in situ analysis of biofilms on historic window glass using confocal laser scanning microscopy

In situ analysis of biofilms on historic window glass usingconfocal laser scanning microscopy

Elisabeth Müllera, Ursula Drewellob, Rainer Drewellob, Rudolf Weißmannb, Stefan Wuertza*

aInstitute of Water Quality Control and Waste Management, Technical University of Munich, Am Coulombwall,D-85748 Garching, Germany

bDepartment of Materials Science, Institute of Glass and Ceramics, University of Erlangen-Nürnberg, Martensstraße 5,D-91058 Erlangen, Germany

Received 18 July 2000; accepted 12 January 2001

Abstract – Microbial colonization of the surface of historic glass panels and the subsequent biodeteroration of glass are welldocumented phenomena. Yet little is known about the composition of this microflora that has to be adapted to low nutrientconditions and a dry environment. The microbial community growing on glass window panels from four different locations andages ranging from 30 to 600 years was analyzed in situ using confocal laser scanning microscopy with nucleic acid stains andfluorescently labeled rRNA-targeted oligonucleotide probes for the domains Bacteria and Eucarya. A typical biofilm of thestudied glasses displayed a total thickness of approximately 10–60 µm. Microbial colonization of the glass surface washeterogeneous at 0.8–7% areal coverage. The dominant microbial group belonged to the filamentous fungi. A different attachedmicroflora was found only on one glass surface. This sample was sparsely colonized with areal coverage of 0.8% and a thicknessof 10–20 µm; the biofilm consisted of single bacterial cells and microcolonies. Chemical composition and durability of the glasssamples and availability of an additional organic layer were important factors influencing the extent of microbial growth.Information about the thickness and microbial composition of biofilms offer an essential background to optimize cleaningprocedures or conservation strategies for stained glass windows. © 2001 Éditions scientifiques et médicales Elsevier SAS

historic glass / biofilm / microbial colonization density / FISH

1. Research aims

The attachment and accumulation of microbial cellsat interfaces of liquids and solids, liquids and gases,liquids and liquids or solids and gases result in theformation of biogenic layers called biofilms. Biofilmdevelopment and concurring microbial corrosion canvary with glass type and environmental condition.The objective of this study was to investigate glasssamples from church windows of different ages fromseveral locations and of varying chemical composi-tion. The microbial community was analyzed in situ,that is, directly on the glass surface using confocallaser scanning microscopy (CLSM). CLSM combinesthe advantages of digital fluorescence microscopy andthe possibility to detect optical sections of biofilmsamples with enhanced vertical and axial resolution

and quality. The recorded digital images may be sub-jected to a wide range of processing and analysisroutines to obtain quantitative information or three-dimensional reconstructions of the scanned samples[1]. To gain information about biofilm development,microbial colonization density was determined fol-lowing a total cell staining procedure. The composi-tion of the microbial population was analyzed withfluorescently labeled nucleic acid probes which bindto specific microorganisms and can be visualized di-rectly on the historical glass. Results are discussedwith respect to chemical glass composition and micro-bially induced corrosion (MIC) processes.

2. Introduction

The microbial colonization and subsequent deterio-ration of buildings and paintings belonging to ourcultural heritage are well documented phenomena[2–5]. Biodeterioration of the surface of historic win-

*Correspondence and reprints.E-mail address: [email protected] (S. Wuertz).

Journal of Cultural Heritage 2 (2001) 31−42© 2001 Éditions scientifiques et médicales Elsevier SAS. All rights reserved

S1296207401011062/FLA

dow glass was first described by Mellor [6] whodetected lichenous growth on medieval window pan-els. Recently, the microflora growing on glass surfacesand the microbial corrosion mechanisms of glass havebeen further investigated in several studies [7–14].The microbial populations of the glass biofilms con-sisted mostly of fungi and bacteria, and fungi wereoften found as the dominant group.

The role of these microorganisms in corrosion pro-cesses of historic glass has long been underestimated.Recent studies documented that about 5–10% ofcorroded historic glass windows in Germany showbiodeterioration features [15]. Microbial corrosion ofglass is caused by a combination of biophysical inter-action and biochemical processes induced by cellgrowth. For filamentous microorganisms, this mayresult in tensile stress which can propagate cracks inthe glass surface. The production of inorganic andorganic acids, extracellular enzymes, extracellularpolymeric substances (EPS) and metabolites can causebiodestruction of glass. Microbial interaction mecha-nisms such as biopitting, bioetching, bioleaching andbiocracking have been described [14]. The generalmechanism of biodeterioration is similar to one de-scribed for acidic attack on glass surface [7, 16].Leaching processes lead to the development of a hy-drosilicate layer (gel layer), resulting in the replace-ment of network-modifying ions (e.g., Na, K, Ca, Mg,Pb, Al) and the simultaneous diffusion of hydroniumions [12, 14]. This gel layer may have a protectivefunction and if it is lost the uncorroded bulk glass canbe attacked again and the cycle of corrosion contin-ues. An additional precipitation layer can be formedon the top of the gel layer by the reaction of biomin-eralization products such as oxalates, carbonic andsulfuric acid derivatives, and phosphates with metalcations leached from the substratum [12, 13, 17, 18].A further problem of microbial surface growth is thedeterioration of the optical properties of glass causedby the oxidation of trace metals or EPS and by theoccurrence of pigmented microorganisms [11–13].The stability of glass against microbially influencedcorrosion (MIC) depends on its chemical composi-tion, the existence of an additional organic layer, andthe prevailing climatic conditions [13] since all theseparameters influence the availability of nutrients.

In this work the biofilm thickness and the coloniza-tion density was analyzed in situ with nucleic acidstains detecting most of the microbial cells usingCLSM. In nature the majority of microbial cells areviable but do not form colonies on plates. Microbesadapted to low nutrient conditions and a stronglydehydrated environment such as cells growing onglass surfaces are particularly difficult to cultivate

under laboratory conditions. In situ hybridizationwith fluorescently labeled rRNA-targeted oligonucle-otide probes gives information about the phylogeneticcomposition of a microbial population without anycultivation step [19]. Therefore, the biofilm popula-tion was characterized in situ with fluorescently la-beled rRNA-targeted oligonucleotide probes for thedomains Bacteria and Eucarya.

3. Materials and methods

3.1. Samples

Glass window panels from four churches (Ger-many) and of different origins were investigated. In-formation about the age, surface layers and the glasscorrosion phenomena of the samples is listed in tableI. The microbial populations were analyzed non-invasively by CLSM on glass panel surface which wasoriginally oriented towards the interior of the church.

3.2. Chemical analysis of the glass samples

The chemical composition of the glass panels wasdetermined by analyzing polished samples usingX-ray fluorescence analysis (Siemens SRS 3000). Foreach panel one representative glass sample was ana-lyzed.

3.3. Microbiological studies

3.3.1. Staining with fluorescent dyesThe microbial community was analyzed in situ with

the cell-permeant nucleic acid stains PicoGreen (PG)and SYTO 17 (both from Molecular Probes, Eugene,Oregon), and the fluorescent dye Congo red (Sigma,Deisenhofen, Germany), which detects (1→ 4)-�-D-glucan [22], a typical component of the fungal andbacterial cell wall. Stock solutions of PG (the concen-tration and molarity of this dye were not provided bythe supplier) and SYTO 17 (5 mM) were diluted200-fold in PBS solution (phosphate buffered saline:130 mM NaCl, 7 mM Na2HPO4, 3 mM NaH2PO4,pH 7.0). For the dye Congo red, a stock solution of0.7 mM was prepared in PBS, and a working solutionof 14 µM was used. About 100 µL of the dye solutionwas applied to the surface of the samples and incu-bated 15 min in the dark at room temperature. Afterthe staining procedure the samples were washed threetimes in PBS and air dried.

3.3.2. FixationThe glass window panels covered by biofilm were

incubated for 3 h at room temperature in freshly

32 E. Müller et al. / J. Cult. Heritage 2 (2001) 31–42

prepared 4% (w/v) paraformaldehyde (final concen-tration). After the fixation step the glass samples werewashed twice in PBS and dehydrated for 3 min in 50,80 and 100% (v/v) ethanol, respectively.

3.3.3. Enzymatic treatmentThe paraformaldehyde-fixed biofilm samples from

Altenberg were incubated for 6 h at 55 °C with 17 U/mL �-(1-4) glucanase (cell wall lysing enzyme pre-pared from Bacillus subtilis, Fluka, Deisenhofen, Ger-many) in 1 M Tris/HCl buffer at pH 6.0. To arrestdigestion the samples were washed three times in PBSand dehydrated for 3 min in 50, 80 and 100% (v/v)ethanol, respectively.

3.3.4. In situ hybridizationHybridization of the fixed and dehydrated biofilm

samples was carried out as described by Manz et al.[23]. Five hundred microliters of hybridization buffer(0.9 M NaCl, 20 mM Tris/HCl, 5 mM EDTA, 0.02%w/v SDS, 0% v/v formamide, pH 8) containing 5 ngµL–1 probe was applied to the glass samples andincubated for 2–4 h in an isotonically equilibratedhumidity chamber at 46 °C. The hybridization mix-ture was removed and samples were incubated inwashing buffer (0.9 M NaCl, 20 mM Tris/HCl,5 mM EDTA and 0.02%, w/v SDS, pH 8) for 20 minat 48 °C. Afterwards they were rinsed with distilledwater and air dried. All biofilms were counterstainedwith a 0.1% (w/v) solution of the nucleic acid dye4',6-diamidino-2-phenylindole (DAPI, Sigma, De-isenhofen, Germany) for 15 min at room tempera-ture.

3.3.5. Oligonucleotide probesThe oligonucleotide probes used were targeted to

independent sites of the 16S rRNA molecule of micro-organisms belonging to the domains Bacteria andEucarya (table II). They were added individually or asa mixture containing different probes directed at Bac-teria or Eucarya (“EUB-Mix-(5)” = EUB338,EUB785, EUB927, EUB1055 and EUB1088; “EUK-Mix-(3)” = EUK516, EUK1195 and EUK1379). Eachprobe was added at a concentration of 5 ng µL–1 withsimultaneous hybridization of both phylogeneticgroups. The oligonucleotides were purchased fromMWG Biotech (Ebersberg, Germany) and labeledwith the sulfoindocyanine dyes Cy3 or Cy5.

3.3.6. MicroscopyAfter staining with the fluorescent dyes or in situ

hybridization with rRNA-targeted oligonucleotideprobes the biofilm samples were mounted in AF1solution (Citifluor Ltd., London, UK). All confocalimages were recorded using the 410 CLSM (Zeiss,Germany) including an Axiovert 135 microscopeequipped with 100×/1.3, 40×/1.3 plan neofluor objec-tives (both oil immersion type). The fluorescence ofPG and Congo red dyes was detected with an externalargon laser (488 nm). The two internal helium-neonlasers (543 nm and 633 nm) were used as the excita-tion source for the nucleic acid stain Syto17 (at543 nm) and the Cy3- (at 543 nm) or Cy5- (at633 nm) labeled oligonucleotide probes. Image pro-cessing was carried out with the resident Zeiss soft-ware package.

Table I. Characterization of the glass samples (indoor glass panels).

Location Age Object Additional glass surfacelayer/surface treatments

Glass corrosion symptoms Reference

Altenberg, Cathedral(Germany)

medieval westwindow

cementing material(drying oil, CaCO3)

– bioetching [13]– biopitting– crack formation– gel layer: 20 µm

Brakel, Church(Germany)

1870 northwindow

cold settings uncorroded [20](protein)

Stockkämpen,Church (Germany)

1870 northwindow

layer of lead silicate glass: 20 µm(metal oxides of Pb, Mn, Fe,Co,Cu, Zn)

bulk glass: uncorroded [21]

cementing material (linseed oil,CaCO3)

surface layer:– occurrence of bubbles– enrichment of K, Ca, Pb, Feand Mn

cold settings – crystalline precipitationBad Driburg, Church(Germany)

1970 northwindow

conservation material (drying oil)cementing material (drying oil,CaCO3)

uncorroded [15]

E. Müller et al. / J. Cult. Heritage 2 (2001) 31–42 33

3.3.7. Determination of biofilm coverageand thickness

The biofilm samples stained with the nucleic aciddyes Syto17 or PG and the dye Congo red wereanalyzed quantitatively using CLSM. Images in thehorizontal xy-register were scanned automatically asdescribed by Kuehn et al. [30]. The analyzed region ofinterest consisted of four fields with an area of319.6 × 319.6 µm (magnification 400×) or with anarea of 127.8 × 127.8 µm (magnification 1 000×). Foreach sample three different representative areas wereinvestigated. Digital image processing and analysiswas performed with a Quantimet 570 computer sys-tem (Leica, Cambridge, UK) by calculating the arealpercentage of the microbial colonization of the xy-sections. The biofilm thickness was measured manu-ally using the CLSM software.

4. Results

4.1. Chemical composition of the glass samples

The glass samples from different panels showed ahigh variation in their chemical composition (tableIII). The Altenberg glass is a typical potash-lime-silicate glass which was produced in the 12th–14thcentury. The content of network-forming SiO2 was53.5% (w/w), and network-modifying alkali andearth alkaline metals (Na2O, K2O, CaO and MgO)amounted to 37.6% (w/w). The glass was character-ized by a very low amount of Na2O (< 1%, w/w) anda high K2O concentration (22%, w/w). In contrast tothe Altenberg samples the glass samples from Brakeland Stockkämpen are soda-lime-silicate glass panelsfrom the 19th century. The samples consisted of ahigher SiO2 concentration (∼ 70%, w/w), a higheramount of Na2O (15.8 or 14.2%, w/w), and a very

low content of K2O (0.7 or 1.5%, w/w). Additionalcomponents such as Al2O3 were found in all threeglass types at low concentrations (< 1%, w/w); P2O5was only relevant in the glass samples from Altenberg.These polyvalent oxides can be either network-formers or network-modifiers depending on the oxideconcentration and the glass matrix. The coloring ef-fect of the Altenberg glass (dark blue) and the Stock-kämpen glass (brown) was the result of the occur-rence of Mn and Fe. A higher lead concentration(1.6%, w/w) was only determined for the Stock-kämpen glass leading to higher stability against hy-drolytic attack. Minor components were the oxides ofsulfur and transition metals. These elements may beessential trace elements for biological growth. In con-trast to the glass samples from Altenberg, Brakel andStockkämpen which contained a high number ofchemical compounds, the Bad Driburg glass was com-posed of only three constituents: SiO2 (74%, w/w),Na2O (16%, w/w), and CaO (10%, w/w).

Chemical durability of the glass matrix increaseswith the network-forming SiO2 content (> 66%, w/w[31]) and a simultaneously decreasing content ofnetwork-modifying components. At a low ratio ofSiO2 to alkali oxides the glass is sensitive to chemicaland/or biological attack, which leads to leaching ofalkali metals [14]. The ratio of CaO to alkali metaloxides also plays an important role, since a higherratio is proof of a more durable glass [16]. Thesimultaneous occurrence of a high amount of Na andK (total alkali content ≥ 10%, w/w) has the effect thatchemical durability is higher than if only one alkalielement is available (mixed alkali effect [32]). Theratio of CaO to alkali metals oxides (table III) wasvery low in all investigated glass samples without anysignificant differences. Furthermore, only a low mixedalkali effect was determined. The SiO2 content andthe calculated ratio of SiO2 to alkali oxides for the

Table II. Oligonucleotide probes used for in situ hybridization of historic glass.

Probe Specificity Sequence (5'-3') of probe Target site References(rRNA positions)a

EUK309 Eucarya TCAGGCTCCCTCTCCGG 16S, 309–525 [24]EUK516 Eucarya ACCAGACTTGCCCTCC 16S, 502–516 [25]EUK1195 Eucarya GGGCATCACAGACCTG 16S, 1195–1209 [26]EUK1379 Eucarya TAGAAAGGGCAGGGA 16S, 1379–1394 [27]EUB338 Bacteria GCTGCCTCCCGTAGGAGT 16S, 338–355 [25]EUB785 Bacteria CTACCAGGGTATCTAATCC 16S, 785–803 [26]EUB927 Bacteria ACCGCTTGTGCGGGCCC 16S, 927–942 [28]EUB1055 Bacteria CACGAGCTGACGACAGCCAT 16S, 1 055–1 074 [28]EUB1088 Bacteria GCTCGTTGCGGGACTTAACC 16S, 1 088–1 107 [28]

a E. coli numbering [29].


Table III. Chemical composition of glass samples.

Samples Glass composition (metal oxides, % w/w)

SiO2 Na2O K2O CaO MgO Al2O3 P2O5 MnO2 Fe2O3 PbO Oxides of SiO2/Na2O+K2O CaO/Na2O+K2OΣ (Na2O, K2O, CaO, MgO) Σ (Al2O3, P2O5) Σ (MnO2, Fe2O3) S, Ti, As,

Zn, Sr, Zr,Sb, Ba,and Ce

Altenberg 53.5 0.5 22.2 12.0 2.9 0.8 2.3 1.2 0.6 0.2 0.8 2.3 0.5Potash-lime-silicate glass

37.6 3.1 1.8

Brakel 69.5 15.8 1.5 9.0 0.2 0.8 N.D.a N.D. 0.2 0.2 0.8 4.0 0.5Soda-lime-silicate glass

26.5 0.8 0.2

Stockkämpen 68.9 14.2 0.7 7.0 0.1 0.7 0.2 1.4 3.0 1.6 1.5 4.6 0.5Soda-lime-silicate glass

22.0 0.9 4.4

Bad Driburg 74.0 16.0 N.D. 10.0 N.D. N.D. N.D. N.D. N.D. N.D. N.D. 4.6 0.6Soda-silicateglass

26.0

a Not detectable.

E.M

ülleretal./J.C

ult.Heritage

2(2001)31–42

35

analyzed glass samples (table III) demonstrated thatthe modern soda-silicate glass from Bad Driburg is themost stable glass, and the glass samples from Brakeland Stockkämpen also have a high chemical stability.The lowest resistance against chemical attack wasdetermined for the medieval potash-lime-silicate glass(Altenberg).

4.2. Microbial colonization densityand biofilm thickness

A biofilm with a thickness of 10–60 µm was presenton the surface of the glass window panels. The glasssurfaces from Altenberg, Brakel and Bad Driburgwere covered with filamentous microorganisms (fig-ure 1a, b, d and e). In contrast, the biofilm fromStockkämpen was characterized by surface-associated patchy growth of microcolonies and singlecells (figure 1c). The colonization density and thick-ness of this biofilm could only be determined using thedye PicoGreen (PG) compared to very weak SYTO 17signals. An explanation for this observation may bethat the stronger fluorescent signals of the stain PGwere necessary for the detection of smaller cells whichwere not present in other biofilm samples. The micro-bial colonization density on the glass surface revealeda high degree of heterogeneity related to the chemicalcomposition of the glass samples and the type ofmicrobial population. The lowest microbial densitywas determined for the Stockkämpen biofilm with amaximum areal colonization of 0.8% (figure 2) and abiofilm thickness of 10–20 µm. The microbial coloni-zation of the Altenberg glass samples (figure 2)showed values no higher than those of the Stock-kämpen samples but the biofilm had a thickness of20–40 µm. The biofilm on the glass samples fromBrakel revealed a higher colonization density varyingfrom 1 to 3% (figure 2) and a biofilm thickness of20–60 µm. Surface growth on the glass samples fromBad Driburg was even more heterogeneous (figure 1dand e; figure 3). Areal colonization varied from 1 to7% and thickness ranged from 10 to 40 µm whencomparing three different analyzed area. There wasno difference when the nucleic acid dye SYTO 17 orthe dye Congo red were used to stain biofilms (figure3A and B). Therefore, the observed heterogeneity ofmicrobial cell distribution was not due to poor detec-tion of cells by the SYTO 17 stain. A further interest-ing result was that the highest colonization density ofeach sample was not found directly on the substratumbut at a distance of 10–20 µm from the glass surface.The reason for this kind of aerial growth could be therough surface of the glass samples. Oxygen limitationis unlikely to have played a role. Other workers havereported higher cell densities in the outer regions of

biofilms, but were referring to immersed surfaces [33,34]. The growth characteristics manifested on dryglass samples may be a reflection of the nutritivestatus of individual members of the microbial com-munity. Hence the source (organic surface layers,glass matrix or air) and specific location of nutrientsinfluence spatial biofilm structure.

4.3. Characterization of themicrobial biofilm community

Microorganisms living on glass surfaces are slowgrowing and display little physiological activity. Thisaccounts for a low ribosome content rendering in situhybridization of individual cells difficult. By usingseveral monolabeled oligonucleotides targeted to in-dependent sites on the rRNA molecule with identicalspecificity [19] we obtained a higher fluorescent cellsignal. Hence different Bacteria and Eucarya probeswere used simultaneously in this study.

The in situ hybridization of the Altenberg glasssamples with a Cy5-labeled mixture of five Bacteriaprobes (“EUB-Mix-(5)”) and a Cy3-labeled mixtureof three Eucarya probes (“EUK-Mix-(3)”) showed nofluorescent signals. In contrast, filamentous microor-ganisms could be detected with the nucleic acid stainDAPI in the same microscopic area of interest (datanot shown). These results illustrate the difficultiesencountered when describing starving cells with geneprobes. Another possible explanation for the lowhybridization signals in this biofilm is lack of penetra-tion by fluorescently labeled rRNA-targeted oligo-nucleotide probes through the cell wall, althoughmembranes are expected to be readily permeable afterfixation. After exposing the Altenberg biofilm to enzy-matic treatment with �-(1-4) glucanase weak fluores-cent signals with the “EUK-mix(3)” were obtained(figure 4a); however, there were no signals when thesingle Eucarya probe or the “EUB-mix(5)” was ap-plied. In the Brakel (figure 4b) and Bad Driburg(figure 4d) biofilms, filamentous microorganismswere detected using a single Eucarya probe withoutany enzymatic pre-treatment, and no signals wereobtained by applying the different bacteria probes.Therefore, these microorganisms belonged to theFungi because in the domain Eucarya there is no othertaxonomic group with the ability to form mycelia. Afurther experiment involved the simultaneous use of asingle Cy5-labeled Eucarya probe (EUK309) and theCy3-labeled “EUK-Mix-(3)” to demonstrate whetherthe same microorganisms could be detected with dif-ferent Eucarya probes. Figure 4 (c = Brakel and e =Bad Driburg) shows that the cells hybridized bothwith the single probe (blue color) and the “EUK-Mix-(3)” (red color); a superimposition of both signals


Figure 1. Confocal laser scanning microscopic (CLSM) images of biofilms on the surface of glass window panes. The biofilmswere stained with the nucleic acid dyes SYTO 17 or PicoGreen (PG). Microphotograph (a) A medieval glass sample fromAltenberg church; the red color shows cells labeled with SYTO 17; CLSM image: projection of 15 xy-sections, ∆z = 1 µm,magnification 400×. Bar, 40 µm. Microphotograph (b) A 130-year-old glass sample from Brakel; the red color shows cellslabeled with SYTO 17; CLSM image: projection of 16 xy-sections, ∆z = 2 µm, magnification 400×. Bar, 40 µm. Microphoto-graph (c) A 130-year-old glass sample from Stockkämpen; the green color shows cells labeled with PG; CLSM image: projectionof 10 xy-sections, ∆z = 1 µm, magnification 1 000×. Bar, 20 µm. Microphotographs (d and e) A 30-year-old glass sample fromBad Driburg; the red color shows cells labeled with SYTO 17; CLSM image: projection of 15 xy-sections, ∆z = 1 µm,magnification 1 000×. Bar, 20 µm.


results in pink cells. The microorganisms growing onthe glass samples from Stockkämpen gave clear fluo-rescence signals after hybridization with a mixture offive bacteria probes (figure 4f). A comparison ofprobe signals and DAPI-stained cells demonstratedthat most of the cells could be detected with the“EUB-Mix-(5)”. No fluorescent cell signals were de-termined using the single bacteria probe EUB338 andthe “EUK-Mix-(3)”. These results show that the

Figure 3. Image analysis of microbial colonization on thesurface of the 30-year-old glass samples from Bad Driburg.The microbial community was stained with the nucleic acidstain SYTO17 or with Congo red. Values (■ , ● and ·)represent the determination of three analyzed areas(0.4 mm2). (A) Biofilm was stained with Syto17. (B) Biofilmwas stained with Congo red.

Figure 4. Whole cell hybridization of biofilms growing on glass window panes from different churches with probes detectingthe domains Bacteria and Eucarya. Microphotograph (a) A biofilm on a medieval glass (Altenberg) pretreated with cell walllysing enzymes was hybridized with a Cy3-labeled mixture of three Eucarya probes (“EUK-Mix-(3)”, red color) and aCy5-labeled single Eucarya probe (EUK309, blue color). Cells were detected only with the mixture of Eucarya probes. CLSMimage: projection of 15 xy-sections, ∆z = 1 µm, magnification 1 000×. Bar, 20 µm. Microphotograph (b) A biofilm on a130-year-old glass (Brakel) was hybridized with a Cy5-labeled single Eucarya probe (EUK309, blue color). CLSM image:projection of 12 xy-sections, ∆z = 1 µm, magnification 1 000×. Bar, 20 µm. Microphotograph (c) A biofilm on a 130-year-oldglass (Brakel) was hybridized with a Cy3-labeled mixture of three Eucarya probes (“EUK-Mix-(3)”, red color) and aCy5-labeled single Eucarya probe (EUK516, blue color). The pink signals demonstrate that these cells have been detected bothwith a mixture of three Eucarya probes and with a single Eucarya probe. CLSM image: projection of 12 xy-sections, ∆z = 1 µm,magnification 400×. Bar, 40 µm. Microphotograph (d) A biofilm on a 30-year-old glass (Bad Driburg) was hybridized with theCy3-labeled probe EUK516 (red color) detecting Eucarya; CLSM image: projection of 16 xy-sections, ∆z = 4 µm, magnification400×. Bar, 40 µm. Microphotograph (e) A biofilm on a 30-year-old glass (Bad Driburg) was hybridized with a Cy3-labeledmixture of three Eucarya probes (“EUK-Mix-(3)”, red color) and a Cy5-labeled single Eucarya probe (EUK309, blue color).The color pink shows that these cells have been detected both with a mixture of three Eucarya probes and with a single Eucaryaprobe. CLSM image: projection of 16 xy-sections, ∆z = 3 µm, magnification 1 000×. Bar, 20 µm. (f) A biofilm on a130-year-old glass (Stockkämpen) was hybridized with a Cy5-labeled mixture of five bacteria probes (“EUB-Mix-(5)”, bluecolor). CLSM image: projection of 12 xy-sections, ∆z = 1 µm, magnification 1 000×. Bar, 20 µm.

Figure 2. Image analysis of microbial colonization on theglass surface. The microbial community was stained withthe nucleic acids stains Syto17 or PicoGreen (PG). For eachdata point the mean areal percentage of biofilm coverage ofthree areas (0.4 mm2 or 0.06 mm2) was determined; errorbars indicate the standard deviation. ● Biofilm on themedieval glass samples from Altenberg stained with Syto17(analyzed area 0.4 mm2 ). ■ Biofilm on the 130-year-oldglass samples from Brakel stained with Syto17 (analyzedarea 0.4 mm2). · Biofilm on the 130-year-old glass samplesfrom Stockkämpen stained with PG (analyzed area 0.06mm2).


Stockkämpen biofilm consisted mainly of bacterialcells and that these cells were characterized by lowphysiological activity.

5. Discussion

Microbial growth on glass and microbially influ-enced corrosion (MIC) of the glass matrix are depen-dent on the chemical durability of the glass and theoccurrence of essential nutrients. The medievalpotassium-lime-silicate glass from Altenberg has arelatively low chemical durability due to the lowcontent of network-forming and the high amount ofnetwork-modifying components; consequently, theglass matrix may be attacked by microorganisms.Organic carbon compounds were available as an ad-ditional cementing material layer, and the essentialtrace elements K, Ca, Mn and Fe were present insufficient quantities to enable microbial growth [13,14]. However, the surface of the medieval glass fromAltenberg was barely colonized by microorganisms.In previous work a variety of symptoms of MIC weredetected on the surface of this glass type [13] and itcan be assumed that the colonization density observedin this study was low due to the depletion of essentialnutrient compounds by earlier microbial growth. Thishypothesis is supported by the weak in situ fluores-cence hybridization signals.

A more dense biofilm was determined on the surfaceof the soda-lime-silicate glass from Brakel. Previouslythis glass type was characterized by high chemicalstability, weak biofilm growth and slight MIC [15].The bulk glass from Brakel is uncorroded [20] and,therefore, the microorganisms did not obtain anyessential minerals from the glass matrix. However,due to cold settings the microorganisms experiencedmore favorable growth conditions and, consequently,a thicker and denser biofilm developed. In contrast,the surface of the soda-lime-silicate glass from Stock-kämpen was colonized only by single cells and micro-colonies. The bulk glass is also uncorroded and theessential nutrients for microbial growth are providedby cementing material and cold settings. The veryweak growth on this glass sample may be explainedby the occurrence of lead in the surface layer whichcan have an inhibitory effect on microorganisms. It iswell known that on lead silicate glass types biofilmsdevelop only in a nanometer to micrometer range[13]. The highest chemical durability was determinedfor the glass samples from Bad Driburg. These glasssamples are characterized by a very inhomogeneousbiofilm. The lowest analyzed biofilm thickness of10 µm is typical for this modern soda-silicate glass[15], which is very resistant to microbial attack. The

additional layers of conservation and cementing ma-terials may contain nutrients and, therefore, microor-ganisms could grow on this type of glass. Becausethese layers did not fully coat the glass surface thebiofilm revealed a patchy growth pattern. To summa-rize, the surfaces of all glass window panels analyzedin this study were colonized with biofilms which werethinner than comparable biofilms growing under op-timal nutrient and humidity conditions [35, 36]. Thisresult does not indicate that MIC of the investigatedglass types is less important than that of other knowncases. The thickness of a biofilm may have an effect onthe time required for corrosion symptoms to occur,but even a thin biofilm layer can attack glass overtime.

Only a fraction of these organisms can be cultivatedunder laboratory conditions. Therefore, the identifi-cation of microbial populations without cultivationdirectly in their natural environments is very impor-tant. In situ hybridization with rRNA-targeted oligo-nucleotide probes gives information about the phylo-genetic composition of the microbial community andphysiological cell activity. The biofilm communitiesfrom Brakel and Bad Driburg were more physiologi-cally active, and the cells could be detected with asingle Eucarya probe. These filamentous microorgan-isms belong to the Fungi. The Stockkämpen biofilmwas difficult to characterize by in situ hybridizationwith a single Bacteria probe although the mixture offive different Bacteria probes yield satisfactory results.Rölleke et al. [21] investigated bacterial growth onthe same glass samples from Stockkämpen using de-naturing gradient gel electrophoresis (DGGE) ofPCR-amplified 16S rDNA fragments. This methodallows a closer look at the microbial diversity. Iso-lated 16S rDNA fragments can be sequenced to revealthe identity of the microorganisms growing on glasssamples. For Stockkämpen, a very complex bacterialcommunity comprising slowly growing organismswas determined [21]. These cells have a low ribosomecontent. Amann et al. [19] emphasized that cells witha low cellular rRNA content are difficult to detectwith fluorescently labeled rRNA-targeted probes. Inour study the use of several monolabeled oligonucle-otides targeted to independent sites of the rRNAmolecule resulted in a higher fluorescence intensity ofthe targeted cells. Similar results were observed by Leeet al. [28]. Planktonic bacteria showed an increase inthe probe-labeled fraction from 20% (one bacteriaprobe) to 75% (five bacteria probes) of the totalpopulation [28]. In contrast to these observationsmicroorganisms growing on the Altenberg glass couldnot be detected by applying a mixture of differentBacteria and Eucarya probes. Even after a cell-lysing


treatment the cells gave only very weak signals withthe “EUK-mix(3)”. These results are in agreementwith the observed very low biofilm density.

Filamentous fungi were the dominant microbialgroup on all investigated glass surfaces. Only theStockkämpen glass sample revealed a significant bac-terial population. This corroborates the results ob-tained by Rölleke et al. [21]. A high microbial diver-sity of culturable fungal species growing on the glasssurface from Altenberg was determined by Drewello[14]. A smaller variety of fungal species were foundon the glass surface from Brakel (Drewello U., unpub-lished). Likewise, the microbial composition of theBad Driburg biofilm is not very complex, only Cla-dosporium spp. could be isolated from this glasssamples. These observations demonstrate that thediversity of the microbial population growing on theglass surface varies with the glass type. Because thespecies identification of the fungi in previous reportswas done after a cultivation step which may havebiased the results, it is necessary to study the fungalspecies distribution by in situ analysis. In furtherinvestigations different probes directed at specificmembers of the Fungi should be used to detect sub-populations. In this study we demonstrated that fluo-rescent in situ hybridization (FISH) can be used forthe characterization of glass biofilms. Together withCLSM this technique represents an important tool togain insight into glass biofilm composition and bio-film density. These data are needed to enhance theunderstanding of biodeterioration processes and todecide upon the restoration measures to be used.

Acknowledgments

We thank Hannelore Römich (Fraunhofer-Institut fürSilicatforschung (ISC), Würzburg, Germany) for criti-cally reading the manuscript and Christoph Sander(restorer, Glasmalerei Peters, Paderborn, Germany)for providing us with original glass samples. Thiswork was supported partly by Deutsche Bundesstif-tung Umwelt (Osnabrück, Germany), grant numberAZ : 11 472.

References

[1] Caldwell D.E., Korber D.R., Lawrence J.R., Confocallaser scanning microscopy and digital image analysis inmicrobial ecology, Adv. Microb. Ecol. 12 (1992) 1–67.[2] Krumbein W.E., Petersen K., Mikroorganismen bes-chleunigen den Zerfall mittelalterlicher Wardgemälde, Ar-beitshefte zur Denkmalpflege in Niedersachsen 8 (1990)115–121.

[3] Lyalikova N.N., Petushkova Y.P., Role of microorgan-isms in the weathering of minerals in building stone ofhistorical buildings, Geomicrobiol. J. 9 (1991) 91–101.[4] Urzi C., Lisi S., Criseo G., Pernice A., Adhesion to anddegradation of marble by Micrococcus strain isolated fromit, Geomicrobiol. J. 9 (1991) 81–90.[5] Bock E., Sand W., The microbiology of masonry bio-deterioration, J. Appl. Bacteriol. 74 (1993) 503–514.[6] Mellor E., The decay of window glass from the point ofview of the lichenous growths, J. Soc. Glass Technol. 8(1924) 182–186.[7] Newton R., Davison S., Conservation of glass, Butter-worth, London, 1989.[8] Krumbein W.E., Urzi C.E., Gehrmann C., Biocorrosionand biodeterioration of antique and medieval glass, Geomi-crobiol. J. 9 (1991) 139–160.[9] Krumbein W.E., Gorbushina A.A., Rudolph C.,Urzi C., Biological investigations on the question of organicand inorganic eutrophication induced biocorrosions andbiogenic deposits on late medieval church windows of thecathedral of Tours and St. Katharina in Oppenheim, in:Welck S. (Ed.), Gemeinsames Erbe Gemeinsam Erhalten, 1.Statuskolloquium des dtsch.-frz, Forschungsprogrammszur Erhaltung von Baudenkmälern, Champs-sur-Marne,1993, pp. 269–275.[10]Perez y Jorba M., Mazerolles M., Michel D., Romme-luere M., Bahezre J.C., Corrosion process of the stainedglass window of the cathedral in Tours. Role of minorelements. Characterization of the ‘grisailles’, in: Welck S.(Ed.), Gemeinsames Erbe Gemeinsam Erhalten, 1. Sta-tuskolloquium des dtsch.-frz, Forschungsprogramms zurErhaltung von Baudenkmälern, Champs-sur-Marne, 1993,pp. 213–219.[11]Kaiser J.P., Trümpler S., Raschle P., Fungal growth onmedieval glass paintings, in: Heitz E., Flemming H.C.,Sand W. (Eds.), Microbially Influenced Corrosion of Mate-rials, Springer, Berlin, 1996, pp. 353–357.[12]Weissmann R., Drewello R., Attack on glass, in:Heitz E., Flemming H.C., Sand W. (Eds.), MicrobiallyInfluenced Corrosion of Materials, Springer, Berlin, 1996,pp. 339–352.[13]Drewello R., Weissmann R., Microbially influencedcorrosion of glass, Appl. Microbiol. Biotechnol. 47 (1997)337–346.[14]Drewello R., Mikrobiell induzierte Korrosion von Sil-ikatglas – unter besonderer Berücksichtigung von Alkali-Erdalkali-Silikatgläsern, Ph. D. thesis, Friedrich-AlexanderUniversität Erlangen-Nürnberg, Germany, 1998.[15]Drewello U., Weißmann R., Rölleke S., Müller E.,Wuertz S., Fekrsanati F., Troll C., Drewello R., Biogenicsurface layers on historical window glass and the effect ofExcimer Laser cleaning, J. Cult. Heritage 1 (suppl. 1) (2000)S161–S171.[16]Paul A., Chemistry of Glasses, Chapman and Hall,London, 1990.[17]Eckhardt F.E.W., Solubilization, transport and deposi-tion of mineral cations by microorganisms-efficient rockweathering agents, in: Drever J.I. (Ed.), The Chemistry ofWeathering, Reidel, Dordrecht, 1985, pp. 161–173.[18]Quellmalz G., The calcium oxalate Whewellite-mineralogy and natural occurrence, in: Alessandrini G.(Ed.), The Oxalate Films: Origin and Significance in the


Conservation of Works of Art, Centro CNR “Gino Bozza”,Politecnico di Milano, 1989, pp. 103–111.[19]Amann R.I., Ludwig W., Schleifer K.H., Phylogeneticidentification and in situ detection of individual microbialcells without cultivation, Microbiol. Rev. 59 (1995)143–169.[20]Drewello R., Weißmann R., Historische Glasfenster –Restaurierungsprobleme, neue Untersuchungsmethoden,Laserreinigung, Arbeitsblätter für Restauratoren 2/98(1998) 95–100.[21]Rölleke S., Gurtner C., Drewello U., Drewello R.,Lubitz W., Weissmann R., Analysis of bacterial communi-ties on historical glass by denaturing gradient gel electro-phoresis of PCR-amplified gene fragments coding for 16SrRNA, J. Microbiol. Methods 36 (1999) 107–114.[22]Wood P.J., Specificity in the interaction of direct dyeswith polysaccharides, Carbohydrate Res. 85 (1980)271–287.[23]Manz W., Amann R., Ludwig W., Wagner M., Schlei-fer K.H., Phylogenetic oligodeoxynucleotide probes for themajor subclasses of proteobacteria: problems and solutions,Syst. Appl. Microbiol. 15 (1992) 593–600.[24]Lim E.L., Caron D.A., Delong E.F., Development andfield application of a quantitative method for examiningnatural assemblages of protists with oligonucleotideprobes, Appl. Environ. Microbiol. 62 (1996) 1416–1423.[25]Amann R.I., Binder B.J., Olson R.J., Chisholm S.W.,Devereux R., Stahl D.A., Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry foranalyzing mixed microbial populations, Appl. Environ. Mi-crobiol. 56 (1990) 1919–1925.[26]Giovannoni S.J., DeLong E.F., Olsen G.J., Pace N.R.,Phylogenetic group-specific oligodeoxynucleotide probesfor identification of single microbial cells, J. Bacteriol. 170(1988) 720–726.[27]Hicks R., Amann R.I., Stahl D.A., Dual staining ofnatural bacterioplankton with 4’,6-diamidino-2-

phenylindole and fluorescent oligonucleotide probes target-ing kingdom-level 16S rRNA sequences, Appl. Environ.Microbiol. 58 (1992) 2158–2163.[28]Lee S., Malone C., Kemp P.F., Use of multiple 16SrRNA-targeted fluorescent probes to increase signalstrength and measure cellular RNA from natural planktonicbacteria, Mar. Ecol. Prog. Ser. 101 (1993) 193–201.[29]Brosius J., Dull T.J., Sleeter D.D., Noller H.F., Geneorganization and primary structure of ribosomal RNA op-eron from Escherichia coli, J. Mol. Biol. 148 (1981)107–127.[30]Kuehn M., Hausner M., Bungartz H.J., Wagner M.,Wilderer P.A., Wuertz S., Automated confocal laser scan-ning microscopy and semiautomated image processing foranalysis of biofilms, Appl. Environ. Microbiol. 64 (1998)4115–4127.[31]El-Shamy T.M., The chemical durability of K2O-CaO-MgO-SiO2 glasses, Phys. Chem. Glasses 14 (1973) 1–5.[32]Scholze H., Glas – Natur, Struktur und Eigenschaften,Springer-Verlag, Berlin, 1988.[33]Lawrence J.R., Korber D.R., Hoyle B.D., Coster-ton J.W., Caldwell D.E., Optical sectioning of biofilms,J. Bacteriol. 173 (1991) 6558–6567.[34]Neu T.R., Lawrence J.R., Development and structureof microbial biofilms in river water studied by confocal laserscanning microscopy, FEMS Microbiol. Ecol. 24 (1997)11–25.[35]Møller S., Pedersen A.R., Poulsen L.K., Arvin E., Mo-lin S., Activity and three-dimensional distribution totoluene-degrading Pseudomonas putida in a multispeciesbiofilm assessed by quantitative in situ hybridization andscanning confocal laser microscopy, Appl. Environ. Micro-biol. 62 (1996) 4632–4640.[36]Wolfaardt G.M., Lawrence J.R., Robarts R.D., Cald-well S.J., Caldwell D.E., Multicellular organization in adegradative biofilm community, Appl. Environ. Microbiol.60 (1994) 434–446.


in situ analysis of biofilms on historic window glass using confocal laser scanning microscopy

Documents