., H. Shimizu, M. Shiomi, T. Nakano & T. Miyamura, (2002) Rapid
serological diagnosis of enterovirus 71 infection by IgM ELISA. Jpn J Infect
Dis 55: 133-135.
242
Taylor, K.E. & K.L. Mossman, (2013) Recent advances in understanding viral
evasion of type I interferon. Immunology 138: 190-197.
Taylor, M.P., O.O. Koyuncu & L.W. Enquist, (2011) Subversion of the actin
cytoskeleton during viral infection. Nature reviews. Microbiology 9: 427-439.
Tee, K.K., T.T. Lam, Y.F. Chan, J.M. Bible, A. Kamarulzaman, C.Y. Tong, Y.
Takebe & O.G. Pybus, (2010) Evolutionary genetics of human enterovirus
71: origin, population dynamics, natural selection, and seasonal periodicity of
the VP1 gene. J Virol 84: 3339-3350.
tenOever, B.R., (2013) RNA viruses and the host microRNA machinery. Nature
reviews. Microbiology 11: 169-180.
Thompson, M.R., J.J. Kaminski, E.A. Kurt-Jones & K.A. Fitzgerald, (2011) Pattern
recognition receptors and the innate immune response to viral infection.
Viruses 3: 920-940.
Triboulet, R., B. Mari, Y. Lin, C. Chable-Bessia, Y. Bennasser, K. Lebrigand, B.
Cardinaud, T. Maurin, P. Barbry, V. Baillat, J. Reynes, P. Corbeau, K. Jeang
& M. Benkirane, (2007) Suppression of microRNA-silencing pathway by
HIV-1 during virus replication. Science (New York, N.Y.) 315: 1579 - 1582.
Umbach, J.L. & B.R. Cullen, (2009) The role of RNAi and microRNAs in animal
virus replication and antiviral immunity. Genes Dev 23: 1151-1164.
Valastyan, S. & R.A. Weinberg, (2011) Roles for microRNAs in the regulation of
cell adhesion molecules. Journal of cell science 124: 999-1006.
van der Sanden, S., M. Koopmans, G. Uslu & H. van der Avoort, (2009)
Epidemiology of enterovirus 71 in the Netherlands, 1963 to 2008. J Clin
Microbiol 47: 2826-2833.
243
van der Sanden, S., H. van der Avoort, P. Lemey, G. Uslu & M. Koopmans, (2010)
Evolutionary trajectory of the VP1 gene of human enterovirus 71 genogroup
B and C viruses. J Gen Virol 91: 1949-1958.
Versteeg, G.A. & A. Garcia-Sastre, (2010) Viral tricks to grid-lock the type I
interferon system. Current opinion in microbiology 13: 508-516.
Vignuzzi, M., E. Wendt & R. Andino, (2008) Engineering attenuated virus vaccines
by controlling replication fidelity. Nat Med 14: 154-161.
Viswanathan, K., K. Fruh & V. DeFilippis, (2010) Viral hijacking of the host
ubiquitin system to evade interferon responses. Current opinion in
microbiology 13: 517-523.
Wang, J.N., C.T. Yao, C.N. Yeh, C.C. Huang, S.M. Wang, C.C. Liu & J.M. Wu,
(2006) Critical management in patients with severe enterovirus 71 infection.
Pediatrics international : official journal of the Japan Pediatric Society 48:
250-256.
Wang, J.R., H.P. Tsai, P.F. Chen, Y.J. Lai, J.J. Yan, D. Kiang, K.H. Lin, C.C. Liu &
I.J. Su, (2000) An outbreak of enterovirus 71 infection in Taiwan, 1998. II.
Laboratory diagnosis and genetic analysis. Journal of clinical virology : the
official publication of the Pan American Society for Clinical Virology 17: 91-
99.
Wang, S.M., H.Y. Lei, M.C. Huang, J.M. Wu, C.T. Chen, J.N. Wang, J.R. Wang &
C.C. Liu, (2005) Therapeutic efficacy of milrinone in the management of
enterovirus 71-induced pulmonary edema. Pediatric pulmonology 39: 219-
223.
244
Wen, B.P., H.J. Dai, Y.H. Yang, Y. Zhuang & R. Sheng, (2013) MicroRNA-23b
Inhibits Enterovirus 71 Replication through Downregulation of EV71 VPl
Protein. Intervirology 56: 195-200.
Wiertz, E., A. Hill, D. Tortorella & H. Ploegh, (1997) Cytomegaloviruses use
multiple mechanisms to elude the host immune response. Immunology letters
57: 213-216.
Wong, S.S., C.C. Yip, S.K. Lau & K.Y. Yuen, (2010) Human enterovirus 71 and
hand, foot and mouth disease. Epidemiol Infect 138: 1071-1089.
Wong, W.R., Y.Y. Chen, S.M. Yang, Y.L. Chen & J.T. Horng, (2005)
Phosphorylation of PI3K/Akt and MAPK/ERK in an early entry step of
enterovirus 71. Life sciences 78: 82-90.
Wu, C.N., Y.C. Lin, C. Fann, N.S. Liao, S.R. Shih & M.S. Ho, (2001) Protection
against lethal enterovirus 71 infection in newborn mice by passive
immunization with subunit VP1 vaccines and inactivated virus. Vaccine 20:
895-904.
Wu, K.X., M.M. Ng & J.J. Chu, (2010) Developments towards antiviral therapies
against enterovirus 71. Drug discovery today 15: 1041-1051.
Wu, T.C., Y.F. Wang, Y.P. Lee, J.R. Wang, C.C. Liu, S.M. Wang, H.Y. Lei, I.J. Su
& C.K. Yu, (2007) Immunity to avirulent enterovirus 71 and coxsackie A16
virus protects against enterovirus 71 infection in mice. J Virol 81: 10310-
10315.
Xiao, C. & K. Rajewsky, (2009) MicroRNA control in the immune system: basic
principles. Cell 136: 26-36.
Xu, L.J., T. Jiang, F.J. Zhang, J.F. Han, J. Liu, H. Zhao, X.F. Li, R.J. Liu, Y.Q.
Deng, X.Y. Wu, S.Y. Zhu, E.D. Qin & C.F. Qin, (2013) Global
245
transcriptomic analysis of human neuroblastoma cells in response to
enterovirus type 71 infection. PLoS One 8: e65948.
Yamayoshi, S., K. Fujii & S. Koike, (2012) Scavenger receptor b2 as a receptor for
hand, foot, and mouth disease and severe neurological diseases. Frontiers in
microbiology 3: 32.
Yamayoshi, S., Y. Yamashita, J. Li, N. Hanagata, T. Minowa, T. Takemura & S.
Koike, (2009) Scavenger receptor B2 is a cellular receptor for enterovirus 71.
Nat Med 15: 798-801.
Yan, J.J., I.J. Su, P.F. Chen, C.C. Liu, C.K. Yu & J.R. Wang, (2001) Complete
genome analysis of enterovirus 71 isolated from an outbreak in Taiwan and
rapid identification of enterovirus 71 and coxsackievirus A16 by RT-PCR. J
Med Virol 65: 331-339.
Yang, S.L., Y.T. Chou, C.N. Wu & M.S. Ho, (2011) Annexin II binds to capsid
protein VP1 of enterovirus 71 and enhances viral infectivity. J Virol 85:
11809-11820.
Yi, L., J. Lu, H.F. Kung & M.L. He, (2011) The virology and developments toward
control of human enterovirus 71. Crit Rev Microbiol 37: 313-327.
Yoshikawa, T., A. Takata, M. Otsuka, T. Kishikawa, K. Kojima, H. Yoshida & K.
Koike, (2012) Silencing of microRNA-122 enhances interferon-alpha
signaling in the liver through regulating SOCS3 promoter methylation.
Scientific reports 2: 637.
Zhang, G., F. Zhou, B. Gu, C. Ding, D. Feng, F. Xie, J. Wang, C. Zhang, Q. Cao, Y.
Deng, W. Hu & K. Yao, (2012) In vitro and in vivo evaluation of ribavirin
and pleconaril antiviral activity against enterovirus 71 infection. Arch Virol
157: 669-679.
246
Zhang, Y., W. Cui, L. Liu, J. Wang, H. Zhao, Y. Liao, R. Na, C. Dong, L. Wang, Z.
Xie, J. Gao, P. Cui, X. Zhang & Q. Li, (2011) Pathogenesis study of
enterovirus 71 infection in rhesus monkeys. Laboratory investigation; a
journal of technical methods and pathology 91: 1337-1350.
Zheng, Z., X. Ke, M. Wang, S. He, Q. Li, C. Zheng, Z. Zhang, Y. Liu & H. Wang,
(2013) Human microRNA hsa-miR-296-5p suppresses Enterovirus 71
replication by targeting the viral genome. J Virol.
Zhu, F.C., Z.L. Liang, X.L. Li, H.M. Ge, F.Y. Meng, Q.Y. Mao, Y.T. Zhang, Y.M.
Hu, Z.Y. Zhang, J.X. Li, F. Gao, Q.H. Chen, Q.Y. Zhu, K. Chu, X. Wu, X.
Yao, H.J. Guo, X.Q. Chen, P. Liu, Y.Y. Dong, F.X. Li, X.L. Shen & J.Z.
Wang, (2013) Immunogenicity and safety of an enterovirus 71 vaccine in
healthy Chinese children and infants: a randomised, double-blind, placebo-
controlled phase 2 clinical trial. Lancet 381: 1037-1045.
247
Appendices
248
Appendices
249
Appendices
Appendix A
Altered mRNA expression profile of EV71 infected and non-infected control colorectal cells, HT29.
Column
#
Column ID Entrez Gene Gene Symbol Gene Title RefSeq
Transcript ID
p-
value(Infected
vs. Control)
Fold-
Change(Infected
vs. Control)
3633 11718724_at 57561 ARRDC3 arrestin domain containing 3 NM_020801 0.000102 3.77318
43130 11758221_s_at 57561 ARRDC3 arrestin domain containing 3 NM_020801 3.87E-07 3.7577
49355 AFFX-
M27830_M_at
--- --- --- --- 0.000171 2.80778
3632 11718723_at 57561 ARRDC3 arrestin domain containing 3 NM_020801 0.001566 2.30754
10571 11725662_a_at 151473 SLC16A14 solute carrier family 16, member 14
(monocarboxylic acid transporter
14)
NM_152527 0.003781 2.05637
44671 11759762_a_at 440836 ODF3B outer dense fiber of sperm tails 3B NM_001014440 0.003513 1.98264
20813 11735904_at 282618 IL29 interleukin 29 (interferon, lambda
1)
NM_172140 0.001237 1.9206
44230 11759321_a_at 196264 MPZL3 myelin protein zero-like 3 NM_198275 0.000768 1.9043
16278 11731369_x_at 79973 ZNF442 zinc finger protein 442 NM_030824 0.001441 1.88819
3412 11718503_a_at 56261 GPCPD1 glycerophosphocholine
phosphodiesterase GDE1 homolog
(S. cerevisiae)
NM_019593 0.00022 1.87381
33804 11748895_a_at 134266 GRPEL2 GrpE-like 2, mitochondrial (E. coli) NM_152407 9.22E-06 1.86842
250
2099 11717190_s_at 10628 TXNIP thioredoxin interacting protein NM_006472 7.62E-06 1.86782
22969 11738060_s_at 121504 ///
554313 ///
8294 /// 8359
/// 8360 ///
8361 /// 8362
/// 8363 ///
8364 /// 83
HIST1H4A ///
HIST1H4B ///
HIST1H4C ///
HIST1H4D ///
HIST1H4E ///
HIST1H4F ///
HIST1H4H ///
HIST1H4I ///
HIST1H4J ///
HIST1H4K ///
HIST1H4L ///
HIST2H4A ///
HIST2H4B ///
HIST4H4
histone cluster 1, H4a /// histone
cluster 1, H4b /// histone cluster 1,
H4c /// histon
NM_001034077
/// NM_003495
/// NM_003538
/// NM_003539
/// NM_003540
/// NM_003541
///
0.009641 1.82976
614 11715705_a_at 10724 MGEA5 meningioma expressed antigen 5
(hyaluronidase)
NM_001142434
/// NM_012215
1.09E-06 1.80531
41340 11756431_s_at 10628 TXNIP thioredoxin interacting protein NM_006472 5.32E-06 1.79276
37674 11752765_s_at 10628 TXNIP thioredoxin interacting protein NM_006472 5.72E-06 1.78761
19109 11734200_at 284391 ZNF844 zinc finger protein 844 NM_001136501 1.76E-05 1.75669
615 11715706_x_at 10724 MGEA5 meningioma expressed antigen 5
(hyaluronidase)
NM_001142434
/// NM_012215
3.16E-06 1.75181
33453 11748544_s_at 10628 TXNIP thioredoxin interacting protein NM_006472 6.03E-05 1.74939
38336 11753427_a_at 390 RND3 Rho family GTPase 3 NM_001254738
/// NM_005168
0.000853 1.74621
1234 11716325_a_at 1195 CLK1 CDC-like kinase 1 NM_001024646
///
0.004308 1.71591
251
NM_001162407
/// NM_004071
/// NR_027855
/// NR_027856
33452 11748543_a_at 10628 TXNIP thioredoxin interacting protein NM_006472 0.001977 1.71264
4669 11719760_at 91947 ARRDC4 arrestin domain containing 4 NM_183376 0.005599 1.71178
18260 11733351_at 55175 KLHL11 kelch-like 11 (Drosophila) NM_018143 0.012659 1.67587
18477 11733568_x_at 163059 ZNF433 zinc finger protein 433 NM_001080411
/// NM_152602
0.001603 1.66142
21510 11736601_at 83990 BRIP1 BRCA1 interacting protein C-
terminal helicase 1
NM_032043 0.000358 1.64957
29037 11744128_x_at 2920 CXCL2 chemokine (C-X-C motif) ligand 2 NM_002089 0.001577 1.62624
43785 11758876_at 153222 CREBRF CREB3 regulatory factor NM_001168393
///
NM_001168394
/// NM_153607
0.000516 1.60036
402 11715493_a_at 3491 CYR61 cysteine-rich, angiogenic inducer,
61
NM_001554 0.00027 1.59476
16277 11731368_at 79973 ZNF442 zinc finger protein 442 NM_030824 0.002515 1.57275
9376 11724467_at 3859 KRT12 keratin 12 NM_000223 0.011131 1.56759
8481 11723572_at 23252 OTUD3 OTU domain containing 3 NM_015207 0.041063 1.5639
41374 11756465_s_at 390 RND3 Rho family GTPase 3 NM_001254738
/// NM_005168
0.002659 1.55294
4670 11719761_at 91947 ARRDC4 arrestin domain containing 4 NM_183376 0.000446 1.53056
19726 11734817_at 323 APBB2 amyloid beta (A4) precursor
protein-binding, family B, member
2
NM_001166050
///
NM_001166051
0.001824 1.52967
252
///
NM_001166052
///
NM_001166053
///
NM_001166054
/// NM
13385 11728476_a_at 2921 CXCL3 chemokine (C-X-C motif) ligand 3 NM_002090 0.025571 1.51915
26462 11741553_a_at 6498 SKIL SKI-like oncogene NM_001145097
///
NM_001145098
///
NM_001248008
/// NM_005414
0.000966 1.49154
30633 11745724_at 100507645 ///
378938
LOC100507645
/// MALAT1
uncharacterized LOC100507645 ///
metastasis associated lung
adenocarcinoma transcript 1
NR_002819 ///
XR_110915 ///
XR_110916 ///
XR_110917 ///
XR_111190 ///
XR_111191 ///
XR_
9.80E-05 1.4796
35561 11750652_a_at 2444 FRK fyn-related kinase NM_002031 0.023839 1.46959
44568 11759659_at 1E+08 LOC100130428 IGYY565 XR_110533 ///
XR_111228
0.009338 1.46816
48097 11763188_a_at 27131 SNX5 sorting nexin 5 NM_014426 ///
NM_152227
0.001321 1.46308
5205 11720296_at 79666 PLEKHF2 pleckstrin homology domain
containing, family F (with FYVE
NM_024613 0.00206 1.4612
253
domain) member 2
43392 11758483_s_at 91947 ARRDC4 arrestin domain containing 4 NM_183376 0.000513 1.44954
37466 11752557_a_at 153222 CREBRF CREB3 regulatory factor NM_001168393
///
NM_001168394
/// NM_153607
0.00642 1.44726
34200 11749291_a_at 2353 FOS FBJ murine osteosarcoma viral
oncogene homolog
NM_005252 7.89E-05 1.43973
44434 11759525_at 4616 GADD45B growth arrest and DNA-damage-
inducible, beta
NM_015675 0.003623 1.43547
40609 11755700_a_at 25976 TIPARP TCDD-inducible poly(ADP-ribose)
polymerase
NM_001184717
///
NM_001184718
/// NM_015508
0.036261 1.43522
32051 11747142_a_at 80012 PHC3 polyhomeotic homolog 3
(Drosophila)
NM_024947 0.00253 1.43029
35041 11750132_a_at 255967 PAN3 PAN3 poly(A) specific ribonuclease
subunit homolog (S. cerevisiae)
NM_175854 0.005458 1.42743
896 11715987_a_at 2688 GH1 growth hormone 1 NM_000515 ///
NM_022559 ///
NM_022560 ///
NM_022561 ///
NM_022562
0.007867 1.42049
28805 11743896_at 55758 RCOR3 REST corepressor 3 NM_001136223
///
NM_001136224
///
NM_001136225
0.000893 1.41962
254
/// NM_018254
40819 11755910_a_at 26043 UBXN7 UBX domain protein 7 NM_015562 0.000898 1.41872
4649 11719740_a_at 167227 DCP2 DCP2 decapping enzyme homolog
(S. cerevisiae)
NM_001242377
/// NM_152624
/// NR_038352
0.016116 1.41834
12090 11727181_a_at 6498 SKIL SKI-like oncogene NM_001145097
///
NM_001145098
///
NM_001248008
/// NM_005414
0.003174 1.41831
35448 11750539_a_at 10242 KCNMB2 potassium large conductance
calcium-activated channel,
subfamily M, beta member 2
NM_005832 ///
NM_181361
0.010573 1.41745
351 11715442_s_at 1490 CTGF connective tissue growth factor NM_001901 0.002323 1.41468
19568 11734659_a_at 2353 FOS FBJ murine osteosarcoma viral
oncogene homolog
NM_005252 5.18E-05 1.41385
34561 11749652_a_at 49854 ZNF295 zinc finger protein 295 NM_001098402
///
NM_001098403
/// NM_020727
0.00395 1.41373
41315 11756406_x_at 133 ADM adrenomedullin NM_001124 0.000118 1.41276
25347 11740438_a_at 2528 FUT6 fucosyltransferase 6 (alpha (1,3)
fucosyltransferase)
NM_000150 ///
NM_001040701
0.007178 1.40876
7793 11722884_at 153222 CREBRF CREB3 regulatory factor NM_001168393
///
NM_001168394
0.000552 1.40832
255
/// NM_153607
47515 11762606_x_at 645261 LOC645261 PP565 NM_001039781 0.046925 1.405
40284 11755375_a_at 160851 DGKH diacylglycerol kinase, eta NM_001204504
///
NM_001204505
///
NM_001204506
/// NM_152910
/// NM_178009
0.000702 1.40429
37042 11752133_a_at 79598 CEP97 centrosomal protein 97kDa NM_024548 0.04284 1.40126
12165 11727256_a_at 100529855 ///
7568
ZNF20 ///
ZNF625-
ZNF20
zinc finger protein 20 /// ZNF625-
ZNF20 readthrough
NM_001203250
/// NM_021143
/// NR_037802
2.32E-05 1.39579
10572 11725663_a_at 151473 SLC16A14 solute carrier family 16, member 14
(monocarboxylic acid transporter
14)
NM_152527 0.001988 1.39573
1619 11716710_a_at 133 ADM adrenomedullin NM_001124 0.00012 1.39486
46688 11761779_a_at 196264 MPZL3 myelin protein zero-like 3 NM_198275 0.002432 1.39473
7791 11722882_at 153222 CREBRF CREB3 regulatory factor NM_001168393
///
NM_001168394
/// NM_153607
0.008605 1.39171
12755 11727846_a_at 55602 CDKN2AIP CDKN2A interacting protein NM_017632 0.006151 1.3883
28591 11743682_s_at 7071 KLF10 Kruppel-like factor 10 NM_001032282
/// NM_005655
0.000817 1.38344
33024 11748115_a_at 63876 PKNOX2 PBX/knotted 1 homeobox 2 NM_022062 0.021506 1.3782
16671 11731762_s_at 6196 RPS6KA2 ribosomal protein S6 kinase, 90kDa, NM_001006932 0.009433 1.37529
256
polypeptide 2 /// NM_021135
24859 11739950_a_at 57082 CASC5 cancer susceptibility candidate 5 NM_144508 ///
NM_170589
0.003455 1.37191
17977 11733068_s_at 7071 KLF10 Kruppel-like factor 10 NM_001032282
/// NM_005655
0.000694 1.37008
24876 11739967_a_at 120526 DNAJC24 DnaJ (Hsp40) homolog, subfamily
C, member 24
NM_181706 0.018804 1.36822
10607 11725698_x_at 331 XIAP X-linked inhibitor of apoptosis NM_001167 ///
NM_001204401
/// NR_037916
0.007849 1.36765
29036 11744127_at 2920 CXCL2 chemokine (C-X-C motif) ligand 2 NM_002089 0.016053 1.36714
22968 11738059_x_at 3013 HIST1H2AD histone cluster 1, H2ad NM_021065 0.028426 1.36563
40151 11755242_a_at 6498 SKIL SKI-like oncogene NM_001145097
///
NM_001145098
///
NM_001248008
/// NM_005414
0.000608 1.36492
11303 11726394_a_at 121512 FGD4 FYVE, RhoGEF and PH domain
containing 4
NM_139241 0.021325 1.3649
34814 11749905_a_at 3491 CYR61 cysteine-rich, angiogenic inducer,
61
NM_001554 0.000101 1.36416
10991 11726082_a_at 905 CCNT2 cyclin T2 NM_001241 ///
NM_058241 ///
NR_037649
0.021307 1.3577
8843 11723934_a_at 29944 PNMA3 paraneoplastic Ma antigen 3 NM_013364 0.00317 1.35372
49354 AFFX- --- --- --- --- 0.011792 1.35371
257
M27830_5_at
7792 11722883_a_at 153222 CREBRF CREB3 regulatory factor NM_001168393
///
NM_001168394
/// NM_153607
0.010315 1.3514
47313 11762404_at 148 ADRA1A adrenoceptor alpha 1A NM_000680 ///
NM_033302 ///
NM_033303 ///
NM_033304
0.001237 1.35038
9075 11724166_a_at 23127 GLT25D2 glycosyltransferase 25 domain
containing 2
NM_015101 0.027852 1.3503
32025 11747116_a_at 133746 JMY junction mediating and regulatory
protein, p53 cofactor
NM_152405 0.003651 1.34977
24544 11739635_at 9969 MED13 mediator complex subunit 13 NM_005121 0.035394 1.34761
15268 11730359_a_at 90693 CCDC126 coiled-coil domain containing 126 NM_138771 0.031644 1.34594
11127 11726218_a_at 639 PRDM1 PR domain containing 1, with ZNF
domain
NM_001198 ///
NM_182907
0.039496 1.34377
34761 11749852_s_at 2353 FOS FBJ murine osteosarcoma viral
oncogene homolog
NM_005252 0.006148 1.34042
19708 11734799_s_at 51132 RLIM ring finger protein, LIM domain
interacting
NM_016120 ///
NM_183353
0.001525 1.34023
11533 11726624_a_at 901 CCNG2 cyclin G2 NM_004354 0.000319 1.33927
15962 11731053_a_at 96459 FNIP1 folliculin interacting protein 1 NM_001008738
/// NM_133372
0.036329 1.33758
39243 11754334_s_at 1958 EGR1 early growth response 1 NM_001964 0.001395 1.33756
8206 11723297_a_at 11217 ///
445815
AKAP2 ///
PALM2-
A kinase (PRKA) anchor protein 2
/// PALM2-AKAP2 readthrough
NM_001004065
///
0.019993 1.33685
258
AKAP2 NM_001136562
///
NM_001198656
/// NM_007203
/// NM_147150
20674 11735765_a_at 27314 RAB30 RAB30, member RAS oncogene
family
NM_014488 0.04587 1.33545
22070 11737161_a_at 905 CCNT2 cyclin T2 NM_001241 ///
NM_058241 ///
NR_037649
0.003839 1.33262
45830 11760921_a_at 26036 ZNF451 zinc finger protein 451 NM_001031623
///
NM_001257273
/// NM_015555
///
XM_003118557
///
XM_003403792
0.02704 1.33241
11518 11726609_at 22823 MTF2 metal response element binding
transcription factor 2
NM_001164391
///
NM_001164392
///
NM_001164393
/// NM_007358
0.027257 1.33137
14299 11729390_a_at 57708 MIER1 mesoderm induction early response
1 homolog (Xenopus laevis)
NM_001077700
///
NM_001077701
///
0.007522 1.3308
259
NM_001077702
///
NM_001077703
///
NM_001077704
/// NM
36846 11751937_s_at 55582 KIF27 kinesin family member 27 NM_017576 0.028873 1.33035
22071 11737162_at 222584 FAM83B family with sequence similarity 83,
member B
NM_001010872 0.023157 1.32977
2769 11717860_a_at 1958 EGR1 early growth response 1 NM_001964 0.001233 1.32915
11534 11726625_at 901 CCNG2 cyclin G2 NM_004354 0.00406 1.32856
7188 11722279_a_at 80012 PHC3 polyhomeotic homolog 3
(Drosophila)
NM_024947 0.043937 1.32831
46947 11762038_at 284391 ZNF844 zinc finger protein 844 NM_001136501 0.048406 1.32687
35590 11750681_a_at 153222 CREBRF CREB3 regulatory factor NM_001168393
///
NM_001168394
/// NM_153607
0.012134 1.3268
27139 11742230_x_at 1E+08 FAM48B1 family with sequence similarity 48,
member B1
NM_001136234 0.031498 1.32651
18674 11733765_at 3456 IFNB1 interferon, beta 1, fibroblast NM_002176 0.015741 1.32647
43308 11758399_s_at 2846 LPAR4 lysophosphatidic acid receptor 4 NM_005296 0.029642 1.32621
22334 11737425_x_at 115727 RASGRP4 RAS guanyl releasing protein 4 NM_001146202
///
NM_001146203
///
NM_001146204
0.005792 1.32503
260
///
NM_001146205
///
NM_001146206
/// NM
22732 11737823_at 84197 SGK196 protein kinase-like protein SgK196 NM_032237 0.00932 1.32502
37849 11752940_a_at 1958 EGR1 early growth response 1 NM_001964 0.006409 1.32323
12658 11727749_a_at 2494 NR5A2 nuclear receptor subfamily 5, group
A, member 2
NM_003822 ///
NM_205860
0.003697 1.32303
21037 11736128_a_at 55211 DPPA4 developmental pluripotency
associated 4
NM_018189 0.009001 1.32237
44972 11760063_x_at 388372 ///
9560
CCL4L1 ///
CCL4L2
chemokine (C-C motif) ligand 4-
like 1 /// chemokine (C-C motif)
ligand 4-like 2
NM_001001435
/// NM_207007
0.039822 1.3213
16788 11731879_a_at 22861 NLRP1 NLR family, pyrin domain
containing 1
NM_001033053
/// NM_014922
/// NM_033004
/// NM_033006
/// NM_033007
0.009596 1.32096
36413 11751504_a_at 79691 QTRTD1 queuine tRNA-ribosyltransferase
domain containing 1
NM_001256835
///
NM_001256836
///
NM_001256837
/// NM_024638
0.026976 1.31678
47260 11762351_x_at 7576 ZNF28 zinc finger protein 28 NM_006969 ///
NR_036599 ///
NR_036600
0.006452 1.3146
261
17271 11732362_x_at 51710 ZNF44 zinc finger protein 44 NM_001164276
/// NM_016264
0.008115 1.31441
26248 11741339_a_at 2549 GAB1 GRB2-associated binding protein 1 NM_002039 ///
NM_207123
0.004962 1.3136
19727 11734818_at 323 APBB2 amyloid beta (A4) precursor
protein-binding, family B, member
2
NM_001166050
///
NM_001166051
///
NM_001166052
///
NM_001166053
///
NM_001166054
/// NM
0.032037 1.31093
46501 11761592_a_at 22944 KIN KIN, antigenic determinant of recA
protein homolog (mouse)
NM_012311 ///
NR_045609 ///
NR_045610
0.040734 1.3106
21794 11736885_at 56903 PAPOLB poly(A) polymerase beta (testis
specific)
NM_020144 0.037413 1.30936
221 11715312_at 2303 FOXC2 forkhead box C2 (MFH-1,
mesenchyme forkhead 1)
NM_005251 0.036523 1.30891
10541 11725632_at 4929 NR4A2 nuclear receptor subfamily 4, group
A, member 2
NM_006186 ///
NM_173171 ///
NM_173172 ///
NM_173173
0.007935 1.30885
14600 11729691_a_at 54800 KLHL24 kelch-like 24 (Drosophila) NM_017644 0.001649 1.30856
29148 11744239_a_at 126075 CCDC159 coiled-coil domain containing 159 NM_001080503 0.008035 1.30716
262
30453 11745544_a_at 100302736 ///
353376
TICAM2 ///
TMED7-
TICAM2
toll-like receptor adaptor molecule 2
/// TMED7-TICAM2 readthrough
NM_001164468
///
NM_001164469
/// NM_021649
0.026865 1.30633
24577 11739668_a_at 26039 SS18L1 synovial sarcoma translocation gene
on chromosome 18-like 1
NM_015558 ///
NM_198935
0.012679 1.30595
22825 11737916_a_at 79858 NEK11 NIMA (never in mitosis gene a)-
related kinase 11
NM_001146003
/// NM_024800
/// NM_145910
0.010577 1.30463
15558 11730649_at 389320 C5orf48 chromosome 5 open reading frame
48
NM_207408 0.024246 1.30137
8219 11723310_at 8793 TNFRSF10D tumor necrosis factor receptor
superfamily, member 10d, decoy
with truncated death doma
NM_003840 0.000684 1.29951
11863 11726954_at 140766 ADAMTS14 ADAM metallopeptidase with
thrombospondin type 1 motif, 14
NM_080722 ///
NM_139155
0.010339 1.2977
25042 11740133_a_at 800 CALD1 caldesmon 1 NM_004342 ///
NM_033138 ///
NM_033139 ///
NM_033140 ///
NM_033157
0.020841 1.29622
44500 11759591_at 79969 ATAT1 alpha tubulin acetyltransferase 1 NM_001031722
///
NM_001190724
///
NM_001254952
/// NM_024909
/// NR_033821
0.010046 1.2956
263
/// NR_03382
7427 11722518_a_at 23137 SMC5 structural maintenance of
chromosomes 5
NM_015110 0.007102 1.29527
2989 11718080_a_at 10018 BCL2L11 BCL2-like 11 (apoptosis facilitator) NM_001204106
///
NM_001204107
///
NM_001204108
///
NM_001204109
///
NM_001204110
/// NM
0.005602 1.29476
26091 11741182_s_at 148137 C19orf55 chromosome 19 open reading frame
55
NM_001039887
/// NM_144692
0.044211 1.29425
8829 11723920_at 10324 KBTBD10 kelch repeat and BTB (POZ)
domain containing 10
NM_006063 0.025575 1.29385
396 11715487_a_at 4170 MCL1 myeloid cell leukemia sequence 1
(BCL2-related)
NM_001197320
/// NM_021960
/// NM_182763
0.006242 1.29168
2916 11718007_a_at 29116 MYLIP myosin regulatory light chain
interacting protein
NM_013262 0.000422 1.29103
47656 11762747_at 4322 MMP13 matrix metallopeptidase 13
(collagenase 3)
NM_002427 0.018962 1.29037
44359 11759450_x_at 6248 /// 84301 DDI2 ///
RSC1A1
DNA-damage inducible 1 homolog
2 (S. cerevisiae) /// regulatory solute
carrier protein,
NM_006511 ///
NM_032341
0.00731 1.28986
40173 11755264_a_at 23097 CDK19 cyclin-dependent kinase 19 NM_015076 0.035616 1.28974
264
20232 11735323_at 126068 ZNF441 zinc finger protein 441 NM_152355 0.006537 1.28901
6803 11721894_at 2619 GAS1 growth arrest-specific 1 NM_002048 0.039973 1.28898
48404 11763495_s_at 9256 BZRAP1 benzodiazapine receptor
(peripheral) associated protein 1
NM_001261835
/// NM_004758
/// NM_024418
0.018835 1.28894
32821 11747912_a_at 11044 PAPD7 PAP associated domain containing
7
NM_001171805
///
NM_001171806
/// NM_006999
0.044264 1.28818
28598 11743689_a_at 57540 PTCHD2 patched domain containing 2 NM_020780 0.007156 1.28793
34028 11749119_a_at 121512 FGD4 FYVE, RhoGEF and PH domain
containing 4
NM_139241 0.019764 1.28777
29998 11745089_a_at 7182 NR2C2 nuclear receptor subfamily 2, group
C, member 2
NM_003298 0.030307 1.28679
4446 11719537_a_at 119587 CPXM2 carboxypeptidase X (M14 family),
member 2
NM_198148 0.0221 1.28661
44910 11760001_at 54766 BTG4 B-cell translocation gene 4 NM_017589 0.003711 1.28448
7440 11722531_a_at 800 CALD1 caldesmon 1 NM_004342 ///
NM_033138 ///
NM_033139 ///
NM_033140 ///
NM_033157
0.006582 1.2839
36949 11752040_s_at 80012 PHC3 polyhomeotic homolog 3
(Drosophila)
NM_024947 0.023829 1.28293
48123 11763214_at 51735 RAPGEF6 Rap guanine nucleotide exchange
factor (GEF) 6
NM_001164386
///
NM_001164387
0.015816 1.28218
265
///
NM_001164388
///
NM_001164389
///
NM_001164390
/// NM
42900 11757991_s_at 23253 ANKRD12 ankyrin repeat domain 12 NM_001083625
///
NM_001204056
/// NM_015208
0.010279 1.28048
8567 11723658_at 79759 ZNF668 zinc finger protein 668 NM_001172668
///
NM_001172669
///
NM_001172670
/// NM_024706
0.033049 1.27896
33047 11748138_x_at 25956 SEC31B SEC31 homolog B (S. cerevisiae) NM_015490 ///
NM_198138
0.011356 1.27772
35779 11750870_a_at 23279 NUP160 nucleoporin 160kDa NM_015231 0.017281 1.27757
41944 11757035_a_at 2532 DARC Duffy blood group, chemokine
receptor
NM_001122951
/// NM_002036
0.020641 1.27729
9071 11724162_a_at 283464 GXYLT1 glucoside xylosyltransferase 1 NM_001099650
/// NM_173601
0.015681 1.27635
10688 11725779_a_at 8618 CADPS Ca++-dependent secretion activator NM_003716 ///
NM_183393 ///
NM_183394
0.038957 1.2759
37114 11752205_a_at 79781 IQCA1 IQ motif containing with AAA NM_024726 0.020593 1.2758
266
domain 1
47540 11762631_a_at 196441 ZFC3H1 zinc finger, C3H1-type containing NM_144982 0.041071 1.27519
2165 11717256_at 5292 PIM1 pim-1 oncogene NM_001243186
/// NM_002648
0.006294 1.27507
28804 11743895_a_at 55758 RCOR3 REST corepressor 3 NM_001136223
///
NM_001136224
///
NM_001136225
/// NM_018254
0.022609 1.27491
19645 11734736_a_at 84188 FAR1 fatty acyl CoA reductase 1 NM_032228 0.002165 1.27446
39822 11754913_a_at 7227 TRPS1 trichorhinophalangeal syndrome I NM_014112 0.018214 1.27441
10951 11726042_a_at 9262 STK17B serine/threonine kinase 17b NM_004226 0.003861 1.27401
8497 11723588_at 149041 RC3H1 ring finger and CCCH-type domains
1
NM_172071 0.045208 1.27349
49116 11764207_at --- --- --- --- 0.031855 1.27316
37442 11752533_a_at 149095 DCST1 DC-STAMP domain containing 1 NM_001143687
/// NM_152494
0.029453 1.27231
10245 11725336_a_at 51132 RLIM ring finger protein, LIM domain
interacting
NM_016120 ///
NM_183353
0.000128 1.27114
20876 11735967_at 59351 PBOV1 prostate and breast cancer
overexpressed 1
NM_021635 0.048078 1.27064
22558 11737649_a_at 51479 ANKFY1 ankyrin repeat and FYVE domain
containing 1
NM_001257999
/// NM_016376
/// NM_020740
/// NR_047571
0.008471 1.2696
23170 11738261_at 284443 ZNF493 zinc finger protein 493 NM_001076678 0.003182 1.26959
267
/// NM_145326
/// NM_175910
16748 11731839_a_at 9331 B4GALT6 UDP-Gal:betaGlcNAc beta 1,4-
galactosyltransferase, polypeptide 6
NM_004775 0.020911 1.26887
29161 11744252_at 5991 RFX3 regulatory factor X, 3 (influences
HLA class II expression)
NM_002919 ///
NM_134428
0.000558 1.26819
9419 11724510_at 5366 PMAIP1 phorbol-12-myristate-13-acetate-
induced protein 1
NM_021127 0.004854 1.26818
7893 11722984_a_at 203447 NRK Nik related kinase NM_198465 0.010236 1.26778
22669 11737760_s_at 390 RND3 Rho family GTPase 3 NM_001254738
/// NM_005168
0.001363 1.26711
40424 11755515_s_at 6248 /// 84301 DDI2 ///
RSC1A1
DNA-damage inducible 1 homolog
2 (S. cerevisiae) /// regulatory solute
carrier protein,
NM_006511 ///
NM_032341
0.00491 1.26703
18471 11733562_a_at 23008 KLHDC10 kelch domain containing 10 NM_014997 0.035458 1.26636
37955 11753046_x_at 10150 MBNL2 muscleblind-like splicing regulator
2
NM_144778 ///
NM_207304
0.030541 1.26615
44136 11759227_at 170482 CLEC4C C-type lectin domain family 4,
member C
NM_130441 ///
NM_203503
0.036563 1.26454
9544 11724635_at 55432 YOD1 YOD1 OTU deubiquinating enzyme
1 homolog (S. cerevisiae)
NM_018566 6.51E-05 1.2645
5270 11720361_at 55023 PHIP pleckstrin homology domain
interacting protein
NM_017934 0.002029 1.26433
15755 11730846_x_at 8503 PIK3R3 phosphoinositide-3-kinase,
regulatory subunit 3 (gamma)
NM_001114172
/// NM_003629
0.007165 1.26381
39054 11754145_x_at 100287723 ///
642424
LOC100287723
/// LOC642424
ig kappa chain V-I region Walker-
like /// ig kappa chain V-I region
XM_003403530
///
0.018219 1.26232
268
Walker-like XM_003403532
///
XM_003403621
12145 11727236_a_at 147339 C18orf25 chromosome 18 open reading frame
25
NM_001008239
/// NM_145055
0.010095 1.26101
13950 11729041_a_at 9940 DLEC1 deleted in lung and esophageal
cancer 1
NM_007335 ///
NM_007336 ///
NM_007337 ///
NM_007338
0.025826 1.26077
1209 11716300_x_at 3685 ITGAV integrin, alpha V NM_001144999
///
NM_001145000
/// NM_002210
0.035373 1.26019
4968 11720059_a_at 57348 TTYH1 tweety homolog 1 (Drosophila) NM_001005367
///
NM_001201461
/// NM_020659
0.003954 1.26
17901 11732992_s_at 54798 DCHS2 dachsous 2 (Drosophila) NM_001142552
///
NM_001142553
/// NM_017639
/// NM_199348
0.045637 1.25982
45747 11760838_at 23116 FAM179B family with sequence similarity
179, member B
NM_015091 0.004454 1.2585
36104 11751195_a_at 56479 KCNQ5 potassium voltage-gated channel,
KQT-like subfamily, member 5
NM_001160130
///
NM_001160132
///
0.01754 1.25825
269
NM_001160133
///
NM_001160134
/// NM_019842
44365 11759456_x_at 347688 TUBB8 tubulin, beta 8 class VIII NM_001164154
/// NM_177987
0.037874 1.25729
36323 11751414_a_at 26298 EHF ets homologous factor NM_001206615
///
NM_001206616
/// NM_012153
0.003309 1.2572
13010 11728101_at 195828 ZNF367 zinc finger protein 367 NM_153695 0.000217 1.25631
14831 11729922_a_at 5973 RENBP renin binding protein NM_002910 0.018833 1.25587
7007 11722098_a_at 253260 RICTOR RPTOR independent companion of
MTOR, complex 2
NM_152756 0.023253 1.25455
42881 11757972_s_at 29116 MYLIP myosin regulatory light chain
interacting protein
NM_013262 0.00034 1.25441
952 11716043_a_at 130074 FAM168B family with sequence similarity
168, member B
NM_001009993 0.005366 1.25419
12095 11727186_a_at 7474 WNT5A wingless-type MMTV integration
site family, member 5A
NM_001256105
/// NM_003392
0.005417 1.25419
48932 11764023_at --- --- --- --- 0.004665 1.25399
27101 11742192_a_at 1240 CMKLR1 chemokine-like receptor 1 NM_001142343
///
NM_001142344
///
NM_001142345
/// NM_004072
0.005271 1.25351
270
915 11716006_a_at 10525 HYOU1 hypoxia up-regulated 1 NM_001130991
/// NM_006389
0.02518 1.25322
46553 11761644_at 51227 PIGP phosphatidylinositol glycan anchor
biosynthesis, class P
NM_153681 ///
NM_153682 ///
NR_028352
0.003661 1.2529
22191 11737282_x_at 92092 ZC3HAV1L zinc finger CCCH-type, antiviral 1-
like
NM_080660 0.03066 1.2529
27429 11742520_at 81328 OR4A15 olfactory receptor, family 4,
subfamily A, member 15
NM_001005275 0.003666 1.25262
6783 11721874_at 3433 IFIT2 interferon-induced protein with
tetratricopeptide repeats 2
NM_001547 0.01022 1.25256
8365 11723456_x_at 221476 PI16 peptidase inhibitor 16 NM_001199159
/// NM_153370
0.012259 1.25166
21758 11736849_a_at 83856 FSD1L fibronectin type III and SPRY
domain containing 1-like
NM_001145313
/// NM_031919
/// NM_207647
0.04386 1.25165
4807 11719898_s_at 1839 HBEGF heparin-binding EGF-like growth
factor
NM_001945 0.003253 1.25078
8307 11723398_at 4804 NGFR nerve growth factor receptor NM_002507 0.032872 1.25049
2194 11717285_a_at 8976 WASL Wiskott-Aldrich syndrome-like NM_003941 0.028548 1.25039
19117 11734208_s_at 1270 ///
386607
CNTF ///
ZFP91-CNTF
ciliary neurotrophic factor ///
ZFP91-CNTF readthrough (non-
protein coding)
NM_000614 ///
NM_170768 ///
NR_024091
0.002783 1.24955
29317 11744408_x_at 23015 GOLGA8A golgin A8 family, member A NM_181077 ///
NR_027409
0.026889 1.24951
42762 11757853_s_at 117581 TWIST2 twist homolog 2 (Drosophila) NM_057179 0.00447 1.2495
28782 11743873_x_at 64321 SOX17 SRY (sex determining region Y)- NM_022454 0.00444 1.24948
271
box 17
1883 11716974_a_at 5166 PDK4 pyruvate dehydrogenase kinase,
isozyme 4
NM_002612 0.020372 1.24945
26280 11741371_at 392862 GRID2IP glutamate receptor, ionotropic, delta
2 (Grid2) interacting protein
NM_001145118 0.038358 1.24934
14825 11729916_s_at 221079 ARL5B ADP-ribosylation factor-like 5B NM_178815 0.004488 1.24866
21132 11736223_a_at 64376 IKZF5 IKAROS family zinc finger 5
(Pegasus)
NM_022466 0.009314 1.24823
6274 11721365_a_at 3658 IREB2 iron-responsive element binding
protein 2
NM_004136 0.005775 1.247
21806 11736897_x_at 79056 PRRG4 proline rich Gla (G-
carboxyglutamic acid) 4
(transmembrane)
NM_024081 0.016473 1.24684
39538 11754629_s_at 9120 SLC16A6 solute carrier family 16, member 6
(monocarboxylic acid transporter 7)
NM_001174166
/// NM_004694
0.023591 1.24683
11519 11726610_s_at 22823 MTF2 metal response element binding
transcription factor 2
NM_001164391
///
NM_001164392
///
NM_001164393
/// NM_007358
0.000565 1.24652
18126 11733217_s_at 54532 USP53 ubiquitin specific peptidase 53 NM_019050 0.002523 1.24647
40890 11755981_a_at 1839 HBEGF heparin-binding EGF-like growth
factor
NM_001945 0.011996 1.24633
45295 11760386_at 3603 IL16 interleukin 16 NM_001172128
/// NM_004513
/// NM_172217
0.001816 1.24611
272
7438 11722529_a_at 11099 PTPN21 protein tyrosine phosphatase, non-
receptor type 21
NM_007039 0.012155 1.24601
46135 11761226_at 2694 GIF gastric intrinsic factor (vitamin B
synthesis)
NM_005142 0.001051 1.24582
32742 11747833_a_at 8462 KLF11 Kruppel-like factor 11 NM_001177716
///
NM_001177718
/// NM_003597
0.006155 1.24577
23517 11738608_a_at 341359 SYT10 synaptotagmin X NM_198992 0.004228 1.24543
21565 11736656_a_at 11245 GPR176 G protein-coupled receptor 176 NM_007223 0.01871 1.24512
41948 11757039_a_at 331 XIAP X-linked inhibitor of apoptosis NM_001167 ///
NM_001204401
/// NR_037916
0.020739 1.24375
14304 11729395_s_at 143279 HECTD2 HECT domain containing E3
ubiquitin protein ligase 2
NM_173497 ///
NM_182765
0.047803 1.24322
12237 11727328_at 50964 SOST sclerostin NM_025237 0.002652 1.24321
25572 11740663_a_at 283464 GXYLT1 glucoside xylosyltransferase 1 NM_001099650
/// NM_173601
0.0036 1.24301
31603 11746694_a_at 5048 PAFAH1B1 platelet-activating factor
acetylhydrolase 1b, regulatory
subunit 1 (45kDa)
NM_000430 0.009477 1.24257
2725 11717816_at 9925 ZBTB5 zinc finger and BTB domain
containing 5
NM_014872 0.007584 1.24193
27461 11742552_at 138802 OR13C8 olfactory receptor, family 13,
subfamily C, member 8
NM_001004483 0.019104 1.24135
14983 11730074_a_at 27152 INTU inturned planar cell polarity effector
homolog (Drosophila)
NM_015693 0.011 1.24103
273
9788 11724879_at 7764 ZNF217 zinc finger protein 217 NM_006526 0.003191 1.2409
22112 11737203_a_at 220972 Mar-08 membrane-associated ring finger
(C3HC4) 8, E3 ubiquitin protein
ligase
NM_001002265
///
NM_001002266
/// NM_145021
0.034602 1.24087
21241 11736332_a_at 51230 PHF20 PHD finger protein 20 NM_016436 0.015175 1.24053
393 11715484_a_at 4170 MCL1 myeloid cell leukemia sequence 1
(BCL2-related)
NM_001197320
/// NM_021960
/// NM_182763
0.035193 1.24053
48603 11763694_a_at 2744 GLS glutaminase NM_001256310
/// NM_014905
0.012074 1.24001
20996 11736087_at 221061 FAM171A1 family with sequence similarity
171, member A1
NM_001010924 0.018744 1.24
44792 11759883_x_at 6728 /// 7310 SRP19 ///
ZRSR1
signal recognition particle 19kDa ///
zinc finger (CCCH type), RNA-
binding motif and se
NM_001204193
///
NM_001204194
///
NM_001204196
///
NM_001204199
/// NM_003135
3.99E-05 1.23945
23155 11738246_at 4995 OR3A2 olfactory receptor, family 3,
subfamily A, member 2
NM_002551 0.008776 1.23922
29272 11744363_s_at 3635 INPP5D inositol polyphosphate-5-
phosphatase, 145kDa
NM_001017915
/// NM_005541
0.018179 1.23902
2763 11717854_a_at 65982 ZSCAN18 zinc finger and SCAN domain
containing 18
NM_001145542
///
NM_001145543
0.013494 1.23844
274
///
NM_001145544
/// NM_023926
/// NR_027135
29650 11744741_at 29931 LINC00312 long intergenic non-protein coding
RNA 312
NM_013343 ///
NR_024065
0.003108 1.23786
24161 11739252_x_at 3283 HSD3B1 hydroxy-delta-5-steroid
dehydrogenase, 3 beta- and steroid
delta-isomerase 1
NM_000862 0.049947 1.23781
4274 11719365_x_at 26010 SPATS2L spermatogenesis associated, serine-
rich 2-like
NM_001100422
///
NM_001100423
///
NM_001100424
/// NM_015535
0.033337 1.23768
8487 11723578_a_at 221710 C6orf228 chromosome 6 open reading frame
228
NM_001135575 0.00989 1.23738
36002 11751093_a_at 140578 CHODL chondrolectin NM_001204174
///
NM_001204175
///
NM_001204176
///
NM_001204177
///
NM_001204178
/// NM
0.03011 1.23735
30133 11745224_a_at 55183 RIF1 RAP1 interacting factor homolog NM_001177663 0.018213 1.23664
275
(yeast) ///
NM_001177664
///
NM_001177665
/// NM_018151
13386 11728477_at 2921 CXCL3 chemokine (C-X-C motif) ligand 3 NM_002090 0.007987 1.23654
26536 11741627_a_at 54879 ST7L suppression of tumorigenicity 7 like NM_017744 ///
NM_138727 ///
NM_138728 ///
NM_138729 ///
NM_198327 ///
NM_198328
0.010353 1.23633
47359 11762450_at 136259 KLF14 Kruppel-like factor 14 NM_138693 0.043271 1.23607
14823 11729914_at 221079 ARL5B ADP-ribosylation factor-like 5B NM_178815 0.010794 1.23602
46061 11761152_at 79958 DENND1C DENN/MADD domain containing
1C
NM_024898 0.017763 1.23586
43577 11758668_s_at 100294341 ///
100506084 ///
51326
ARL17A ///
ARL17B ///
LOC100294341
ADP-ribosylation factor-like 17A ///
ADP-ribosylation factor-like 17B ///
ADP-ribosylat
NM_001039083
///
NM_001103154
///
NM_001113738
/// NM_016632
/// NR_003653
/// XM_00234
0.019806 1.23567
39143 11754234_a_at 23008 KLHDC10 kelch domain containing 10 NM_014997 0.038512 1.23523
23601 11738692_at 79295 OR5H6 olfactory receptor, family 5,
subfamily H, member 6
NM_001005479 0.013145 1.2352
276
37627 11752718_a_at 2664 GDI1 GDP dissociation inhibitor 1 NM_001493 0.015251 1.2352
29104 11744195_at 120114 FAT3 FAT tumor suppressor homolog 3
(Drosophila)
NM_001008781 0.047457 1.23493
46606 11761697_a_at 56683 C21orf59 chromosome 21 open reading frame
59
NM_017835 ///
NM_021254 ///
NR_036552
0.025338 1.23413
24347 11739438_at 160760 PPTC7 PTC7 protein phosphatase homolog
(S. cerevisiae)
NM_139283 0.000303 1.23357
4579 11719670_a_at 10231 RCAN2 regulator of calcineurin 2 NM_001251973
///
NM_001251974
/// NM_005822
0.048183 1.23326
32141 11747232_a_at 121512 FGD4 FYVE, RhoGEF and PH domain
containing 4
NM_139241 0.029658 1.23306
44639 11759730_a_at 100509445 ///
144203
LOC100509445
/// OVOS2
uncharacterized LOC100509445 ///
ovostatin 2
NM_001080502
/// NM_173498
///
XM_002343151
/// XR_111273
0.027874 1.23287
43030 11758121_s_at 155435 RBM33 RNA binding motif protein 33 NM_001008408
/// NM_053043
0.000144 1.23256
15487 11730578_at 79924 ADM2 adrenomedullin 2 NM_001253845
/// NM_024866
0.046445 1.2312
47366 11762457_a_at 23503 ZFYVE26 zinc finger, FYVE domain
containing 26
NM_015346 0.038941 1.2311
14799 11729890_at 124961 ZFP3 zinc finger protein 3 homolog
(mouse)
NM_153018 0.024672 1.23094
796 11715887_s_at 8396 PIP4K2B phosphatidylinositol-5-phosphate 4- NM_003559 /// 0.003702 1.23093
277
kinase, type II, beta NM_138687
33940 11749031_a_at 9991 PTBP3 polypyrimidine tract binding protein
3
NM_001163788
///
NM_001163790
///
NM_001244896
///
NM_001244897
///
NM_001244898
/// NM
0.026234 1.23019
43024 11758115_s_at 58155 PTBP2 polypyrimidine tract binding protein
2
NM_021190 0.001825 1.23012
16451 11731542_at 91404 SESTD1 SEC14 and spectrin domains 1 NM_178123 0.002545 1.22995
10719 11725810_at 2979 GUCA1B guanylate cyclase activator 1B
(retina)
NM_002098 0.040224 1.22944
2948 11718039_at 25853 DCAF12 DDB1 and CUL4 associated factor
12
NM_015397 0.016767 1.22928
34468 11749559_x_at 11283 CYP4F8 cytochrome P450, family 4,
subfamily F, polypeptide 8
NM_007253 0.017426 1.22924
40427 11755518_a_at 494470 RNF165 ring finger protein 165 NM_001256758
/// NM_152470
/// NR_046357
0.01622 1.22861
3849 11718940_a_at 7128 TNFAIP3 tumor necrosis factor, alpha-
induced protein 3
NM_006290 0.013174 1.22859
46793 11761884_at 5889 RAD51C RAD51 homolog C (S. cerevisiae) NM_002876 ///
NM_058216 ///
NM_058217
0.006566 1.22801
278
24481 11739572_x_at 55205 ZNF532 zinc finger protein 532 NM_018181 0.010761 1.22762
33059 11748150_a_at 9656 MDC1 mediator of DNA-damage
checkpoint 1
NM_014641 0.046649 1.22729
38527 11753618_a_at 133 ADM adrenomedullin NM_001124 0.006389 1.22623
21227 11736318_a_at 154007 SNRNP48 small nuclear ribonucleoprotein
48kDa (U11/U12)
NM_152551 0.002368 1.22595
28803 11743894_at 284323 ZNF780A zinc finger protein 780A NM_001010880
///
NM_001142577
///
NM_001142578
///
NM_001142579
0.026262 1.22553
36922 11752013_s_at 80205 CHD9 chromodomain helicase DNA
binding protein 9
NM_025134 0.045542 1.22551
36442 11751533_a_at 2444 FRK fyn-related kinase NM_002031 0.028489 1.22539
19567 11734658_s_at 2353 FOS FBJ murine osteosarcoma viral
oncogene homolog
NM_005252 0.01176 1.22511
13506 11728597_a_at 7673 ZNF222 zinc finger protein 222 NM_001129996
/// NM_013360
0.029226 1.22485
35353 11750444_a_at 776 CACNA1D calcium channel, voltage-
dependent, L type, alpha 1D subunit
NM_000720 ///
NM_001128839
///
NM_001128840
0.005557 1.22406
44046 11759137_at 10585 POMT1 protein-O-mannosyltransferase 1 NM_001077365
///
NM_001077366
0.012201 1.22386
279
///
NM_001136113
///
NM_001136114
/// NM_007171
37376 11752467_s_at 3635 INPP5D inositol polyphosphate-5-
phosphatase, 145kDa
NM_001017915
/// NM_005541
0.003022 1.22351
44054 11759145_s_at 9173 IL1RL1 interleukin 1 receptor-like 1 NM_003856 ///
NM_016232 ///
NM_173459
0.016449 1.22324
44482 11759573_at 10724 MGEA5 meningioma expressed antigen 5
(hyaluronidase)
NM_001142434
/// NM_012215
0.023199 1.22209
37498 11752589_a_at 5540 PPYR1 pancreatic polypeptide receptor 1 NM_005972 0.022882 1.22179
675 11715766_a_at 1843 DUSP1 dual specificity phosphatase 1 NM_004417 0.005511 1.22177
36906 11751997_a_at 399687 MYO18A myosin XVIIIA NM_078471 ///
NM_203318
0.036035 1.22167
48103 11763194_at 1.01E+08 LOC100506082 uncharacterized LOC100506082 NR_047550 ///
XR_109054 ///
XR_111147
0.007723 1.22163
10270 11725361_s_at 4089 SMAD4 SMAD family member 4 NM_005359 0.002408 1.2216
47803 11762894_at 9527 GOSR1 golgi SNAP receptor complex
member 1
NM_001007024
///
NM_001007025
/// NM_004871
0.033332 1.2212
34085 11749176_a_at 8780 RIOK3 RIO kinase 3 (yeast) NM_003831 ///
NM_145906
0.001997 1.22083
24118 11739209_a_at 5562 PRKAA1 protein kinase, AMP-activated, NM_006251 /// 0.008875 1.22068
280
alpha 1 catalytic subunit NM_206907
25593 11740684_at 341208 HEPHL1 hephaestin-like 1 NM_001098672 0.014642 1.22068
18994 11734085_a_at 159296 NKX2-3 NK2 homeobox 3 NM_145285 0.028933 1.22047
41110 11756201_x_at 1117 CHI3L2 chitinase 3-like 2 NM_001025197
///
NM_001025199
/// NM_004000
0.040509 1.22015
28896 11743987_a_at 7407 VARS valyl-tRNA synthetase NM_006295 0.009002 1.21947
37467 11752558_a_at 540 ATP7B ATPase, Cu++ transporting, beta
polypeptide
NM_000053 ///
NM_001005918
///
NM_001243182
0.029206 1.21908
21964 11737055_at 339500 ZNF678 zinc finger protein 678 NM_032755 ///
NM_178549 ///
NR_033184
0.041419 1.21824
32616 11747707_x_at 79957 PAQR6 progestin and adipoQ receptor
family member VI
NM_024897 ///
NM_198406
0.031735 1.21708
6804 11721895_x_at 2619 GAS1 growth arrest-specific 1 NM_002048 0.016278 1.2168
32689 11747780_x_at 100132565 ///
100132979 ///
283768 ///
390535 ///
729786
GOLGA8C ///
GOLGA8DP ///
GOLGA8E ///
GOLGA8F ///
GOLGA8G
golgin A8 family, member C ///
golgin A8 family, member D,
pseudogene /// golgin A8 fam
NM_001012420
///
NM_001012423
///
NM_001012452
///
NM_001164328
/// NR_027407
/// NR_02
0.013877 1.21676
281
8770 11723861_a_at 10396 ATP8A1 ATPase, aminophospholipid
transporter (APLT), class I, type
8A, member 1
NM_001105529
/// NM_006095
0.015754 1.21643
4620 11719711_a_at 5170 PDPK1 3-phosphoinositide dependent
protein kinase-1
NM_001261816
/// NM_002613
/// NM_031268
0.005326 1.21637
35697 11750788_a_at 53944 CSNK1G1 casein kinase 1, gamma 1 NM_022048 0.049956 1.21629
22805 11737896_s_at 6884 TAF13 TAF13 RNA polymerase II, TATA
box binding protein (TBP)-
associated factor, 18kDa
NM_005645 0.030982 1.21627
45350 11760441_at --- --- --- --- 0.021806 1.21615
16352 11731443_a_at 23365 ARHGEF12 Rho guanine nucleotide exchange
factor (GEF) 12
NM_001198665
/// NM_015313
0.014638 1.21611
37257 11752348_a_at 23329 TBC1D30 TBC1 domain family, member 30 NM_015279 0.000506 1.21582
9174 11724265_x_at 64792 RABL5 RAB, member RAS oncogene
family-like 5
NM_001130820
///
NM_001130821
///
NM_001130822
/// NM_022777
0.008203 1.21567
11619 11726710_at 5198 PFAS phosphoribosylformylglycinamidine
synthase
NM_012393 0.036226 1.21545
2726 11717817_a_at 27327 TNRC6A trinucleotide repeat containing 6A NM_014494 0.038278 1.215
36913 11752004_s_at 285190 ///
400966 ///
653489 ///
727851 ///
GCC2 ///
RGPD1 ///
RGPD2 ///
RGPD3 ///
GRIP and coiled-coil domain
containing 2 /// RANBP2-like and
GRIP domain containing 1 /
NM_001024457
///
NM_001037866
///
0.016404 1.21494
282
729540 ///
729857 ///
84220 /// 9648
RGPD4 ///
RGPD5 ///
RGPD6 ///
RGPD8
NM_001078170
///
NM_001123363
///
NM_001144013
/// NM
40005 11755096_x_at 54522 ANKRD16 ankyrin repeat domain 16 NM_001009941
///
NM_001009942
///
NM_001009943
/// NM_019046
0.042942 1.21422
22026 11737117_at 140886 PABPC5 poly(A) binding protein,
cytoplasmic 5
NM_080832 0.00566 1.2138
14824 11729915_at 221079 ARL5B ADP-ribosylation factor-like 5B NM_178815 0.012378 1.21361
43672 11758763_at 10539 GLRX3 glutaredoxin 3 NM_001199868
/// NM_006541
0.020701 1.2136
27935 11743026_at 441061 Mar-11 membrane-associated ring finger
(C3HC4) 11
NM_001102562 0.038116 1.21257
44027 11759118_at 55033 FKBP14 FK506 binding protein 14, 22 kDa NM_017946 ///
NR_046478 ///
NR_046479
0.046397 1.21246
44233 11759324_s_at 387119 CEP85L centrosomal protein 85kDa-like NM_001042475
///
NM_001178035
/// NM_206921
0.028967 1.21225
29736 11744827_a_at 1195 CLK1 CDC-like kinase 1 NM_001024646
///
0.00234 1.21213
283
NM_001162407
/// NM_004071
/// NR_027855
/// NR_027856
19938 11735029_a_at 23332 CLASP1 cytoplasmic linker associated
protein 1
NM_001142273
///
NM_001142274
///
NM_001207051
/// NM_015282
0.029295 1.21176
8498 11723589_at 149041 RC3H1 ring finger and CCCH-type domains
1
NM_172071 0.027939 1.21146
27048 11742139_a_at 56244 BTNL2 butyrophilin-like 2 (MHC class II
associated)
NM_019602 0.032138 1.21144
31030 11746121_a_at 79748 LMAN1L lectin, mannose-binding, 1 like NM_021819 0.032029 1.2113
13991 11729082_at 126326 GIPC3 GIPC PDZ domain containing
family, member 3
NM_133261 0.024095 1.21107
18528 11733619_a_at 130399 ACVR1C activin A receptor, type IC NM_001111031
///
NM_001111032
///
NM_001111033
/// NM_145259
0.042315 1.21106
21814 11736905_a_at 4920 ROR2 receptor tyrosine kinase-like orphan
receptor 2
NM_004560 0.009594 1.21083
6595 11721686_at 404203 SPINK6 serine peptidase inhibitor, Kazal
type 6
NM_001195290
/// NM_205841
0.018649 1.21066
26220 11741311_a_at 79027 ZNF655 zinc finger protein 655 NM_001009956 0.03515 1.21041
284
///
NM_001009957
///
NM_001009958
///
NM_001009960
///
NM_001083956
/// NM
45443 11760534_a_at 145957 NRG4 neuregulin 4 NM_138573 0.036378 1.21026
33389 11748480_a_at 94015 TTYH2 tweety homolog 2 (Drosophila) NM_032646 ///
NM_052869
0.036607 1.21014
20155 11735246_a_at 162514 TRPV3 transient receptor potential cation
channel, subfamily V, member 3
NM_001258205
/// NM_145068
0.018568 1.21009
27466 11742557_s_at 10776 ARPP19 cAMP-regulated phosphoprotein,
19kDa
NM_006628 0.018819 1.20926
5437 11720528_at 4053 LTBP2 latent transforming growth factor
beta binding protein 2
NM_000428 0.039292 1.20923
38468 11753559_at 6290 SAA3P serum amyloid A3 pseudogene NR_026576 0.009259 1.20917
37985 11753076_a_at 199 AIF1 allograft inflammatory factor 1 NM_001623 ///
NM_004847 ///
NM_032955
0.004023 1.20905
17761 11732852_a_at 23439 ATP1B4 ATPase, Na+/K+ transporting, beta
4 polypeptide
NM_001142447
/// NM_012069
0.036087 1.20882
10271 11725362_x_at 4089 SMAD4 SMAD family member 4 NM_005359 0.002608 1.20881
1002 11716093_a_at 1316 KLF6 Kruppel-like factor 6 NM_001008490
///
0.000219 1.2088
285
NM_001160124
///
NM_001160125
/// NM_001300
/// NR_027653
46249 11761340_x_at 730092 RRN3P1 RNA polymerase I transcription
factor homolog (S. cerevisiae)
pseudogene 1
NR_003370 0.039998 1.20879
12397 11727488_s_at 54801 HAUS6 HAUS augmin-like complex,
subunit 6
NM_017645 0.020478 1.20876
25636 11740727_a_at 93426 SYCE1 synaptonemal complex central
element protein 1
NM_001143763
///
NM_001143764
/// NM_130784
/// NM_201564
0.010377 1.20872
44751 11759842_at 5793 PTPRG protein tyrosine phosphatase,
receptor type, G
NM_002841 0.030621 1.20791
44338 11759429_a_at 8609 KLF7 Kruppel-like factor 7 (ubiquitous) NM_003709 0.005981 1.20767
46903 11761994_at 57679 ALS2 amyotrophic lateral sclerosis 2
(juvenile)
NM_001135745
/// NM_020919
0.015366 1.20659
24541 11739632_at 9969 MED13 mediator complex subunit 13 NM_005121 0.026684 1.20602
2294 11717385_a_at 4495 MT1G metallothionein 1G NM_005950 0.003447 1.20593
1680 11716771_s_at 150094 SIK1 salt-inducible kinase 1 NM_173354 0.001637 1.20559
41460 11756551_a_at 54813 KLHL28 kelch-like 28 (Drosophila) NM_017658 0.009263 1.20558
36273 11751364_a_at 55244 SLC47A1 solute carrier family 47, member 1 NM_018242 0.016366 1.20494
28133 11743224_a_at 100653339 ///
440073
IQSEC3 ///
LOC100653339
IQ motif and Sec7 domain 3 /// IQ
motif and SEC7 domain-containing
NM_001170738
/// NM_015232
0.011637 1.20476
286
protein 3-like ///
XM_003403736
38049 11753140_at 257103 LINC00205 long intergenic non-protein coding
RNA 205
NM_153454 ///
XR_040463 ///
XR_040465
0.000564 1.20373
44426 11759517_a_at 80852 GRIP2 glutamate receptor interacting
protein 2
NM_001080423 0.040939 1.20373
1656 11716747_a_at 4299 AFF1 AF4/FMR2 family, member 1 NM_001166693
/// NM_005935
0.006439 1.20357
20978 11736069_at 23210 JMJD6 jumonji domain containing 6 NM_001081461
/// NM_015167
0.004452 1.2034
32360 11747451_a_at 7629 ZNF76 zinc finger protein 76 NM_003427 0.035542 1.20295
45800 11760891_s_at 150763 GPAT2 glycerol-3-phosphate
acyltransferase 2, mitochondrial
NM_207328 0.002945 1.20286
13461 11728552_a_at 64386 MMP25 matrix metallopeptidase 25 NM_004142 ///
NM_022468 ///
NM_022718
0.040485 1.20244
33819 11748910_a_at 100129518 ///
6648
LOC100129518
/// SOD2
uncharacterized LOC100129518 ///
superoxide dismutase 2,
mitochondrial
NM_000636 ///
NM_001024465
///
NM_001024466
/// NR_037166
0.036578 1.20217
15806 11730897_a_at 23063 WAPAL wings apart-like homolog
(Drosophila)
NM_015045 0.004747 1.20202
46644 11761735_a_at 6257 RXRB retinoid X receptor, beta NM_001270401
/// NM_021976
0.040682 1.20177
25482 11740573_a_at 222389 BEND7 BEN domain containing 7 NM_001100912
/// NM_152751
0.034076 1.20144
287
20211 11735302_a_at 84435 GPR123 G protein-coupled receptor 123 NM_001083909
/// NM_032422
0.045542 1.20118
20909 11736000_x_at 163049 ZNF791 zinc finger protein 791 NM_153358 0.046129 1.20101
20047 11735138_a_at 29951 PDZRN4 PDZ domain containing ring finger
4
NM_001164595
/// NM_013377
0.00855 1.20018
44744 11759835_at 55795 PCID2 PCI domain containing 2 NM_001127202
///
NM_001127203
///
NM_001258212
///
NM_001258213
/// NM_018386
0.023097 -1.20021
12646 11727737_s_at 9465 AKAP7 A kinase (PRKA) anchor protein 7 NM_004842 ///
NM_016377 ///
NM_138633
0.005521 -1.20033
43302 11758393_s_at 84277 DNAJC30 DnaJ (Hsp40) homolog, subfamily
C, member 30
NM_032317 0.002108 -1.20051
14010 11729101_a_at 100653286 ///
1646
AKR1C2 ///
LOC100653286
aldo-keto reductase family 1,
member C2 (dihydrodiol
dehydrogenase 2; bile acid binding
NM_001135241
/// NM_001354
/// NM_205845
///
XM_003403856
0.000145 -1.20056
40770 11755861_a_at 64900 LPIN3 lipin 3 NM_022896 0.018203 -1.20081
35094 11750185_a_at 168455 CCDC71L coiled-coil domain containing 71-
like
NM_175884 0.000983 -1.20092
36532 11751623_s_at 9179 AP4M1 adaptor-related protein complex 4,
mu 1 subunit
NM_004722 0.000987 -1.20124
288
36540 11751631_s_at 9179 AP4M1 adaptor-related protein complex 4,
mu 1 subunit
NM_004722 0.000987 -1.20124
49069 11764160_at --- --- --- --- 0.005169 -1.20153
41283 11756374_a_at 8460 TPST1 tyrosylprotein sulfotransferase 1 NM_003596 0.033913 -1.20214
6377 11721468_at 114327 EFHC1 EF-hand domain (C-terminal)
containing 1
NM_001172420
/// NM_018100
/// NR_033327
0.018092 -1.20227
48108 11763199_at 5094 PCBP2 poly(rC) binding protein 2 NM_001098620
///
NM_001128911
///
NM_001128912
///
NM_001128913
///
NM_001128914
/// NM
0.034997 -1.20228
22247 11737338_a_at 84503 ZNF527 zinc finger protein 527 NM_032453 0.018612 -1.20246
40076 11755167_s_at 729678 LOC729678 uncharacterized LOC729678 NR_027183 ///
NR_045678 ///
NR_045679
0.007106 -1.20249
17601 11732692_at 140711 C20orf118 chromosome 20 open reading frame
118
NM_080628 0.029336 -1.20265
2511 11717602_a_at 79048 SECISBP2 SECIS binding protein 2 NM_024077 0.049288 -1.20265
24123 11739214_at 79085 SLC25A23 solute carrier family 25
(mitochondrial carrier; phosphate
carrier), member 23
NM_024103 0.029546 -1.20285
289
34300 11749391_x_at 23475 QPRT quinolinate
phosphoribosyltransferase
NM_014298 0.006679 -1.20335
12774 11727865_a_at 9481 SLC25A27 solute carrier family 25, member 27 NM_001204051
///
NM_001204052
/// NM_004277
0.022818 -1.20457
39133 11754224_x_at 100271927 ///
10156
RASA4 ///
RASA4B
RAS p21 protein activator 4 /// RAS
p21 protein activator 4B
NM_001079877
/// NM_006989
///
XM_003118598
///
XM_003118599
///
XM_003118600
/// XM_00
0.006129 -1.20463
14328 11729419_a_at 489 ATP2A3 ATPase, Ca++ transporting,
ubiquitous
NM_005173 ///
NM_174953 ///
NM_174954 ///
NM_174955 ///
NM_174956 ///
NM_174957 ///
NM_
0.005561 -1.20467
22330 11737421_at 345079 SOWAHB sosondowah ankyrin repeat domain
family member B
NM_001029870 0.044605 -1.20471
1021 11716112_at 5284 PIGR polymeric immunoglobulin receptor NM_002644 0.016502 -1.20495
26052 11741143_x_at 50507 NOX4 NADPH oxidase 4 NM_001143836
///
NM_001143837
0.020971 -1.20507
290
/// NM_016931
/// NR_026571
2569 11717660_a_at 26051 PPP1R16B protein phosphatase 1, regulatory
subunit 16B
NM_001172735
/// NM_015568
0.046059 -1.20543
40431 11755522_a_at 9404 LPXN leupaxin NM_001143995
/// NM_004811
0.018913 -1.20549
2721 11717812_a_at 3797 KIF3C kinesin family member 3C NM_002254 0.011076 -1.20567
6451 11721542_a_at 92979 Mar-09 membrane-associated ring finger
(C3HC4) 9
NM_138396 0.03139 -1.20585
29723 11744814_a_at 5108 PCM1 pericentriolar material 1 NM_006197 0.039572 -1.20608
31866 11746957_a_at 8794 TNFRSF10C tumor necrosis factor receptor
superfamily, member 10c, decoy
without an intracellular
NM_003841 0.005701 -1.20612
35173 11750264_x_at 55266 TMEM19 transmembrane protein 19 NM_018279 0.01368 -1.20624
31547 11746638_a_at 79154 DHRS11 dehydrogenase/reductase (SDR
family) member 11
NM_024308 0.040247 -1.20662
10073 11725164_at 136895 C7orf31 chromosome 7 open reading frame
31
NM_138811 0.008362 -1.20684
6624 11721715_s_at 546 ATRX alpha thalassemia/mental
retardation syndrome X-linked
NM_000489 ///
NM_138270 ///
NM_138271
0.009359 -1.20697
41186 11756277_a_at 29799 YPEL1 yippee-like 1 (Drosophila) NM_013313 0.006849 -1.20719
27377 11742468_at 644943 RASSF10 Ras association (RalGDS/AF-6)
domain family (N-terminal)
member 10
NM_001080521 0.022588 -1.20719
28881 11743972_a_at 54541 DDIT4 DNA-damage-inducible transcript 4 NM_019058 0.023377 -1.20731
27639 11742730_a_at 828 CAPS calcyphosine NM_004058 /// 0.012728 -1.20756
291
NM_080590
48285 11763376_s_at 5094 PCBP2 poly(rC) binding protein 2 NM_001098620
///
NM_001128911
///
NM_001128912
///
NM_001128913
///
NM_001128914
/// NM
0.035006 -1.20845
11539 11726630_a_at 27429 HTRA2 HtrA serine peptidase 2 NM_013247 ///
NM_145074
0.025179 -1.20892
14747 11729838_at 54877 ZCCHC2 zinc finger, CCHC domain
containing 2
NM_017742 0.036758 -1.20895
25014 11740105_x_at 200728 TMEM17 transmembrane protein 17 NM_198276 0.016459 -1.209
37766 11752857_x_at 2875 GPT glutamic-pyruvate transaminase
(alanine aminotransferase)
NM_005309 0.019151 -1.2099
33818 11748909_a_at 665 BNIP3L BCL2/adenovirus E1B 19kDa
interacting protein 3-like
NM_004331 0.004611 -1.20994
38331 11753422_a_at 665 BNIP3L BCL2/adenovirus E1B 19kDa
interacting protein 3-like
NM_004331 0.004611 -1.20994
10162 11725253_at 6928 HNF1B HNF1 homeobox B NM_000458 ///
NM_001165923
/// NM_006481
0.002235 -1.20999
13604 11728695_at 384 ARG2 arginase, type II NM_001172 0.030119 -1.21058
166 11715257_x_at 170626 XAGE3 X antigen family, member 3 NM_130776 /// 0.045026 -1.21082
292
NM_133179
2683 11717774_a_at 58473 PLEKHB1 pleckstrin homology domain
containing, family B (evectins)
member 1
NM_001130033
///
NM_001130034
///
NM_001130035
///
NM_001130036
/// NM_021200
0.007767 -1.21093
46027 11761118_at 56904 SH3GLB2 SH3-domain GRB2-like endophilin
B2
NM_020145 0.027158 -1.21112
21296 11736387_a_at 18 ABAT 4-aminobutyrate aminotransferase NM_000663 ///
NM_001127448
/// NM_020686
0.009395 -1.21135
1846 11716937_a_at 26471 NUPR1 nuclear protein, transcriptional
regulator, 1
NM_001042483
/// NM_012385
0.031886 -1.21142
36077 11751168_s_at 100532746 ///
80864 /// 9374
EGFL8 ///
PPT2 /// PPT2-
EGFL8
EGF-like-domain, multiple 8 ///
palmitoyl-protein thioesterase 2 ///
PPT2-EGFL8 readthr
NM_001204103
/// NM_005155
/// NM_030652
/// NM_138717
/// NM_138934
/// NR_037860
///
0.049869 -1.21157
17348 11732439_a_at 27293 SMPDL3B sphingomyelin phosphodiesterase,
acid-like 3B
NM_001009568
/// NM_014474
0.046449 -1.21209
29214 11744305_a_at 79705 LRRK1 leucine-rich repeat kinase 1 NM_024652 0.007476 -1.2121
37593 11752684_a_at 283461 C12orf40 chromosome 12 open reading frame
40
NM_001031748
/// NM_173599
0.033035 -1.21296
293
37947 11753038_a_at 27241 BBS9 Bardet-Biedl syndrome 9 NM_001033604
///
NM_001033605
/// NM_014451
/// NM_198428
0.007922 -1.21345
10381 11725472_a_at 85315 PAQR8 progestin and adipoQ receptor
family member VIII
NM_133367 0.019707 -1.21345
20959 11736050_s_at 619208 C6orf225 chromosome 6 open reading frame
225
NM_001033564 0.006055 -1.21369
16392 11731483_a_at 25927 CNRIP1 cannabinoid receptor interacting
protein 1
NM_001111101
/// NM_015463
0.047908 -1.21401
28175 11743266_a_at 6164 RPL34 ribosomal protein L34 NM_000995 ///
NM_033625
0.001965 -1.21418
27525 11742616_at 390148 OR5W2 olfactory receptor, family 5,
subfamily W, member 2
NM_001001960 0.043484 -1.21431
4131 11719222_at 6690 SPINK1 serine peptidase inhibitor, Kazal
type 1
NM_003122 0.001685 -1.21453
31117 11746208_a_at 578 BAK1 BCL2-antagonist/killer 1 NM_001188 0.007218 -1.21486
23343 11738434_s_at 390443 RNASE9 ribonuclease, RNase A family, 9
(non-active)
NM_001001673
///
NM_001110356
///
NM_001110357
///
NM_001110358
///
NM_001110359
/// NM
0.040511 -1.21499
294
42458 11757549_s_at 64755 C16orf58 chromosome 16 open reading frame
58
NM_022744 0.004109 -1.215
23029 11738120_x_at 138474 TAF1L TAF1 RNA polymerase II, TATA
box binding protein (TBP)-
associated factor, 210kDa-like
NM_153809 0.028277 -1.21572
17123 11732214_at 7586 ZKSCAN1 zinc finger with KRAB and SCAN
domains 1
NM_003439 0.011543 -1.2161
31463 11746554_a_at 100505813 ///
6678
LOC100505813
/// SPARC
uncharacterized LOC100505813 ///
secreted protein, acidic, cysteine-
rich (osteonectin)
NM_003118 ///
XR_110317 ///
XR_110318 ///
XR_110319 ///
XR_133410 ///
XR_133411 ///
XR_
0.023456 -1.2163
9709 11724800_a_at 23475 QPRT quinolinate
phosphoribosyltransferase
NM_014298 0.005231 -1.21631
8714 11723805_a_at 9590 AKAP12 A kinase (PRKA) anchor protein 12 NM_005100 ///
NM_144497
0.046348 -1.21649
3897 11718988_s_at 6038 RNASE4 ribonuclease, RNase A family, 4 NM_002937 ///
NM_194430 ///
NM_194431
0.008156 -1.21663
11704 11726795_a_at 3691 ITGB4 integrin, beta 4 NM_000213 ///
NM_001005619
///
NM_001005731
0.00242 -1.21681
40991 11756082_a_at 4281 MID1 midline 1 (Opitz/BBB syndrome) NM_000381 ///
NM_001098624
///
0.025082 -1.21694
295
NM_001193277
///
NM_001193278
///
NM_001193279
/// NM_00
189 11715280_s_at 3728 /// 3872 JUP /// KRT17 junction plakoglobin /// keratin 17 NM_000422 ///
NM_002230 ///
NM_021991
0.007101 -1.21711
231 11715322_s_at 646486 FABP12 fatty acid binding protein 12 NM_001105281 0.044813 -1.2175
36793 11751884_s_at 23198 PSME4 proteasome (prosome, macropain)
activator subunit 4
NM_014614 0.045089 -1.21759
30737 11745828_x_at 665 BNIP3L BCL2/adenovirus E1B 19kDa
interacting protein 3-like
NM_004331 0.026464 -1.21781
35309 11750400_a_at 10020 GNE glucosamine (UDP-N-acetyl)-2-
epimerase/N-acetylmannosamine
kinase
NM_001128227
///
NM_001190383
///
NM_001190384
///
NM_001190388
/// NM_005476
0.01022 -1.21826
38919 11754010_x_at 2801 GOLGA2 golgin A2 NM_004486 0.030603 -1.2185
8212 11723303_at 10158 PDZK1IP1 PDZK1 interacting protein 1 NM_005764 0.005362 -1.21855
15359 11730450_at 140825 NEURL2 neuralized homolog 2 (Drosophila) NM_080749 0.000234 -1.21876
16204 11731295_at 55064 SPATA6L spermatogenesis associated 6-like NM_001039395
/// NM_017985
0.010215 -1.21931
296
33132 11748223_a_at 200879 LIPH lipase, member H NM_139248 0.020476 -1.21945
20659 11735750_x_at 54960 GEMIN8 gem (nuclear organelle) associated
protein 8
NM_001042479
///
NM_001042480
/// NM_017856
0.006971 -1.21985
18034 11733125_a_at 5824 PEX19 peroxisomal biogenesis factor 19 NM_001131039
///
NM_001193644
/// NM_002857
/// NR_036492
/// NR_036493
9.53E-05 -1.22
29188 11744279_a_at 83998 REG4 regenerating islet-derived family,
member 4
NM_001159352
///
NM_001159353
/// NM_032044
0.026264 -1.22012
17335 11732426_a_at 9630 GNA14 guanine nucleotide binding protein
(G protein), alpha 14
NM_004297 0.009822 -1.22036
431 11715522_a_at 3030 HADHA hydroxyacyl-CoA dehydrogenase/3-
ketoacyl-CoA thiolase/enoyl-CoA
hydratase (trifunctiona
NM_000182 0.031358 -1.22095
39927 11755018_a_at 5501 PPP1CC protein phosphatase 1, catalytic
subunit, gamma isozyme
NM_001244974
/// NM_002710
4.23E-05 -1.22125
4585 11719676_s_at 4128 MAOA monoamine oxidase A NM_000240 0.000409 -1.2222
11192 11726283_s_at 59084 ENPP5 ectonucleotide
pyrophosphatase/phosphodiesterase
5 (putative)
NM_021572 0.021045 -1.223
43133 11758224_s_at 151887 CCDC80 coiled-coil domain containing 80 NM_199511 ///
NM_199512
0.013373 -1.2235
297
12271 11727362_x_at 7846 TUBA1A tubulin, alpha 1a NM_001270399
///
NM_001270400
/// NM_006009
0.049391 -1.22382
26468 11741559_a_at 312 ANXA13 annexin A13 NM_001003954
/// NM_004306
0.001654 -1.22403
34825 11749916_a_at 79841 AGBL2 ATP/GTP binding protein-like 2 NM_024783 0.033135 -1.22414
44989 11760080_at 634 CEACAM1 carcinoembryonic antigen-related
cell adhesion molecule 1 (biliary
glycoprotein)
NM_001024912
///
NM_001184813
///
NM_001184815
///
NM_001184816
///
NM_001205344
/// NM
0.036474 -1.22479
19063 11734154_a_at 143879 KBTBD3 kelch repeat and BTB (POZ)
domain containing 3
NM_152433 ///
NM_198439
0.003809 -1.22488
4323 11719414_a_at 5087 PBX1 pre-B-cell leukemia homeobox 1 NM_001204961
///
NM_001204963
/// NM_002585
0.0275 -1.22505
10989 11726080_a_at 117248 GALNTL2 UDP-N-acetyl-alpha-D-
galactosamine:polypeptide N-
acetylgalactosaminyltransferase-like
2
NM_054110 0.009221 -1.22518
48627 11763718_x_at 1028 CDKN1C cyclin-dependent kinase inhibitor NM_000076 /// 0.03569 -1.22587
298
1C (p57, Kip2) NM_001122630
///
NM_001122631
45250 11760341_at 389161 ANKUB1 ankyrin repeat and ubiquitin domain
containing 1
NM_001144960 0.010898 -1.22595
3654 11718745_s_at 57584 ARHGAP21 Rho GTPase activating protein 21 NM_020824 0.018088 -1.22613
23465 11738556_s_at 100133046 ///
100287534 ///
3803 /// 3805
/// 3813 ///
553128 ///
57292
KIR2DL2 ///
KIR2DL4 ///
KIR2DL5A ///
KIR2DL5B ///
KIR3DL3 ///
KIR3DS1 ///
LOC100287534
killer cell immunoglobulin-like
receptor, two domains, long
cytoplasmic tail, 2 /// kil
NM_001018081
///
NM_001080770
///
NM_001080772
///
NM_001083539
///
NM_001258383
/// NM
0.023448 -1.22624
1294 11716385_at 7040 TGFB1 transforming growth factor, beta 1 NM_000660 0.010381 -1.22672
15689 11730780_x_at 126 ADH1C alcohol dehydrogenase 1C (class I),
gamma polypeptide
NM_000669 0.010235 -1.22684
39145 11754236_a_at 5792 PTPRF protein tyrosine phosphatase,
receptor type, F
NM_002840 ///
NM_130440
0.009022 -1.2269
32049 11747140_a_at 63027 SLC22A23 solute carrier family 22, member 23 NM_015482 ///
NM_021945
0.0003 -1.22703
16081 11731172_s_at 342035 GLDN gliomedin NM_181789 0.002424 -1.22707
524 11715615_at 7832 BTG2 BTG family, member 2 NM_006763 0.009668 -1.22718
45095 11760186_at 59 ACTA2 Actin, alpha 2, smooth muscle,
aorta
NM_001141945
/// NM_001613
0.00459 -1.22722
299
38230 11753321_a_at 407977 ///
8741 /// 8742
TNFSF12 ///
TNFSF12-
TNFSF13 ///
TNFSF13
tumor necrosis factor (ligand)
superfamily, member 12 ///
TNFSF12-TNFSF13 readthrough /
NM_001198622
///
NM_001198623
///
NM_001198624
/// NM_003808
/// NM_003809
/// NM_17208
0.001394 -1.22778
20432 11735523_a_at 100129583 ///
100631383
FAM47E ///
FAM47E-
STBD1
family with sequence similarity 47,
member E /// FAM47E-STBD1
readthrough
NM_001136570
///
NM_001242936
///
NM_001242939
0.023535 -1.22893
43255 11758346_s_at 9060 PAPSS2 3'-phosphoadenosine 5'-
phosphosulfate synthase 2
NM_001015880
/// NM_004670
0.039836 -1.229
10964 11726055_at 8705 B3GALT4 UDP-Gal:betaGlcNAc beta 1,3-
galactosyltransferase, polypeptide 4
NM_003782 0.00043 -1.22973
21972 11737063_a_at 9633 MTL5 metallothionein-like 5, testis-
specific (tesmin)
NM_001039656
/// NM_004923
0.018281 -1.22999
21470 11736561_a_at 85480 TSLP thymic stromal lymphopoietin NM_033035 ///
NM_138551 ///
NR_033425 ///
NR_045089
0.049996 -1.23
16287 11731378_a_at 81857 MED25 mediator complex subunit 25 NM_030973 0.000372 -1.23034
43290 11758381_s_at 79640 C22orf46 chromosome 22 open reading frame
46
NM_001142964
/// NM_024588
0.043647 -1.23085
13680 11728771_a_at 22802 CLCA4 chloride channel accessory 4 NM_012128 ///
NR_024602
0.048875 -1.23097
300
45858 11760949_a_at 7389 UROD uroporphyrinogen decarboxylase NM_000374 ///
NR_036510
0.034561 -1.23148
37478 11752569_x_at 3932 LCK lymphocyte-specific protein
tyrosine kinase
NM_001042771
/// NM_005356
0.018114 -1.23174
7974 11723065_at 2021 ENDOG endonuclease G NM_004435 0.001787 -1.23218
32943 11748034_a_at 8418 CMAHP cytidine monophospho-N-
acetylneuraminic acid hydroxylase,
pseudogene
NR_002174 ///
NR_027626
0.010086 -1.23245
41718 11756809_a_at 80258 EFHC2 EF-hand domain (C-terminal)
containing 2
NM_025184 0.015188 -1.23286
8830 11723921_at 10324 ///
129880
BBS5 ///
KBTBD10
Bardet-Biedl syndrome 5 /// kelch
repeat and BTB (POZ) domain
containing 10
NM_006063 ///
NM_152384
0.007444 -1.2331
8982 11724073_a_at 28227 PPP2R3B protein phosphatase 2, regulatory
subunit B'', beta
NM_013239 ///
NM_199326
0.013236 -1.23367
19632 11734723_at 10085 EDIL3 EGF-like repeats and discoidin I-
like domains 3
NM_005711 0.019917 -1.23375
5424 11720515_s_at 286343 LURAP1L leucine rich adaptor protein 1-like NM_203403 0.045501 -1.23386
3386 11718477_a_at 6770 STAR steroidogenic acute regulatory
protein
NM_000349 ///
NM_001007243
0.041029 -1.23387
38686 11753777_a_at 10242 KCNMB2 potassium large conductance
calcium-activated channel,
subfamily M, beta member 2
NM_005832 ///
NM_181361
0.027343 -1.23408
48626 11763717_a_at 1028 CDKN1C cyclin-dependent kinase inhibitor
1C (p57, Kip2)
NM_000076 ///
NM_001122630
///
NM_001122631
0.025871 -1.23421
301
22097 11737188_x_at 165082 GPR113 G protein-coupled receptor 113 NM_001145168
///
NM_001145169
/// NM_153835
0.005379 -1.23477
14813 11729904_at 3268 AGFG2 ArfGAP with FG repeats 2 NM_006076 0.029345 -1.23536
20718 11735809_a_at 221391 OPN5 opsin 5 NM_001030051
/// NM_181744
/// NR_033806
0.044833 -1.23548
24764 11739855_a_at 9765 ZFYVE16 zinc finger, FYVE domain
containing 16
NM_001105251
/// NM_014733
0.031046 -1.23554
28026 11743117_a_at 22803 XRN2 5'-3' exoribonuclease 2 NM_012255 0.014837 -1.23564
31855 11746946_a_at 55109 AGGF1 angiogenic factor with G patch and
FHA domains 1
NM_018046 0.029804 -1.23608
34845 11749936_a_at 55869 HDAC8 histone deacetylase 8 NM_001166418
///
NM_001166419
///
NM_001166420
///
NM_001166422
///
NM_001166448
/// NM
0.029899 -1.23617
8276 11723367_a_at 25837 RAB26 RAB26, member RAS oncogene
family
NM_014353 0.010147 -1.23648
43304 11758395_s_at 2153 F5 coagulation factor V (proaccelerin,
labile factor)
NM_000130 0.043685 -1.23702
302
10264 11725355_at 9852 EPM2AIP1 EPM2A (laforin) interacting protein
1
NM_014805 0.017311 -1.2374
21765 11736856_at 387496 RASL11A RAS-like, family 11, member A NM_206827 0.000284 -1.23756
11475 11726566_a_at 1981 EIF4G1 eukaryotic translation initiation
factor 4 gamma, 1
NM_001194946
///
NM_001194947
/// NM_004953
/// NM_182917
/// NM_198241
/// NM_198242
/
0.048389 -1.23763
1675 11716766_a_at 8826 IQGAP1 IQ motif containing GTPase
activating protein 1
NM_003870 0.041029 -1.23771
45447 11760538_a_at 54534 MRPL50 mitochondrial ribosomal protein
L50
NM_019051 0.037577 -1.23779
31965 11747056_a_at 171023 ASXL1 additional sex combs like 1
(Drosophila)
NM_001164603
/// NM_015338
0.03195 -1.2379
13439 11728530_a_at 29760 BLNK B-cell linker NM_001114094
///
NM_001258440
///
NM_001258441
///
NM_001258442
/// NM_013314
/// NR_04
0.002115 -1.23805
34807 11749898_a_at 9522 SCAMP1 secretory carrier membrane protein
1
NM_004866 ///
NM_052822
0.035959 -1.23847
303
28709 11743800_a_at 146754 DNAH2 dynein, axonemal, heavy chain 2 NM_020877 0.031707 -1.2385
12108 11727199_a_at 56134 ///
56135 ///
56136 ///
56137 ///
56138 ///
56139 ///
56140 ///
56141 ///
56142 /
PCDHA1 ///
PCDHA10 ///
PCDHA11 ///
PCDHA12 ///
PCDHA13 ///
PCDHA2 ///
PCDHA3 ///
PCDHA4 ///
PCDHA5 ///
PCDHA6 ///
PCDHA7 ///
PCDHA8 ///
PCDHA9 ///
PCDHAC1 ///
PCDHAC2
protocadherin alpha 1 ///
protocadherin alpha 10 ///
protocadherin alpha 11 /// protoca
NM_014005 ///
NM_018898 ///
NM_018899 ///
NM_018900 ///
NM_018901 ///
NM_018902 ///
NM_
0.026203 -1.2386
5577 11720668_at 8850 KAT2B K(lysine) acetyltransferase 2B NM_003884 0.00451 -1.23864
11212 11726303_a_at 148808 MFSD4 major facilitator superfamily
domain containing 4
NM_181644 0.025465 -1.23888
48966 11764057_s_at 57035 C1orf63 chromosome 1 open reading frame
63
NM_020317 ///
NM_207035
0.000121 -1.23893
42187 11757278_x_at 445 ASS1 argininosuccinate synthase 1 NM_000050 ///
NM_054012
0.009249 -1.24044
37535 11752626_a_at 5087 PBX1 pre-B-cell leukemia homeobox 1 NM_001204961
///
NM_001204963
/// NM_002585
0.011712 -1.24106
8082 11723173_at 54756 IL17RD interleukin 17 receptor D NM_017563 0.003662 -1.2413
304
43900 11758991_at 284069 FAM171A2 family with sequence similarity
171, member A2
NM_198475 0.003381 -1.24169
2762 11717853_at 6366 CCL21 chemokine (C-C motif) ligand 21 NM_002989 0.006669 -1.24311
25340 11740431_s_at 643836 ZFP62 zinc finger protein 62 homolog
(mouse)
NM_001172638
/// NM_152283
0.011418 -1.24403
37133 11752224_a_at 162394 SLFN5 schlafen family member 5 NM_144975 0.017746 -1.24454
26134 11741225_a_at 57082 CASC5 cancer susceptibility candidate 5 NM_144508 ///
NM_170589
0.016498 -1.24472
16712 11731803_a_at 399948 C11orf92 chromosome 11 open reading frame
92
NM_207429 ///
NR_034154
0.008069 -1.2453
6125 11721216_s_at 54664 TMEM106B transmembrane protein 106B NM_001134232
/// NM_018374
0.035951 -1.24585
6627 11721718_a_at 546 ATRX alpha thalassemia/mental
retardation syndrome X-linked
NM_000489 ///
NM_138270 ///
NM_138271
0.045416 -1.24606
45732 11760823_x_at 6324 SCN1B sodium channel, voltage-gated, type
I, beta subunit
NM_001037 ///
NM_199037
0.045525 -1.24654
44745 11759836_at 9886 RHOBTB1 Rho-related BTB domain
containing 1
NM_001242359
/// NM_014836
/// NR_024554
/// NR_024555
0.041544 -1.24688
18642 11733733_a_at 51611 DPH5 DPH5 homolog (S. cerevisiae) NM_001077394
///
NM_001077395
/// NM_015958
0.022314 -1.24689
4601 11719692_a_at 5920 RARRES3 retinoic acid receptor responder
(tazarotene induced) 3
NM_004585 0.000751 -1.24696
305
1153 11716244_s_at 10163 WASF2 WAS protein family, member 2 NM_001201404
/// NM_006990
0.041973 -1.24753
29137 11744228_x_at 93129 ORAI3 ORAI calcium release-activated
calcium modulator 3
NM_152288 0.007309 -1.24772
6213 11721304_at 10267 RAMP1 receptor (G protein-coupled)
activity modifying protein 1
NM_005855 0.023286 -1.24875
25751 11740842_at 401145 FAM190A family with sequence similarity
190, member A
NM_001145065
/// NM_207491
0.005094 -1.24915
4416 11719507_a_at 57325 CSRP2BP CSRP2 binding protein NM_020536 ///
NM_177926 ///
NR_028402
0.02803 -1.24964
16566 11731657_s_at 10451 VAV3 vav 3 guanine nucleotide exchange
factor
NM_001079874
/// NM_006113
0.005075 -1.24991
15688 11730779_at 126 ADH1C alcohol dehydrogenase 1C (class I),
gamma polypeptide
NM_000669 0.000333 -1.25012
15488 11730579_a_at 57520 HECW2 HECT, C2 and WW domain
containing E3 ubiquitin protein
ligase 2
NM_020760 0.003253 -1.25085
42842 11757933_s_at 7832 BTG2 BTG family, member 2 NM_006763 0.002055 -1.25124
41497 11756588_a_at 55808 ST6GALNAC1 ST6 (alpha-N-acetyl-neuraminyl-
2,3-beta-galactosyl-1,3)-N-
acetylgalactosaminide alpha-2
NM_018414 0.007672 -1.25186
47438 11762529_at 55612 FERMT1 fermitin family member 1 NM_017671 0.039922 -1.25232
39769 11754860_a_at 7586 ZKSCAN1 zinc finger with KRAB and SCAN
domains 1
NM_003439 0.030506 -1.25359
37224 11752315_a_at 129563 DIS3L2 DIS3 mitotic control homolog (S.
cerevisiae)-like 2
NM_001257281
///
0.021344 -1.25481
306
NM_001257282
/// NM_152383
/// NR_046476
/// NR_046477
16737 11731828_at 221914 GPC2 glypican 2 NM_152742 0.024006 -1.25497
37427 11752518_a_at 55102 ATG2B autophagy related 2B NM_018036 0.024243 -1.25518
3946 11719037_a_at 7405 UVRAG UV radiation resistance associated
gene
NM_003369 0.003668 -1.25647
29228 11744319_a_at 80235 PIGZ phosphatidylinositol glycan anchor
biosynthesis, class Z
NM_025163 0.01918 -1.25682
10335 11725426_a_at 5873 RAB27A RAB27A, member RAS oncogene
family
NM_004580 ///
NM_183234 ///
NM_183235 ///
NM_183236
0.043738 -1.25729
35951 11751042_a_at 2153 F5 coagulation factor V (proaccelerin,
labile factor)
NM_000130 0.009224 -1.25795
36598 11751689_a_at 10020 GNE glucosamine (UDP-N-acetyl)-2-
epimerase/N-acetylmannosamine
kinase
NM_001128227
///
NM_001190383
///
NM_001190384
///
NM_001190388
/// NM_005476
0.030207 -1.25848
42531 11757622_s_at 85453 TSPYL5 TSPY-like 5 NM_033512 0.038948 -1.25874
44503 11759594_at 100616102 ///
100862685
ERVK-19 ///
ERVK-9
endogenous retrovirus group K,
member 19 /// endogenous
--- 0.048496 -1.25896
307
retrovirus group K, member 9
28752 11743843_a_at 54943 DNAJC28 DnaJ (Hsp40) homolog, subfamily
C, member 28
NM_001040192
/// NM_017833
0.005817 -1.26047
3699 11718790_at 55502 HES6 hairy and enhancer of split 6
(Drosophila)
NM_001142853
/// NM_018645
0.000136 -1.26062
48714 11763805_a_at 149986 LSM14B LSM14B, SCD6 homolog B (S.
cerevisiae)
NM_144703 0.028343 -1.26131
42724 11757815_s_at 25840 METTL7A methyltransferase like 7A NM_014033 0.00147 -1.2614
1748 11716839_a_at 51655 RASD1 RAS, dexamethasone-induced 1 NM_001199989
/// NM_016084
0.01462 -1.2623
29560 11744651_a_at 27035 NOX1 NADPH oxidase 1 NM_007052 ///
NM_013954 ///
NM_013955
0.000814 -1.26244
39503 11754594_a_at 1836 SLC26A2 solute carrier family 26 (sulfate
transporter), member 2
NM_000112 0.030755 -1.26315
14953 11730044_a_at 84688 C9orf24 chromosome 9 open reading frame
24
NM_001252195
/// NM_032596
/// NM_147168
/// NM_147169
0.045568 -1.26447
43306 11758397_s_at 81790 RNF170 ring finger protein 170 NM_001160223
///
NM_001160224
///
NM_001160225
/// NM_030954
/// NR_027668
/// NR_02766
0.010982 -1.26506
308
38320 11753411_a_at 23197 FAF2 Fas associated factor family
member 2
NM_014613 0.040681 -1.26559
30988 11746079_a_at 113 ADCY7 adenylate cyclase 7 NM_001114 0.003523 -1.26587
41715 11756806_a_at 3669 ISG20 interferon stimulated exonuclease
gene 20kDa
NM_002201 2.58E-05 -1.26625
10912 11726003_a_at 51315 KRCC1 lysine-rich coiled-coil 1 NM_016618 0.001054 -1.26682
20868 11735959_at 344018 FIGLA folliculogenesis specific basic helix-
loop-helix
NM_001004311 0.008797 -1.26683
38104 11753195_a_at 80274 SCUBE1 signal peptide, CUB domain, EGF-
like 1
NM_173050 0.032757 -1.26762
48145 11763236_at 149076 ZNF362 Zinc finger protein 362 NM_152493 0.026231 -1.26776
14349 11729440_at 203562 TMEM31 transmembrane protein 31 NM_182541 0.03059 -1.26808
39380 11754471_a_at 3109 HLA-DMB major histocompatibility complex,
class II, DM beta
NM_002118 0.030613 -1.26829
42624 11757715_a_at 642587 MIR205HG MIR205 host gene (non-protein
coding)
NM_001104548 0.007751 -1.26991
12939 11728030_a_at 285313 IGSF10 immunoglobulin superfamily,
member 10
NM_001178145
///
NM_001178146
/// NM_178822
0.005391 -1.27027
11066 11726157_at 139886 SPIN4 spindlin family, member 4 NM_001012968 0.027853 -1.27111
8857 11723948_s_at 6519 SLC3A1 solute carrier family 3 (cystine,
dibasic and neutral amino acid
transporters, activato
NM_000341 0.003673 -1.27118
20409 11735500_a_at 696 BTN1A1 butyrophilin, subfamily 1, member
A1
NM_001732 0.022304 -1.27142
860 11715951_s_at 115207 KCTD12 potassium channel tetramerisation NM_138444 0.021417 -1.27191
309
domain containing 12
5350 11720441_x_at 25903 OLFML2B olfactomedin-like 2B NM_015441 0.00397 -1.27259
39793 11754884_s_at 57590 WDFY1 WD repeat and FYVE domain
containing 1
NM_020830 0.049915 -1.27348
12461 11727552_at 2535 FZD2 frizzled family receptor 2 NM_001466 0.007723 -1.27385
21406 11736497_a_at 23112 TNRC6B trinucleotide repeat containing 6B NM_001024843
///
NM_001162501
/// NM_015088
0.007254 -1.27394
20848 11735939_at 730755 ///
85294
KRTAP2-4 ///
LOC730755
keratin associated protein 2-4 ///
keratin associated protein 2-4-like
NM_001165252
/// NM_033184
0.024651 -1.27397
25489 11740580_at 427 ASAH1 N-acylsphingosine amidohydrolase
(acid ceramidase) 1
NM_001127505
/// NM_004315
/// NM_177924
0.016775 -1.27454
8926 11724017_a_at 127700 OSCP1 organic solute carrier partner 1 NM_145047 ///
NM_206837
0.04227 -1.27492
43591 11758682_s_at 90871 C9orf123 chromosome 9 open reading frame
123
NM_033428 0.012916 -1.27527
27736 11742827_a_at 23469 PHF3 PHD finger protein 3 NM_015153 0.03338 -1.27653
24789 11739880_a_at 169792 GLIS3 GLIS family zinc finger 3 NM_001042413
/// NM_152629
0.02803 -1.27692
20990 11736081_at 819 CAMLG calcium modulating ligand NM_001745 0.006621 -1.27789
27738 11742829_x_at 23469 PHF3 PHD finger protein 3 NM_015153 0.018363 -1.278
1395 11716486_at 8857 FCGBP Fc fragment of IgG binding protein NM_003890 0.034969 -1.27848
17757 11732848_a_at 153768 PRELID2 PRELI domain containing 2 NM_138492 ///
NM_182960 ///
NM_205846
0.016394 -1.27874
310
11239 11726330_a_at 9963 SLC23A1 solute carrier family 23 (nucleobase
transporters), member 1
NM_005847 ///
NM_152685
0.001014 -1.27999
37982 11753073_a_at 7292 TNFSF4 tumor necrosis factor (ligand)
superfamily, member 4
NM_003326 0.02055 -1.28155
38249 11753340_a_at 3384 ICAM2 intercellular adhesion molecule 2 NM_000873 ///
NM_001099786
///
NM_001099787
///
NM_001099788
///
NM_001099789
0.022321 -1.28185
7747 11722838_a_at 2568 GABRP gamma-aminobutyric acid (GABA)
A receptor, pi
NM_014211 0.005674 -1.28205
6365 11721456_x_at 5265 SERPINA1 serpin peptidase inhibitor, clade A
(alpha-1 antiproteinase, antitrypsin),
member 1
NM_000295 ///
NM_001002235
///
NM_001002236
///
NM_001127700
///
NM_001127701
/// NM_00
0.001629 -1.28231
9256 11724347_a_at 23245 ASTN2 astrotactin 2 NM_001184734
///
NM_001184735
/// NM_014010
/// NM_198186
0.017982 -1.28324
311
/// NM_198187
/// NM_198188
45244 11760335_s_at 10436 EMG1 EMG1 nucleolar protein homolog
(S. cerevisiae)
NM_006331 0.032114 -1.28401
21486 11736577_a_at 134728 IRAK1BP1 interleukin-1 receptor-associated
kinase 1 binding protein 1
NM_001010844 0.027579 -1.28421
42786 11757877_a_at 547 KIF1A kinesin family member 1A NM_001244008
/// NM_004321
0.049659 -1.28448
1134 11716225_a_at 51474 LIMA1 LIM domain and actin binding 1 NM_001113546
///
NM_001113547
///
NM_001243775
/// NM_016357
0.020845 -1.28473
8281 11723372_a_at 139818 DOCK11 dedicator of cytokinesis 11 NM_144658 0.021828 -1.28545
30333 11745424_a_at 10592 SMC2 structural maintenance of
chromosomes 2
NM_001042550
///
NM_001042551
///
NM_001265602
/// NM_006444
0.021935 -1.2857
46384 11761475_x_at 79465 ULBP3 UL16 binding protein 3 NM_024518 0.017126 -1.28672
18998 11734089_a_at 863 CBFA2T3 core-binding factor, runt domain,
alpha subunit 2; translocated to, 3
NM_005187 ///
NM_175931
0.018349 -1.28685
18914 11734005_s_at 201931 TMEM192 transmembrane protein 192 NM_001100389
/// NM_152681
0.048167 -1.28847
40203 11755294_x_at 4703 NEB nebulin NM_001164507
///
0.010163 -1.28987
312
NM_001164508
/// NM_004543
43383 11758474_s_at 399948 C11orf92 chromosome 11 open reading frame
92
NM_207429 ///
NR_034154
0.004775 -1.29007
6363 11721454_a_at 5265 SERPINA1 serpin peptidase inhibitor, clade A
(alpha-1 antiproteinase, antitrypsin),
member 1
NM_000295 ///
NM_001002235
///
NM_001002236
///
NM_001127700
///
NM_001127701
/// NM_00
0.002156 -1.29052
37776 11752867_a_at 10908 PNPLA6 patatin-like phospholipase domain
containing 6
NM_001166111
///
NM_001166112
///
NM_001166113
///
NM_001166114
/// NM_006702
0.036812 -1.29102
36815 11751906_a_at 5797 PTPRM protein tyrosine phosphatase,
receptor type, M
NM_001105244
/// NM_002845
0.00182 -1.29125
9384 11724475_a_at 57509 MTUS1 microtubule associated tumor
suppressor 1
NM_001001924
///
NM_001001925
///
NM_001001927
0.008062 -1.29213
313
///
NM_001001931
///
NM_001166393
/// NM
30036 11745127_x_at 7138 TNNT1 troponin T type 1 (skeletal, slow) NM_001126132
///
NM_001126133
/// NM_003283
0.004097 -1.29326
15613 11730704_s_at 81285 OR51E2 olfactory receptor, family 51,
subfamily E, member 2
NM_030774 0.026457 -1.2935
45803 11760894_s_at 6430 SRSF5 serine/arginine-rich splicing factor 5 NM_001039465
/// NM_006925
0.016484 -1.29479
36054 11751145_a_at 23376 UFL1 UFM1-specific ligase 1 NM_015323 0.022721 -1.2978
35770 11750861_x_at 8418 CMAHP cytidine monophospho-N-
acetylneuraminic acid hydroxylase,
pseudogene
NR_002174 ///
NR_027626
0.032434 -1.29807
36749 11751840_s_at 255180 FLJ38723 uncharacterized FLJ38723 NM_173805 ///
XR_132593 ///
XR_133071
0.008121 -1.29919
36240 11751331_a_at 64798 DEPTOR DEP domain containing MTOR-
interacting protein
NM_022783 0.000199 -1.29997
46264 11761355_a_at 10084 PQBP1 polyglutamine binding protein 1 NM_001032381
///
NM_001032382
///
NM_001032383
///
0.022616 -1.30309
314
NM_001032384
///
NM_001032385
/// NM
31747 11746838_a_at 26058 GIGYF2 GRB10 interacting GYF protein 2 NM_001103146
///
NM_001103147
///
NM_001103148
/// NM_015575
0.005785 -1.3032
33457 11748548_a_at 5025 P2RX4 purinergic receptor P2X, ligand-
gated ion channel, 4
NM_001256796
///
NM_001261397
///
NM_001261398
/// NM_002560
/// NM_175567
/// NM_17556
0.033658 -1.30328
32040 11747131_at 83998 REG4 regenerating islet-derived family,
member 4
NM_001159352
///
NM_001159353
/// NM_032044
0.005908 -1.30564
47143 11762234_a_at 4149 MAX MYC associated factor X NM_002382 ///
NM_145112 ///
NM_145113 ///
NM_145114 ///
NM_145116 ///
NM_197957
0.024282 -1.3077
315
7618 11722709_a_at 54462 FAM190B family with sequence similarity
190, member B
NM_018999 0.017885 -1.31036
1044 11716135_a_at 9961 MVP major vault protein NM_005115 ///
NM_017458
0.007348 -1.31096
23241 11738332_a_at 10317 B3GALT5 UDP-Gal:betaGlcNAc beta 1,3-
galactosyltransferase, polypeptide 5
NM_006057 ///
NM_033170 ///
NM_033171 ///
NM_033172 ///
NM_033173
0.027184 -1.31194
34843 11749934_s_at 3323 HSP90AA4P heat shock protein 90kDa alpha
(cytosolic), class A member 4,
pseudogene
NR_036692 4.31E-05 -1.31311
25821 11740912_a_at 55024 BANK1 B-cell scaffold protein with ankyrin
repeats 1
NM_001083907
///
NM_001127507
/// NM_017935
0.001232 -1.31351
8687 11723778_at 113612 CYP2U1 cytochrome P450, family 2,
subfamily U, polypeptide 1
NM_183075 0.006067 -1.31428
28204 11743295_a_at 1063 CENPF centromere protein F, 350/400kDa
(mitosin)
NM_016343 0.041141 -1.31452
9672 11724763_s_at 64798 DEPTOR DEP domain containing MTOR-
interacting protein
NM_022783 0.002325 -1.31576
18475 11733566_a_at 26013 L3MBTL1 l(3)mbt-like 1 (Drosophila) NM_015478 ///
NM_032107
0.005787 -1.31856
17083 11732174_a_at 2188 FANCF Fanconi anemia, complementation
group F
NM_022725 0.015158 -1.31877
46640 11761731_x_at 51548 SIRT6 sirtuin 6 NM_001193285
/// NM_016539
0.021283 -1.32108
316
6366 11721457_a_at 5265 SERPINA1 serpin peptidase inhibitor, clade A
(alpha-1 antiproteinase, antitrypsin),
member 1
NM_000295 ///
NM_001002235
///
NM_001002236
///
NM_001127700
///
NM_001127701
/// NM_00
0.028544 -1.32316
21908 11736999_a_at 7592 ZNF41 zinc finger protein 41 NM_007130 ///
NM_153380
0.034478 -1.32613
34889 11749980_x_at 84525 HOPX HOP homeobox NM_001145459
///
NM_001145460
/// NM_032495
/// NM_139211
/// NM_139212
0.011405 -1.32703
35827 11750918_a_at 253012 HEPACAM2 HEPACAM family member 2 NM_001039372
/// NM_198151
0.013962 -1.32864
3415 11718506_at 7033 TFF3 trefoil factor 3 (intestinal) NM_003226 0.000792 -1.33201
26356 11741447_s_at 6038 RNASE4 ribonuclease, RNase A family, 4 NM_002937 ///
NM_194430 ///
NM_194431
0.00244 -1.33863
6478 11721569_a_at 283 ANG angiogenin, ribonuclease, RNase A
family, 5
NM_001097577
/// NM_001145
0.027187 -1.33982
39246 11754337_s_at 10397 NDRG1 N-myc downstream regulated 1 NM_001135242
///
NM_001258432
0.029326 -1.34082
317
///
NM_001258433
/// NM_006096
47628 11762719_at 3658 IREB2 iron-responsive element binding
protein 2
NM_004136 0.015881 -1.34125
18269 11733360_x_at 6563 SLC14A1 solute carrier family 14 (urea
transporter), member 1 (Kidd blood
group)
NM_001128588
///
NM_001146036
///
NM_001146037
/// NM_015865
0.027089 -1.34247
9671 11724762_a_at 64798 DEPTOR DEP domain containing MTOR-
interacting protein
NM_022783 0.001008 -1.34342
4121 11719212_a_at 388677 NOTCH2NL notch 2 N-terminal like NM_203458 0.026813 -1.34398
47068 11762159_at 23301 EHBP1 EH domain binding protein 1 NM_001142614
///
NM_001142615
///
NM_001142616
/// NM_015252
0.005564 -1.3443
38679 11753770_a_at 22803 XRN2 5'-3' exoribonuclease 2 NM_012255 0.006529 -1.34525
15351 11730442_s_at 728215 FAM155A family with sequence similarity
155, member A
NM_001080396 0.026916 -1.34558
27899 11742990_x_at 7430 EZR ezrin NM_001111077
/// NM_003379
0.049235 -1.34755
13730 11728821_a_at 253012 HEPACAM2 HEPACAM family member 2 NM_001039372
/// NM_198151
0.002761 -1.35247
318
38229 11753320_s_at 55632 G2E3 G2/M-phase specific E3 ubiquitin
protein ligase
NM_017769 0.035822 -1.35578
10087 11725178_at 147040 KCTD11 potassium channel tetramerisation
domain containing 11
NM_001002914 0.007298 -1.36071
46615 11761706_at 9200 PTPLA protein tyrosine phosphatase-like
(proline instead of catalytic
arginine), member A
NM_014241 0.004611 -1.36145
42057 11757148_at 619505 SNORA21 small nucleolar RNA, H/ACA box
21
NR_002576 0.006612 -1.37038
18386 11733477_at 56670 SUCNR1 succinate receptor 1 NM_033050 0.0055 -1.37048
21368 11736459_a_at 27035 NOX1 NADPH oxidase 1 NM_007052 ///
NM_013954 ///
NM_013955
0.008144 -1.37311
1275 11716366_s_at 10136 ///
23436
CELA3A ///
CELA3B
chymotrypsin-like elastase family,
member 3A /// chymotrypsin-like
elastase family, mem
NM_005747 ///
NM_007352
0.008322 -1.38925
7326 11722417_a_at 55323 LARP6 La ribonucleoprotein domain
family, member 6
NM_018357 ///
NM_197958
0.029808 -1.38955
37120 11752211_a_at 340706 VWA2 von Willebrand factor A domain
containing 2
NM_198496 0.007477 -1.39297
3373 11718464_s_at 54492 NEURL1B neuralized homolog 1B
(Drosophila)
NM_001142651
/// NR_015355
0.024115 -1.39907
30297 11745388_x_at 1954 MEGF8 multiple EGF-like-domains 8 NM_001410 ///
NM_178121
0.011358 -1.40016
19110 11734201_s_at 2710 GK glycerol kinase NM_000167 ///
NM_001128127
///
NM_001205019
0.023056 -1.43066
319
/// NM_203391
1507 11716598_a_at 5119 CHMP1A charged multivesicular body protein
1A
NM_001083314
/// NM_002768
/// NR_046418
0.018856 -1.43344
3681 11718772_at 6605 SMARCE1 SWI/SNF related, matrix
associated, actin dependent
regulator of chromatin, subfamily e
NM_003079 0.000268 -1.49914
13953 11729044_at 143503 OR51E1 olfactory receptor, family 51,
subfamily E, member 1
NM_152430 0.008961 -1.50046
39900 11754991_a_at 6257 RXRB retinoid X receptor, beta NM_001270401
/// NM_021976
0.0296 -1.52294
31787 11746878_s_at 3398 ID2 inhibitor of DNA binding 2,
dominant negative helix-loop-helix
protein
NM_002166 0.037375 -1.53804
5666 11720757_a_at 10625 IVNS1ABP influenza virus NS1A binding
protein
NM_006469 ///
NM_016389
1.82E-05 -1.57134
2483 11717574_s_at 5216 PFN1 profilin 1 NM_005022 1.70E-05 -1.69428
30219 11745310_s_at 6519 SLC3A1 solute carrier family 3 (cystine,
dibasic and neutral amino acid
transporters, activato
NM_000341 0.004815 -1.74989
320
Appendices
Appendix B
Altered miRNA expression profile of EV71 infected and non-infected control colorectal cells, HT29.
Column # Probeset ID Species Scientific Name p-value(Infected vs. Control) Fold-Change(Infected vs. Control)
11517 hsa-miR-1975_st Homo sapiens 0.000163 3.94209
11959 hsa-miR-483-5p_st Homo sapiens 0.024704 2.81949
12080 hsa-miR-548a-3p_st Homo sapiens 0.010631 2.71964
11669 hsa-miR-3124_st Homo sapiens 0.047508 2.50557
11434 hsa-miR-149-star_st Homo sapiens 0.000677 2.23921
12237 hsa-miR-664-star_st Homo sapiens 0.01227 2.22846
11617 hsa-miR-2861_st Homo sapiens 0.002286 2.059
12236 hsa-miR-663b_st Homo sapiens 0.01177 1.99451
19572 v11_hsa-miR-768-3p_st Homo sapiens 0.000723 1.89955
321
12166 hsa-miR-601_st Homo sapiens 0.046423 1.79713
12209 hsa-miR-638_st Homo sapiens 0.002766 1.78007
11499 hsa-miR-1915_st Homo sapiens 0.001266 1.70212
11710 hsa-miR-3162_st Homo sapiens 0.027274 1.56497
11874 hsa-miR-4270_st Homo sapiens 0.002332 1.47817
11486 hsa-miR-1909-star_st Homo sapiens 0.024058 1.46414
9845 hp_hsa-mir-525_st Homo sapiens 0.017357 1.45682
11288 hsa-miR-1228-star_st Homo sapiens 0.044908 1.3919
9062 hp_hsa-mir-1181_st Homo sapiens 0.013386 1.38869
11522 hsa-miR-199a-3p_st Homo sapiens 0.008481 1.34305
9576 hp_hsa-mir-320c-2_x_st Homo sapiens 0.031207 1.32182
9736 hp_hsa-mir-449a_st Homo sapiens 0.025192 1.29993
9165 hp_hsa-mir-1282_st Homo sapiens 0.045774 1.26961
9066 hp_hsa-mir-1184-2_s_st Homo sapiens 0.019358 1.2661
322
9507 hp_hsa-mir-3154_st Homo sapiens 0.047258 1.25549
10006 hp_hsa-mir-620_x_st Homo sapiens 0.014759 1.24735
9270 hp_hsa-mir-15b_st Homo sapiens 0.001623 1.23691
9136 hp_hsa-mir-1263_st Homo sapiens 0.015698 1.23327
11785 hsa-miR-33a_st Homo sapiens 0.015369 1.22434
9618 hp_hsa-mir-372_st Homo sapiens 0.024112 1.20353
10020 hp_hsa-mir-631_x_st Homo sapiens 0.000101 1.20226
9807 hp_hsa-mir-516b-2_x_st Homo sapiens 0.013246 1.20032
12294 hsa-miR-922_st Homo sapiens 0.029909 -1.20845
11495 hsa-miR-1913_st Homo sapiens 0.049946 -1.21026
11546 hsa-miR-205_st Homo sapiens 0.007349 -1.21409
9598 hp_hsa-mir-339_st Homo sapiens 0.019065 -1.21441
12204 hsa-miR-633_st Homo sapiens 0.005741 -1.21803
11246 hsa-miR-103-2-star_st Homo sapiens 0.000123 -1.22043
323
9174 hp_hsa-mir-1288_st Homo sapiens 0.031884 -1.22398
11540 hsa-miR-203_st Homo sapiens 0.011568 -1.22787
12172 hsa-miR-607_st Homo sapiens 0.01372 -1.22914
9178 hp_hsa-mir-1289-2_x_st Homo sapiens 0.041897 -1.22958
9707 hp_hsa-mir-4304_st Homo sapiens 0.02584 -1.24091
11489 hsa-miR-190b_st Homo sapiens 0.037805 -1.24125
12211 hsa-miR-640_st Homo sapiens 0.014434 -1.24236
10128 hp_hsa-mir-941-3_s_st Homo sapiens 0.001341 -1.2437
11763 hsa-miR-323b-3p_st Homo sapiens 0.025807 -1.25967
12182 hsa-miR-616-star_st Homo sapiens 0.03395 -1.26134
9895 hp_hsa-mir-548i-4_st Homo sapiens 0.003498 -1.26684
11425 hsa-miR-146b-5p_st Homo sapiens 0.008528 -1.26984
11822 hsa-miR-375_st Homo sapiens 0.038667 -1.27214
12084 hsa-miR-548c-3p_st Homo sapiens 0.014034 -1.27284
324
11797 hsa-miR-34b_st Homo sapiens 0.01083 -1.27311
11672 hsa-miR-3126-5p_st Homo sapiens 0.046993 -1.27517
12208 hsa-miR-637_st Homo sapiens 0.039124 -1.28712
9214 hp_hsa-mir-1321_st Homo sapiens 0.01516 -1.29294
11691 hsa-miR-3144-3p_st Homo sapiens 0.04497 -1.30681
11578 hsa-miR-219-5p_st Homo sapiens 0.003858 -1.31686
12087 hsa-miR-548d-5p_st Homo sapiens 0.022997 -1.31845
9221 hp_hsa-mir-133a-1_x_st Homo sapiens 0.044891 -1.32283
9307 hp_hsa-mir-1911_st Homo sapiens 0.020344 -1.32376
12102 hsa-miR-548t_st Homo sapiens 0.043826 -1.33336
11726 hsa-miR-3178_st Homo sapiens 0.016713 -1.35363
11963 hsa-miR-486-3p_st Homo sapiens 0.009167 -1.35607
12184 hsa-miR-617_st Homo sapiens 9.54E-05 -1.35717
11458 hsa-miR-181a-2-star_st Homo sapiens 0.047522 -1.35906
325
11770 hsa-miR-329_st Homo sapiens 0.006891 -1.39187
11279 hsa-miR-1208_st Homo sapiens 0.046593 -1.40286
12155 hsa-miR-590-5p_st Homo sapiens 0.007432 -1.48358
11566 hsa-miR-212_st Homo sapiens 0.036881 -1.52046
11473 hsa-miR-185-star_st Homo sapiens 0.031342 -1.5402
11890 hsa-miR-4286_st Homo sapiens 0.011371 -1.57105
11395 hsa-miR-134_st Homo sapiens 0.011043 -1.66762
11331 hsa-miR-1266_st Homo sapiens 0.035153 -1.6898
11256 hsa-miR-10a-star_st Homo sapiens 0.015768 -1.74491
11960 hsa-miR-484_st Homo sapiens 0.039047 -1.76997
11923 hsa-miR-4317_st Homo sapiens 0.034233 -1.80619
11786 hsa-miR-33b-star_st Homo sapiens 0.011657 -2.05341
11724 hsa-miR-3176_st Homo sapiens 0.037357 -2.16789
RESEARCH Open Access
Characterisation of enterovirus 71 replicationkinetics in human colorectal cell line, HT29Yan Long Edmund Lui1,2,3, Peter Timms2,3, Louise Marie Hafner2,3*, Tuan Lin Tan4, Kian Hwa Tan1
and Eng Lee Tan1,5
Abstract
Hand, Foot and Mouth Disease (HFMD), a contagious viral disease that commonly affects infants and children withblisters and flu like symptoms, is caused by a group of enteroviruses such as Enterovirus 71 (EV71) andcoxsackievirus A16 (CA16). However some HFMD caused by EV71 may further develop into severe neurologicalcomplications such as encephalitis and meningitis. The route of transmission was postulated that the virus transmitfrom one person to another through direct contact of vesicular fluid or droplet from the infected or via faecal-oralroute. To this end, this study utilised a human colorectal adenocarcinoma cell line (HT29) with epithelioidmorphology as an in vitro model for the investigation of EV71 replication kinetics. Using qPCR, viral RNA was firstdetected in HT29 cells as early as 12 h post infection (hpi) while viral protein was first detected at 48 hpi. Asignificant change in HT29 cells’ morphology was also observed after 48 hpi. Furthermore HT29 cell viability alsosignificantly decreased at 72 hpi. Together, data from this study demonstrated that co-culture of HT29 with EV71 isa useful in vitro model to study the pathogenesis of EV71.
Keywords: Hand, Foot and mouth disease, Enterovirus 71, Virus replication kinetics, Colorectal cell
BackgroundHand, Foot and Mouth Disease (HFMD), a contagiousviral disease that commonly affects infants and children,are caused by a group of enteroviruses such as Entero-virus 71 (EV71) and coxsackievirus A16 (CA16) (Brownet al. 1999; Cardosa et al. 2003; Lee et al. 2009; Prageret al. 2003). This self-limiting disease is characterised byfever, rashes, poor appetite and multiple ulcers in mouth(Brown et al. 1999; Cardosa et al. 2003; Lee et al. 2009;Prager et al. 2003). However, patients infected withEV71 may further develop severe neurological complica-tion such as aseptic meningitis and brainstem/cerebellarencephalitis (Lee and Chang 2010; Lee et al. 2009; Singhet al. 2002; Solomon et al. 2010; McMinn 2002).EV71, a member from the Enterovirus genus of the
Picornaviridae family, is a non-enveloped, positive sense,single stranded, RNA virus with genomic RNA of ap-proximately 7400 bp in length (Lee and Chang 2010;
Oberste et al. 1999a, b). EV71 was first isolated fromHFMD patients with central nervous system disease in1969 (Schmidt et al. 1974). Large fatal EV71 outbreaksof HFMD first appeared in Bulgaria in 1975, and diseaseoutbreaks were subsequently identified in Hungary in1978 and re-emerged in Malaysia in 1997 and Taiwan in1998 (Chumakov et al. 1979; Nagy et al. 1982; Ho et al.1999; Lu et al. 2002; Solomon et al. 2010). HFMD epi-demics and pandemics have been periodically reportedworldwide with outbreaks occurring every two to threeyears in countries including Australia, China, Taiwan,Japan, Korea, Malaysia, Vietnam, Thailand and Singapore(Schmidt et al. 1974; Chumakov et al. 1979; McMinnet al. 2001; Huang et al. 2012). Although the consistentpresences and outbreaks of HFMD push for an urgentneed to develop a vaccine or antiviral therapies againstenteroviruses (Pourianfar et al. 2012; McMinn et al.2001; Tan et al. 2007a,b; Tan et al. 2010). Currently,there are no available antiviral therapies or vaccines ap-proved by the United States Food and Drug Administra-tion (FDA) to prevent HFMD infections (Li et al. 2007).The route of transmission of EV71 was postulated to
happen via direct contact of vesicular fluid or droplet
* Correspondence: [email protected] of Biomedical Sciences, Faculty of Health, Queensland University ofTechnology, Brisbane, Australia3Institute of Health and Biomedical Innovation, Queensland University ofTechnology, Brisbane, AustraliaFull list of author information is available at the end of the article
a SpringerOpen Journal
© 2013 Lui et al.; licensee Springer. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproductionin any medium, provided the original work is properly cited.
Lui et al. SpringerPlus 2013, 2:267http://www.springerplus.com/content/2/1/267
from the infected or via faecal-oral route (Wong et al.2010; Lee et al. 2009; Liu et al. 2000; Brown et al. 1999).EV71 was shown to replicate within the gastrointestinaltract, bypass the gut barrier and infect into the skeletalmuscle cell before entering into the bloodstream and thecentral nervous system (Wong et al. 2010; Lee et al.2009; Liu et al. 2000; Brown et al. 1999). Indeed variousstudies had shown in in vivo model such as mouse thatthe intestine was the initial site of infection for EV71 in-fection with the muscle cells responsible for persistentinfection supporting efficient virus replication (Chenet al. 2007; Chen et al. 2004; Khong et al. 2012). There-fore we hypothesised that it is relevant to study EV71using an in vitro model of a human gastrointestinal celltype origin during the initial stages of infection.In this study, we used a human colorectal adenocar-
cinoma cell line (HT29) with epithelioid morphology asan in vitro model for the investigation of EV71 replica-tion kinetics. To characterise the virus replication inHT29 cells, the viral VP1 RNA and protein were moni-tored using qPCR and western blot respectively. Inaddition, the cell viability of HT29 to EV71 infectionwas monitored throughout the time course of 72 hoursposts infection (hpi).
ResultsThis study aims to characterise the viral replication inan in vitro model of HFMD for EV71 pathogenesisstudy. To this end a human colorectal adenocarcinomacell line (HT29) with epithelioid morphology wasinfected with EV71 over the time course of 72 h.
Cytopathic effects and cell viability of HT29 cells duringEV71 infectionThere are no changes between control and infected cellsat 12 hpi, 24 hpi and 48 hpi (Figure 1). However at72 hpi there was a statistically significant decrease ofapproximately 60% of the infected cells (17.6%) as com-pared to control (77.5%). There are no apparent changein morphology between infected and control cells at12 hpi and 24 hpi. However, at 48 hpi and 72 hpi, cellswere observed to lose its adherence and round up whichsuggest cells are under stress conditions (Figure 1) withcytopathic effect observed. At 72 hpi, in comparisonwith the control and infected cells, there was a highernumber of floating cells in the media which correlate tothe decrease in live cells count (Figure 1).
Viral kinetics of EV71 replicationTo further study EV71 replication kinetics in HT29 cells,the viral RNA and protein synthesis was monitored over72 h. Using established protocols, the kinetics of EV71RNA synthesis in infected HT29 cells were examinedquantitatively using qPCR at various time points (12 hr,
24 hr, 48 hr and 72 hr) (Tan et al. 2008b). Control cellsshow no viral RNA presents (Figure 2). There was anexpected exponential increase in viral RNA copy numberof the infected cells as measured by qPCR. Viral RNAwas first detected at 12 hpi. Approximately 5 millionvirus copy number was detected at 12 hpi, which thendoubles at 24 hpi to approximately 10 million virus copynumber. Subsequently at 48 hpi, it increases 20 folds toapproximately 200 million virus copy number. Finally at72 hpi, it increases 5 folds to 1000 million virus copynumber. The viral copy number quantitated had expo-nential increase at every time points except 72 hpi wherethere was only 5 folds increase in virus copy number(Figure 2).
Viral kinetics of EV71 VP1 protein synthesisIn addition to the detection of viral RNA, the kinetics ofEV71 VP1 protein synthesis in infected HT29 cells wasmonitored using western blot specific to EV71 (Figure 3).Relative expression of EV71 VP1 protein of infected andcontrol cells were analysed using Image J and statisticalsignificant amount of virus protein were only detected at48 hpi and 72 hpi.
Cellular receptor SCARB2 is present in both HT29 and RDcellsReceptor binding is an essential and vital process duringvirus infection of the cells (Patel and Bergelson 2009;Yamayoshi et al. 2012). Cellular receptor plays an im-portant role in the pathogenicity of viruses particularlyduring the internalisation of virus during infection. Assuch we quantified the relative expression of a functionalreceptor, Scavenger receptor class B, member 2(SCARB2) based on the formula: 2(Ct of gene−Ct of ACT).Primers for SCARB2 and ACT were designed to spanexon-exon boundaries to give a single PCR product of89 bp and 198 bp respectively (Figure 4). HT29 wasfound to express SCARB2 at the expression level of ap-proximately 20.2 as compared with RD cells of approxi-mately 26.9. The presence of SCARB2 in HT29 furthersupports HT29 cells as a viable in vitro model to studyEV71 pathogenesis.
DiscussionViral replication kinetics plays an important role in theunderstanding of virus pathogenesis (Baccam et al. 2006;Chang et al. 2006; Major et al. 2004). The kinetics ofvarious viruses such as hepatitis C, Nipah virus and in-fluenza virus have been reported in various studies andhave provided valuable information particularly in re-sponse to antiviral therapeutics which aid in the under-standing the host pathogen interaction (Baccam et al.2006; Chang et al. 2006; Major et al. 2004). In compa-rison, the only information reported for EV71 virus
Lui et al. SpringerPlus 2013, 2:267 Page 2 of 8http://www.springerplus.com/content/2/1/267
kinetics was by Lu et al. (2011) who demonstrated EV71proliferation in rhabdomyosarcoma (RD) cells, of musclecells origin as an in vitro model (Lu et al. 2011). In aclinical context, this may not be a good representativemodel during EV71 infection of a human host. Variousstudies have demonstrated in animal model that thegastrointestinal tract such as the intestine was the firstsite for EV71 proliferation (Chen et al. 2007; Chen et al.2004; Khong et al. 2012). Furthermore, Khong et al.
(2012) reported that mice that were administrated withEV71 via the intraperitoneal route exhibits 100% morta-lity as compared to mice that were administrated withEV71 via the oral route which shows 10-30% mortality(Khong et al. 2012). Interestingly, the mortality result ofmice administrated with EV71 via the oral route (gastro-intestinal tract) reported by Khong et al. (2012)corresponded to the percentage of EV71 infected humanpatient with central nervous system complications. This
Figure 1 Cell viability of HT29 cells following EV71 infection. Confluent HT29 cells were infected with or without EV71 (MOI of 1). (A) HT29cell harvested at different time points and cell viability assessed using vital dye trypan blue. (n = 3, * = p values of < 0.05) (B) Micrograph ofconfluent HT29 cell cultures were taken at a magnification of 20× at different time points for 72 h.
Lui et al. SpringerPlus 2013, 2:267 Page 3 of 8http://www.springerplus.com/content/2/1/267
suggests the relevant of studying EV71 in colorectal cellline (oral route), HT29 as an in vitro model (Ooi et al.2010; Ooi et al. 2009; Ooi et al. 2007).In this study, we have demonstrated that upon EV71
infection in human epithelial colorectal cell line (HT29),significant cell death only occurs at 72 hpi. This was var-ies from the rhabdomyosarcoma (RD) cells previouslyreported by Lu et al. (2011) where most cell deathoccurs within 24 hpi. Similarly Chen et al. (2007) andKhong et al. (2012) proposed that skeletal muscle cellssuch as RD cells are more effective in supporting viralreplication which allow persistent enterovirus infectionto represent viral source of entry into the central ner-vous system (CNS) (Chen et al. 2007; Khong et al. 2012).In comparison with EV71 RNA synthesis, RNA was firstdetected at 12 hpi. Viral protein synthesis was only ob-served at a later stage during the infection possibly dueto translational time required. Lu et al. (2011) showed asimilar trend that virus RNA was first detected at 3 hpiwhile virus protein was observed at 6 hpi. We reckon
Figure 3 Kinetics of EV71 VP1 protein synthesis in HT29 cells. Confluent HT29 cells were infected with or without EV71 (MOI of 1). Totalintracellular protein were harvested at various time points and measured by western blot captured using Quantity One software. (n = 3, * = p valuesof < 0.05) The results were then analysed using Image J. As observed, it trends the results we observed by viral RNA amplification. (A) Intracellular viralVP1 measured by Western blotting with Ponceau S staining control of membrane (B) Relative expression of viral VP1 protein.
Figure 2 Kinetics of EV71 replication in HT29 cells. ConfluentHT29 cells were infected with or without EV71 (MOI of 1). Totalintracellular RNA were harvested at various time points, converted tocDNA and measured by quantitative real time polymerase chain reaction(qRT-PCR) with primers specific to viral VP1. (n = 3, * = p values of < 0.05)As observed, there was an increase in viral copy number throughincreasingly time points.
Lui et al. SpringerPlus 2013, 2:267 Page 4 of 8http://www.springerplus.com/content/2/1/267
that such differences could be due to the fact that ittakes three times longer for the virus to kill HT29 cellsin comparison with RD cells Additional file 1: Table S1.Receptor binding is an essential and vital process dur-
ing virus infection of the cells (Patel and Bergelson 2009;Tan et al. 2013; Yamayoshi et al. 2012). Cellular recep-tors therefore play an important role in the pathogen-icity of viruses. Notwithstanding, viruses have beenfound to utilise multiple receptors for the facilitation ofentry into susceptible cells (Patel and Bergelson 2009;Hayes et al. 2006; Yamayoshi et al. 2009). Thus the iden-tification and characterisation of cellular receptors playsa critical role in the understanding of EV71 pathogen-esis. Scavenger receptor class B, member 2 (SCARB2)was first reported by Yamayoshi et al. (2009) to be a re-ceptor for all EV71 strains and expressed in the sites ofEV71 replication in vivo (Hayes et al. 2006; Yamayoshiet al. 2009). It is composed of 478 amino acids andbelongs to the CD36 family (Yamayoshi et al. 2012).SCARB2 is commonly found in abundant in the lyso-somal membrane of the cell and assist in the internalisa-tion of EV71 into the host cell via clathrin mediatedendocytosis (Hussain et al. 2011; Lui et al. 2013;Yamayoshi et al. 2012). The presence of SCARB2 in
HT29 further supports HT29 cells as a viable in vitromodel to study EV71 pathogenesis.Considering that different cell types have varying cel-
lular content such as cytoskeleton and endoplasmicreticulum network which would potentially plays a rolein virus replication, it is therefore the virus replicationkinetics may differs from cell types to cell types. Indeed,Hussain et al. (2011) has demonstrated that the cytoskel-etal system comprising of both actin and microtubuleswere involved endocytic kinetics (Buss et al. 2001;Durrbach et al. 1996; Flanagan and Lin 1980; Hussainet al. 2011). The knockdown of genes involves incytoskeleton formation such as ARPC5, ARRB1, andWASF1 and the use of drug disrupting the cytoskeletonnetwork such as cytochalasin B, have resulted in the de-crease in EV71 replication kinetics (Hussain et al. 2011;Lui et al. 2013).Furthermore, the incubation period for HFMD is be-
tween three to seven days (Khong et al. 2012; Ooi et al.2010; Ooi et al. 2009; Ooi et al. 2007). This may corres-pond to the number of days the virus requires to passthrough the gastrointestinal tract before spreading itthroughout the body Khong et al. 2012; Ooi et al. 2010;Ooi et al. 2009; Ooi et al. 2007). Therefore the in vitro
Figure 4 Expression SCARB2 in RD and HT29 cells. Total intracellular RNA were harvested from RD and HT29 cells, converted to cDNA andmeasured by quantitative real time polymerase chain reaction (qRT-PCR) with primers specific to SCARB2 and ACT. Primers for SCARB2 and ACTwere designed to span exon-exon boundaries to give a single PCR product of 89 bp and 198 bp respectively. The presence of SCARB2 in HT29further supports HT29 cells as a viable in vitro model to study EV71 pathogenesis.
Lui et al. SpringerPlus 2013, 2:267 Page 5 of 8http://www.springerplus.com/content/2/1/267
model of human epithelial colorectal cell line (HT29)and EV71 may be more clinically relevant and mimicsthe mechanism of pathogenesis of EV71 closer.
ConclusionsIn conclusion, we have established the use of HT29 cellsas a clinically relevant in vitro model of EV71 repli-cation. We have demonstrated for the first time anincrease of viral concentration in a time course of72 hours upon infection with the use of cell viability,qPCR and western blot. In addition, this is the firstreport on the presence of SCARB2 on HT29 cells, anessential receptor for all EV71 strains which establishedHT29 cells as a viable in vitro model to study EV71pathogenesis. Our study has provide valuable knowledgetoward the study of EV71 pathogenesis, virus-host inter-action and this could lead to future investigation for thedevelopment of antiviral therapeutics against EV71.Therapeutic agents against EV71 could be developed bypotentially inhibit several key stages of the viral life cyclesuch as viral attachment, translation, polyprotein pro-cessing and RNA replication with the use of HT29 as anin vitro model for EV71 replication (Chen et al. 2008).
MethodsCell culture and virus propagationHuman colorectal cell line (HT29) (ATCCW catalog no.HTB-38™) was maintained in Roswell Park Memorial In-stitute medium (RPMI) (PAA Laboratories, Austria)supplemented with 10% (v/v) Fetal Bovine Serum (FBS)(PAA Laboratories, Austria) and 2% penicillin–strepto-mycin (PAA Laboratories, Austria) at 37°C with 5% CO2.The EV71 strain used in this study was isolated from afatal case of HFMD during October 2000 outbreak inSingapore, Enterovirus 5865/sin/000009 strain (accessionnumber 316321; hereby designated as Strain 41) fromsubgenogroup B4. The virus stock was prepared bypropagation of viruses using 90% confluent HT29 cellsmonolayer in RPMI with 10% FBS and 2% penicillin–streptomycin at 37°C with 5% CO2. The virus titres weredetermined using 50% tissue culture infective dose(TCID50) per millilitre (mL) according to Reed andMuench method (Reed and Muench 1938).
Viral infectionHT29 cells were seeded at a concentration of 2 × 106 cells/mlin 6-well plates and incubated for 24 h at 37°C with 5%CO2. Cells were washed twice with phosphate buffered sa-line (PBS) and infect with EV71 at multiplicity of infection(MOI) of 1 or nil respectively. Following infection for 1 h,the culture media were removed and replaced with 2 mLof fresh RPMI medium. Micrograph was then taken usingphase contrast microscopy at different time points afterwhich the cells were trypsinised and harvested at 12 h,
24 h, 48 h and 72 h to isolate RNA and proteins for qPCRreactions and western blots respectively.
Cell viability and countsCell count and viability was performed on the Luna™Automated Cell Counter system (Logos Biosystem,USA) in accordance to the manufacturer’s instructions.Briefly, the cells were trypsinised at different time points(12 h, 24 h, 48 h and 72 h). The trypsinised cells werethen topped up with fresh media to a total volume of1000 μl of media and 10 μl of this cell suspension weremixed with 10 μl of tryphan blue. 10 μl of this dilutedcell suspension were then loaded onto the Luna™counting slide for analysis.
RNA isolation and cDNA synthesisThe total cellular RNA of HT29 cells were extractedusing the miRNeasy mini kit (Qiagen, Hilden, Germany)in accordance to the manufacturer’s instructions. Briefly,the cells were lysed and homogenise using lyses solutionprovided (Qiagen, Hilden, Germany). Total RNA wereharvested using the RNeasy spin column and wash twicebefore elution (Qiagen, Hilden, Germany). Harvestedtotal RNA was quantitated using Nanodrop 100 spectro-photometer (Thermo Scientific, Waltham, USA) and1 ng of the total RNA was then reverse transcriptedusing the iScript™ cDNA Synthesis Kit (Bio-Rad Labora-tories, CA, USA) in accordance to the manufacturer’s in-structions. Briefly, 1 ng of the extracted RNA was mixedwith enzyme reverse transcriptase and buffer to a vol-ume of 20 ul and subjected to thermal profile of 25°Cfor 5 m, 42°C for 30 m followed by 85°C for 5 m in ac-cordance to the manufacturer’s instructions.
Quantitative real time polymerase chain reactionThe EV71 specific primers targeting the conserve VP1regions were 5′-GCTCTATAGGAGATAGTGTGAGTAGGG-3′ and the reverse primer 5′-ATGACTGCTCACCTGCGTGTT-3′ (Tan et al. 2008a). Primers forSCARB2 receptors were 5′- CCAATACGTCAGACAATGCC-3′ and the reverse primer 5′-ACCATTCTTGCAGATGCTGA-3′ were designed to span exon-exonboundaries. The primers for the house keeping geneactin (ACT) used were 5′- ACCAACTGGGACGACATGGAGAAA-3′ and the reverse primer 5′-TAGCACAGCCTGGATAGCAACGTA-3′. The quantitative realtime polymerase chain reaction (qRT-PCR) was per-formed using the iQ™ SYBRW Green Super mix (Bio-RadLaboratories, CA, USA) on the Bio-Rad CFX96™ Real-Time PCR system (Bio-Rad Laboratories, CA, USA).Briefly, 1 μl of cDNA and 1 μl of the forward and the re-verse primers were added to iQ™ SYBRW Green Supermix. The reaction mix was then subjected to thermalprofile of denaturation at 95°C for 10 m, followed by
Lui et al. SpringerPlus 2013, 2:267 Page 6 of 8http://www.springerplus.com/content/2/1/267
amplification and quantification in 40 cycles at 95°C for10 s, 60°C for 30 s followed by 50°C for 30 s. At the end ofamplification cycles, melting temperature analysis wasperformed by the Bio-Rad CFX96™ Real-Time PCR system(Bio-Rad Laboratories, CA, USA). Relative gene expressionwas quantified based on the formula: 2(Ct of gene−Ct of ACT).
Western blotTotal cellular protein extraction for HT29 cells and con-trol cells were performed using a lysis mix in mamma-lian cell lysis solution – CelLytic M (Sigma-Aldrich PteLtd, USA) in accordance with manufacturer’s instruc-tions. Equal protein concentration (20 μg) from eachsamples were added into SDS PAGE, 10% Mini-PROTEANW TGX™ (Bio-Rad Laboratories, CA, USA)and separated by electrophoresis. Separated proteinswere transferred onto polyvinylidene diflouride mem-branes (Invitrogen, California, USA) using iBlotW
Western Detection kit (Invitrogen, California, USA) inaccordance to manufacturer instructions. Ponceau Sstaining was performed to ensure equal level of proteinpresent in all lanes according to Romero-Calvo et al.(2010) (Romero-Calvo et al. 2010). Briefly, membraneswere stained with Ponceau S (Sigma-Aldrich Pte Ltd,USA) for 1 m and washed three times with water toremove stain. Western blot was then performedusing Western BreezeW Chromogenic Kit–Anti-Mouse(Invitrogen, California, USA) in accordance to manufac-turer instructions. Briefly, the membranes were incu-bated with mouse anti EV71 antibody (AbD serotech,Oxford, UK) or anti Tubulin antibody (Santa CruzBiotechnology inc, California, USA) respectively inshaker for an hour. The membranes were washed threetimes before and incubating with secondary antibodies(Invitrogen, California, USA) for 30 m. The membraneswere washed three times and incubated with chromogensubstrate till purple bands were developed in 1 h. Themembranes were left to air dry then placed into thedensitometer and scanned using the Quantity One soft-ware (Bio-Rad Laboratories, CA, USA). The picturewas analysed using Image J (National Institutes ofHealth, USA).
Statistical analysisAll statistical analysis was performed on Graph PadPrism Version 6.0c (Graph Pad Software, USA). Studentt test was used to compare two groups. p values of < 0.05were considered statistically significant.
Additional file
Additional file 1: Table S1. Proposed timeline of EV71 replicationkinetics in HT29 cells.
Competing interestsThe authors declare that they have no competing interests.
Authors’ contributionsYLEL perform the work, evaluate the result and wrote the paper. TLT performthe work. LMH, PT, KHT, ELT provide research idea, design the work andevaluate manuscript. All authors read and approved the final manuscript.
AcknowledgementsWe would like to thank Mrs Phoon Meng Chee from the Department ofMicrobiology, National University of Singapore for providing the EV71 strain5865/sin/000009. The Human colorectal cell line (HT29) (ATCCW catalog no.HTB-38™) was a gift from Mr Woo Wee Hong from the School of Chemical &Life Sciences, Singapore Polytechnic. This research was supported bySingapore Polytechnic. Yan Long Edmund Lui was supported by QueenslandUniversity of Technology Higher Degree Research Award Scholarship.
Author details1Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singapore,Singapore. 2School of Biomedical Sciences, Faculty of Health, QueenslandUniversity of Technology, Brisbane, Australia. 3Institute of Health andBiomedical Innovation, Queensland University of Technology, Brisbane,Australia. 4School of Chemical and Life Sciences, Singapore Polytechnic,Singapore, Singapore. 5Department of Paediatrics, University Children’sMedical Institute, National University Hospital, Singapore, Singapore.
Received: 25 April 2013 Accepted: 10 June 2013Published: 18 June 2013
ReferencesBaccam P, Beauchemin C, Macken CA, Hayden FG, Perelson AS (2006) Kinetics of
influenza a virus infection in humans. J Virol 80(15):7590–7599. doi:10.1128/jvi.01623-05
Brown BA, Oberste MS, Alexander JP, Jr, Kennett ML, Pallansch MA (1999)Molecular epidemiology and evolution of enterovirus 71 strains isolated from1970 to 1998. J Virol 73(12):9969–9975
Buss F, Luzio JP, Kendrick-Jones J (2001) Myosin VI, a new force in clathrinmediated endocytosis. FEBS Lett 508(3):295–299
Cardosa MJ, Perera D, Brown BA, Cheon D, Chan HM, Chan KP, Cho H, McMinn P(2003) Molecular epidemiology of human enterovirus 71 strains and recentoutbreaks in the Asia-Pacific region: comparative analysis of the VP1 and VP4genes. Emerg Infect Dis 9(4):461–468. doi:10.3201/eid0904.020395
Chang LY, Ali AR, Hassan SS, AbuBakar S (2006) Quantitative estimation of Nipahvirus replication kinetics in vitro. Virol J 3:47. doi:10.1186/1743-422x-3-47
Chen CS, Yao YC, Lin SC, Lee YP, Wang YF, Wang JR, Liu CC, Lei HY, Yu CK (2007)Retrograde axonal transport: a major transmission route of enterovirus 71 inmice. J Virol 81(17):8996–9003. doi:10.1128/JVI.00236-07
Chen TC, Weng KF, Chang SC, Lin JY, Huang PN, Shih SR (2008) Development ofantiviral agents for enteroviruses. J Antimicrob Chemother 62(6):1169–1173.doi:10.1093/jac/dkn424
Chen YC, Yu CK, Wang YF, Liu CC, Su IJ, Lei HY (2004) A murine oral enterovirus71 infection model with central nervous system involvement. J Gen Virol85(Pt 1):69–77
Chumakov M, Voroshilova M, Shindarov L, Lavrova I, Gracheva L, Koroleva G,Vasilenko S, Brodvarova I, Nikolova M, Gyurova S, Gacheva M, Mitov G, NinovN, Tsylka E, Robinson I, Frolova M, Bashkirtsev V, Martiyanova L, Rodin V(1979) Enterovirus 71 isolated from cases of epidemic poliomyelitis-likedisease in Bulgaria. Arch Virol 60(3–4):329–340
Durrbach A, Louvard D, Coudrier E (1996) Actin filaments facilitate two steps ofendocytosis. J Cell Sci 109(Pt 2):457–465
Flanagan MD, Lin S (1980) Cytochalasins block actin filament elongation bybinding to high affinity sites associated with F-actin. J Biol Chem255(3):835–838
Hayes MJ, Shao D, Bailly M, Moss SE (2006) Regulation of actin dynamics byannexin 2. EMBO J 25(9):1816–1826. doi:10.1038/sj.emboj.7601078
Ho M, Chen ER, Hsu KH, Twu SJ, Chen KT, Tsai SF, Wang JR, Shih SR (1999) Anepidemic of enterovirus 71 infection in Taiwan. Taiwan enterovirusepidemic working group. N Engl J Med 341(13):929–935. doi:10.1056/NEJM199909233411301
Lui et al. SpringerPlus 2013, 2:267 Page 7 of 8http://www.springerplus.com/content/2/1/267
Huang HI, Weng KF, Shih SR (2012) Viral and host factors that contribute topathogenicity of enterovirus 71. Future Microbiol 7(4):467–479. doi:10.2217/fmb.12.22
Hussain KM, Leong KL, Ng MM, Chu JJ (2011) The essential role of clathrin-mediated endocytosis in the infectious entry of human enterovirus 71. J BiolChem 286(1):309–321. doi:10.1074/jbc.M110.168468
Khong WX, Yan B, Yeo H, Tan EL, Lee JJ, Ng JK, Chow VT, Alonso S (2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibits neurotropism, causingneurological manifestations in a novel mouse model of EV71 infection. J Virol86(4):2121–2131. doi:10.1128/jvi.06103-11
Lee MS, Chang LY (2010) Development of enterovirus 71 vaccines. Expert RevVaccines 9(2):149–156. doi:10.1586/erv.09.152
Lee TC, Guo HR, Su HJ, Yang YC, Chang HL, Chen KT (2009) Diseases caused byenterovirus 71 infection. Pediatr Infect Dis J 28(10):904–910. doi:10.1097/INF.0b013e3181a41d63
Li C, Wang H, Shih SR, Chen TC, Li ML (2007) The efficacy of viral capsidinhibitors in human enterovirus infection and associated diseases. Curr MedChem 14(8):847–856
Liu CC, Tseng HW, Wang SM, Wang JR, Su IJ (2000) An outbreak of enterovirus 71infection in Taiwan, 1998: epidemiologic and clinical manifestations. J ClinVirol 17(1):23–30. doi:10.1016/s1386-6532(00)00068-8
Lu CY, Lee CY, Kao CL, Shao WY, Lee PI, Twu SJ, Yeh CC, Lin SC, Shih WY, Wu SI,Huang LM (2002) Incidence and case-fatality rates resulting from the 1998enterovirus 71 outbreak in Taiwan. J Med Virol 67(2):217–223. doi:10.1002/jmv.2210
Lu J, He YQ, Yi LN, Zan H, Kung HF, He ML (2011) Viral kinetics of enterovirus 71in human abdomyosarcoma cells. World J Gastroenterol 17(36):4135–4142.doi:10.3748/wjg.v17.i36.4135
Lui YLE, Lin Z, Lee JJ, Chow VTK, Poh CL, Tan EL (2013) Beta-actin variant isnecessary for Enterovirus 71 replication. Biochem Biophys Res Commun433(4):607–610. doi:10.1016/j.bbrc.2013.03.044
Major ME, Dahari H, Mihalik K, Puig M, Rice CM, Neumann AU, Feinstone SM(2004) Hepatitis C virus kinetics and host responses associated with diseaseand outcome of infection in chimpanzees. Hepatology (Baltimore, Md)39(6):1709–1720. doi:10.1002/hep.20239
McMinn P, Stratov I, Nagarajan L, Davis S (2001) Neurological manifestations ofenterovirus 71 infection in children during an outbreak of hand, foot, andmouth disease in Western Australia. Clin Infect Dis 32(2):236–242.doi:10.1086/318454
McMinn PC (2002) An overview of the evolution of enterovirus 71 and its clinicaland public health significance. FEMS Microbiol Rev 26(1):91–107
Nagy G, Takatsy S, Kukan E, Mihaly I, Domok I (1982) Virological diagnosis ofenterovirus type 71 infections: experiences gained during an epidemic ofacute CNS diseases in Hungary in 1978. Arch Virol 71(3):217–227
Oberste MS, Maher K, Kilpatrick DR, Flemister MR, Brown BA, Pallansch MA(1999a) Typing of human enteroviruses by partial sequencing of VP1. J ClinMicrobiol 37(5):1288–1293
Oberste MS, Maher K, Kilpatrick DR, Pallansch MA (1999b) Molecular evolution ofthe human enteroviruses: correlation of serotype with VP1 sequence andapplication to picornavirus classification. J Virol 73(3):1941–1948
Ooi MH, Wong SC, Lewthwaite P, Cardosa MJ, Solomon T (2010) Clinical features,diagnosis, and management of enterovirus 71. Lancet Neurol 9(11):1097–1105.doi:10.1016/s1474-4422(10)70209-x
Ooi MH, Wong SC, Mohan A, Podin Y, Perera D, Clear D, del Sel S, Chieng CH, Tio PH,Cardosa MJ, Solomon T (2009) Identification and validation of clinical predictorsfor the risk of neurological involvement in children with hand, foot, and mouthdisease in Sarawak. BMC Infect Dis 9:3. doi:10.1186/1471-2334-9-3
Ooi MH, Wong SC, Podin Y, Akin W, del Sel S, Mohan A, Chieng CH, Perera D,Clear D, Wong D, Blake E, Cardosa J, Solomon T (2007) Human enterovirus71 disease in Sarawak, Malaysia: a prospective clinical, virological, andmolecular epidemiological study. Clin Infect Dis 44(5):646–656.doi:10.1086/511073
Patel KP, Bergelson JM (2009) Receptors identified for hand, foot and mouthvirus. Nat Med 15(7):728–729. doi:10.1038/nm0709-728
Pourianfar HR, Poh CL, Fecondo J, Grollo L (2012) In vitro evaluation of theantiviral activity of heparan sulfate mimetic compounds against Enterovirus71. Virus Res 169(1):22–29. doi:10.1016/j.virusres.2012.06.025
Prager P, Nolan M, Andrews IP, Williams GD (2003) Neurogenic pulmonaryedema in enterovirus 71 encephalitis is not uniformly fatal but causessevere morbidity in survivors. Pediatr Crit Care Med 4(3):377–381.doi:10.1097/01.PCC.0000074274.58997.FE
Reed LJ, Muench H (1938) A simple method of estimating fifty percent endpoints.Am J Hyg 27:493–497
Romero-Calvo I, Ocón B, Martínez-Moya P, Suárez MD, Zarzuelo A, Martínez-Augustin O, de Medina FS (2010) Reversible Ponceau staining as a loadingcontrol alternative to actin in Western blots. Anal Biochem 401(2):318–320.doi:10.1016/j.ab.2010.02.036
Schmidt NJ, Lennette EH, Ho HH (1974) An apparently new enterovirus isolatedfrom patients with disease of the central nervous system. J Infect Dis129(3):304–309
Singh S, Chow VT, Phoon MC, Chan KP, Poh CL (2002) Direct detection ofenterovirus 71 (EV71) in clinical specimens from a hand, foot, and mouthdisease outbreak in Singapore by reverse transcription-PCR with universalenterovirus and EV71-specific primers. J Clin Microbiol 40(8):2823–2827
Solomon T, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, Ooi MH (2010)Virology, epidemiology, pathogenesis, and control of enterovirus 71. LancetInfect Dis 10(11):778–790. doi:10.1016/S1473-3099(10)70194-8
Tan CW, Poh CL, Sam IC, Chan YF (2013) Enterovirus 71 uses cell surface heparansulfate glycosaminoglycan as an attachment receptor. J Virol 87(1):611–620.doi:10.1128/jvi.02226-12
Tan EL, Chow VT, Quak SH, Yeo WC, Poh CL (2008a) Development of multiplexreal-time hybridization probe reverse transcriptase polymerase chain reactionfor specific detection and differentiation of enterovirus 71 and coxsackievirusA16. Diagn Microbiol Infect Dis 61(3):294–301. doi:10.1016/j.diagmicrobio.2008.02.009
Tan EL, Tan TM, Chow VT, Poh CL (2007a) Enhanced potency and efficacy of29-mer shRNAs in inhibition of enterovirus 71. Antiviral Res 74(1):9–15.doi:10.1016/j.antiviral.2007.01.004
Tan EL, Tan TM, Tak Kwong Chow V, Poh CL (2007b) Inhibition of enterovirus 71in virus-infected mice by RNA interference. Mol Ther 15(11):1931–1938.doi:10.1038/sj.mt.6300287
Tan EL, Wong AP, Poh CL (2010) Development of potential antiviral strategy againstcoxsackievirus B4. Virus Res 150(1–2):85–92. doi:10.1016/j.virusres.2010.02.017
Tan EL, Yong LL, Quak SH, Yeo WC, Chow VT, Poh CL (2008b) Rapid detection ofenterovirus 71 by real-time TaqMan RT-PCR. J Clin Virol 42(2):203–206.doi:10.1016/j.jcv.2008.01.001
Wong SS, Yip CC, Lau SK, Yuen KY (2010) Human enterovirus 71 and hand,foot and mouth disease. Epidemiol Infect 138(8):1071–1089.doi:10.1017/S0950268809991555
Yamayoshi S, Fujii K, Koike S (2012) Scavenger receptor b2 as a receptor for hand,foot, and mouth disease and severe neurological diseases. Front Microbiol 3:32.doi:10.3389/fmicb.2012.00032
Yamayoshi S, Yamashita Y, Li J, Hanagata N, Minowa T, Takemura T, Koike S (2009)Scavenger receptor B2 is a cellular receptor for enterovirus 71. Nat Med15(7):798–801. doi:10.1038/nm.1992
doi:10.1186/2193-1801-2-267Cite this article as: Lui et al.: Characterisation of enterovirus 71replication kinetics in human colorectal cell line, HT29. SpringerPlus 20132:267.
Submit your manuscript to a journal and benefi t from:
7 Convenient online submission
7 Rigorous peer review
7 Immediate publication on acceptance
7 Open access: articles freely available online
7 High visibility within the fi eld
7 Retaining the copyright to your article
Submit your next manuscript at 7 springeropen.com
Lui et al. SpringerPlus 2013, 2:267 Page 8 of 8http://www.springerplus.com/content/2/1/267
FEBS Open Bio 4 (2014) 426–431
journal homepage: www.elsevier .com/locate / febsopenbio
Elucidating the host–pathogen interaction between human colorectalcells and invading Enterovirus 71 using transcriptomics profiling
http://dx.doi.org/10.1016/j.fob.2014.04.0052211-5463/� 2014 The Authors. Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies.This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
Abbreviations: EV71, Enterovirus 71; HFMD, Hand, Foot and Mouth Disease; ISG,interferon stimulated genes; MOI, multiplicity of infection; RD, rhabdomyosarcoma⇑ Corresponding authors. Address: Institute of Health and Biomedical Innovation
(IHBI), Queensland University of Technology, 2 George Street, Brisbane, Queensland4000, Australia. Tel.: +61 7 3138 1305; fax: +61 7 3138 1534 (L.M. Hafner). Address:School of Chemical and Life Sciences, Singapore Polytechnic, 500 Dover Road,139651 Singapore, Singapore. Tel.: +65 870 8003; fax: +65 870 8004 (Y.L.E. Lui).
E-mail addresses: [email protected], [email protected] (Y.L.E. Lui), [email protected] (L.M. Hafner).
Yan Long Edmund Lui a,b,c,d,⇑, Tuan Lin Tan c, Peter Timms a,b,e, Louise Marie Hafner a,b,⇑,Kian Hwa Tan c, Eng Lee Tan d,f
a School of Biomedical Sciences, Faculty of Health, Queensland University of Technology, Queensland, Australiab Institute of Health and Biomedical Innovation, Queensland University of Technology, Queensland, Australiac School of Chemical and Life Sciences, Singapore Polytechnic, Singapored Centre for Biomedical and Life Sciences, Singapore Polytechnic, Singaporee Faculty of Science, Health, Education & Engineering, University of the Sunshine Coast, Queensland, Australiaf Department of Paediatrics, University Children’s Medical Institute, National University Hospital, Singapore
a r t i c l e i n f o a b s t r a c t
Article history:Received 6 March 2014Revised 16 April 2014Accepted 17 April 2014
Keywords:Enterovirus 71TranscriptomicsMicroarraymRNA profilingColorectal cellsHand, Foot and Mouth Disease
Enterovirus 71 (EV71) is one of the main etiological agents for Hand, Foot and Mouth Disease(HFMD) and has been shown to be associated with severe clinical manifestation. Currently, thereis no antiviral therapeutic for the treatment of HFMD patients owing to a lack of understandingof EV71 pathogenesis. This study seeks to elucidate the transcriptomic changes that result fromEV71 infection. Human whole genome microarray was employed to monitor changes in genomicprofiles between infected and uninfected cells. The results reveal altered expression of human genesinvolved in critical pathways including the immune response and the stress response. Together, datafrom this study provide valuable insights into the host–pathogen interaction between human colo-rectal cells and EV71.� 2014 The Authors. Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies. This
is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
1. Introduction
Enterovirus 71 (EV71) is a positive sense, single stranded, non-enveloped RNA virus belonging to Enterovirus genus of the Picor-naviridae family [1–4]. It is one of the main etiological agents forHand, Foot and Mouth Disease (HFMD) which commonly affectsinfants and children. This disease is usually self-limiting, charac-terised by various symptoms such as fever, rashes, poor appetiteand multiple ulcers in mouth [5–7]. The route of transmission ofEV71 was postulated to happen via direct contact of vesicular fluidor droplet from the infected or via faecal-oral route [5,8–10]. EV71was shown to replicate within the gastrointestinal tract, bypass the
gut barrier and infect into the skeletal muscle cell before enteringinto the bloodstream and the central nervous system [5,8–10].However, unlike other HFMD causing enteroviruses, EV71 havebeen commonly associated with severe clinical diseases, includingneurological diseases leading to cardiopulmonary failure anddeath.
EV71 was first described in 1974 in CA (USA) after it was iso-lated from patients with central nervous system disease in 1969[11]. Recent molecular evolution studies have predicted thatEV71 could have emerged in the human population as early as1941 [12–14]. Large fatal outbreaks of HFMD first appeared in Bul-garia in 1975, and disease outbreaks were subsequently identifiedin Hungary in 1978 and re-emerged after two decades in Malaysiain 1997 and Taiwan in 1998 [15–19]. Since then, there have beenvarious outbreaks, epidemics and pandemics that have periodicallybeen reported worldwide with outbreaks occurring every two tothree years in countries including Australia, China, Taiwan, Japan,Korea, Malaysia, Vietnam, Thailand and Singapore [7,11,15,20].
Currently and due in part to a lack of understanding of viralpathogenesis of EV71 causing HFMD, there are no effective antivi-ral therapies or vaccines approved by the United States Food and
Table 1Primers used in this study.
Primers 50–30
EV71-VP1-reverse GCTCTATAGGAGATAGTGTGAGTAGGGEV71-VP1-forward ATGACTGCTCACCTGCGTGTTIL29/IFN lambda1-forward ACCGTGGTGCTGGTGACTTIL29/IFN lambda1-reverse CTAGCTCCTGTGGTGACAGAIFN beta1-forward ATGACCAACAAGTGTCTCCTCCIFN beta1-reverse GGAATCCAAGCAAGTTGTAGCTCIFN gamma1-forward TCTTTGGGTCAGAGTTAAAGCCAIFN gamma1-reverse TTCCATCTCGGCATACAGCAAISG54-forward AAGCACCTCAAAGGGCAAAACISG54-reverse TCGGCCCATGTGATAGTAGACISG56-forward TTGATGACGATGAAATGCCTGAISG56-reverse CAGGTCACCAGACTCCTCACb-Actin forward ACCAACTGGGACGACATGGAGAAAb-Actin reverse TAGCACAGCCTGGATAGCAACGTA
Y.L.E. Lui et al. / FEBS Open Bio 4 (2014) 426–431 427
Drug Administration (FDA) to prevent HFMD. There is therefore aneed to gain a better understanding of the mechanism of EV71pathogenesis. The ability to cause infection directly correlates tothe interaction between the host and pathogen. In order to surviveand proliferate during infection, the pathogen must be able tosense, react and adapt to the ever-changing microenvironmentwithin the host. Such adaptations and the use of the host resourcesto proliferate are prerequisites for the successful colonisation ofthe host and establish disease. Viruses, being obligate intracellularparasites have developed highly sophisticated mechanisms notonly to exploit the biosynthetic machinery for replication, but alsoto specifically evade the host immune system.
During infection, viruses regulate host gene expression toenhance their survival. Such activities include altering the cellularmicroenvironment to allow successful virus replication and evasionof the host immune system [21–23]. Elucidating the mechanismthat the virus uses to bypass host defence systems and establishinfections will provide us with a better understanding of the path-ogenesis mechanism of the EV71 virus and will thus aid in thedevelopment of potential antiviral therapeutics for HFMD patients.In this study, transcriptomics profiling was performed using colo-rectal cells infected with EV71 using mRNA microarray.
2. Materials and methods
2.1. Cell culture and virus propagation
Human colorectal cell line (HT29) (ATCC� Catalog No. HTB-38™) was maintained in Roswell Park Memorial Institute medium(RPMI) (PAA Laboratories, Austria) supplemented with 10% (v/v)Fetal Bovine Serum (FBS) (PAA Laboratories, Austria) and 2%penicillin–streptomycin (PAA Laboratories, Austria) at 37 �C with5% CO2. The EV71 strain used in this study was isolated from a fatalcase of HFMD during October 2000 outbreak in Singapore, Entero-virus 5865/sin/000009 strain from subgenogroup B4 (accessionnumber 316321; hereby designated as Strain 41). The virus stockwas prepared by propagation of viruses using 90% confluentHT29 cells monolayer in RPMI with 10% FBS at 37 �C with 5%CO2. The virus titres were determined using 50% tissue cultureinfective dose (TCID50) per millilitre (mL) according to Reed andMuench method [24].
2.2. EV71 infection for mRNA profiling
HT29 cells were seeded at a concentration of 5 � 105 cells/mL ineach well of a 6-well plate and incubated for 24 h at 37 �C with 5%CO2. Cells were washed twice with phosphate buffered saline (PBS)and infected with EV71 at multiplicity of infection (MOI) of 1 or nilrespectively. The culture media were removed and replaced with2 mL of fresh RPMI medium after 1 h of incubation at 37 �C with5% CO2. The respective infected cells were harvested at 36 h postsinfection (hpi). The total cellular RNA of HT29 cells were extractedusing the miRNeasy mini kit (Qiagen, Hilden, Germany) accordingto the manufacturer’s instructions. Briefly, the cells were lysed andhomogenise using lyses solution provided (Qiagen, Hilden, Ger-many). Total RNA were purified using the RNeasy spin columnand eluted (Qiagen, Hilden, Germany). Harvested total RNA wasquantitated using Nanodrop 100 spectrophotometer (ThermoSci-entific, Waltham, USA).
2.3. mRNA microarray analysis
Extracted total RNA were labelled with GeneChip HT 30 IVTExpress Kit following manufacturer’s instruction. Hybridizationto GeneChip PrimeView Human Gene Expression Array wasperformed in accordance to manufacturer’s recommendations.
Every chip was scanned at a high resolution by the AffymetrixGeneChip Scanner 3000 according to the GeneChip ExpressionAnalysis Technical Manual procedures (Affymetrix, Santa Clara,CA). Briefly, total extracted RNA undergo two rounds of cDNA syn-thesis prior to in vitro transcription to synthesise biotin modifiedamplified RNA (Affymetrix, Santa Clara, CA). The amplified RNAwas purified and fragment for the hybridisation onto the GeneChipPrimeView Human Gene Expression Array (Affymetrix, Santa Clara,CA). Raw data for the microarray were analysed with the Partek�
Genomics Suite (Partek Incorporated, Saint Louis, USA) wherep < 0.05 is considered significant.
2.4. cDNA synthesis and quantitative real time polymerase chainreaction
For the conversion of mRNA to cDNA, 1 lg of the total RNA wasreverse transcripted using using the iScript™ cDNA Synthesis Kit(Bio-Rad Laboratories, CA, USA) in accordance to the manufac-turer’s instructions. Briefly, 1 lg of the extracted RNA was mixedwith enzyme reverse transcriptase and buffer to a volume of20 ll and subjected to thermal profile of 25 �C for 5 min, 42 �Cfor 30 min followed by 85 �C for 5 min in accordance to the manu-facturer’s instructions.
The quantitative real time polymerase chain reaction (qPCR)was performed using the iTaq™ Universal SYBR� Green Supermix(Bio-Rad Laboratories, CA, USA) on the BioRad CFX96™ Real-TimePCR system (Bio-Rad Laboratories, CA, USA). The primers used inthis study are listed in Table 1. Briefly, 1 ll of cDNA and 1 ll ofthe forward and the reverse primers were added to iTaq™ Univer-sal SYBR� Green Supermix. The reaction mix was then subjected tothermal profile of denaturation at 95 �C for 30 s, followed by ampli-fication and quantification in 40 cycles at 95 �C for 5 s followed by60 �C for 30 s. At the end of amplification cycles, melting tempera-ture analysis was performed by the BioRad CFX96TM Real-TimePCR system (Bio-Rad Laboratories, CA, USA). Relative gene expres-sion was quantified based on 2�DDCT method using the housekeep-ing gene b-actin as the reference gene [25].
2.5. Data analysis
All statistical analysis was performed on GraphPad Prism Ver-sion 6.0c (GraphPad Software, USA). Student’s t test was used tocompare two groups. p values of <0.05 were considered statisti-cally significant.
3. Result and discussion
Systemic analyses of host response to EV71 provide critical cluesto understand the molecular mechanism of EV71 pathogenesis
428 Y.L.E. Lui et al. / FEBS Open Bio 4 (2014) 426–431
during infection of a human host. Regulation and alteration of thehost cellular system can also be monitored by studying the host cel-lular transcriptomics change following enterovirus infection. Trans-criptomics analysis via RNA-sequencing, mRNA microarray and PCRarray have been previously used to analyse host gene expression[26–28]. However, these studies have been performed on rhabdo-myosarcoma (RD) cells or SH-SY5Y cells, of muscle cells or neuronalorigin respectively. In a clinical context, this may not be a good
Fig. 1. Heat map of the microarray mRNA expression profile of EV71 infected and non-showed differential expressed mRNAs of two groups of samples. The mRNAs were chosexpression and red represent mRNAs with increased expression. (n = 3, ⁄p values of <0.0
Fig. 2. Pathway analysis of differentially expressed genes of EV71 infected and non-ingenerated using Partek� Genomics Suite (Partek Incorporated, Saint Louis, USA) (n = 3).
representative model during EV71 infection of a human host asvarious studies have demonstrated that the gastrointestinal tractwas the first site for EV71 proliferation [29–31]. Considering thatdifferent cell types have varying cellular content, host–pathogeninteraction may differ from cell types to cell types [1,32,33]. Wehave previously reported a human colorectal adenocarcinoma cellline (HT29) with epithelioid morphology as a useful in vitro modelto study the pathogenesis of EV71 [33]. To this end, this study
infected control colorectal cells, HT29. The two-way hierarchical cluster heat mapen according to the cut off p < 0.05 where blue represents mRNAs with decreased5).
fected control colorectal cells, HT29. Pathways with enrichment score of <2 was
Y.L.E. Lui et al. / FEBS Open Bio 4 (2014) 426–431 429
utilised HT29 as a model for the transcriptomics analysis of hostresponse to EV71 infection.
3.1. Identification of deregulated mRNAs during EV71 infection
To identify the differentially transcribed mRNAs in HT29 duringEV71 infection, we perform mRNAs profiling using GeneChipPrimeView Human Gene Expression Array. Comparative mRNAsexpression between EV71 infected cells and control non-infectedcells were performed. Microarray hybridisation identified 699genes being differentially expressed significantly during EV71
Fig. 3. Expression level of types I, II and III IFN signalling pathways in response toEV71 infection. Confluent HT29 cells were infected with or without EV71 (MOI of 1).Total intracellular RNA were harvested 36 hpi, converted to cDNA and measured byquantitative real time polymerase chain reaction (qPCR). (A) Expression of IL29/IFN-k1; (B) expression of IFN-b1; (C) expression of IFN-c1 (n = 3, ⁄p values of <0.05).
infection (p < 0.05) (Fig. 1 and Supplementary Table 1). UsingPartek� Genomics Suite, 699 differentially transcribed genesbetween EV71 infected and control non-infected HT29 were furtheranalyses to generate pathways with enrichment score of <2 (Fig. 2).These differentially transcribed genes were involved in criticalpathways including the immune response, the stress response,metabolism, cytotoxicity, cytokines and the cytoskeleton network(Fig. 2).
In response to viral infection, cells were known to induce animmunological response to combat against invading pathogens.In particular, immune response cytokines IL29/interferon (IFN)-k1 and IFN-b1 were significantly up-regulated in EV71 infectedcells (Supplementary Table 1). The microarray results were vali-dated using qPCR. In line with the microarray findings, qPCRrevealed that both IL29 and IFN-b1 were significantly up-regulatedby approximately 20 fold and 3 fold in EV71 infected cells respec-tively (Fig. 3a and b). This is not surprising as that both IL29 andIFN-b1 are cytokines which play important roles in host antiviralresponse [34–36]. In addition, IL29 has been previously reportedto be up regulated during viral infection such as influenza A, hep-atitis C virus and Sendai viruses [34–36]. A key characteristic ofcytokines is the ability to interact with one another to establishcoordinated defence mechanism against invading pathogens. IL29functions by binding to a unique receptor through a pathway iden-tical to IFN-b1 and IFN-c1 receptors inducing cellular antiviralactivity to inhibit virus replication [34–36]. Synergetic effectbetween IL29, IFN-b1 and IFN-c1 were shown to promote cellular
Fig. 4. Expression level of interferon stimulated genes in response to EV71infection. Confluent HT29 cells were infected with or without EV71 (MOI of 1).Total intracellular RNA were harvested 36 hpi, converted to cDNA and measured byquantitative real time polymerase chain reaction (qPCR). (A) Expression of ISG54;(B) expression of ISG56 (n = 3, ⁄p values of <0.05).
430 Y.L.E. Lui et al. / FEBS Open Bio 4 (2014) 426–431
antiviral response [34–36]. Indeed, the use of IL29, IFN-b1 andIFN-c1 as antiviral treatment has been shown to inhibit variousviruses including herpes simplex-1 virus, mouse hepatitis virustype 2, human T-lymphotropic virus-1, cytomegalovirus and hepa-titis C virus [37–43]. As such during EV71 infection, HT29 may upregulate cytokines such as IL29, IFN-b1 and IFN-c1 (types I, II andIII IFN) to induce interferon stimulated genes (ISG) as part ofcellular antiviral response to slow down virus replication.
To further verify this reasoning, we performed qPCR on IFN-gamma1 receptor, ISG54 and ISG56 to investigate if these geneshave been up regulated during EV71 infection. In agreement withour hypothesis, our qPCR results show significant up regulationof these cytokines in response to EV71 infection (Figs. 3c and 4a,b). This support notion that the host colorectal cells up-regulatecytokines such as IL29, IFN-b1 and IFN-c1 (types I, II and III IFN)
Fig. 5. Schematic illustration of the interplay between types I, II and III IFNpathways and invading viral pathogen-EV71. Following EV71 infection, hostactivate types I, II and III IFN pathways through a series of JAK-STAT signallingcascade to mobilise interferon stimulated genes such as ISG54 and ISG56 in attemptto slow down virus replication.
possibly by a series of JAK-STAT signalling pathways to induceISG such as ISG54 and ISG56 (Fig. 5). However, Lei et al. (2010,2011, 2013) previously reported that EV71 3C protein suppressedthe host immune system, for example type I interferon, duringinfection in RD cells (muscle cells) [44–46]. As such, the mecha-nism whereby EV71 mediate host immune system may differ fromcell type to cell types. To support this hypothesis, Chi et al. (2013)have compared the expression of IFN-signalling pathway betweenintestinal epithelial cells and muscle cells, which demonstratesthat intestinal cells have indeed a significant higher expression ofcytokines response in comparison with muscle cells [47]. Thismay explain the fact it takes three times longer for the virus to killHT29 cells in comparison with RD cells [32,33]. In addition, IFN sig-nalling pathways such as type I interferon was previously demon-strated to play an important role during EV71 pathogenesis [48].
Effectively, the intestinal epithelial immune system, being theinitial site of infection, plays a critical role in the disease progres-sion and clinical prognosis. Impaired or immature immunity haspreviously been associated with increased morbidity and mortalityin EV71 of young children and immune deficient adults [48].Theability to eliminate viral pathogen such as EV71 at the initial siteof infection is critical as a weaker immune response results in ahigher viral titre leading to a systemic spread with more servecomplications [47]. One of the key antiviral responses that theintestinal epithelial immune system utilises may be the types I, IIand III IFN to eliminate invading EV71 (Fig. 5).
4. Conclusion
In conclusion, this study utilised HT29 as an in vitro model toinvestigate on the transcriptomic changes in human colorectalcells in response to EV71 infection. Human whole genome micro-array was employed to monitor changes in profiles betweenEV71 infected cells and uninfected control cells. The result revealsaltered expression of human mRNAs in selected pathways includ-ing the immune response, the stress response, metabolism, cyto-toxicity, cytokines and the cytoskeleton network. Interestingly,our results shows significant up regulation of types I, II and IIIIFN which suggests that during EV71 infection, this may be thekey antiviral response HT29 cells undertake to eliminate invadingEV71. Taken together, data from this study provide valuable funda-mental information toward understanding of host–pathogen inter-action between human colorectal cells and invading EV71.Elucidating the mechanism that the virus uses to bypass hostdefence systems and establish infections will provide us with abetter understanding of the pathogenesis mechanism of the EV71virus and will thus aid in the development of potential antiviraltherapeutics for HFMD patients.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
Y.L.E.L. perform the work, evaluate the result and wrote thepaper. Y.L.E.L., T.L.T., L.M.H., P.T., K.H.T., E.L.T. provide research idea,design the work and evaluate manuscript. All authors read andapproved the final manuscript.
Acknowledgements
We would like to thank Mrs. Phoon Meng Chee from theDepartment of Microbiology, National University of Singapore forproviding the EV71 strain 5865/sin/000009. This research was sup-ported by Singapore Polytechnic. Yan Long Edmund Lui was
Y.L.E. Lui et al. / FEBS Open Bio 4 (2014) 426–431 431
supported by Queensland University of Technology Higher DegreeResearch Award Scholarship.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.fob.2014.04.005.
References
[1] Lui, Y.L.E., Lin, Z., Lee, J.J., Chow, V.T.K., Poh, C.L. and Tan, E.L. (2013) Beta-actinvariant is necessary for enterovirus 71 replication. Biochem. Biophys. Res.Commun. 433, 607–610.
[2] McMinn, P.C. (2002) An overview of the evolution of enterovirus 71 and itsclinical and public health significance. FEMS Microbiol. Rev. 26, 91–107.
[3] McMinn, P.C. (2012) Recent advances in the molecular epidemiology andcontrol of human enterovirus 71 infection. Curr. Opin. Virol. 2, 199–205.
[4] Ooi, M.H., Wong, S.C., Lewthwaite, P., Cardosa, M.J. and Solomon, T. (2010)Clinical features, diagnosis, and management of enterovirus 71. Lancet Neurol.9, 1097–1105.
[5] Wong, S.S., Yip, C.C., Lau, S.K. and Yuen, K.Y. (2010) Human enterovirus 71 andhand, foot and mouth disease. Epidemiol. Infect. 138, 1071–1089.
[6] Ho, B.C., Yu, S.L., Chen, J.J., Chang, S.Y., Yan, B.S., Hong, Q.S., Singh, S., Kao, C.L.,Chen, H.Y., Su, K.Y., Li, K.C., Cheng, C.L., Cheng, H.W., Lee, J.Y., Lee, C.N. andYang, P.C. (2011) Enterovirus-induced miR-141 contributes to shutoff of hostprotein translation by targeting the translation initiation factor eIF4E. CellHost Microbes 9, 58–69.
[7] Huang, H.I., Weng, K.F. and Shih, S.R. (2012) Viral and host factors thatcontribute to pathogenicity of enterovirus 71. Future Microbiol. 7, 467–479.
[8] Lee, T.C., Guo, H.R., Su, H.J., Yang, Y.C., Chang, H.L. and Chen, K.T. (2009)Diseases caused by enterovirus 71 infection. Pediatr. Infect. Dis. J. 28, 904–910.
[9] Liu, C.C., Tseng, H.W., Wang, S.M., Wang, J.R. and Su, I.J. (2000) An outbreak ofenterovirus 71 infection in Taiwan, 1998: epidemiologic and clinicalmanifestations. J. Clin. Virol. 17, 23–30.
[10] Brown, B.A., Oberste, M.S., Alexander Jr., J.P., Kennett, M.L. and Pallansch, M.A.(1999) Molecular epidemiology and evolution of enterovirus 71 strainsisolated from 1970 to 1998. J. Virol. 73, 9969–9975.
[11] Schmidt, N.J., Lennette, E.H. and Ho, H.H. (1974) An apparently newenterovirus isolated from patients with disease of the central nervoussystem. J. Infect. Dis. 129, 304–309.
[12] Lee, M.S., Tseng, F.C., Wang, J.R., Chi, C.Y., Chong, P. and Su, I.J. (2012)Challenges to licensure of enterovirus 71 vaccines. PLoS Negl. Trop. Dis. 6,e1737.
[13] Tee, K.K., Lam, T.T., Chan, Y.F., Bible, J.M., Kamarulzaman, A., Tong, C.Y., Takebe,Y. and Pybus, O.G. (2010) Evolutionary genetics of human enterovirus 71:origin, population dynamics, natural selection, and seasonal periodicity of theVP1 gene. J. Virol. 84, 3339–3350.
[14] van der Sanden, S., Koopmans, M., Uslu, G. and van der Avoort, H. (2009)Epidemiology of enterovirus 71 in the Netherlands, 1963 to 2008. J. Clin.Microbiol. 47, 2826–2833.
[15] Chumakov, M., Voroshilova, M., Shindarov, L., Lavrova, I., Gracheva, L.,Koroleva, G., Vasilenko, S., Brodvarova, I., Nikolova, M., Gyurova, S., Gacheva,M., Mitov, G., Ninov, N., Tsylka, E., Robinson, I., Frolova, M., Bashkirtsev, V.,Martiyanova, L. and Rodin, V. (1979) Enterovirus 71 isolated from cases ofepidemic poliomyelitis-like disease in Bulgaria. Arch. Virol. 60, 329–340.
[16] Nagy, G., Takatsy, S., Kukan, E., Mihaly, I. and Domok, I. (1982) Virologicaldiagnosis of enterovirus type 71 infections: experiences gained during anepidemic of acute CNS diseases in Hungary in 1978. Arch. Virol. 71, 217–227.
[17] Ho, M., Chen, E.R., Hsu, K.H., Twu, S.J., Chen, K.T., Tsai, S.F., Wang, J.R. and Shih,S.R. (1999) An epidemic of enterovirus 71 infection in Taiwan. TaiwanEnterovirus Epidemic Working Group. N. Engl. J. Med. 341, 929–935.
[18] Lu, C.Y., Lee, C.Y., Kao, C.L., Shao, W.Y., Lee, P.I., Twu, S.J., Yeh, C.C., Lin, S.C.,Shih, W.Y., Wu, S.I. and Huang, L.M. (2002) Incidence and case-fatality ratesresulting from the 1998 enterovirus 71 outbreak in Taiwan. J. Med. Virol. 67,217–223.
[19] Solomon, T., Lewthwaite, P., Perera, D., Cardosa, M.J., McMinn, P. and Ooi, M.H.(2010) Virology, epidemiology, pathogenesis, and control of enterovirus 71.Lancet Infect. Dis. 10, 778–790.
[20] McMinn, P., Stratov, I., Nagarajan, L. and Davis, S. (2001) Neurologicalmanifestations of enterovirus 71 infection in children during an outbreak ofhand, foot, and mouth disease in Western Australia. Clin. Infect. Dis. 32, 236–242.
[21] Scaria, V., Hariharan, M., Maiti, S., Pillai, B. and Brahmachari, S.K. (2006) Host–virus interaction: a new role for microRNAs. Retrovirology 3, 68.
[22] Ghosh, Z., Mallick, B. and Chakrabarti, J. (2009) Cellular versus viral microRNAsin host–virus interaction. Nucleic Acids Res. 37, 1035–1048.
[23] Roberts, A.P. and Jopling, C.L. (2010) Targeting viral infection by microRNAinhibition. Genome Biol. 11, 201.
[24] Reed, L.J. and Muench, H. (1938) A simple method of estimating fifty percentendpoints. Am. J. Hyg. 27, 493–497.
[25] Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(�Delta Delta C(T)) Method.Methods 25, 402–408.
[26] Fook, L.W. and Chow, V.T. (2010) Transcriptome profiling of host–microbeinteractions by differential display RT-PCR. Methods Mol. Biol. (Clifton, NJ)630, 33–47.
[27] Leong, W.F. and Chow, V.T. (2006) Transcriptomic and proteomic analyses ofrhabdomyosarcoma cells reveal differential cellular gene expression inresponse to enterovirus 71 infection. Cell. Microbiol. 8, 565–580.
[28] Xu, L.J., Jiang, T., Zhang, F.J., Han, J.F., Liu, J., Zhao, H., Li, X.F., Liu, R.J., Deng, Y.Q.,Wu, X.Y., Zhu, S.Y., Qin, E.D. and Qin, C.F. (2013) Global transcriptomic analysisof human neuroblastoma cells in response to enterovirus type 71 infection.PLoS ONE 8, e65948.
[29] Chen, C.S., Yao, Y.C., Lin, S.C., Lee, Y.P., Wang, Y.F., Wang, J.R., Liu, C.C., Lei, H.Y.and Yu, C.K. (2007) Retrograde axonal transport: a major transmission route ofenterovirus 71 in mice. J. Virol. 81, 8996–9003.
[30] Chen, Y.C., Yu, C.K., Wang, Y.F., Liu, C.C., Su, I.J. and Lei, H.Y. (2004) A murineoral enterovirus 71 infection model with central nervous system involvement.J. Gen. Virol. 85, 69–77.
[31] Khong, W.X., Yan, B., Yeo, H., Tan, E.L., Lee, J.J., Ng, J.K., Chow, V.T. and Alonso, S.(2012) A non-mouse-adapted enterovirus 71 (EV71) strain exhibitsneurotropism, causing neurological manifestations in a novel mouse modelof EV71 infection. J. Virol. 86, 2121–2131.
[32] Lu, J., He, Y.Q., Yi, L.N., Zan, H., Kung, H.F. and He, M.L. (2011) Viral kinetics ofenterovirus 71 in human abdomyosarcoma cells. World J. Gastroenterol. 17,4135–4142.
[33] Lui, Y., Timms, P., Hafner, L., Tan, T., Tan, K. and Tan, E. (2013) Characterisationof enterovirus 71 replication kinetics in human colorectal cell line, HT29.SpringerPlus 2, 267.
[34] Park, H., Serti, E., Eke, O., Muchmore, B., Prokunina-Olsson, L., Capone, S.,Folgori, A. and Rehermann, B. (2012) IL-29 is the dominant type III interferonproduced by hepatocytes during acute hepatitis C virus infection. Hepatology(Baltimore, MD) 56, 2060–2070.
[35] Osterlund, P., Veckman, V., Siren, J., Klucher, K.M., Hiscott, J., Matikainen, S.and Julkunen, I. (2005) Gene expression and antiviral activity of alpha/betainterferons and interleukin-29 in virus-infected human myeloid dendriticcells. J. Virol. 79, 9608–9617.
[36] Pagliaccetti, N.E., Eduardo, R., Kleinstein, S.H., Mu, X.J., Bandi, P. and Robek,M.D. (2008) Interleukin-29 functions cooperatively with interferon to induceantiviral gene expression and inhibit hepatitis C virus replication. J. Biol.Chem. 283, 30079–30089.
[37] Sainz Jr., B. and Halford, W.P. (2002) Alpha/Beta interferon and gammainterferon synergize to inhibit the replication of herpes simplex virus type 1. J.Virol. 76, 11541–11550.
[38] Pierce, A.T., DeSalvo, J., Foster, T.P., Kosinski, A., Weller, S.K. and Halford, W.P.(2005) Beta interferon and gamma interferon synergize to block viral DNA andvirion synthesis in herpes simplex virus-infected cells. J. Gen. Virol. 86, 2421–2432.
[39] Fuchizaki, U., Kaneko, S., Nakamoto, Y., Sugiyama, Y., Imagawa, K., Kikuchi, M.and Kobayashi, K. (2003) Synergistic antiviral effect of a combination of mouseinterferon-alpha and interferon-gamma on mouse hepatitis virus. J. Med.Virol. 69, 188–194.
[40] D’Onofrio, C., Franzese, O., Puglianiello, A., Peci, E., Lanzilli, G. and Bonmassar,E. (1992) Antiviral activity of individual versus combined treatments withinterferon alpha, beta and gamma on early infection with HTLV-I in vitro. Int. J.Immunopharmacol. 14, 1069–1079.
[41] Sainz Jr., B., LaMarca, H.L., Garry, R.F. and Morris, C.A. (2005) Synergisticinhibition of human cytomegalovirus replication by interferon-alpha/beta andinterferon-gamma. Virol. J. 2, 14.
[42] Okuse, C., Rinaudo, J.A., Farrar, K., Wells, F. and Korba, B.E. (2005)Enhancement of antiviral activity against hepatitis C virus in vitro byinterferon combination therapy. Antiviral Res. 65, 23–34.
[43] Larkin, J., Jin, L., Farmen, M., Venable, D., Huang, Y., Tan, S.L. and Glass, J.I.(2003) Synergistic antiviral activity of human interferon combinationsin the hepatitis C virus replicon system. J. Interferon Cytokine Res. 23, 247–257.
[44] Lei, X., Liu, X., Ma, Y., Sun, Z., Yang, Y., Jin, Q., He, B. and Wang, J. (2010) The 3Cprotein of enterovirus 71 inhibits retinoid acid-inducible gene I-mediatedinterferon regulatory factor 3 activation and type I interferon responses. J.Virol. 84, 8051–8061.
[45] Lei, X., Sun, Z., Liu, X., Jin, Q., He, B. and Wang, J. (2011) Cleavage of the adaptorprotein TRIF by enterovirus 71 3C inhibits antiviral responses mediated byToll-like receptor 3. J. Virol. 85, 8811–8818.
[46] Lei, X., Xiao, X., Xue, Q., Jin, Q., He, B. and Wang, J. (2013) Cleavage of interferonregulatory factor 7 by enterovirus 71 3C suppresses cellular responses. J. Virol.87, 1690–1698.
[47] Chi, C., Sun, Q., Wang, S., Zhang, Z., Li, X., Cardona, C.J., Jin, Y. and Xing, Z.(2013) Robust antiviral responses to enterovirus 71 infection in humanintestinal epithelial cells. Virus Res..
[48] Liu, M.L., Lee, Y.P., Wang, Y.F., Lei, H.Y., Liu, C.C., Wang, S.M., Su, I.J., Wang, J.R.,Yeh, T.M., Chen, S.H. and Yu, C.K. (2005) Type I interferons protect miceagainst enterovirus 71 infection. J. Gen. Virol. 86, 3263–3269.
Enterovirus71 (EV71) Utilise Host microRNAs to MediateHost Immune System Enhancing Survival duringInfectionYan Long Edmund Lui1,2,3,4*, Tuan Lin Tan3, Wee Hong Woo3, Peter Timms1,2,5, Louise Marie Hafner1,2*,
Kian Hwa Tan3, Eng Lee Tan4,6
1 School of Biomedical Sciences, Faculty of Health, Queensland University of Technology, Brisbane, Queensland, Australia, 2 Institute of Health and Biomedical Innovation,
Queensland University of Technology, Brisbane, Queensland, Australia, 3 School of Chemical and Life Sciences, Singapore Polytechnic, Singapore, Singapore, 4 Centre for
Biomedical and Life Sciences, Singapore Polytechnic, Singapore, Singapore, 5 Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast,
Sippy Downs, Queensland, Australia, 6 Department of Paediatrics, University Children’s Medical Institute, National University Hospital, Singapore, Singapore
Abstract
Hand, Foot and Mouth Disease (HFMD) is a self-limiting viral disease that mainly affects infants and children. In contrast withother HFMD causing enteroviruses, Enterovirus71 (EV71) has commonly been associated with severe clinical manifestationleading to death. Currently, due to a lack in understanding of EV71 pathogenesis, there is no antiviral therapeutics for thetreatment of HFMD patients. Therefore the need to better understand the mechanism of EV71 pathogenesis is warranted.We have previously reported a human colorectal adenocarcinoma cell line (HT29) based model to study the pathogenesis ofEV71. Using this system, we showed that knockdown of DGCR8, an essential cofactor for microRNAs biogenesis resulted in areduction of EV71 replication. We also demonstrated that there are miRNAs changes during EV71 pathogenesis and EV71utilise host miRNAs to attenuate antiviral pathways during infection. Together, data from this study provide criticalinformation on the role of miRNAs during EV71 infection.
Citation: Lui YLE, Tan TL, Woo WH, Timms P, Hafner LM, et al. (2014) Enterovirus71 (EV71) Utilise Host microRNAs to Mediate Host Immune System EnhancingSurvival during Infection. PLoS ONE 9(7): e102997. doi:10.1371/journal.pone.0102997
Editor: Dong-Yan Jin, University of Hong Kong, Hong Kong
Received March 17, 2014; Accepted June 26, 2014; Published July 21, 2014
Copyright: � 2014 Lui et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricteduse, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. Data are within the paper and its SupportingInformation files.
Funding: This research was supported by Singapore Polytechnic. Yan Long Edmund Lui was supported by Queensland University of Technology Higher DegreeResearch Award Scholarship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* Email: [email protected] (YLEL); [email protected] (LMH)
Introduction
Hand, Foot and Mouth Disease (HFMD) is a contagious viral
disease that commonly affects infants and children, with blisters
and flu like symptoms [1–6]. HFMD is caused by a group of
enteroviruses such as enterovirus 71 (EV71) and coxsackievirus
A16 (CA16) [7–9]. However, unlike other HFMD causing
enteroviruses, EV71 is also commonly associated with severe
clinical diseases, including neurological diseases such as aseptic
meningitis, brainstem and cerebellar encephalitis leading to
cardiopulmonary failure and death [3,10–13]. Due in part to a
lack of understanding of viral pathogenesis of EV71 causing
HFMD, there are no antiviral therapies or vaccines approved by
the United States Food and Drug Administration (FDA) to prevent
HFMD infections. There is therefore a need to gain a better
understanding of the mechanism of EV71 pathogenesis. During
infection, viruses attenuate host gene expression to enhance their
survival [14–18]. Such activities include altering the cellular
microenvironment to allow successful virus replication and evasion
of the host immune system [19].
The host innate system is the first line of defence with the
interferon (IFNs) being a key component against viral infection
[17,18,20–25]. The release of IFNs begins with the recognition of
pathogen-associated molecular patterns (PAMPs) which include
Toll like receptors (TLRs), NOD like receptors (NLRs), retinoic
acid-inducible gene I (RIG-I) like receptors [24,26]. This family of
cytokines act in an autocrine and paracrine manner to induce
expression of transcription factors, gamma activated sequence and
IFN stimulated response element and the consequent induction of
IFN-stimulated genes (ISGs) which function to slow down viral
infection [20–22]. Antiviral pathways such as the programmed cell
death or apoptosis could also be activated by the host cells in
attempt to control the infection by limiting viral replication [19].
Many viruses have evolved to counteract with strategies by host
cells to establish infection. One of the mediators for such
regulation includes genes that encode for microRNA (miRNAs).
microRNAs are small single-stranded RNA species of approxi-
mately 20–24 bases in length that play a pivotal role in the post
transcriptional regulation of gene expression [27,28]. These small
RNA are first discovered in Caenorhabditis elegans but was later
discovered in a wide range of organisms from uni to multicellular
eukaryotes [29–31]. miRNAs are found to regulate many cellular
functions including cell proliferation, differentiation, homeostasis,
immune activation and apoptosis [28,29,32–34]. As such,
miRNAs can contribute to the repertoire of host-pathogen
interactions during infection by modulating and directing host
PLOS ONE | www.plosone.org 1 July 2014 | Volume 9 | Issue 7 | e102997
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 2 July 2014 | Volume 9 | Issue 7 | e102997
and viral gene expression thereby playing a pivotal role during
infection. Elucidating the mechanism that the virus uses to bypass
host defence systems and establish infections will provide us with a
better understanding of the pathogenesis mechanism of the EV71
virus, allowing development of potent antiviral therapeutics for
HFMD patients.
In this study, we explore the role of miRNAs in the pathogenesis
of EV71 infected HT29 cells and identified key miRNA changes
due to EV71 infection which might play a key role during EV71
pathogenesis.
Results
We have previously reported a human colorectal adenocarci-
noma cell line (HT29) with epithelioid morphology as a useful
model to study the pathogenesis of EV71 [35]. Utilising the HT29
as a model, this study further elucidate the role of miRNAs during
EV71 infection.
Knockdown of DGCR8 resulted in the reduction of EV71replication
In order to characterise the role of miRNAs during EV71
pathogenesis, DGCR8 was knocked down prior to infection.
HT29 cells were transfected with DsiRNA specific to DGCR8, an
essential cofactor for miRNAs biogenesis. As control, HT29 cells
were transfected with NC1, negative control duplex-scrambled
DsiRNA. Knockdown of DGCR8 was verified using qPCR
(Figure 1a). Transfection was shown to be successful using TYE
563 DS Transfection Control, fluorescent-labelled transfection
control duplex (Figure 1b).
miRNAs is essential for EV71 replicationTo investigate the role of miRNAs in EV71 infection, we
compare EV71 replication in miRNAs depleted HT29 cells
against control cells (scrambled DsiRNA). Using established
protocols, the kinetics of EV71 RNA synthesis in both infected
DGCR8 knockdown cells and control cells were examined
quantitatively using real time quantitative polymerase chain
reaction (qPCR) at 36 h post infection (hpi). Interestingly, DGCR8
knockdown (miRNAs depleted) HT29 cells were unable to support
EV71 proliferation compared to control cells (Figure 2). There is a
significant decrease in viral RNA between DGCR8 knockdown
HT29 cell in contrast with control cells (scrambled DsiRNA)
(Figure 2a). Consistent with our qPCR analysis, protein analysis of
viral VP1 protein representation of EV71 replication, were shown
to be highly downregulated in EV71 infected DGCR8 knockdown
cells (Figure 2b). To further elucidate the effect of miRNAs during
EV71 infection, we asked if the host cells survivability was
enhanced in EV71 infected miRNAs depleted cells. Indeed, it was
observed that at 72 hpi, there was a statistically significant
percentage of living cells in EV71 infected DGCR8 knockdown
cells compared to control cells infected with EV71 (Figure 2c and
Figure S1). In order to validate our findings in HT29 cells, we
further test this on another colorectal cell line (RKO) and skeleton
muscle cell line (RD) where we knock down DGCR8 and examine
the effect on EV71 replication (Figure 3). Consistent with our
findings in HT29 model, EV71 is unable to establish infection in
miRNAs depleted cells (HT29, RKO and RD cells) (Figure 2 and
3).
Taken together, DGCR8 or rather miRNAs affects EV71
replication and recused its detrimental phenotype.
Identification of deregulated miRNAs during EV71infection
To pinpoint on the differentially transcribed miRNAs used by
EV71 during infection, we perform miRNAs profiling using
Affymetrix GeneChip miRNA array. Specifically, comparative
miRNAs expression between EV71 infected cells and control non-
infected cells were performed. Microarray hybridisation identified
78 miRNAs being differentially expressed during EV71 infection
(p,0.05) (Figure 4 and Table S1). To confirm the microarray
results, relative abundance of the selected miRNAs were assayed
using qPCR. The expression pattern from 10 selected miRNAs
qPCR data showed similar direction of response in microarray
analysis data with both methodologies showing similar trends
(Figure 5 and 6). This indicates high quality and reliability of the
microarray data analysis.
EV71 down regulate host immune system using hostmiRNAs during infection
To understand why miRNAs depleted cells resulted in the
inability of EV71 to established infection; we examine the
expression of 84 key genes involved in the innate antiviral immune
response between EV71 infected miRNAs depleted HT29 cells in
comparison with control cells (scrambled DsiRNA). In particular,
we examine the host antiviral expression profile between infected
DGCR8 knockdown cells against control cells. Using qPCR,
quantitative expression of 52 antiviral genes from various antiviral
signalling pathways such as Toll-like receptor signalling, Nod-like
receptor signalling, RIG-1-like receptor signalling and type 1
interferon signalling were statistically up regulated in DGCR8
knockdown cells (Figure 7a, 7b, 7c, 7d). Noteworthy, CASP1,
OAS2, DDX58, DHX58, CCL5, CXCL10, CXCL11, IRF7,
IFBB1, ISG15, MX1 and STAT1 have at least 10–550 fold
increase (Figure 7a, 7b, 7c, 7d).
Discussion
Viruses have developed highly sophisticated gene-silencing
mechanisms to evade host-immune response in order to establish
infection. One of such mediators used by viruses is miRNAs.
miRNAs is a new paradigm of RNA-directed gene expression
regulation which contribute to the repertoire of host-pathogen
interactions during viral infection. Cellular miRNAs could be
involved during viral infection with either positive or negative
effects on viral replication kinetics [36,37]. Indeed, computational
prediction reveal that one miRNAs may regulate hundreds of
genes while one gene may be in turn regulated by hundreds of
miRNAs [38]. However, the role of cellular miRNAs in the
defence against viral infection has thus remained elusive. Given
the scope of miRNA-mediated gene regulation in the mammalian
system, cellular miRNAs may directly or indirectly affect virus
pathogenesis. Cellular miRNA expression could be remodelled by
viral infection, which can alter the host cellular microenvironment
and attributing to both host antiviral defence and viral factors
[25,32,36,39,40].
The biogenesis of miRNAs begins with the transcription of a
long primary transcript known as pri-miRNA by RNA polymerase
II [27–29,32,39,41]. Pri-miRNAs are cleaved/processed by
Figure 1. Knockdown of DGCR8 using DsiRNA. (A) Relative expression of DGCR8 gene measured by qPCR verifying knockdown. (n = 3, **** = pvalues of ,0.0001) (B) Transfection Control using fluorescent-labeled transfection control duplex TYE 563 DS to monitor transfection efficiency.doi:10.1371/journal.pone.0102997.g001
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 3 July 2014 | Volume 9 | Issue 7 | e102997
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 4 July 2014 | Volume 9 | Issue 7 | e102997
RNase III enzyme (Drosha), double-stranded-RNA-binding pro-
tein, (DiGeorge Syndrome Critical Region; DGCR8) and RNAse
III-like Dicer to become functional miRNAs. In this study, we
have demonstrated that abolishing functional miRNAs in human
epithelial colorectal cell line (HT29) impair EV71 replication while
this was not observed in control cells treated with scrambled
DsiRNA. On the contrary, global knockdown of miRNAs have
been previously shown to have enhance HIV-1 infection [42,43].
Knock down of DGCR8, a precursor to miRNAs biogensis were
shown to enhance human immunodeficiency virus (HIV) replica-
tion [42,43]. This implies that EV71 utilise miRNAs during
infection and in the absent of miRNAs, EV71 was unable to
successfully mount the infection.
Another study reported by Otsuka and colleagues showed a
similar finding in Vesicular stomatitis virus (VSV) infection [44].
Otsuka and colleagues observed that impaired miRNA production
in mice with dicer deficient mice resulted in the hypersensitivity
toward infection by VSV [44]. It was observed there is no
alternation of interferon-mediated antiviral response by dicer
deficiency instead the change in virus replication is due to miR-24
and miR-93 [44]. Otsuka and colleagues shown that miR-24 and
miR-93 could target VSV viral protein and thus in miRNA
depleted cells, VSV replication was enhanced in the absence of
miR-24 and miR-93 [44].
In recent years, there are reported evidences of specific host-
cellular miRNAs modulating host-pathogen interaction [44–51].
Cytomegalovirus (CMV) for example was observed to down
regulate miR-27a [45]. Overexpression of miR-27a using miRNAs
mimics was shown to inhibit CMV proliferation and virus titres
suggesting that miR-27a or miR-27a-regulated genes plays a role
during CMV infection [45,52]. Hepatitis C virus (HCV), an
enveloped RNA virus of the Flavivirus family, responsible for both
acute and chronic hepatitis in humans induced a liver-specific
cellular miRNA, miR-122 for the facilitation of HCV replication
[17,48,51,53–55]. It was suggested that miR-122 is a valuable
target for antiviral intervention and therapeutics. In vivotreatment of HCV-infected chimpanzees with antisense miR-122
successfully reduced HCV virus titres demonstrating promising
antiviral treatment against virus induced diseases [48,49,53,54].
Indeed, various miRNAs have been identified to play a role
during EV71 pathogenesis. Recent publications of investigations
into the role of miRNA in enterovirus infection have reported that
enterovirus-induced miRNAs such as miR-23b, miR-296-5p,
miR-141 and miR-146a play a role in EV71 replication [8,56–
58]. The use of miRNA inhibitors or mimics have demonstrated
that miRNAs plays an important role in EV71 pathogenesis.
miRNA inhibitors or mimics on these miRNAs either inhibited or
enhanced EV71 replication during infection.
In particular, our results revealed miR-548 to be significantly up
regulated in EV71 infected cells at 36 hpi in comparison with
control non infected cells. Further bioinformatics analysis revealed
that miR-548 was involved in antiviral response during infection
[17,23,25,38,59]. Consistent with our findings, Li and colleagues
have recently identified the involvement of miR-548 in IFN
signalling pathways during viral infection [59]. Li and colleagues
demonstrated that miR-548 down-regulates host antiviral response
via direct targeting of IFN-l1 [59]. In contrast, in EV71 infected
rhabdomyosarcoma (RD) cells, miR-548 was observed to decrease
in a time dependent manner [59]. In view that the host innate
system is the first line of defence with IFNs being a key player
during viral infection, it is atypical that miR-548 was up regulated
to down regulate the host immune system [17,18,20–25]. The use
of miR-548 mimics and inhibitors were shown to enhance or
inhibit EV71 replication in RD cells respectively [59].
The innate immune system has evolved an arsenal of
mechanism to sense and destroy invading pathogen. An interesting
question that arises is whether EV71 is able to regulate host
cellular miRNA transcription and processing during infection
thereby leading to the down-regulation of deleterious cellular
miRNA and/or the up-regulation of advantageous cellular
miRNAs to enhance its replication in the host cells. To add to
this intriguing interplay between cellular miRNAs and viral
pathogens, Huang and colleagues has demonstrated that HIV, an
enveloped RNA virus of the Retreoviridae family utilise host
cellular miR-28, miR-125b, miR-150, miR-223 and miR-382 to
control viral protein synthesis in order to evade host immune
system [47]. Epstein-Barr virus (EBV), a DNA virus of the Herpes
family, for example induce the expression of miR-29b, miR-155
and miR-146a to mediate the down regulation of innate immune
response and IFN signalling pathways to enhances its survival
[46,60,61]. Lecellier and colleagues have shown that in primate
foamy virus type 1 (PFV-1), overexpression of cellular miRNA
miR-32 could induce an antiviral response to inhibit virus
replication [37].
To test this reasoning that EV71 down regulate host miRNAs
during infection to enhance its survival, we next ask if the innate
response and signalling pathways were altered in EV71 infected
miRNA-depleted cells. Therefore, we analysed the expression of
84 key genes involved in the innate antiviral immune response
between EV71 infected miRNAs depleted HT29 cells in
comparison with control cells (scrambled DsiRNA). Quantitative
analysis\revealed 52 antiviral genes from various antiviral
signalling pathways such as Toll-like receptor signalling, Nod-like
receptor signalling, RIG-1-like receptor signalling and type 1
interferon signalling were significantly up regulated in EV71
infected miRNAs depleted HT29 cells. In particular, CASP1,
OAS2, DDX58, DHX58, CCL5, CXCL10, CXCL11, IRF7,
IFBB1, ISG15, MX1 and STAT1 have at least 10–550 fold
increase. The enhanced host antiviral response in miRNA-
depleted cells during EV71 infection may result in the inability
for EV71 to replicate during infection (Figure 8).
The host immune response is responsible for the eradication of
invading pathogens, as such viruses has developed means to
counteract with the induction, signalling and antiviral pathways
[16,20,21,25,40]. RNA viruses generally block and inhibit IFN
and antiviral molecules detrimental to virus replication [20,24].
Despite all the sophisticated mechanism used by viruses to inhibit
host immune system, host has been under evolutionary pressure
against viral antagonism of IFN system [20,21,24,40]. Our result
suggests that EV71 attenuate host miRNAs to mediate host
immune system during infection (Figure 8). As a result of DGCR8
knockdown, EV71 is unable to regulate host miRNAs to enhance
cellular microenvironment leading to the inability to establish
infection (Figure 8). Notwithstanding, IFN signalling pathways
Figure 2. miRNA depleted HT29 cells is not able to support EV71 replication. DGCR8 knockdown HT29 cells and control HT29 cells(scrambled DsiRNA) were infected with EV71 (MOI of 1). Total intracellular RNA were harvested at 36 hpi, converted to cDNA and measured by qPCRwith primers specific to viral VP1. Total intracellular protein were harvested at at 36 hpi and measured by western blot (A) Relative expression of EV71viral RNA measured by qPCR. (n = 3, **** = p values of ,0.0001) (B) Western blot analysis for EV71 VP1 viral protein. (C) Cell viability assessed at 72 hpiusing vital dye trypan blue. (n = 3, ** = p values of ,0.01).doi:10.1371/journal.pone.0102997.g002
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 5 July 2014 | Volume 9 | Issue 7 | e102997
such as type I interferon was previously demonstrated to play an
important role during EV71 pathogenesis [62,63]. These results
warrant further studies for the identification of specific miRNAs
which play a pivotal role during EV71 pathogenesis specifically
targeting the host antiviral signalling pathway.
Conclusion
In conclusion, we provided evidence for an intricate physiolog-
ical interplay between host miRNAs machinery and invading
pathogen, EV71. We reported three salient findings. First,
DGCR8, an essential cofactor for microRNAs biogenesis contrib-
ute to a central role during EV71 pathogenesis. We have shown
that EV71 is not able to replicate efficiently in miRNAs depleted
cells. Secondly, our results suggest that EV71 may remodel the
cellular miRNAs composition thereby utilising the host cellular
miRNAs to enhance cellular microenvironment for viral replica-
tion. Specifically, our result suggests that EV71 may be at least
partially responsible for the up regulation of host miR-548 to
enhance cellular microenvironment for viral replication. Thirdly,
remodelling of miRNAs during EV71 infection plays a significant
role specifically in antiviral response. We have demonstrated that
in EV71 infected miRNAs depleted cells, host antiviral responses
from various antiviral signalling pathways such as Toll-like
receptor signalling, Nod-like receptor signalling, RIG-1-like
receptor signalling and type 1 interferon signalling were signif-
icantly higher in comparison with EV71 infected control cells.
This may explain our result on the inability for EV71 to infect
miRNAs depleted cells given the enhanced host antiviral response.
Taken together, our study has provide valuable knowledge toward
the study of host-pathogen interaction during EV71 pathogenesis
and this could lead to future investigation for the development of
Figure 3. EV71 is unable to establish infection in both RKO and RD miRNAs depleted cells. DGCR8 knockdown cells and control cells(scrambled DsiRNA) in both RKO and RD cell line were infected with EV71 (MOI of 1). Total intracellular RNA were harvested at 12 hpi, converted tocDNA and measured by qPCR with primers specific to viral VP1. (A) Relative expression of DGCR8 gene in miRNAs depleted RKO cells measured byqPCR verifying knockdown. (n = 3, * = p values of ,0.05) (B) Relative expression of DGCR8 gene in miRNAs depleted RD cells measured by qPCRverifying knockdown. (n = 3, * = p values of ,0.05) (C) Relative expression of EV71 viral RNA in miRNAs depleted RKO cells measured by qPCR. (n = 3,* = p values of ,0.05) (D) Relative expression of EV71 viral RNA in miRNAs depleted RKO cells measured by qPCR. (n = 3, * = p values of ,0.05).doi:10.1371/journal.pone.0102997.g003
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 6 July 2014 | Volume 9 | Issue 7 | e102997
antiviral therapeutics using miRNAs inhibitors against EV71. This
will open the door toward novel host-defence mechanism that
exists in mammalian cells as well as to the antiviral mechanisms
employed during EV71 pathogenesis.
Materials and Methods
Cell culture and virus propagationThe EV71 strain used in this study was isolated from a fatal case
of HFMD during October 2000 outbreak in Singapore, Entero-
virus 5865/sin/000009 strain from subgenogroup B4 (accession
number 316321; hereby designated as Strain 41) (a gift from Mrs
Phoon Meng Chee, Department of Microbiology, National
University of Singapore). Human colorectal cell line (HT29)
(ATCC catalog no. HTB-38) was maintained in Roswell Park
Memorial Institute medium (RPMI) (PAA Laboratories, Austria)
supplemented with 10% (v/v) Fetal Bovine Serum (FBS) (PAA
Laboratories, Austria) and 2% penicillin–streptomycin (PAA
Laboratories, Austria) at 37uC with 5% CO2. Human skeleton
muscle cell line (RD) (ATCC catalog no. CCL-136) and Human
colorectal cell line (RKO) (ATCC catalog no. CRL-2577) were
maintained in Eagle’s minimum essential medium (EMEM) (PAA
Laboratories, Austria) supplemented with 10% (v/v) Fetal Bovine
Serum (FBS) (PAA Laboratories, Austria) and 2% penicillin–
streptomycin (PAA Laboratories, Austria) at 37uC with 5% CO2.
The virus stock was prepared by propagation of viruses using 90%
confluent HT29 cells monolayer in RPMI with 10% FBS at 37uCwith 5% CO2. The virus titres were determined using 50% tissue
culture infective dose (TCID50) per millilitre (mL) according to
Reed and Muench method [64].
DsiRNA transfection and EV71 infectionHT29, RD and RKO cells were seeded at a concentration of
26105 cells/ml in 6-well plates and incubated for 8 h at 37uC with
5% CO2. Cells were washed twice with phosphate buffered saline
(PBS) and transfected using Lipofectamine RNAiMAX (Invitrogen
Corporation, CA, USA) with TriFECTa Dicer-Substrate RNAi
KIT (Integrated DNA Technology, Coralville, IA, USA). Briefly,
10 nM of DGCR8 DsiRNA (NM_001190326 duplex 2), NC1,
negative control duplex-scrambled DsiRNA (NM_001190326)
and TYE 563 DS Transfection Control, fluorescent-labeled
transfection control duplex (NM_001190326) were used to
transfect the cells respectively (Integrated DNA Technology,
Coralville, IA, USA). Following 24 h after transfection, cells were
washed twice with PBS and infected with EV71 at multiplicity of
infection (MOI) of 1. The culture media were removed and
replaced with 2 mL of fresh RPMI medium after 1 h of incubation
at 37uC with 5% CO2.
EV71 infection for miRNA profilingHT29 cells were seeded at a concentration of 56105 cells/ml in
6-well plates and incubated for 24 h at 37uC with 5% CO2. Cells
were washed twice with phosphate buffered saline (PBS) and
infected with EV71 at multiplicity of infection (MOI) of 1 or nil
respectively. The culture media were removed and replaced with
2 mL of fresh RPMI medium after 1 h of incubation at 37uC with
5% CO2.
Total cellular RNA extractionThe respective infected cells were harvest at 12 or 36 hours
posts infection (hpi) respectively. The total cellular RNA of HT29,
Figure 4. Heat map of the microarray miRNA expression profile of EV71 infected and non-infected control colorectal cells, HT29.The two-way hierarchical cluster heat map showed differential expressed miRNAs of two groups of samples. The miRNAs were chosen according tothe cut off p,0.05 where blue represents miRNAs with decreased expression and red represent miRNAs with increased expression. (n = 3, * = p valuesof ,0.05).doi:10.1371/journal.pone.0102997.g004
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 7 July 2014 | Volume 9 | Issue 7 | e102997
RD and RKO cells were extracted using the miRNeasy mini kit
(Qiagen, Hilden, Germany) in accordance to the manufacturer’s
instructions. Briefly, the cells were lysed and homogenise using
lyses solution provided (Qiagen, Hilden, Germany). Total RNA
were harvested using the RNeasy spin column and wash twice
before elution (Qiagen, Hilden, Germany). Harvested total RNA
was quantitated using Nanodrop 100 spectrophotometer (Ther-
moScientific, Waltham, USA).
miRNA microarray analysisThe extracted total RNA was labelled with FlashTag Biotin
HSR RNA Labeling Kits for the Affymetrix GeneChip miRNA
array according to manufacturer’s instruction. Briefly, one
microgram of total RNA will be incubated with ATP and Poly
A polymerase at 37uC for 15 m to add a 39 polyA tail. A ligation
reaction will then be performed to covalently attach to the miRNA
population a multiple-biotin molecule containing a 3DNA
dendrimer. Labelled samples will subsequently be processed
according to manufacturer’s instructions for the Affymetrix
miRNA Array 2.0 (Affymetrix, Santa Clara, CA). After hybrid-
isation for 16 h at 48uC, the arrays will be washed and stained in
an Affymetrix Fluidics station 450, then scanned in an Affymetrix
Figure 5. Validation of differential expression of selected miRNAs by qPCR. Ten expression levels of selected miRNAs from microarray assaywere validated using qPCR. U6snRNA was used as reference RNA for the normalization of miRNAs and relative gene expression was quantified basedon 22DDCT. (n = 3, * = p values of ,0.05).doi:10.1371/journal.pone.0102997.g005
Figure 6. Heat map of differential expression of selectedmiRNAs by microarray. The two-way hierarchical cluster heat mapshowed differential expressed selected miRNAs of two groups ofsamples. The miRNAs from both methodology qPCR data showedsimilar direction of response in microarray analysis data with bothmethodologies showing similar trends where blue represents miRNAswith decreased expression and red represent miRNAs with increasedexpression.doi:10.1371/journal.pone.0102997.g006
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 8 July 2014 | Volume 9 | Issue 7 | e102997
3000 7G scanner. Raw data for the microarray (GSE57372) was
analysed with Partek Genomics Suite (Partek Incorporated, Saint
Louis, USA) where p,0.05 is considered significant.
cDNA synthesisFor the conversion of mRNA to cDNA, 1 mg of the total RNA
was reverse transcripted using RT2 First Strand kit (Qiagen,
Hilden, Germany) in accordance to the manufacturer’s instruc-
tions. Briefly, 1 mg of the extracted RNA was first mixed with
Buffer GE to a total volume of 10 ml for genomic DNA elimination
and incubated at 42uC for 5 m and on ice for 1 m. Reverse-
transcription mix which consist of enzyme reverse transcriptase
and buffer was then added to a volume of 20 ml and subjected to
thermal profile of 42uC for 15 m followed by 95uC for 5 m. 91 ml
of RNase free water was then added to each reaction in
accordance to the manufacturer’s instructions.
For conversion of microRNA to cDNA, 10 ng of the total RNA
was reverse transcripted using the Universal cDNA Synthesis kit
(Exiqon, Denmark) the manufacturer’s instructions. Briefly, 10 ng
of the extracted RNA will be mixed with enzyme reverse
transcriptase and buffer to a volume of 10 ml. The reaction mix
will then subject to thermal profile of 25uC for 5 m, 42uC for 30 m
followed by 85uC for 5 m according to the manufacturer’s
instructions.
Quantitative real time polymerase chain reactionThe EV71 specific primers targeting the conserve VP1 regions
were 59-GCTCTATAGGAGATAGTGTGAGTAGGG-39 and
the reverse primer 59-ATGACTGCTCACCTGCGTGTT-39
[65]. Primers for DGCR8 were 59-ACTTGTGCATGT-
TAGCTGTGTAGA-39 and the reverse primer 59-GCTTAA-
GACTAGTTTACAAGACCAGAGT-39 were designed to span
exon-exon boundaries. The primers for the house keeping gene
actin (b-ACT) used were 59-ACCAACTGGGACGACATGGA-
GAAA-39 and the reverse primer 59-TAGCACAGCCTGGA-
TAGCAACGTA-39. The qPCR was performed using the iTaq
Universal SYBR Green Supermix (Bio-Rad Laboratories, CA,
USA) on the BioRad CFX96 Real-Time PCR system (Bio-Rad
Laboratories, CA, USA). Briefly, 1 ml of cDNA and 1 ml of the
forward and the reverse primers were added iTaq Universal
SYBR Green Supermix. The reaction mix was then subjected to
thermal profile of denaturation at 95uC for 30 s, followed by
amplification and quantification in 40 cycles at 95uC for 5 s
followed by 60uC for 30 s. At the end of amplification cycles,
melting temperature analysis was performed by the BioRad
Figure 7. EV71 is unable to down regulate host antiviral response in miRNA depleted cells during infection. DGCR8 knockdown cellsand control cells (scrambled DsiRNA) were infected with EV71 (MOI of 1). Total intracellular RNA were harvested at 36 hpi, converted to cDNA andmeasured by quantitative real time polymerase chain reaction (qPCR) (n = 3, * = p values of ,0.05). A) Relative expression of Toll-like receptorsignalling measured by qPCR. (B) Relative expression of RIG-1 like receptor signalling measured by qPCR. (C) Relative expression of Nod-like receptorsignalling measured by qPCR. (D) Relative expression of Type 1 interferon signalling measured by qPCR.doi:10.1371/journal.pone.0102997.g007
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 9 July 2014 | Volume 9 | Issue 7 | e102997
CFX96 Real-Time PCR system (Bio-Rad Laboratories, CA,
USA). Relative gene expression was quantified based on 22DDCT
method [66].
For RT2 profiler PCR array, PCR arrays were performed with
customized PCR containing pre-dispensed primers to monitor
Human antiviral response PAHS-122ZD-2 (Qiagen, Hilden,
Germany). qPCR was performed using RT2 SYBR Green qPCR
mastermix (Qiagen, Hilden, Germany). Briefly, a total volume of
25 ml of cDNA and RT2 SYBR Green qPCR mastermix were
added into each well of the Human antiviral response array 96
wells plate PAHS-122ZD-2 (Qiagen, Hilden, Germany) in
accordance to the manufacturer’s instructions. The reaction mix
was then subjected to thermal profile of denaturation at 95uC for
10 m, followed by amplification and quantification in 40 cycles at
95uC for 15 s followed by 60uC for 1 m. At the end of
amplification cycles, melting temperature analysis was performed
by the BioRad CFX96 Real-Time PCR system (Bio-Rad
Laboratories, CA, USA).
For the detection of microRNA, qPCR was performed using the
ExiLENT SYBR Green Master mix (Exiqon, Denmark) on the
BioRad CFX96 Real-Time PCR system (Bio-Rad Laboratories,
CA, USA). Briefly, 2.5 ml of cDNA and 1 ml of the forward and the
reverse primers was added to ExiLENT SYBR Green Master mix
(Exiqon, Denmark) according to the manufacturer’s instructions.
The reaction mix will then subjected to thermal profile of
denaturation at 95uC for 10 m, followed by amplification and
quantification in 40 cycles at 95uC for 10 s, 60uC for 30 s followed
by 50uC for 30 s. At the end of amplification cycles, melting
temperature analysis will be performed by the BioRad CFX96
Real-Time PCR system (Bio-Rad Laboratories, CA, USA).
Primers for microRNA qPCR were designed and purchased from
Exiqon, Denmark. U6snRNA was used as reference RNA for the
normalization of microRNA (miRNA) qPCR data. Relative gene
expression was quantified based on 22DDCT method [66].
Western blotTotal cellular protein for HT29 cells and control cells were
collected using a lysis mix in mammalian cell lysis solution–
CelLytic M (Sigma-Aldrich Pte Ltd, USA) in accordance with
manufacturer’s instructions. Equal protein concentration (20 mg)
from each samples were added onto 10% Mini-PROTEAN TGX
(Bio-Rad Laboratories, CA, USA) and separated by electropho-
resis. Separated proteins were transferred onto nitrocellulose
membrane (Bio-Rad Laboratories, CA, USA). The membranes
were incubated with mouse anti EV71 antibody (AbD serotech,
Oxford, UK) or anti tubulin antibody (Santa Cruz Biotechnology
inc, California, USA) respectively in shaker 4uC overnight. The
membranes were washed three times in Tris-buffered saline with
0.05% tween-20 before and incubating with secondary antibodies
conjugated to horseradish peroxidase (HRP) for 30 m. (Thermo-
Scientific, Waltham, USA). After three wash with Tris-buffered
saline and 0.05% tween-20, membrane was subjected to Clarity
Western ECL Substrate (Bio-Rad Laboratories, CA, USA) in
accordance with manufacturer’s instructions. The membranes
Figure 8. Schematic illustration of the interplay between EV71 and host miRNAs. EV71 altered host miRNAs such as has-miR-548 tomanipulate host antiviral responses such as Toll-like signalling, NOD-like signalling, RIG-1 signalling and Type I interferon pathways to enhance itssurvival during pathogenesis.doi:10.1371/journal.pone.0102997.g008
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 10 July 2014 | Volume 9 | Issue 7 | e102997
were then scanned using the LI-COR C-DiGit Blot Scanner (LI-
COR Biosciences, Lincoln, Nebraska, USA).
Cell viability and countsCell count and viability was performed at 0 h, 48 h and 72 h on
the Luna Automated Cell Counter system (Logos Biosystem, USA)
in accordance to the manufacturer’s instructions. Briefly, the cells
were trypsinised and topped up with fresh media to a total volume
of 1000 ml of media and 10 ml of this cell suspension were mixed
with 10 ml of tryphan blue. 10 ml of this diluted cell suspension
were then loaded onto the Luna counting slide for analysis.
Statistical analysisAll statistical analysis was performed on GraphPad Prism
Version 6.0c (GraphPad Software, USA). Student t test was used
to compare two groups. p values of ,0.05 were considered
statistically significant.
Supporting Information
Figure S1 Cell viability assessed 24 h after transfectionand throughout 72 h post EV71 infection using vital dyetrypan blue. (n = 3, * = p values of ,0.05).
(TIFF)
Table S1 Altered miRNA expression profile of EV71infected and non-infected control colorectal cells, HT29.
(DOCX)
Author Contributions
Conceived and designed the experiments: YLEL TLT PT LMH KHT
ELT. Performed the experiments: YLEL TLT. Analyzed the data: YLEL
TLT PT LMH KHT ELT. Contributed reagents/materials/analysis tools:
YLEL TLT WWH KHT ELT. Wrote the paper: YLEL.
References
1. Lui YLE, Lin Z, Lee JJ, Chow VTK, Poh CL, et al. (2013) Beta-actin variant is
necessary for Enterovirus 71 replication. Biochemical and Biophysical Research
Communications 433: 607–610.
2. McMinn PC (2002) An overview of the evolution of enterovirus 71 and its
clinical and public health significance. FEMS Microbiol Rev 26: 91–107.
3. McMinn PC (2012) Recent advances in the molecular epidemiology and control
of human enterovirus 71 infection. Curr Opin Virol 2: 199–205.
4. Ooi MH, Wong SC, Lewthwaite P, Cardosa MJ, Solomon T (2010) Clinical
features, diagnosis, and management of enterovirus 71. Lancet Neurol 9: 1097–
1105.
5. Patel KP, Bergelson JM (2009) Receptors identified for hand, foot and mouth
virus. Nat Med 15: 728–729.
6. Solomon T, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, et al. (2010)
Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet
Infect Dis 10: 778–790.
7. Wong SS, Yip CC, Lau SK, Yuen KY (2010) Human enterovirus 71 and hand,
foot and mouth disease. Epidemiol Infect 138: 1071–1089.
8. Ho BC, Yu SL, Chen JJ, Chang SY, Yan BS, et al. (2011) Enterovirus-induced
miR-141 contributes to shutoff of host protein translation by targeting the
translation initiation factor eIF4E. Cell Host Microbe 9: 58–69.
9. Huang HI, Weng KF, Shih SR (2012) Viral and host factors that contribute to
pathogenicity of enterovirus 71. Future Microbiol 7: 467–479.
10. Chu PY, Lin KH, Hwang KP, Chou LC, Wang CF, et al. (2001) Molecular
epidemiology of enterovirus 71 in Taiwan. Arch Virol 146: 589–600.
11. Lee JJ, Seah JB, Chow VT, Poh CL, Tan EL (2011) Comparative proteome
analyses of host protein expression in response to Enterovirus 71 and
Coxsackievirus A16 infections. J Proteomics 74: 2018–2024.
12. Lee MS, Chang LY (2010) Development of enterovirus 71 vaccines. Expert Rev
Vaccines 9: 149–156.
13. Lee MS, Tseng FC, Wang JR, Chi CY, Chong P, et al. (2012) Challenges to
licensure of enterovirus 71 vaccines. PLoS Negl Trop Dis 6: e1737.
14. Viswanathan K, Fruh K, DeFilippis V (2010) Viral hijacking of the host
ubiquitin system to evade interferon responses. Curr Opin Microbiol 13: 517–
523.
15. tenOever BR (2013) RNA viruses and the host microRNA machinery. Nat Rev
Microbiol 11: 169–180.
16. Taylor KE, Mossman KL (2013) Recent advances in understanding viral
evasion of type I interferon. Immunology 138: 190–197.
17. Randall RE, Goodbourn S (2008) Interferons and viruses: an interplay between
induction, signalling, antiviral responses and virus countermeasures. J Gen Virol
89: 1–47.
18. Rajsbaum R, Garcia-Sastre A (2013) Viral evasion mechanisms of early antiviral
responses involving regulation of ubiquitin pathways. Trends Microbiol 21: 421–
429.
19. Munday DC, Surtees R, Emmott E, Dove BK, Digard P, et al. (2012) Using
SILAC and quantitative proteomics to investigate the interactions between viral
and host proteomes. Proteomics 12: 666–672.
20. Versteeg GA, Garcia-Sastre A (2010) Viral tricks to grid-lock the type I
interferon system. Curr Opin Microbiol 13: 508–516.
21. Thompson MR, Kaminski JJ, Kurt-Jones EA, Fitzgerald KA (2011) Pattern
recognition receptors and the innate immune response to viral infection. Viruses
3: 920–940.
22. Oudshoorn D, Versteeg GA, Kikkert M (2012) Regulation of the innate immune
system by ubiquitin and ubiquitin-like modifiers. Cytokine Growth Factor Rev
23: 273–282.
23. de Weerd NA, Nguyen T (2012) The interferons and their receptors–distribution
and regulation. Immunol Cell Biol 90: 483–491.
24. Brennan K, Bowie AG (2010) Activation of host pattern recognition receptors by
viruses. Curr Opin Microbiol 13: 503–507.
25. Boss IW, Renne R (2011) Viral miRNAs and immune evasion. Biochim Biophys
Acta 1809: 708–714.
26. Kanarek N, Ben-Neriah Y (2012) Regulation of NF-kappaB by ubiquitination
and degradation of the IkappaBs. Immunol Rev 246: 77–94.
27. Sullivan CS, Ganem D (2005) MicroRNAs and viral infection. Mol Cell 20: 3–7.
28. Scaria V, Hariharan M, Maiti S, Pillai B, Brahmachari SK (2006) Host-virus
interaction: a new role for microRNAs. Retrovirology 3: 68.
29. Ghosh Z, Mallick B, Chakrabarti J (2009) Cellular versus viral microRNAs in
host-virus interaction. Nucleic Acids Res 37: 1035–1048.
30. Lau NC, Lim LP, Weinstein EG, Bartel DP (2001) An abundant class of tiny
RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:
858–862.
31. Lee RC, Feinbaum RL, Ambros V (1993) The C. elegans heterochronic gene
lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75:
843–854.
32. Skalsky RL, Cullen BR (2010) Viruses, microRNAs, and host interactions. Annu
Rev Microbiol 64: 123–141.
33. Nathans R, Chu CY, Serquina AK, Lu CC, Cao H, et al. (2009) Cellular
microRNA and P bodies modulate host-HIV-1 interactions. Mol Cell 34: 696–
709.
34. Mack GS (2007) MicroRNA gets down to business. Nat Biotechnol 25: 631–638.
35. Lui Y, Timms P, Hafner L, Tan T, Tan K, et al. (2013) Characterisation of
enterovirus 71 replication kinetics in human colorectal cell line, HT29.
SpringerPlus 2: 267.
36. Berkhout B, Jeang KT (2007) RISCy business: MicroRNAs, pathogenesis, and
viruses. J Biol Chem 282: 26641–26645.
37. Lecellier CH, Dunoyer P, Arar K, Lehmann-Che J, Eyquem S, et al. (2005) A
cellular microRNA mediates antiviral defense in human cells. Science 308: 557–
560.
38. Gottwein E, Cullen BR (2008) Viral and cellular microRNAs as determinants of
viral pathogenesis and immunity. Cell Host Microbe 3: 375–387.
39. Sullivan CS (2008) New roles for large and small viral RNAs in evading host
defences. Nat Rev Genet 9: 503–507.
40. Boss IW, Renne R (2010) Viral miRNAs: tools for immune evasion. Curr Opin
Microbiol 13: 540–545.
41. Roberts AP, Jopling CL (2010) Targeting viral infection by microRNA
inhibition. Genome Biol 11: 201.
42. Chable-Bessia C, Meziane O, Latreille D, Triboulet R, Zamborlini A, et al.
(2009) Suppression of HIV-1 replication by microRNA effectors. Retrovirology
6: 26.
43. Triboulet R, Mari B, Lin Y, Chable-Bessia C, Bennasser Y, et al. (2007)
Suppression of microRNA-silencing pathway by HIV-1 during virus replication.
Science 315: 1579–1582.
44. Otsuka M, Jing Q, Georgel P, New L, Chen J, et al. (2007) Hypersusceptibility to
vesicular stomatitis virus infection in Dicer1-deficient mice is due to impaired
miR24 and miR93 expression. Immunity 27: 123–134.
45. Buck AH, Perot J, Chisholm MA, Kumar DS, Tuddenham L, et al. (2010) Post-
transcriptional regulation of miR-27 in murine cytomegalovirus infection. RNA
16: 307–315.
46. Cameron JE, Yin Q, Fewell C, Lacey M, McBride J, et al. (2008) Epstein-Barr
virus latent membrane protein 1 induces cellular MicroRNA miR-146a, a
modulator of lymphocyte signaling pathways. J Virol 82: 1946–1958.
47. Huang J, Wang F, Argyris E, Chen K, Liang Z, et al. (2007) Cellular
microRNAs contribute to HIV-1 latency in resting primary CD4+ T
lymphocytes. Nat Med 13: 1241–1247.
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 11 July 2014 | Volume 9 | Issue 7 | e102997
48. Jopling CL, Schutz S, Sarnow P (2008) Position-dependent function for a
tandem microRNA miR-122-binding site located in the hepatitis C virus RNA
genome. Cell Host Microbe 4: 77–85.
49. Lanford RE, Hildebrandt-Eriksen ES, Petri A, Persson R, Lindow M, et al.
(2010) Therapeutic silencing of microRNA-122 in primates with chronic
hepatitis C virus infection. Science 327: 198–201.
50. Martinez I, Gardiner AS, Board KF, Monzon FA, Edwards RP, et al. (2008)
Human papillomavirus type 16 reduces the expression of microRNA-218 in
cervical carcinoma cells. Oncogene 27: 2575–2582.
51. Yoshikawa T, Takata A, Otsuka M, Kishikawa T, Kojima K, et al. (2012)
Silencing of microRNA-122 enhances interferon-alpha signaling in the liver
through regulating SOCS3 promoter methylation. Sci Rep 2: 637.
52. Wiertz E, Hill A, Tortorella D, Ploegh H (1997) Cytomegaloviruses use multiple
mechanisms to elude the host immune response. Immunol Lett 57: 213–216.
53. Jopling CL, Norman KL, Sarnow P (2006) Positive and negative modulation of
viral and cellular mRNAs by liver-specific microRNA miR-122. Cold Spring
Harb Symp Quant Biol 71: 369–376.
54. Jopling CL, Yi M, Lancaster AM, Lemon SM, Sarnow P (2005) Modulation of
hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science 309:
1577–1581.
55. Randall G, Panis M, Cooper JD, Tellinghuisen TL, Sukhodolets KE, et al.
(2007) Cellular cofactors affecting hepatitis C virus infection and replication.
Proc Natl Acad Sci U S A 104: 12884–12889.
56. Wen BP, Dai HJ, Yang YH, Zhuang Y, Sheng R (2013) MicroRNA-23b Inhibits
Enterovirus 71 Replication through Downregulation of EV71 VPl Protein.
Intervirology 56: 195–200.
57. Zheng Z, Ke X, Wang M, He S, Li Q, et al. (2013) Human microRNA hsa-
miR-296-5p suppresses Enterovirus 71 replication by targeting the viral genome.J Virol.
58. Ho BC, Yu IS, Lu LF, Rudensky A, Chen HY, et al. (2014) Inhibition of miR-
146a prevents enterovirus-induced death by restoring the production of type Iinterferon. Nat Commun 5: 3344.
59. Li Y, Xie J, Xu X, Wang J, Ao F, et al. (2013) MicroRNA-548 down-regulateshost antiviral response via direct targeting of IFN-lambda1. Protein Cell 4: 130–
141.
60. Lo AK, To KF, Lo KW, Lung RW, Hui JW, et al. (2007) Modulation of LMP1protein expression by EBV-encoded microRNAs. Proc Natl Acad Sci U S A 104:
16164–16169.61. Xiao C, Rajewsky K (2009) MicroRNA control in the immune system: basic
principles. Cell 136: 26–36.62. Liu ML, Lee YP, Wang YF, Lei HY, Liu CC, et al. (2005) Type I interferons
protect mice against enterovirus 71 infection. J Gen Virol 86: 3263–3269.
63. Lui YLE, Tan TL, Timms P, Hafner LM, Tan KH, et al. (2014) Elucidating thehost–pathogen interaction between human colorectal cells and invading
Enterovirus 71 using transcriptomics profiling. FEBS Open Bio 4: 426–431.64. Reed LJ, Muench H (1938) A simple method of estimating fifty percent
endpoints. The American Journal of Hygiene 27: 493–497.
65. Tan EL, Chow VT, Quak SH, Yeo WC, Poh CL (2008) Development ofmultiplex real-time hybridization probe reverse transcriptase polymerase chain
reaction for specific detection and differentiation of Enterovirus 71 andCoxsackievirus A16. Diagn Microbiol Infect Dis 61: 294–301.
66. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:
402–408.
EV71 Utilise microRNAs to Mediate Immune System during Pathogenesis
PLOS ONE | www.plosone.org 12 July 2014 | Volume 9 | Issue 7 | e102997
Biochemical and Biophysical Research Communications 433 (2013) 607–610
Contents lists available at SciVerse ScienceDi rect
Bioch emical an d Biophysical Research Com munications
journal homepage: www.elsevier .com/locate /ybbrc
Journal of Virological Methods 207 (2014) 200–203
Contents lists available at ScienceDirect
Journal of Virological Methods
j o ur nal ho me pag e: www.elsev ier .com/ locate / jv i romet