JOURNAL OF BACTERIOLOGY, Aug. 1991, p. 5079-5085 Vol. 173, No. 160021-9193/91/165079-07$02.00/0Copyright ©) 1991, American Society for Microbiology

Importance of the Position of TYR R Boxes for Repression andActivation of the tyrP and aroF Genes in Escherichia coli

A. E. ANDREWS,lt B. DICKSON,2t B. LAWLEY,1 C. COBBETT,2 AND A. J. PITTARD'*Department of Microbiology' and Department of Genetics,2 University of Melbourne, Parkville, Victoria 3052, Australia

Received 26 November 1990/Accepted 21 May 1991

Tyrosine-mediated repression of aroF and tyrP was studied by inserting DNA sequences between the twoadjacent TYR R boxes which, in each case, overlap the respective RNA polymerase binding sites of these genes.In both cases, repression was greatest when homologous regions of these two TYR R boxes were on the sameface of the DNA helix and the boxes were directly adjacent. An insertion of 3 bases was sufficient to abolishrepression, which was reestablished as the boxes became separated by one full turn of the helix. Theseobservations, coupled with the results of in vitro DNase I protection studies, supported the hypothesis that thebinding of TyrR protein to the downstream boxes required cooperative interaction with TyrR protein alreadybound to the upstream boxes. In the case of tyrP, moving the upstream box also affected activation. Maximalactivation was observed when the box was moved 3 or 12 to 14 residues upstream. Practically no activation wasseen at intermediate positions, such as +7 and -4. It is hypothesized that these results indicate positionsallowing maximal interaction between TyrR protein bound to the upstream box and RNA polymerase boundto the RNA polymerase binding site.

The expression of five transcription units of the TyrRregulon (aroL-aroM, aroF-tyrA, tyrP, aroP, and tyrB) isrepressed by tyrosine (4, 7, 8, 10, 25). In each case, thesetranscription units have two adjacent TYR R boxes (18). Theboxes, which are 22 nucleotides in length, are separated bya single base pair, and homologous regions of each box arelocated on approximately the same face of the DNA helix. Inthis study, by altering the number of bases between theboxes, we examined the importance of their positioning forefficient repression. The two regulatory regions chosen forthis study are those which control the expression of thearoF-tyrA operon and tyrP and are shown in Fig. 1.The expression of tyrP not only is repressed by TyrR

protein in the presence of tyrosine but also is activated byTyrR protein in the presence of phenylalanine. This activa-tion requires only a functional left-hand, or upstream, box(1, 9). By changing the position of this box relative to theRNA polymerase binding site, we were also able to examinethe effect of positioning on the activation of tyrP expression.

MATERIALS AND METHODS

Bacterial strains, plasmids, and bacteriophages. The bacte-rial strhins used in this study were all derivatives of Esche-richia coli K-12, and their relevant characteristics are shownin Table 1. The plasmids used are also shown in Table 1.Bacteriophages M13mplO, M13tg130, and M13tgl31 havebeen described elsewhere (11).Media and chemicals. The minimal medium used was

prepared from the 56/2 buffer of Monod et al. (17) andsupplemented with appropriate growth requirements. Tostudy regulation, we added tyrosine and/or phenylalanine tothe minimal medium at a final concentration of 1 mM.Trimethoprim was used in nutrient and minimal media at

* Corresponding author.t Present address: Department of Veterinary Science, University

of Melbourne, Parkville, Victoria 3052, Australia.t Present address: Zoological Institute, University of Zurich,

Zurich CH 8057, Switzerland.

final concentrations of 40 and 10 1tg/ml, respectively. Ampi-cillin was used at a final concentration, in all media, of 25,ug/ml. The chemicals used were all obtained commerciallyand not purified further. [a-35S]dATP (1,200 Ci/mmol; 10mCi/ml) was obtained from Amersham International.Recombinant DNA techniques. Standard techniques were

used essentially as described previously (14). DNA sequenc-ing of operator mutants involved cloning the respectivepromoter-operator regions into the M13tg130 and M13tgl31vectors (11) and sequencing via the chain terminationmethod of Sanger et al. (21) with modified T7 polymerase(24).

Construction of aroF and tyrP spacing mutations. Spacingmutations in aroF and tyrP were constructed by basictechniques of oligonucleotide-directed mutagenesis, exonu-clease digestion, and ligation (12, 14). Each of the mutationswas sequenced before use. The sequences are shown in Fig.2 and 3.

Oligonucleotide-directed mutagenesis. Oligonucleotideswere synthesized on either an Applied Biosystems 381ADNA synthesizer or a Pharmacia GeneAssembler Plus.Mutagenesis was performed on M13tgl31 derivatives con-taining the tyrP promoter-operator region from pMU2003with an oligonucleotide-directed in vitro mutagenesis systemkit from Amersham.Enzyme assays. 1-Galactosidase activity was assayed as

described by Miller (16). Chloramphenicol acetyltransferase(CAT) assays were carried out as previously described (6).DNase I footprinting of the tyrP operator with purified TyrR

protein. The method used was that described in the accom-panying paper (1).

RESULTS

tyrP spacing mutants. The details of the insertion anddeletion mutants are shown in Fig. 2. In their construction,it was assumed that the actual sequences which were in-serted or deleted only exerted their effects by altering thedistance between the left-hand box and the downstreamsequences. Apart from avoiding the creation of another TYR

5079

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

5080 ANDREWS ET AL.

tyrP-35

ATTGTACAmTATAmTACAOC A TATGTAAOGTC GGMTTGACGAA11/12 9/12

LEFT HAND BOX RIGHT HAND BOX

aroF-35

AGTGTAAAmTATCTATACAGA -30-r TGTGTAAATMAAATGTACGAA A TATGGA1TGT AACTTTACITI11/12 10/12 8/12

BOX 3 BOX 2 BOX 1

FIG. 1. Nucleotide sequences of the TYR R boxes in tyrP and aroF. The 22-bp TYR R boxes are shown with the -35 region of eachpromoter marked. The number of bases in each box matching the TGTAAA-N6-TTTACA consensus sequence is shown below the box.

R box or an RNA polymerase binding site, we determinedthe sequences of the inserts solely by the strategies used intheir creation. Plasmids with these alterations were derivedfrom pMU2003, which is described in the accompanyingpaper (1). In these plasmids, 3-galactosidase synthesis is adirect result of transcription initiated from the tyrP pro-moter.

Effect of spacing changes on tyrP repression. Each of theplasmids represented in Fig. 2 was transformed into thetyrR+ strain JP3561 and into its tyrR366 derivative JP4822.Cells were grown in minimal medium plus tyrosine and inminimal medium plus phenylalanine and assayed for n-ga-lactosidase activity. The results obtained with the plasmidderivatives of JP4822 measured the effects of the insertionsand deletions on the unregulated activity of the tyrP pro-moter. None of the insertions had any effect on promoteractivity (data not shown). The ,-galactosidase levels ob-tained in plasmid derivatives of JP3561 are shown in Fig. 4.This figure also shows the average ,B-galactosidase levelobtained in plasmid derivatives of JP4822. As can be seenfrom the graph, tyrosine-mediated repression is at a maxi-mum in the mutant in which 1 base has been deleted betweenthe boxes (-1 mutant). As the boxes are moved furtherapart, repression decreases. With an insertion of 1 base,

TABLE 1. E. coli K-12 strains and plasmids used in this work

Strain or . Source orplasmid ~Relevant characteristics" eeecplasmid reference

StrainsJP3561 thr-J leu-J lacZAM15 supE44 tonA2 9

gyrA379 aroL478::TnlOJP4099 tyrR366 lacZAM15 6JP4822 JP3561 tyrR366b P1 transductionCC146 JP4098/pMU1065 6

PlasmidspBR328 Apr Tcr Cmr 23pKK232.8 Apr; ColEl replicon 3pMU575 Tpr ga1K'lac'ZYA; low-copy- 1

number promoter cloning vectorpMU1743 Apr; aroF-cat fusion 6pMU1745 Apr; aroF-cat fusion 6pMU2016 Apr; tyrP promoter fragment in This work

pBR328a The nomenclature for genetic symbols follows that described by Bach-

mann (2). Apr, ampicillin resistance; Tcr, tetracycline resistance; Cmr,chloramphenicol resistance; Tpr, trimethoprim resistance.

b tyrR366 is a frameshift mutatioin which creates a stop codon within thecoding sequence of the tyrR gene and destroys all TyrR activity (21a).

repression approaches that observed in the tyrR366 deriva-tive. Insertions of 2, 3, 4, 5, and 6 bases all result in,B-galactosidase levels equal to or greater than that observedin the tyrR366 derivative, with the highest level of activitybeing observed in the +4 mutant. In the +7, +8, +9, and+ 10 mutants, repression is progressively restored, reaching

ATTGTACATTTATATTTACACC A TATGTMCGTCGGTTTGACGAleft hand TYR R box right hand TYR R box

-4 CACC GTAA

3 CACO TGTA

- 2 CAC IATGT-1 ATC

+1 CACCO AT ITATG+2 CACC ATA TATG

+3 CACC ATCG TATG

+4 CACC ATCTG TATG+5 ATCATG TATG+6 CACCGGGTCC G+7 CACO AGGGTACCTAG+8 CACC ATACAGCTG TAG+9 CACC ATAGGGTACC TATG

+10 CACC ATACAGATCTG TATG+12 CACC ATCAGATGATCTGTAG+14 CACC ATACAGATCGATCTG TATG+16 CACC A(TAGGATCCCGGGTACC)1 TATG+32 CACC IA(TAGGATCCCGGGTACC)2 TG+48 CACC A(TAGGATCCCGGGTACC)3 TAG+80 CACC A(TAGGATCCCGGGTACC)5 TAG+92 CACC A(TAGGATCCCGGGTACC)6 TAG

FIG. 2. Sequence changes in the tyrP spacing mutants. Theleft-hand and right-hand TYR R boxes are shown, with the -35region underlined. The region between the boxes shows the se-quence of the deleted and inserted bases. In each case, the left-handTYR R box remains intact, while the right-hand TYR R box is onlyaltered in the -2, -3, and -4 mutants.

J. BACTERIOL.

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

TYR R BOX POSITIONING FOR REPRESSION AND ACTIVATION 5081

CTAG3 ' F- -l 5'TTTTACATGCTT ATACCTAACTTT oligonucleotide

|TGTGTAAATAAAAATGTACGAA A TATGGATTGAAAACTTTCTTTA wild type

- 1

+1

+3

+6

+7

+8+15

TYR R box 2 TYR R box 1

AATCTAA GATC TA

AA GATCGTC TA

A GATCGAC TA

AA GATCCGATC TA

AA GATCCGAGCTCGGATC TA

+30 AA GGATCCGTCGACCTGCAGCCMGCTTGGAAA TA

FIG. 3. Sequence changes in the aroF promoter region. The wild-type nucleotide sequence of the aroF promoter containing TYR R boxes1 and 2 is shown. The TYR R boxes are boxed, and the -35 promoter sequence is underlined. The oligonucleotide was used to generate the+3 mutant derivative. The nucleotide sequence of the region between the two boxes in each mutant and the wild type is also shown. Thenumbers at the left indicate the number of nucleotides inserted or deleted in each case. The BgIII and ClaI sites in the +3 and +7 mutantderivatives, respectively, are underlined.

a maximum in the +9 mutant, in which, however, repressionis almost three times higher than that in the -1 mutant.These results show a clear periodicity, with maximum re-pression occurring when the two boxes are positioned on thesame face of the helix. When 32 bases were inserted betweenthe boxes, the ,-galactosidase activities of cells grown inminimal medium with tyrosine or with phenylalanine were581 and 771 U, respectively. Repression is therefore abol-ished when the boxes are separated by three full turns of thehelix. Insertions of 48, 80, or 96 bases resulted in theabolition of both repression and activation (data not shown).

Effect of spacing changes on tyrP activation. From theresults previously mentioned and shown in Fig. 4, it can be

3000 a MM+Tyr

* MM+Phe

CIO 2000

(D(nCZ-0

0C.) 1000CIO

0)

-4-3-2-1 0 1 2 3 4 5 6 7 8 9 10 12 14 16

Change in SpacingFIG. 4. ,B-galactosidase activity of JP3561 containing tyrP spac-

ing mutations and grown in minimal medium supplemented with 1mM tyrosine (El) or 1 mM phenylalanine (*). The average 3-galac-tosidase activity of tyrR366 strains carrying tyrP plasmids is indi-cated by the horizontal line. 3-Galactosidase activity units of arethose defined by Miller (16).

concluded that activation is found in all spacing mutants,except those in which the insertion is greater that 32 bases.An examination of Fig. 4 shows that for cells grown in thepresence of phenylalanine, maximum activity is found in the+3 mutant and again in the +12 and +14 mutants, thusshowing a marked periodicity. If this periodicity reflects theactivation process itself, it could well reflect changes in therelative positions of RNA polymerase and TyrR protein onthe DNA helix.On the other hand, there is the possibility that the perio-

dicity seen in Fig. 4 for the cells grown in the presence ofphenylalanine is only a reflection of the periodicity seen withrepression. The +3 and +4 mutants show both a minimum of

1400

-u--n MM+Tyr1200 9-MM+Phe

1000CZ

U)CZ 800-0

0C.) 600

CL 400

200

-4-3-2- 1 01 2 34 56 7 8 910 1 2 1 4 1 6

Change in spacingFIG. 5. 3-Galactosidase activity of a repression-negative strain

containing tyrP spacing mutations. Cells were grown in minimalmedium plus 1 mM tyrosine (El) or 1 mM phenylalanine (*). Theaverage ,B-galactosidase activity of tyrR366 strains carrying tyrPplasmids is indicated by the horizontal line. 3-Galactosidase activityunits are those defined by Miller (16).

VOL. 173, 1991

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

5082 ANDREWS ET AL. J. BACTERIOL.

a

0

a

a)cc ATP ATP cctn tyrosine phenylalanine >.+o o [TyrR]

175 70 35 10 5 175 70 35 10 5 ° [nA~~~ ~ ~~~~~~:__|A>

-.: *m 0

LeftBox

RightBox

.~~

g~~~

~

0- ATPOcr

n, tyrosine<HF+0o_D a 175 70 35 1

_~

ATPphenylalanine

17r, 7n .ir, in r,

Bo [TyrRI

nM

ILeftBox

RightBox

'Z1 + .:; ' * :$' :re.-:: - -- ^

X-li-i-* - <> . a.s - - -^X ......... SF_-

s - SX-tw- .... - :"ex -. - *- ..... *-*... - : . -_ r'__U =

FIG. 6. DNase I footprinting of the antisense strand of tyrP wild-type and mutant operators. A 328-bp DNA fragment containing the tyrPregulatory region was 32p labelled at the 3' end of the antisense strand and subjected to partial DNase I digestion in the presence of purifiedTyrR protein. Tyrosine, phenylalanine, and ATP were added at final concentrations of 1, 1, and 0.2 mM, respectively, to the preincubationmixture. The concentrations of TyrR protein are shown above the gels. The G+A Maxam-Gilbert (15) sequence of the operator fragmentsis shown, with the regions corresponding to the left-hand and right-hand TYR R boxes marked. (A) Footprint of the operator from the +4spacing mutant. (B) Footprint of the operator from the + 10 spacing mutant. (C) Footprint of the operator from the +48 spacing mutant.

tyrosine-mediated repression and a maximum of phenylala-nine-mediated enhancement. If activation does exhibit peri-odicity with maxima at +3 and + 13 and if this activation canwork over long distances on the DNA, the +48 mutantwould be expected to show activation. As reported above,although some activation could still be seen in the +32mutant, activation had disappeared in the +48 mutant.

Activation of tyrP in repression-negative mutants. To dis-criminate between increased activity resulting from the lossof repression and increased activity resulting from enhancedactivation, we transformed the plasmids containing the spac-ing mutations into a tyrR mutant strain carrying a plasmidwith a mutant tyrR gene. This mutation, which affects theATP binding site of the protein, results in a TyrR proteinwhich has lost the ability to repress genes of the TyrRregulon but is still able to mediate activation (21b).The ,-galactosidase activities of repression-negative

strains with the tyrR spacing mutations are shown in Fig. 5.It is evident that there is a significant periodicity in phenyl-alanine-mediated activation and that the variation in activa-tion levels is not just a result of changes in repression. Inthese mutants, tyrosine also activates expression and ,B-ga-lactosidase levels never fall below that of the tyrR mutantstrain.The results obtained with this mutant TyrR protein were

subsequently confirmed by the construction of new +3, +9

and + 14 spacing mutants in which the right-hand box wasmutated A to G at the -6 position. This mutation destroystyrosine-mediated repression but does not adversely affectactivation (1, 9). These mutants showed levels of activationsimilar to those seen in Fig. 5 (data not shown).DNase I protection studies. DNA templates from the +4,

+10, and +48 mutants were used in in vitro DNase protec-tion studies involving the purified TyrR protein and theeffectors ATP, tyrosine, and phenylalanine. The results areshown in Fig. 6. See the accompanying paper (1) for resultswith the wild-type template. In the case of the +4 mutant,there is no protection of the right-hand box, even in thepresence of tyrosine and ATP. The left-hand box is stillprotected, and the result is remarkably similar to thatobtained with the right-hand box mutant described in theaccompanying paper (1). In the +10 mutant, protection ofboth boxes occurs in the presence of tyrosine and ATP.However, by comparison with the wild type, protectionrequires a higher concentration of TyrR protein. Althoughboth boxes are protected, the inserted region between theboxes is not protected. In the presence of ATP and phenyl-alanine, only the left-hand box is protected, as is the case forthe wild type.

In the +48 mutant, there is still protection of the left-handbox, indicating that a failure to activate is not a consequenceof a failure of TyrR to bind. There is no protection of the

-sWT ! _wW.

ffva. .

W-K4w.,Va-4v.t

*:

- -.414-1.x' s-,. 40M q~ .-

4%&

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

TYR R BOX POSITIONING FOR REPRESSION AND ACTIVATION 5083

c)a)

5)

cr ATP ATP

tyrosine phenylalanine >.+ ol0 TyrR](2) 175 70 35 10 5 175 70 35 10 5 ]

LeftBox

RightBox

-ik

FIG. 6-Co,itinuiedl

right-hand box, except at the highest concentration of TyrR

protein used (175 nM). This protection is seen in the pres-

ence of tyrosine and ATP and also in the presence of

phenylalanine and ATP. The failure to observe any repres-

sion in the +48 mutant suggests that this protection results

from nonphysiological levels of TyrR protein.

Repression of the aroF promoter in spacing mutants. The

effect of spacing mutations between the two adjacent TYR R

boxes on TyrR-mediated repression of the aroF promoter

was also examined. It was previously shown that in the

absence of upstream box 3, boxes 1 and 2 can still exert a

significant level of repression, although less than that ob-

served in the wild type (6). Thus, we wished to investigatethe effect of these spacing mutations both in the absence of

box 3 (a situation analogous to tyrP) and in its presence.

These mutations were created in pMU1745, a derivative of

the cat fusion vector pKK232.8, in which the cat gene is

transcribed from the aroF promoter containing boxes 1 and

2 but not box 3 (6). Subsequently, box 3 was placed

upstream of each of these mutant promoter regions. The

details of the mutations are shown in Fig. 3.

Each of these plasmids was transformed into the tyrR366strain JP4099 and into strain CC146, which contains the

multicopy tyrR' plasmid pMU1065. Cells were grown to the

mid-log phase in Luria broth and assayed for CAT activity.

The activities obtained are shown in Table 2. In the tyrR366

strain, the CAT activities conferred by the various plasmidsdiffered over an eightfold range, suggesting that the muta-

tions had a significant influence on the expression of the

TABLE 2. Repression of aroF-cat fusions

CAT activity (U/mg of protein)

Boxes 1 and 2b Boxes 1, 2, and 3'Spacing mutation'

tx'rRd Multicopy Ratioe tyrRd Multicopy Ratio'tVrR+d tVrR+d

-1 9.2 0.077 120 7.9 0.013 6100 (Wild type) 8.5 0.39 22 9.0 0.053 169+1 6.5 1.1 5.7 5.6 0.12 46+3 2.9 3.3 0.9 2.3 1.4 1.7+6 1.9 1.3 1.4 1.1 0.35 3.1+7 3.7 0.91 4.1 5.1 0.36 14+8 4.1 0.53 7.7 3.6 0.09 40+15 1.7 2.5 0.7 NDf ND+30 4.8 5.2 0.9 ND NDDeletion of box 2 5.0 4.9 1.0 ND ND

aThe number of bases inserted or deleted between boxes 1 and 2.b Construction contained only boxes 1 and 2.' Construction contained boxes 1 and 2 and upstream box 3.d CAT activities were measured in JP4099 (tyrR) and CC146 (multicopy

tyrR+).eThe ratio of the activity conferred on JP4099 to that conferred on CC146.-" ND, not determined.

derepressed promoter. Because of this variation, the resultsare also expressed as ratios of the activity obtained in thetyrR366 strain to that obtained in the multicopy tyrR+ strain,thereby indicating the degree to which each construct isrepressed.As in the case of tyrP, altering the distance between the

adjacent boxes in aroF significantly affected the repressionof the aroF-cat fusions in either the presence or the absenceof the upstream box. Deletion of a single base increased therepression ratio three- to fourfold, while insertion of a singlebase decreased the repression ratio twofold. Insertions of 3and 6 bases, which would place boxes 1 and 2 on oppositesides of the DNA helix, abolished repression in the absenceof box 3 and reduced it to a very low level in plasmidscontaining all three boxes. As further bases were added inthe +7 and +8 derivatives, thus progressively restoring thealignment of the two boxes on the same face of the helix,repression was progressively increased.

In the wild-type strain, the aroF operon is repressed bytyrosine and, to a lesser extent, by high concentrations ofphenylalanine (7), although it is not yet clear through whichTYR R boxes the latter effect is mediated. As reported in theaccompanying paper (1), activation of the tyrP promoter byphenylalanine in tyrR+ strains is mediated via the upstream,or left-hand, box, and mutations in the right-hand box, whichabolish tyrosine-mediated repression, have no effect onphenylalanine activation. In the tyrP promoter, the end ofthe left-hand box is positioned 15 bases upstream of the -35sequence.A mutant (+8) having exactly the same spacing between

the left-hand box and the -35 sequence in the aroF promoterwas constructed, and it was of interest to determine whetherit exhibited phenylalanine activation similar to that found fortyrP. To do this, we cloned the promoter regions of thewild-type and +8 plasmids into the expression vectorpMU575 (1) and transformed the resultant plasmids into thetyrR+ strain JP3561 and its tyrR366 derivative JP4822. In thetyrR366 strain, neither tyrosine nor phenylalanine affectedthe expression of either plasmid. For the wild-type plasmidin the tyrR+ strain, 5.5-fold repression and 2.6-fold repres-sion of 3-galactosidase activity were observed when cells

VOL. 173, 1991

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

5084 ANDREWS ET AL.

were grown, respectively, in minimal medium plus tyrosineand in minimal medium plus phenylalanine. For the +8plasmid in the tyrR+ strain, tyrosine-mediated repressionwas reduced to 2.6-fold, while in the presence of phenylal-anine neither repression nor activation was observed (datanot shown).

DISCUSSION

In the accompanying paper (1), we postulated that ty-rosine-mediated repression of tyrP and other genes of theTyrR regulon involves the cooperative binding of two TyrRmolecules to both TYR R boxes. By moving the left-handbox further upstream, we have been able to show that forrepression to occur, the two TYR R boxes need to be alignedon the same face of the DNA helix. When the boxes areseparated by less than a full turn of the helix, as in the +4mutant, tyrosine-mediated repression is abolished. DNase Iprotection studies show that in the +4 mutant, TyrR proteinstill binds to the upstream box, but in the presence oftyrosine and ATP, there is no binding to the downstreambox. In the +10 mutant, binding to both boxes is reestab-lished, as is tyrosine-mediated repression. Essentially thesame results are obtained with aroF, in which repression isgreatly reduced by the insertion of 1 base and completelyabolished by the introduction of 3 bases. Insertion of 7 or 8bases, however, progressively restores repression. Of par-ticular interest is the observation that for both aroF andtyrP, deletion of the 1 base between the boxes results inenhanced repression. Since the boxes are 22 bases in length,removal of this 1 base should align homologous regions ofeach box more exactly on the same face of the helix. The factthat the 1-base spacer is present in aroF, tyrP, tyrB, aroL,and aroP suggests that the arrangement which provides themost efficient repression has not been selected during evo-lution. The results which show that adjacent boxes need tobe on the same face of the helix for efficient repression tooccur are in agreement with the hypothesis that cooperativebinding between two TyrR molecules is required for theprotein to bind to the downstream box and inhibit transcrip-tion. We have not yet constructed +22 spacing mutants;however, the failure to observe repression in the +32 tyrPmutant and the +30 aroF mutant indicates that the interac-tion between molecules binding to the two boxes can onlyoccur over short distances. By contrast, it has already beenshown (6) that the single box of aroF, which is located 30bases upstream of the adjacent boxes, does influence repres-sion, presumably as a result of an interaction between theTyrR protein bound at that box and the TyrR protein boundat the adjacent boxes. Furthermore, moving that single boxfurther upstream does not result in the same periodicity ofeffects as that reported here (5). The explanation for thesedifferences may well lie in the fact that the interaction that isseen between the two adjacent boxes in both aroF and tyrPoccurs between two boxes with different affinities for TyrRprotein. The proposed weakness of the interaction betweenthe downstream box and TyrR protein may explain whyreactions involving just this box and the adjacent upstreambox occur only over short distances. This idea could betested by constructing a +32 mutant in which both adjacentboxes have an equally strong affinity for TyrR protein.An even more dramatic effect of spacing on expression is

seen when one considers the activation of tyrP expression.Again, there is a clear periodicity of effects, with maximalactivation occurring in the regions from + 1 to +3 and + 12 to+ 14. It seems likely that when the upstream box is in either

of these positions, the ability of TyrR protein to interact withRNA polymerase and activate transcription is maximized.One other gene of the TyrR regulon (mtr) is also activated byTyrR, and in this case the position of an upstream TYR Rbox shown to be involved in activation corresponds to the+13 position (22). In the case of tyrP, the left-hand boxserves as a target critical for both activation and repression,and it appears that some of its effectiveness as an activatorhas been sacrificed to allow effective repression.The failure to observe activation when the left-hand box is

moved more than 32 bases upstream differentiates TyrRactivation from activation involving other activator proteins,such as NtrC (20). In this regard, activation of tyrP by TyrRprotein more closely resembles activation of ompC byOmpR protein (13), with which activation again appears towork best over small distances, being almost completely lostwith a spacer of 31 bases but being highest, at intermediatedistances, when the OmpR binding sites have been movedby integral turns of the helix.The mechanism by which activation occurs is at the

moment unknown. The observation that TyrR protein withan alteration in the region of the ATP binding site canactivate but not repress is unexpected, since in the case ofNtrC, it has been proposed that ATP is intimately involvedin the activation of transcription (19). The failure to observeactivation by phenylalanine in the +8 aroF spacing mutantmay simply reflect the basic difference in promoter strengthbetween aroF and tyrP. The putative -35 and -10 se-quences of aroF are TTGAAA and TATCGT, respectively,with a 15-base spacer; those of tyrP are TTGACG andTAACCT, respectively, with a 17-base spacer. However, ina tyrR mutant background, a lacZ transcriptional fusion witharoF is expressed at approximately tenfold a tyrP-IacZfusion. Further studies are required to identify the molecularbasis for the activation of the tyrP promoter.

ACKNOWLEDGMENTS

This work was supported by the Australian Research Council.A. E. Andrews and B. Lawley were recipients of CommonwealthPostgraduate Awards.We thank D. Presidente, S. Potter, L. Farmer, and L. Vizard for

technical assistance and J. Praszkier, B. E. Davidson, and V.Argyropoulos for helpful discussions.

REFERENCES

1. Andrews, A. E., B. Lawley, and A. J. Pittard. 1991. Mutationalanalysis of repression and activation of the tyrP gene in Esch-erichia coli K-12. J. Bacteriol. 173:5068-5078.

2. Bachmann, B. J. 1987. Linkage map of Escherichia coli K-12,edition 7, p. 807-876. In F. C. Neidhardt, J. L. Ingraham, K. B.Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.),Escherichia coli and Salmonella typhimurium: cellular andmolecular biology. American Society for Microbiology, Wash-ington, D.C.

3. Brosius, J. 1984. Plasmid vectors for the selection of promoters.Gene 27:151-160.

4. Chye, M.-L., and J. Pittard. 1987. Transcription control of thearoP gene in Escherichia coli K-12: analysis of operator mu-tants. J. Bacteriol. 169:386-393.

5. Cobbett, C. S. 1988. Repression of the aroF promoter by theTyrR repressor in Escherichia coli K-12: role of the 'upstream'operator site. Mol. Microbiol. 2:377-383.

6. Cobbett, C. S., and M. L. Delbridge. 1987. Regulatory mutantsof the aroF-tyrA operon of Escherichia coli K-12. J. Bacteriol.169:2500-2506.

7. Cobbett, C. S., S. Morrison, and J. Pittard. 1984. Isolation andanalysis of aroFo mutants by using an aroF-lac operon fusion.

J. BACTERIOL.

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

TYR R BOX POSITIONING FOR REPRESSION AND ACTIVATION 5085

J. Bacteriol. 157:303-310.

8. DeFeyter, R. C., B. E. Davidson, and J. Pittard. 1986. Thenucleotide sequence of the transcription unit containing thearoL and aroM genes from Escherichia coli K-12. J. Bacteriol.165:233-239.

9. Kasian, P. A., B. E. Davidson, and J. Pittard. 1986. Molecularanalysis of the promoter operator region of the Escherichia coliK-12 tyrP gene. J. Bacteriol. 167:556-561.

10. Kasian, P. A., and J. Pittard. 1984. Construction of a tyrP-lacoperon fusion strain and its use in the isolation and analysis ofmutants derepressed for tyrP expression. J. Bacteriol. 160:175-183.

11. Kieny, M. P., R. Lathe, and J. P. Lecocq. 1983. New versatilecloning and sequencing vectors based on bacteriophage M13.Gene 26:91-99.

12. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid andefficient site-specific mutagenesis without phenotypic selection.Methods Enzymol. 154:367-382.

13. Maeda, S., Y. Ozawa, T. Mizuno, and S. Mizushima. 1988.Stereospecific positioning of the cis-acting sequence with re-

spect to the canonical promoter is required for activation of theompC gene by a positive regulator, ImpR, in Escherichia coli. J.Mol. Biol. 202:433-441.

14. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

15. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

16. Miller, J. H. 1974. Experiments in molecular genetics, p.

352-355. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.

17. Monod, J., G. Cohen-Bazaire, and M. Cohn. 1951. Sur labiosynthese de la ,-galactosidase (lactase) chez Escherichia

coli. La specificite de l'induction. Biochim. Biophys. Acta7:585-599.

18. Pittard, A. J. 1987. Biosynthesis of the aromatic amino acids, p.368-394. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B.Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Esche-richia coli and Salmonella typhimurium: cellular and molecularbiology. American Society for Microbiology, Washington, D.C.

19. Popham, D. L., D. Szeto, J. Keener, and S. Kustu. 1989.Function of a bacterial activator protein that binds to transcrip-tional enhancers. Science 243:629-635.

20. Reitzer, L. J., B. Movsas, and B. Magasanik. 1989. Activation ofgInA transcription by nitrogen regulator I (NR,)-phosphate inEscherichia coli: evidence for a long-range physical interactionbetween NRI-phosphate and RNA polymerase. J. Bacteriol.171:5512-5522.

21. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

21a.Sarsero, J. P. 1988. B.Sc. honors thesis. The University ofMelbourne, Parkville, Australia.

21b.Sarsero, J. P., S. Ganesan, and A. J. Pittard. Unpublished data.22. Sarsero, J. P., P. J. Wookey, and A. J. Pittard. 1991. Regulation

of expression of the Escherichia coli K-12 mtr gene by TyrRprotein and Trp repressor. J. Bacteriol. 173:4133-4143.

23. Soberon, X., L. Covarrubias, and F. Bolivar. 1980. Constructionand characterization of new cloning vehicles. IV. Deletionderivatives of pBR322 and pBR325. Gene 9:287-305.

24. Tabor, S., and C. C. Richardson. 1987. DNA sequence analysiswith a modified bacteriophage T7 DNA polymerase. Proc. Natl.Acad. Sci. USA 84:4767-4771.

25. Yang, J., and J. Pittard. 1987. Molecular analysis of theregulatory region of the Escherichia coli K-12 tyrB gene. J.Bacteriol. 169:4710-4715.

VOL. 173, 1991

on April 5, 2020 by guest

http://jb.asm.org/

Dow

nloaded from