impairment of ubiquitin–proteasome system by e334k cmybpc modifies channel proteins, leading to...

doi:10.1016/j.jmb.2011.09.006 J. Mol. Biol. (2011) 413, 857–878

Contents lists available at www.sciencedirect.com

Journal of Molecular Biologyj ourna l homepage: ht tp : / /ees .e lsev ie r.com. jmb

Impairment of Ubiquitin–Proteasome System by E334KcMyBPC Modifies Channel Proteins, Leading toElectrophysiological DysfunctionUdin Bahrudin 1, 2†, Kumi Morikawa 1†, Ayako Takeuchi 3,Yasutaka Kurata 4, Junichiro Miake 5, Einosuke Mizuta 5, Kaori Adachi 6,Katsumi Higaki 6, Yasutaka Yamamoto 1, Yasuaki Shirayoshi 1,Akio Yoshida 1, Masahiko Kato 5, Kazuhiro Yamamoto 5, Eiji Nanba 6,Hiroko Morisaki 7, Takayuki Morisaki 7, Satoshi Matsuoka 8,Haruaki Ninomiya 9 and Ichiro Hisatome 1⁎1Division of Regenerative Medicine and Therapeutics, Institute of Regenerative Medicine and Biofunction,Tottori University Graduate School of Medical Science, Yonago, Japan2Department of Cardiology and Vascular Medicine, Faculty of Medicine, Diponegoro University, Semarang, Indonesia3Department of Physiology and Biophysics, Graduate School of Medicine, Kyoto University, Kyoto, Japan4Department of Physiology, Kanazawa Medical University, Ishikawa, Japan5Division of Molecular Medicine and Therapeutics, Tottori University Faculty of Medicine, Yonago, Japan6Division of Functional Genomics, Research Center for Bioscience and Technology, Tottori University, Yonago, Japan7Department of Bioscience, National Cardiovascular Center Research Institute, Osaka, Japan8Center for Innovation in Immunoregulative Technology and Therapeutics, Graduate School of Medicine,Kyoto University, Kyoto, Japan9Department of Biological Regulation, Tottori University Faculty of Medicine, Yonago, Japan

Received 3 May 2011;received in revised form25 August 2011;accepted 5 September 2011Available online12 September 2011

Edited by I. B. Holland

Keywords:ubiquitin–proteasomesystem;cardiac myosin-bindingprotein C;cardiac electrophysiologicaldysfunction;

hyAβ-

00

*Corresponding author. Nishimachi 8† U.B. and K.M. contributed equallyAbbreviations used: UPS, ubiquitinpertrophic cardiomyopathy; APD, aPD90, APD at 90% repolarization; Epadrenergic receptor; qRT-PCR, quan

22-2836/$ - see front matter © 2011 Else

Cardiac arrhythmogenesis is regulated by channel proteins whose proteinlevels are in turn regulated by the ubiquitin–proteasome system (UPS).We have previously reported on UPS impairment induced by E334Kcardiac myosin-binding protein C (cMyBPC), which causes hypertrophiccardiomyopathy (HCM) accompanied by arrhythmia. We hypothesizedthat UPS impairment induced by E334K cMyBPC causes accumulation ofcardiac channel proteins, leading to electrophysiological dysfunction.Wild-type or E334K cMyBPC was overexpressed in HL-1 cells andprimary cultured neonatal rat cardiac myocytes. The expression of E334KcMyBPC suppressed cellular proteasome activities. The protein levels ofKv1.5, Nav1.5, Hcn4, Cav3.2, Cav1.2, Serca, RyR2, and Ncx1 weresignificantly higher in cells expressing E334K cMyBPC than in wildtype. They further increased in cells pretreated with MG132 and hadlonger protein decays. The channel proteins retained the correctlocalization. Cells expressing E334K cMyBPC exhibited higher Ca2+

transients and longer action potential durations (APDs), accompanied by

6, Yonago 683-8503, Japan. E-mail address: [email protected] this work.

–proteasome system; cMyBPC, cardiac myosin-binding protein C; HCM,ction potential duration; Wt, wild type; NRCM, neonatal rat cardiac myocyte;i, subepicardial; Endo, subendocardial; AD, afterdepolarization; β-AR,titative reverse transcriptase–polymerase chain reaction.

vier Ltd. All rights reserved.

http://dx.doi.org/10.1016/j.jmb.2011.09.006

mailto:[email protected]

channel protein;hypertrophiccardiomyopathy

858 UPS Impairment and Cardiac Dysfunction

afterdepolarizations and higher apoptosis. Those augments of APD and Ca2+

transients were recapitulated by a simulation model. Although a Ca2+

antagonist, azelnidipine, neither protected E334K cMyBPC from degrada-tion nor affected E334K cMyBPC incorporation into the sarcomere, itnormalized the APD and Ca2+ transients and partially reversed the levels ofthose proteins regulating apoptosis, thereby attenuating apoptosis. Inconclusion, UPS impairment caused by E334K cMyBPC may modify thelevels of channel proteins, leading to electrophysiological dysfunction.Therefore, UPS impairment due to a mutant cMyBPCmay partly contributeto the observed clinical arrhythmias in HCM patients.

© 2011 Elsevier Ltd. All rights reserved.

Introduction

Hypertrophic cardiomyopathy (HCM) is character-ized by left ventricular hypertrophy and caused bymutations in genes encoding cardiac sarcomeric andnoncardiac sarcomeric proteins.1 Mutations in theMYBPC3 gene encoding cardiac myosin-bindingprotein C (cMyBPC) have been found to be one ofthe two most common genetic causes of familialHCM.2–5 Identified mutations of cMyBPC consist ofmissense, nonsense, deletion/insertion, and splice siteabnormalities. Missense mutations are associatedwith dysfunctional proteins stably integrated intothe sarcomere, whereas nonsense and frameshiftmutations are associated with low levels of mutantmRNA and protein, leading to haploinsufficiency ofthe remaining wild-type (Wt) protein.6 Nonsense-mutation-mediated mRNA decay and the ubiquitin–proteasome system (UPS) are the quality controlsystems for mutant cMyBPC that are responsible forthe removal of affected mRNAs and proteins,respectively.7 An in vitro study showed that the UPSwas impaired as a consequence of encounteringtruncated cMyBPC.8 Proteasomeproteolytic activitieswere found to be reduced in humanHCM and failinghearts.9 Pro-apoptotic proteins accumulated in cardi-ac cells in a stressed mice heart model with UPSimpairment.10 Proteasome functional insufficiencyactivates the calcineurin–NFAT (nuclear factor ofactivated T cells) pathway and promotesmaladaptiveremodeling of cardiac myocytes characteristic ofcongestive heart failure in the stressedmouse heart.11

HCM is associated with a high incidence ofarrhythmia and may lead to heart failure.12 Thekey component of arrhythmias in patients with bothHCM and heart failure includes the functionalexpression of ion channels and Ca2+ handlingproteins that results in prolongation of actionpotential duration (APD) and abnormal Ca2+

handling.13 Elevation of intracellular Ca2+ concen-tration via activation of calcium channels, as well asthat of the Na+/Ca2+ exchanger, underlies cardiaccell death.14 Thus, regulation of both ion channelsand Ca2+ handling proteins is important in control-ling the electrophysiological function of the heartand in preventing cardiac cell death.

We recently reported on three HCM patientscarrying the E334K MYBPC3 mutation15 whoclinically exhibited cardiac arrhythmia. Heterolo-gous expression of E334K cMyBPC causes protea-some inhibition and induces the accumulation ofpro-apoptotic proteins known to be degradedthrough the UPS. Thus, inhibition of proteasomalactivities may lead to accumulation of other proteinsthat are degraded through the UPS. Most of the ionchannels and Ca2+ handling proteins are known tobe degraded through the UPS.16 Kv1.5, Kir6.2,Nav1.5, HERG, and Cav1.2, as well as Serca andRyR2, have been reported to be degraded throughthe UPS.17–24 However, it remains unclear whetherinhibition of the UPS influences cardiac actionpotential and intracellular Ca2+ concentration andthereby induces electrophysiological dysfunction.In this study, we hypothesized that proteasome

inhibition by E334K cMyBPC may cause an accu-mulation of cardiac ion channel proteins or Ca2+

handling proteins, leading to electrophysiologicaldysfunction. We found that impairment of the UPSby E334K cMyBPC altered the protein levels ofcardiac ion channels and Ca2+ handling proteins andthereby augmented the calcium transient amplitude,resulting in electrophysiological dysfunction.

Results

UPS impairment due to E334K cMyBPC alteredthe protein levels of ion channels and Ca2+

handling proteins in cardiac cells

Wt and E334K cMyBPC were expressed in HL-1cells and neonatal rat cardiac myocytes (NRCMs)(Supplementary Fig. 1a). In a previous report,15 wefound that the E334K protein level was significantlylower than the Wt; the mutant protein had a higherlevel of polyubiquitination, increased in cells pre-treated with the proteasome inhibitor MG132, andsuppressed chymotrypsin-like activity in COS7cells. In this study, we confirmed those findings inHL-1 cells and NRCMs (Fig. 1a, i and ii; Supple-mentary Fig. 1f–h). We further discovered that

Wt(a)

100

150 EK

** ** *

50

Chymotrypsin-like Trypsin-like Caspase-like

Chymotrypsin-like Trypsin-like Caspase-like

0

(ii)

(i)

100

150Wt

EK

** * *

50

0

150(b) (c)

50

100

WtEK

Wt EK Wt EK Wt EK

12h 24h 48h

Myc-MyBPC**

*

12 24 36 48 h

12 24 36 48 h

12 24 36 48 h 12 24 36 48 h

β-actin

30 Wt150

* *

10

20

EK

50

100

WtE

****

12h 24h 48h0

150

EK

50

100

100 ** ****

0

Wt EK

50 Wt EK

Act

ivity

(%

to W

t)A

ctiv

ity (

% to

Wt)

Cas

pase

-like

activ

ity (

% to

Wt)

Tryp

sin-

like

activ

ity (

% to

Wt)

Myc

-MyB

PC

leve

l

Chy

mot

ryps

in-li

keac

tivity

(%

to W

t)

Myc

-MyB

PC

(%

to W

t)

Fig. 1. UPS impairment due to E334K cMyBPC. Activities of the indicated 20S proteasome in HL-1 cells (a(i)) orNRCMs (a(ii)) expressing either Wt or E334K cMyBPC (n=5 for each). Time-course experiments of 20S proteasomeactivities (b) and Myc-MyBPC protein levels (c) in HL-1 cells expressing either Wt or E334K cMyBPC at indicated timepoints posttransfection. (c) Top: RepresentativeWestern blot analysis; β-actin was used as control for protein loading. Thebar graph (middle) and the line graph (bottom) indicate a quantitative densitometric scan of E334K Myc-MyBPCcompared to Wt (n=4 for each group in (b) and (c)). ⁎ and ⁎⁎ are compared with the Wt at each indicated time point (b),with E334K at 12 h posttransfection (c; line graph).

859UPS Impairment and Cardiac Dysfunction


trypsin-like and caspase-like activities were signif-icantly lower in HL-1 cells and NRCMs expressingE334K cMyBPC than in cells expressing the Wt at48 h posttransfection (Fig. 1a, i and ii). Time-courseexperiments showed that proteasome activities in

Fig. 2. Change in the protein levels of ion channels and CChange in the protein levels of ion channels and Ca2+ handWestern blot analysis with indicated antibodies in HL-1 cellMyBPC in the presence or in the absence of MG132 treatment.with β-actin used as control for protein loading. (a(i) right–a(MyBPC compared to Wt (n=4). (c) qRT-PCR with indicatedE334K (n=9).

HL-1 cells expressing E334K cMyBPC were slightlyhigher than those in cells expressing the Wt (107–115%) at 12 h posttransfection when the level ofE334K protein was low, and they then decreasedprogressively to a significantly lower level (55–75%)

a2+ handling proteins in cardiac cells expressing E334K .ling proteins in cardiac cells expressing E334K cMyBPC.s (a) or NRCMs (b) expressing either Wt or E334K Myc-(a(i) left and (b) left) Representative Western blot analysis,iii) and (b) right) Quantitative densitometric scan of Myc-mRNAs expressed in HL-1 cells expressing either Wt or

Fig. 2 (legend on previous page)


at 48 h posttransfection when the level of E334Kprotein increased (Fig. 1b and c, bar graph). Aprogressive increase in the protein level of E334KcMyBPC relative to that of Wt was observed from12 h to 48 h posttransfection (Fig. 1c, line graph).These findings suggested that, in the early stage oftransfection, the protein level of E334K cMyBPC

decreased due to its degradation through the UPS.When the accumulated protein level was high in thelater stages of transfection, it suppressed protea-some activities, thereby impairing the UPS.To test whether UPS impairment affects the ion

channels and Ca2+ handling proteins, we measuredtheir expression levels in cardiac cells expressing

image of Fig. 2

image of Fig. 2


E334K cMyBPC. The protein levels of Kv1.5, Nav1.5,Cav3.2, Hcn4, Cav1.2, Serca, RyR2, and Ncx1 weresignificantly increased in HL-1 cells (Fig. 2a) andNRCMs (Fig. 2b) expressing E334K cMyBPC com-pared with their levels in cells expressing the Wtprotein, despite comparable levels of their mRNAs(Fig. 2c). Treatment with MG132 (10 μM, 12 h)further increased the protein levels of Kv1.5, Nav1.5,Cav3.2, Hcn4, Cav1.2, Serca, RyR2, and Ncx1 in bothHL-1 cells expressing E334K and the Wt protein, butthis effect was more prominent in cells expressingthe mutant protein (Fig. 2a). Chase experimentsperformed by adding the transcription inhibitor

Fig. 3. Prolongation of the decays of ion channels (i) and CacMyBPC. Chase analysis of ion channel proteins in HL-1 cells etime after treatment with cycloheximide (6 μg/mL). Shown arindicated ion channels and calcium handling proteins. ⁎pb0.0

cycloheximide (6 μg/mL) to the culture medium ofHL-1 cells showed that the decay of these ionchannels and calcium handling proteins was pro-longed in cells expressing E334K MyBPC comparedwith the decay of the same proteins in cellsexpressing the Wt (Fig. 3). An exception to thesewas Kir2.1, whose protein and mRNA levels, as wellas protein decay, did not differ significantly betweenWt and E334K-expressing cells (Figs. 2a–c and 3).Western blot analysis of cytosolic and membrane

fractions showed that the accumulation of Kv1.5 andCav1.2 occurred in the membrane fractions (Fig. 4a).Immunofluorescence of Kv1.5 and Cav1.2 proteins in

2+ handling proteins (ii) in cardiac cells expressing E334Kxpressing either Wt or E334KMyc-MyBPC at the indicatede the representative blots (left) and time-course decays of5, ⁎⁎pb0.001.

image of Fig. 3



HL-1 cells expressing either Wt or E334K Myc-MyBPC showed the localization of those channelproteins in the cell membrane (Fig. 4b). Treatmentwith MG132 (10 μM, 6 h) did not alter thelocalization (Fig. 4b). The punctate fluorescencethat appeared on the Kv1.5 images was nonspecific,since it was detected in both Myc-MyBPC-expressingand nonexpressing cells.

Taken together, these results suggested thatimpairment of the UPS by E334K cMyBPC inducedhigher protein levels of ion channels and calciumhandling proteins, which are targeted by proteaso-mal degradation. The accumulated channel proteinsretain the correct localization when proteasomeactivity is decreased and do not become sequesteredin membrane-bound nonfunctional compartments.

image of Fig. 3


Electrophysiological dysfunction in cardiaccells expressing E334K cMyBPC

We examined the action potential of HL-1 cellsand NRCMs expressing either Wt or E334KcMyBPC. Figure 5a, i shows that HL-1 cellsexpressing E334K had longer APD at 90% repolar-ization (APD90; 144.39±12.32 ms) than cells expres-sing the Wt protein (APD90=106.07±6.67 ms)without changes in action potential amplitude,overshoot, or resting potential. Since rat subepicar-dial (Epi) and subendocardial (Endo) myocytesexhibit different electrophysiological properties,26,27

we examined the action potential of NRCMsisolated from both Epi and Endo myocytes. Asshown in Fig. 5b, E334K cMyBPC significantlyprolonged the APD90 of both Epi and EndoNRCMs compared with Wt (Epi: Wt 37.58±5.26 ms, E334K 68.25±16.37 ms; Endo: Wt 112.26±14.19 ms, E444K 162.37±18.21 ms) without changesin action potential amplitude, overshoot, or restingpotential. Thus, both HL-1 cells and NRCMsexpressing E334K cMyBPC had a longer APD thanthose expressing Wt. Interestingly, some HL-1 cellsexpressing E334K cMyBPC exhibited afterdepolar-izations (ADs; prevalence, 25.0±5.0%) (Fig. 5a, ii),which were not found in the Wt.

Fig. 4. The accumulated ion channels and Ca2+ handlinganalysis of the cytosolic and membrane fractions of Kv1.5 aE334K plasmid or Wt. Top: Representative Western blot analymarker and protein loading control, respectively. Co, controBottom: Quantitative densitometric scan of indicated proteiproteins in HL-1 cells expressing either Wt or E334K Mytreatment.

We then examined Ca2+ transients in HL-1 cellsexpressing either Wt or E334K cMyBPC. Despitesimilar levels of resting calcium transients, HL-1cells expressing E334K cMyBPC exhibited signifi-cantly higher peaks and amplitudes of calciumtransients than cells expressing Wt (Fig. 5c).We developed a simulation model for action

potential and Ca2+ transients in rat cardiac myo-cytes expressing E334K cMyBPC, using a modeldescribed by Pandit et al. (see Materials andMethods for details).25 In this model, changes inthe density of ion currents were assumed to beproportional to changes in associated protein levels.APD90 was estimated to be 39.9 ms and 68.2 ms inthe models of cells expressing Wt and E334KcMyBPC, respectively (Fig. 5d). The amplitudes ofCa2+ transients were estimated to be 0.45 mM and2.24 mM in the models of cells expressing Wt andE334K cMyBPC, respectively (Fig. 5e). Thus, thissimulation model indicated that a change in thedecay of ion channel proteins could reproducefindings similar to the experimental data, showingthat APD90 and Ca2+ transients were significantlyincreased in cells expressing E334K cMyBPC.Taken together, these findings suggested that

expression of E334K cMyBPC can cause electro-physiological dysfunction characterized by APD

proteins retain the correct localization. (a) Western blotnd Cav1.2 proteins in HL-1 cells transfected with eithersis, with Na+/K+ ATPase and tubulin used as membranel of the indicated proteins taken from whole-cell lysates.ns. (b) Immunofluorescence of Kv1.5 (i) and Cav1.2 (ii)c-MyBPC in the presence or in the absence of MG132

image of Fig. 4



image of Fig. 4

Fig. 5. Effects of E334K cMyBPC expression on action potential and Ca2+ transients in cardiac myocytes. Actionpotential of HL-1 cells (a) and NRCMs (b) expressing Myc-MyBPC. Representative traces of the action potentials of HL-1cells (a(i)) and Epi and Endo NRCMs (b) expressing either Wt or E334K cMyBPC. The bar graph shows the APD90 of thosecells (n=8 for each group). (a(ii)) ADs in HL-1 cells expressing E334K cMyBPC. Top: Traces of the ADs of HL-1 cellsexpressing E334K cMyBPC. The bar graph shows the prevalence of AD. (c) Ca2+ transients in HL-1 cells expressing E334KcMyBPC. Top: Representative traces of the calcium transients of HL-1 cardiac myocytes expressing either Wt or E334KcMyBPC. Bottom: Rest, peak, and amplitude of calcium transients recorded from HL-1 cells expressing either Wt (n=18)or E334K (n=22) cMyBPC. (d and e) Simulation model for augmentation of APD and Ca2+ transients induced by E334KcMyBPC. Steady-state behavior of action potentials (d) and underlying Ca2+ transients (e) in cells expressing Wt andE334K cMyBPC based on the model described by Pandit et al.25 Model cell behaviors after the last 10 min of stimulation(during the last action potential) are depicted. mV, millivolts; ms, milliseconds. ⁎pb0.05, ⁎⁎pb0.001.


image of Fig. 5



prolongation and increased intracellular Ca2+ tran-sients to favor the occurrence of ADs.

A Ca2+ antagonist normalized both Ca2+

transient amplitudes and APD, therebyattenuating the apoptosis of cardiac cellsexpressing E334K cMyBPC

Regulation of intracellular Ca2+ concentration isimportant in controlling cardiac electrophysiologicalfunction and preventing cell death. Impairment of theUPS due to E334K cMyBPC augmented Ca2+

transient amplitude and APD in cardiac cells (Fig. 5)and increased the pro-apoptotic/anti-apoptotic pro-tein ratio, thereby enhancing apoptosis in COS7cells,15 NRCMs, and HL-1 cells (Supplementary Fig.2). Thus, we next examined the effects of a Ca2+

antagonist, azelnidipine, onCa2+ transients andAPD,as well as the level of apoptosis-regulating proteinsand apoptosis in cells expressing E334K cMyBPC. Asexpected, azelnidipine (1 μM, 24 h) significantly

decreased Ca2+ transients in HL-1 cells expressingE334K cMyBPC (Fig. 6a). Azelnidipine shortenedAPD in both HL-1 cells and NRCMs expressingE334K cMyBPC (Fig. 6b) to a duration comparablewith that observed in cells expressing Wt cMyBPC.Figure 6c shows that azelnidipine normalized the

protein levels of pro-apoptotic and anti-apoptoticproteins in HL-1 cells expressing E334K cMyBPC.Interestingly, the decrease in cytochrome c causedby azelnidipine was more marked than that of p53.Azelnidipine significantly decreased cellular apo-ptosis, as shown by Annexin V staining of HL-1 cells(Fig. 6d, i) and NRCMs (Fig. 6d, iii) expressingE334K cMyBPC and the sub-G1 phase population ofHL-1 cells expressing the E334K protein (Fig. 6d, ii),but the degree of apoptosis remained higher thanthat in cells expressing Wt.Chase experiments in HL-1 cells expressing either

Wt or E334K Myc-MyBPC showed that azelnidipinedid not affect the time-dependent decay of E334KcMyBPC proteins (Fig. 7a). Figure 7b shows

image of Fig. 5

Fig. 6 (legend on page 871)


image of Fig. 6


immunofluorescence of Wt or E334K Myc-MyBPCincorporated into the sarcomere of NRCMs. Therewas some punctate fluorescence that might corre-spond to accumulation of E334K Myc-MyBPC due todecreased proteasome activity. This suggested thatE334K Myc-MyBPC was not functionally integratedinto the sarcomere as was the Wt. Figure 7b alsoshows that the Ca2+ antagonist azelnidipine affectedneither the incorporation of E334K Myc-MyBPC intothe sarcomere nor the accumulation of E334K Myc-MyBPC protein.Taken together, these findings suggested that

apoptosis of cardiac cells expressing E334K cMyBPCis caused not only by UPS impairment but also by anincrease in intracellular Ca2+. Although the Ca2+

antagonist azelnidipine neither protects E334KcMyBPC from degradation nor influences E334KcMyBPC incorporation into the sarcomere, it couldnormalize intracellular Ca2+ and APD, therebyattenuating cardiac apoptosis.

Discussion

Evidence for UPS impairment has been documen-ted in HCM and heart failure patients,9 as well as inmice models of heart failure.9,10 UPS impairment is aconsequence of its encounter with truncatedcMyBPC.8 The impaired UPS activates the calci-neurin–NFAT pathway and promotes maladaptiveremodeling of cardiac myocytes.11 Amutant proteininhibits proteasome activity in a dose-dependentmanner.25,26 This body of evidence supports ourfinding that expression of E334K cMyBPC sup-presses proteasome activities, leading to impairmentof UPS (Fig. 1a–c). The effect of mutant cMyBPC onthe UPS may be mutant specific, since some othermutant cMyBPC cause a mild suppression ofproteasome activities or none at all.8,15

Fig. 6 (legend o

Many ion channel proteins and calcium handlingproteins have been reported to be degraded throughthe UPS.17–24 Therefore, we hypothesized that ionchannel proteins and calcium handling proteinsmay accumulate when the UPS is impaired. Ourfindings (Fig. 2) showed that the level of expressionof ion channel proteins (Kv1.5, Nav1.5, Cav3.2, andHcn4) and calcium handling proteins (Cav1.2, Serca,RyR2, and Ncx1) was significantly higher in HL-1cells and NRCMs expressing E334K cMyBPC than incells expressing the Wt, without changes in mRNAlevel. Treatment with the proteasome inhibitorMG132 further increased the protein level of theseion channels and calcium handling proteins in cellsexpressing E334K cMyBPC. Chase experimentsshowed that the decay of those ion channels andcalcium handling proteins was prolonged in cellsexpressing E334K MyBPC (Fig. 3). Thus, Kv1.5,Nav1.5, Cav3.2, and Hcn4, as well as Cav1.2, Serca,RyR2, and Ncx1 proteins, accumulated in HL-1 cellsand NRCMs expressing E334K cMyBPC throughimpairment of proteasomal activity. The accumu-lated channel proteins retained the correct localiza-tion and were not sequestered in membrane-boundnonfunctional compartments. The level of expres-sion of Kir2.1 was influenced neither by E334KcMyBPC overexpression nor by MG132 treatment,but was increased by the lysosomal inhibitorchloroquine (data not shown), indicating thatKir2.1 is degraded via the lysosomal pathway, asreported elsewhere.27

Alterations in Ca2+ handling and kinetics inresponse to the expression of mutant sarcomericproteins have been previously reported to bemutation specific.28,29 A mutant mouse model ofHCM carrying the R403Q α major histocompatibil-ity complex shows a higher peak of Ca2+ transientsduring twitch contraction without a change in forcedevelopment.29 A high number of Ca2+ transients

n page 871)

image of Fig. 6


are mobilized to generate force in those mutant micebut do not suffice to maintain contractility at highstimulation rates. In the present study, augmenta-

Fig. 6 (legend on

tion of the protein levels of ion channels and Ca2+

handling proteins in cardiac myocytes expressingE334K cMyBPC correlated to increases in Ca2+

next page)

image of Fig. 6

Fig. 6. Ca2+ antagonist normalized both Ca2+ transient amplitudes and APD, thereby attenuating apoptosis in cardiaccells expressing E334K cMyBPC. Effects of the Ca2+ antagonist azelnidipine (Azel; 1 μM, 24 h) on Ca2+ transients (a), APD(b), apoptosis-regulating proteins (c), and apoptosis (d) in cardiac myocytes expressing E334K cMyBPC. Treatment wasgiven at 24 h posttransfection, and experiments were performed at 24 h after treatment. (a) Representative traces of Ca2+

transients in HL-1 cells expressing either Wt or E334K cMyBPC in the presence or in the absence of Azel treatment. Thebar graphs show the rest, peak, and amplitude of Ca2+ transients recorded in those cells with or without azelnidipine(Azel) treatment: Wt, n=48; EK, n=66; Wt+Azel, n=22; EK+Azel, n=26. (b) Representative traces of the action potentialsof HL-1 cells, Epi NRCMs, and Endo NRCMs expressing either Wt or E334K cMyBPC in the absence or in the presence ofAzel. The bar graph shows the APD90 of the indicated cells (n=8 for each group). (c) Western blot analysis with theindicated antibodies to determine the levels of pro-apoptotic and anti-apoptotic proteins in HL-1 cells expressing eitherWt or E334K cMyBPC, with or without azelnidipine treatment. The bar graph shows the relative levels of proteinexpression compared toWt (n=4). Cyt. C, cytochrome c. (d) Annexin V staining detected apoptosis in HL-1 cells (d(i)) andNRCMs (d(iii)). The bar graph shows the number of Annexin V(+) cells relative to Wt (n=4 for each group). (d(ii)) Flowcytometric analysis to count the sub-G1 cell population corresponding to apoptosis in HL-1 cells expressing either Wt orE334K cMyBPC, with or without azelnidipine treatment. The bar graph shows the number of cells in the sub-G1population relative to Wt (n=5). mV, millivolts; ms, milliseconds. ⁎pb0.05, ⁎⁎pb0.001.


transients (Fig. 5c). The increase in Ca2+ transients inE334K myocytes could be the result of manycomplex interactions, including myofilament Ca2+

sensitization, alterations in sarcoplasmic reticulumload, Serca/Pln ratio, and phosphorylation of Pln.Further studies are required to elucidate themechanism for the increase in Ca2+ transients incardiac myocytes expressing E334K cMyBPC.Apoptosis, along with reduced proteasome activ-

ity and increased pro-apoptotic/anti-apoptotic pro-tein ratio, was observed in failing hearts.10 Thesefindings support the results of our previous15 andpresent studies, which show that E334K cMyBPCcauses UPS impairment that leads to an increase in

pro-apoptotic proteins and a decrease in anti-apoptotic proteins, thereby increasing cell apoptosis.Another mechanism of increased apoptosis incardiac myocytes expressing E334K cMyBPC maybe related to an increase in intracellular Ca2+. Chenet al. demonstrated that increases in Ca2+ influxaugmented sarcoplasmic reticulum Ca2+ loadingand the amplitude of Ca2+ transients, therebycausing apoptosis.14 They hypothesized that apersistent increase in Ca2+ influx led to apoptosisvia the mitochondrial death pathway when therewas sarcoplasmic reticulum Ca2+ overload. In thepresent study, cardiac myocytes expressing E334KcMyBPC exhibited a higher concentration of Ca2+

image of Fig. 6

Fig. 7. Ca2+ antagonist neither protected E334K cMyBPC from degradation nor influenced E334K proteinincorporation into the sarcomere. (a) Chase experiment of either Wt or E334K Myc-MyBPC in HL-1 cells in the presenceor in the absence of azelnidipine (Azel) at the indicated time after treatment with cycloheximide (6 μg/mL). Shown are therepresentative blots (left) and time-course decays of indicated cMyBPC proteins (right). (b) Immunofluorescence of eitherWt or E334K cMyBPC interacting with tropomyosin in NRCMs in the presence or in the absence of azelnidipine. Arrowsindicate punctate fluorescence, which might be an accumulation of E334K Myc-MyBPC. The scale bar represents 20 μM.


transients associated with cardiac apoptosis. TheCa2+ antagonist azelnidipine suppressed Ca2+

transients and attenuated the apoptosis of cardiacmyocytes expressing E334K cMyBPC, suggestingthat an increase in intracellular Ca2+ transientscould induce apoptosis in cardiac myocytes expres-sing E334K cMyBPC. Thus, apoptosis induced byUPS impairment in cardiac myocytes expressingE334K cMyBPC may be due to alterations in thelevel of proteins regulating apoptosis and in thelevel of intracellular Ca2+. At this point, endoplas-mic reticulum stress might be present in this model,as it has been reported by Fu et al. that proteasome

inhibition induces endoplasmic-reticulum-initiatedcardiac myocyte death via pathways dependent onC/EBP homologous protein.30 Further studies arenecessary to investigate this possibility.cMyBPC is a major component of thick filaments

in the C-zone of the A-band of the sarcomere, whichnormally slows cross-bridge cycling rates and re-duces cardiac myocyte power output. N-terminaldomains of cMyBPC containing the MyBPC motifreduce actin filament velocity under conditionswhere filaments are maximally activated (i.e., eitherin the absence of thin filament regulatory proteins orin the presence of troponin and tropomyosin and

image of Fig. 7

Fig. 8. Proposed mechanism underlying the electrophysiological dysfunction induced by UPS impairment. (↑[Ca2+]i)Increases in calcium transients; (↑APD) prolongation of APD; (→) this study's major findings; (⇢) this study's hypotheses.


high intracellular Ca2+).31 Missense mutations areassociated with dysfunctional proteins stably inte-grated into the sarcomere.6 These previous findingssupport our suggestion that E334K Myc-MyBPCmay not be functionally incorporated into thesarcomere and thus is unable to reduce actinfilament velocity in the presence of a high concen-tration of intracellular Ca2+. This suggestion may berelated to the fact that the C1–C2 domains ofcMyBPC directly interact with myosin and actin ina phosphorylation-dependent manner. Althoughwehave reported that the total phosphorylation level ofE334K cMyBPC was not significantly different fromthat of Wt,15 it remains unclear whether theindividual phosphorylation levels of Ser273,Ser282, and Ser302 differ from those in the Wt.Further experiments are needed to answer thisquestion.To the best of our knowledge, the fact that UPS

impairment affects cardiac ion channels and Ca2+

handling proteins, leading to electrophysiologicaldysfunction, has never been reported previously.The role of the UPS in the initiation and/orprogression of cardiac diseases has been docu-mented in several studies.32,33 However, the roleof the UPS in cardiac hypertrophy and/or cardiacfailure remains unclear. Proteasome inhibitorshave been shown to exert different effects on thehypertrophic and/or failing heart. In mice models,PS-519 decreases cardiac remodeling initiated bypressure overload,34 and epoxomicin promotesregression of left ventricular hypertrophy inducedby isoproterenol.35 On the other hand, bortezomibcauses cardiac hypertrophy and induces failure ofthe stressed heart in mice.11 Clinically, bortezomibcan cause heart failure in cancer patients, partic-ularly when coupled with a preexisting cardiaccondition.36–38 Proteasome inhibition can be influ-enced by the specificity of the agent for theproteasome and by the cause of cardiac hypertro-phy such as pressure overload, isoproterenol, ormutant sarcomeric proteins.

The link between mutant cMyBPC, UPS impair-ment, and cardiac dysfunction in HCM patients hasbeen previously reported.15 However, the patho-physiology of the failing heart in those patients ismore complex. The potential importance of β-adrenergic receptors (β-ARs) in the pathophysiolo-gy of HCM associated with mutant cMyBPC shouldbe noted, since chronic overactivity of this receptordown-regulates β-AR signaling both directly(through decreased sensitivity of the receptor tocatecholamines) and indirectly (via increased activ-ity of the inhibitory G protein,39 which in turnadversely affects the growth and function ofmyocytes).40 There is evidence for increased β-adrenergic signaling in chronic heart failure, such asthe fact that the level of cardiac adrenergic drive isan important prognostic indicator in heart failure.41

Further work is required to study the link betweenβ-AR, mutant-cMyBPC-dependent inhibition ofmyocardial UPS, and HCM.Prolongation of APD, increased amplitude of Ca2+

transients, and enhanced apoptosis of cardiacmyocytes expressing E334K cMyBPC (Fig. 5; Sup-plementary Fig. 2)may explain arrhythmogenicity inHCM patients carrying E334KMYBPC3. It is knownthat changes in the expression of ion channels andCa2+ handling proteins that result in APD prolon-gation and increased intracellular Ca2+ predisposepatients with myocardial hypertrophy and heartfailure to cardiac arrhythmias.13 Prolongation ofAPD is the most consistently observed electricalabnormality in patients with left ventricular hyper-trophy and heart failure.42–44 Prolonged APD can benormalized by regression of left ventricularhypertrophy.45 Augmentation of Ca2+ transientsfacilitates delayed ADs of cardiac myocytes throughactivation of the Na+/Ca2+ exchanger. Interestingly,ADs frequently occurred in HL-1 cardiac myocytesexpressing E334K cMyBPC (Fig. 5a, ii), but not incells expressingWt. These ADs are probably delayedADs rather than early ADs, since Ca2+ overloadwould occur in cells expressing E334K cMyBPC.

image of Fig. 8


However, the possibility of the induction of phase 3early ADs by Na+ channel reactivation cannot beexcluded, since Nav1.5 protein expression was alsoenhanced. ADs due to increases in both Ca2+

transients and APD prolongation may cause ar-rhythmias in cardiac myocytes expressing E334KcMyBPC. In addition toADs, the increased apoptosisof NRCMs or HL-1 cells expressing E334K cMyBPCcould be a substrate for reentry circuits in HCM,since it is known that myocardial cell death andfibrosis are reentrant substrates contributing toarrhythmia susceptibility.46–48 The proposed mech-anism is illustrated in Fig. 8.Our findings indicate that the UPS impairment

caused by E334K cMyBPC can augment the expres-sion of both ion channels and Ca2+ handlingproteins and thus enhance Ca2+ transient ampli-tude, resulting in cardiac electrophysiological dys-function. Whether these findings can be implicatedin the in vivo situation remains speculative atpresent. A limitation of this study is the highexpression level of exogenous cMyBPC in HL-1cells and NRCMs, which may differ from the normallevel of protein expression in adult myocytes.Nevertheless, several findings8–15,42–48 corroboratethe suggestion that UPS impairment due to a mutantsarcomeric protein may partly contribute to theobserved clinical arrhythmias in HCM patients.

Materials and Methods

Cell culture and heterologous expression

Care and treatment of animals were carried out inaccordance with the guidelines for the Care and Use ofLaboratory Animals published by the National Institutes ofHealth (NIH Publication 85-23, revised in 1985) and weresubject to prior approval by the local animal protectionauthority. NRCMs were dissociated from the hearts of1-day-old to 5-day-old Wistar rats using the NeonatalCardiomyocyte Isolation System (Worthington, Lakewood,NJ) according to the manufacturer's instructions. cDNAencoding either Wt or E334K cMyBPC with a 6-myc tag atthe N-terminus15 was ligated to pLenti6/V5 (Invitrogen,Carlsbad,CA) at BamHI andXhoI sites to generate lentiviralexpression vectors (pLenti-6myc-MYBPC3). The deliveryand expression of plasmids, as well as the calculation ofmultiplicity of infection, were performed using the Vira-Power Lentiviral Expression System (Invitrogen) accordingto the manufacturer's instructions. Briefly, pLenti6-MYBPC3, pLP1, pLP2, and pLP/VSV-G were cotransfectedinto 293FT cells to produce Lenti.cMyBPC.HL-1 cardiac myocytes were provided by Dr. Claycomb

(Louisiana State University) and cultured according toinstructions.49 cDNA encoding either Wt or E334KcMyBPC with a 6-myc tag at the N-terminus15 was ligatedto pCS2+ at BamHI and XhoI sites to generate plasmidexpression vectors (pCS-6myc-MYBPC3). Transfectioninto HL-1 cells was performed using Lipofectamine 2000(Invitrogen) following the manufacturer's instructions. For

chase experiments, at 24 h after transfection, cyclohexi-mide (6 μg/mL) was added to the culture medium, andcells were harvested at indicated time points.

Western blot analysis

Wt or E334K cMyBPC was transfected into HL-1 cells orinfected into NRCMs. Unless otherwise indicated, allprotein extracts of cells were prepared 48 h aftertransfection or infection, using methods as reportedelsewhere.15 Proteins (15 μg each) were separated bySDS-PAGE and electrotransferred to the polyvinylidenefluoride membrane. Membranes were probed with anti-bodies to myc (Santa Cruz Biotechnology, Santa Cruz,CA), actin (Calbiochem, La Jolla, CA), p53 (Santa CruzBiotechnology), Bax (Santa Cruz Biotechnology), cyto-chrome c (BD Biosciences, Franklin Lakes, NJ), Bcl-2 (SantaCruz Biotechnology), Bcl-xL (Santa Cruz Biotechnology),Kv1.5 (Alomone Laboratories, Israel), Kir2.1 (AlomoneLaboratories), Nav1.5 (Abcam, Cambridge, MA), Cav3.2(Santa Cruz Biotechnology), Cav1.2 (Santa Cruz Biotech-nology), Hcn4 (Osenses, Australia), Serca (Santa CruzBiotechnology), RyR (Santa Cruz Biotechnology), andNcx1 (Santa Cruz Biotechnology), and were developedusing an ECL system (Amersham Bioscience, Piscataway,NJ). The intensities of the bands were quantified usingNIH Image software.

Subcellular fractionation

HL-1 cells expressing either Wt or E334K Myc-MyBPCwere separated into cytosolic and membrane fractionsusing the Plasma Membrane Protein Extraction Kit(BioVision, Mountain View, CA) according to the manu-facturer's instructions. Each fraction was subjected to a7.5–10% SDS-PAGE and analyzed by Western blotanalysis with antibodies to Kv1.5 (Alomone Laboratories),Cav1.2 (Santa Cruz Biotechnology), Na+/K+ ATPase α-1(Upstate, Temecula, CA), and α-tubulin (DM1A; Abcam)to confirm their subcellular localization.

Immunofluorescence

Immunofluorescence staining of fixed cells was per-formed as described elsewhere.50 The primary antibodiesused were anti-tropomyosin (sarcomeric) clone CH1(Sigma), anti-myc (Santa Cruz Biotechnology), anti-MYBPC3 (H120; Santa Cruz Biotechnology), anti-Kv1.5(Alomone Laboratories), anti-Cav1.2 (Santa Cruz Biotech-nology), and anti-α-tubulin (Abcam). Alexa Fluor 568 goatanti-rabbit IgG (H+L), Alexa Fluor 488 goat anti-rabbitIgG (H+L), Alexa Fluor 546 goat anti-mouse IgG (H+L),and Alexa Fluor 488 goat anti-mouse IgG (H+L)(Molecular Probes) were used as secondary antibodies.The nuclei were stained with 4′,6-diamidino-2-phenylin-dole. Images were collected with a Nikon Eclipse Tifluorescent microscope.

Quantitative reverse transcriptase–polymerase chainreaction

Total RNA from cultured cells was extracted using theRNeasy Plus Mini Kit (Qiagen, Valencia, CA) according to

Table 1. Sequences of oligonucleotides used as qRT-PCR primers

Number Target protein/gene Accession number Sequence (5′→3′)

1 MYBPC3 human NM_000256 F ccagaggacacaggtgacagR cgatgaccttgactgtgagg

2 MYBPC3 mouse NM_008653 F ccagaagatgctggtgctgR cgatgaccttgactgtgagg

3 MYBPC3 human/mousea NM_000256/NM_008653 F aggtgacctggaccaaagagR ggggaggacttggcttgt

4 Kv1.5 NM_145983.2 F tttaaaaagtatcgcattccatgaR catcttacagtgaatgctcacca

5 Kir2.1 NM_008425.4 F agggactcacctcgaacatcR tttgcttgcaacacagaagc

6 Nav1.5 NM_021544.3 F gatgaggagaacagccttggR cacaacttgggattcctgct

7 Hcn4 NM_001081192.1 F ccatcaatggcatggtgaR ccttgaagagggcgtagga

8 Erg NM_013569.2 F gatcgccttctaccggaaaR cattcttcacgggtaccaca

9 Actin NM_001102.3 F gcctcatcagcttgggttatR catgatgcgggcaaattc

10 Cav1.2 NM_009781.3 F catgaagctcaactcaactgtttcR cgtgggctcccatagttg

11 Cav3.1 NM_009783.2 F aggagtaaggagaagcagatggR tttgcactgggcttctgac

12 Cav3.2 NM_021415.4 F cctgctggacactgtggttR ggagcatgaaaagaagaccaa

13 Serca NM_009722.3 F tcgaccagtcaattcttacaggR cagggacagggtcagtatgc

14 RyR2 NM_023868.2 F ttcaacacgctcacggagtaR tgccaggctctgctgatt

15 Ncx1 NM_011406.2 F gcagccttcagagctggtR gacttccaactgctccaacc

16 p53 NM_173378.2 F ctgccatttagccgaagtgtR catccgttcgttatcagcaa

17 Bax NM_007527.3 F gtgagcggctgcttgtctR ggtcccgaagtaggagagga

18 Bcl-2 NM_009741.3 F gtacctgaaccggcatctgR ggggccatatagttccacaa

19 Bcl-xL NM_025778.3 F atcggcacaagagggaaaR ggtcttctgcattacagtctactgac

a Homology between human MYBPC3 cDNA and mouse MYBPC3 cDNA.


the manufacturer's instructions. RNA samples weretreated with DNaseI (Promega) to eliminate genomicDNA contamination, and cDNA was synthesized usingSuperScript™ II reverse transcriptase (Gibco-BRL). Quan-titative reverse transcriptase–polymerase chain reaction(qRT-PCR) was performed on a 384-well plate using the7900HT Fast Real-Time PCR System according to themanufacturer's instructions (Applied Biosystems, FosterCity, CA). Primer sets listed in Table 1 were used for qRT-PCR. Data analysis was performed with SDS softwareversion 3.2 (Applied Biosystems).

Proteasome activity assay

Fluorogenic proteasome peptidase substrates [Suc-Leu-Leu-Val-Tyr-7-amino-4-methylcoumarin (Suc-LLVY-AMC;Calbiochem), benzoyl-Val-Gly-Arg-7-amino-4-methylcou-marin (Bz-VRG-AMC; Biomol), and benzyloxycarbonyl-Leu-Leu-Glu-7-amino-4-methylcoumarin (Z-LLC-AMC;Biomol)] were used to measure chymotrypsin-like, tryp-sin-like, and caspase-like activities, respectively, as de-scribed elsewhere.10,15

Measurement of calcium transients

One day before transfection, HL-1 cells were seeded ontogelatin/fibronectin-coated coverslips at a density of4×105 cells/mL. Three micrograms of the pCS2+ plasmidvector containing either Wt or E334K mutantMYBPC3 and1 μg of pMAX-EGFP plasmid were cotransfected into thecells using Lipofectamine 2000 (Invitrogen) according to themanufacturer's instructions. Calcium transients were mea-sured at 48 h posttransfection. Treatment with azelnidipine(1 μM) was performed at 24 h posttransfection.The cells on coverslips were loaded with 10 μM indo-1

AM (Invitrogen) for 30 min at 37 °C in culture mediumand then washed with Tyrode's solution [140 mmol/LNaCl, 5.4 mmol/L KCl, 0.5 mmol/L MgCl2, 0.3 mmol/LNaH2PO4, 5 mmol/L Hepes, 1.8 mmol/L CaCl2, and5 mmol/L glucose (pH 7.4)]. The coverslips weretransferred to a glass-bottom dish on an invertedmicroscope (Eclipse Ti; Nikon), and the cells were thenfield stimulated (0.5 Hz) at 30 °C. The cells were excitedat 365±10 nm. Fluorescence images at 405±10 nm and480±10 nm, which were separated by a W-View system


(Hamamatsu Photonics), were recorded every 10 ms withan EM-CCD camera (Hamamatsu Photonics). The ratios ofimages at 405 nm to images at 480 nm were calculatedafter the subtraction of background fluorescence withAquacosmos software (Hamamatsu Photonics).

Electrophysiological recording

Isolated single NRCMs or HL-1 cells were dispersed inthe recording bath and superfused with normal Tyrode'ssolution. Action potentials were recorded by the whole-cell patch-clamp technique. The pipette solution con-tained 140 mmol/L K-aspartate, 5 mmol/L MgCl2,5 mmol/L K2ATP, 5 mmol/L ethylene glycol bis(β-aminoethyl ether) N,N′-tetraacetic acid, and 5 mmol/LHepes, and the pH was adjusted to 7.2 with KOH.Tyrode's solution was used as the extracellular recordingsolution. Liquid junction resistance plus capillary resis-tance equalled 3–5 GΩ. The series resistance was furtherminimized by electronic compensation. Data were ac-quired and analyzed by a computer (PC98XL; NEC,Tokyo, Japan) via an analog/digital converter (PCM-DP16; SHOSHIN EM Corp., Okazaki, Japan). IsolatedNRCMs were classified into Epi and Endo myocytes, asreported elsewhere.51,52

Dynamic simulation of the effects of E334K cMyBPConthe electrophysiological behavior of cardiac myocytes

Simulation of the dynamics of Wt and E334K cMyBPCrat ventricular myocytes was performed using the modeldescribed by Pandit et al. for rat Epi ventricularmyocytes.25 We assumed that changes in the density ofion currents were proportional to changes in their proteinlevels. Differential equations were numerically solved for10 min under the initial conditions provided by Panditet al.25 The model myocytes were paced at 1 Hz with 1-msstimuli of 30 pA/pF. Numerical computations wereperformed with MATLAB 7 (The MathWorks, Natick,MA) on a Workstation HP xw9400 (Hewlett-Packard,Tokyo, Japan). We used an available variable time-stepnumerical differentiation approach, such as the MATLABODE solver ode15s, which was selected for its suitability tostiff systems. The maximum relative error tolerance for theintegration methods was set to 1×10− 8.

Annexin V staining and flow cytometry

Annexin V staining and flow cytometry of Wt or E334K-cMyBPC-transfected cells and data analysis were per-formed as reported elsewhere.15

Statistical analysis

Origin® for Windows software version 7.0 (OriginLabCorp., Northampton, MA) was used for statisticalanalysis. Differences between two groups were assessedusing two-sample t test. One-way ANOVA, with Bonfer-roni test for post hoc analysis, was used for multiplecomparisons. All experimental data are expressed as themean±SEM. Differences with p values of b0.05 wereconsidered significant.

Acknowledgements

This study was supported by a grant-in-aid forscientific research from the Ministry of Education,Culture, Sports, Science, and Technology of Japan(18590775) (to I.H.). U.B. was a postdoctoral scholarsupported by the Venture Business Laboratory,National University Corporation, Tottori Universi-ty. We thank Dr. W. C. Claycomb (Louisiana StateUniversity) for kindly providing HL-1 cardiacmyocytes. Azelnidipine was kindly donated byDaiichi Sankyo, Japan.

Supplementary Data

Supplementary data associated with this articlecan be found, in the online version, at doi:10.1016/j.jmb.2011.09.006

References

1. Seidman, J. G. & Seidman, C. (2001). The genetic basisfor cardiomyopathy: from mutation identification tomechanistic paradigms. Cell, 104, 557–567.

2. Jääskeläinen, P., Kuusisto, J., Miettinen, R., Kärkkäinen,P., Kärkkäinen, S., Heikkinen, S. et al. (2002). Muta-tions in the cardiac myosin-binding protein C gene arethe predominant cause of familial hypertrophiccardiomyopathy in eastern Finland. J. Mol. Med. 80,412–422.

3. Winegrad, S. (1999). Cardiac myosin binding proteinC. Circ. Res. 84, 1117–1126.

4. McClellan, G., Kulikovskaya, I. & Winegrad, S. (2001).Changes in cardiac contractility related to calcium-mediated changes in phosphorylation of myosin-binding protein C. Biophys. J. 81, 1083–1092.

5. Bonne, G., Carrier, L., Bercovici, J., Cruaud, C.,Richard, P., Hainque, B. et al. (1995). Cardiac myosinbinding protein-C gene splice acceptor site mutation isassociated with familial hypertrophic cardiomyopa-thy. Nat. Genet. 11, 438–440.

6. Carrier, L., Bonne, G., Bahrend, E., Yu, B., Richard, P.,Niel, F. et al. (1997). Organization and sequence ofhuman cardiac myosin binding protein C gene(MYBPC3) and identification of mutations predictedto produce truncated proteins in familial hypertrophiccardiomyopathy. Circ. Res. 80, 427–434.

7. Vignier, N., Schlossarek, S., Fraysse, B., Mearini, G.,Krämer, E., Pointu, H. et al. (2009). Nonsense-mediated mRNA decay and ubiquitin–proteasomesystem regulate cardiac myosin-binding protein Cmutant levels in cardiomyopathic mice. Circ. Res. 105,239–248.

8. Sarikas, A., Carrier, L., Schenke, C., Doll, D., Flavigny,J., Lindenberg, K. S. et al. (2005). Impairment of theubiquitin–proteasome system by truncated cardiacmyosin binding protein C mutants. Cardiovasc. Res. 66,33–44.




9. Predmore, J. M., Wang, P., Davis, F., Bartolone, S.,Westfall, M. V., Dyke, D. B. et al. (2010). Ubiquitinproteasome dysfunction in human hypertrophic anddilated cardiomyopathies. Circulation, 121, 997–1004.

10. Tsukamoto, O., Minamino, T., Okada, K., Shintani,Y., Takashima, S., Kato, H. et al. (2006). Depres-sion of proteasome activities during the progres-sion of cardiac dysfunction in pressure-overloadedheart of mice. Biochem. Biophys. Res. Commun. 340,1125–1133.

11. Tang, M., Li, J., Huang, W., Su, H., Liang, Q., Tian, Z.et al. (2010). Proteasome functional insufficiencyactivates the calcineurin–NFAT pathway in cardio-myocytes and promotes maladaptive remodelling ofstressed mouse hearts. Cardiovasc. Res. 88, 424–433.

12. Kuck, K. H. (1997). Arrhythmias in hypertrophiccardiomyopathy. Pacing Clin. Electrophysiol. 20,2706–2713.

13. Tomaselli, G. F. & Marbán, E. (1999). Electrophysio-logical remodeling in hypertrophy and heart failure.Cardiovasc. Res. 42, 270–283.

14. Chen, X., Zhang, X., Kubo, H., Harris, D. M., Mills, G.D., Moyer, J. et al. (2005). Ca2+ influx-inducedsarcoplasmic reticulum Ca2+ overload causes mito-chondrial-dependent apoptosis in ventricular myo-cytes. Circ. Res. 97, 1009–1017.

15. Bahrudin, U., Morisaki, H., Morisaki, T., Ninomiya,H., Higaki, K., Nanba, E. et al. (2008). Ubiquitin–proteasome system impairment caused by a missensecardiac myosin-binding protein C mutation andassociated with cardiac dysfunction in hypertrophiccardiomyopathy. J. Mol. Biol. 384, 896–907.

16. Willis, M. S. & Patterson, C. (2006). Into the heart: theemerging role of the ubiquitin–proteasome system. J.Mol. Cell. Cardiol. 41, 567–579.

17. Kato, M., Ogura, K., Miake, J., Sasaki, N., Taniguchi,S., Igawa, O. et al. (2005). Evidence for proteasomaldegradation of Kv1.5 channel protein. Biochem. Bio-phys. Res. Commun. 337, 343–348.

18. Brundel, B. J., Ausma, J., van Gelder, I. C., Van derWant, J. J., van Gilst, W. H., Crijns, H. J. et al. (2002).Activation of proteolysis by calpains and structuralchanges in human paroxysmal and persistent atrialfibrillation. Cardiovasc. Res. 54, 380–389.

19. Tanaka, H., Miake, J., Notsu, T., Sonyama, K., Sasaki,N., Iitsuka, K. et al. (2005). Proteasomal degradation ofKir6.2 channel protein and its inhibition by a Na+

channel blocker aprindine. Biochem. Biophys. Res.Commun. 331, 1001–1006.

20. Yan, F. F., Lin, C. W., Cartier, E. A. & Shyng, S. L.(2005). Role of ubiquitin–proteasome degradationpathway in biogenesis efficiency of {beta}-cell ATP-sensitive potassium channels. Am. J. Physiol. CellPhysiol. 289, C1351–C1359.

21. Kang, L., Zheng, M. Q., Morishima, M., Wang, Y.,Kaku, T. & Ono, K. (2009). Bepridil up-regulatescardiac Na+ channels as a long-term effect by bluntingproteasome signals through inhibition of calmodulinactivity. Br. J. Pharmacol. 157, 404–414.

22. Wu, Z. Y., Chen, K., Haendler, B., McDonald, T. V.& Bian, J. S. (2008). Stimulation of N-terminaltruncated isoform of androgen receptor stabilizeshuman ether-á-go-go-related gene-encoded potassi-um channel protein via activation of extracellular

signal regulated kinase 1/2. Endocrinology, 149,5019–5061.

23. Ihara, Y., Kageyama, K. & Kondo, T. (2005). Overex-pression of calreticulin sensitizes SERCA2a to oxidativestress. Biochem. Biophys. Res. Commun. 329, 1343–1349.

24. Pedrozo, Z., Sánchez, G., Torrealba, N., Valenzuela,R., Fernández, C., Hidalgo, C. et al. (2010). Calpainsand proteasomes mediate degradation of ryanodinereceptors in a model of cardiac ischemic reperfusion.Biochim. Biophys. Acta, 1802, 356–362.

25. Pandit, S. V., Clark, R. B., Giles, W. R. & Demir, S. S.(2001). A mathematical model of action potentialheterogeneity in adult rat left ventricular myocytes.Biophys. J. 81, 3029–3051.

26. van Tijn, P., de Vrij, F. M., Schuurman, K. G.,Dantuma, N. P., Fischer, D. F., van Leeuwen, F. W.et al. (2007). Dose-dependent inhibition of proteasomeactivity by a mutant ubiquitin associated withneurodegenerative disease. J. Cell Sci. 120, 1615–1623.

27. Jansen, J. A., de Boer, T. P., Wolswinkel, R., van Veen,T. A., Vos, M. A., van Rijen, H. V. et al. (2008).Lysosome mediated Kir2.1 breakdown directly in-fluences inward rectifier current density. Biochem.Biophys. Res. Commun. 367, 687–692.

28. Haim, T. E., Dowell, C., Diamanti, T., Scheuer, J. &Tardiff, J. C. (2007). Independent FHC-related cardiactroponin T mutations exhibit specific alterations inmyocellular contractility and calcium kinetics. J. Mol.Cell. Cardiol. 42, 1098–1110.

29. Gao, W. D., Pérez, N. G., Seidman, C. E., Seidman, J.G. & Marbán, E. (1999). Altered cardiac excitation–contraction coupling in mutant mice with familialhypertrophic cardiomyopathy. J. Clin. Invest. 103,661–666.

30. Fu, H. Y., Minamino, T., Tsukamoto, O., Sawada, T.,Asai, M., Kato, H. et al. (2008). Overexpression ofendoplasmic reticulum-resident chaperone attenuatescardiomyocyte death induced by proteasome inhibi-tion. Cardiovasc. Res. 794, 600–610.

31. Razumova, M. V., Shaffer, J. F., Tu, A. Y., Flint, G. V.,Regnier, M. & Harris, S. P. (2006). Effects of the N-terminal domains of myosin binding protein-C in anin vitro motility assay: evidence for long-lived cross-bridges. J. Biol. Chem. 281, 35846–35854.

32. Wang, X., Su, H. & Ranek, M. J. (2008). Protein qualitycontrol and degradation in cardiomyocytes. J. Mol.Cell. Cardiol. 45, 11–27.

33. Willis, M. S. & Patterson, C. (2006). Into the heart: theemerging role of the ubiquitin–proteasome system.J. Mol. Cell. Cardiol. 41, 567–579.

34. Hedhli, N., Lizano, P., Hong, C., Fritzky, L. F., Dhar,S. K., Liu, H. et al. (2008). Proteasome inhibitiondecreases cardiac remodeling after initiation of pres-sure overload. Am. J. Physiol. Heart Circ. Physiol. 295,H1385–H1393.

35. Stansfield, W. E., Tang, R. H., Moss, N. C., Baldwin,A. S., Willis, M. S. & Selzman, C. H. (2008).Proteasome inhibition promotes regression of leftventricular hypertrophy. Am. J. Physiol. Heart Circ.Physiol. 294, H645–H650.

36. Hacihanefioglu, A., Tarkun, P. & Gonullu, E. (2008).Acute severe cardiac failure in a myeloma patient dueto proteasome inhibitor bortezomib. Int. J. Hematol. 88,219–222.


37. Voortman, J. & Giaccone, G. (2006). Severe reversiblecardiac failure after bortezomib treatment combinedwith chemotherapy in a non-small cell lung cancerpatient: a case report. BMC Cancer, 6, 129.

38. Enrico, O., Gabriele, B., Nadia, C., Sara, G., Daniele,V., Giulia, C. et al. (2007). Unexpected cardiotoxicity inhaematological bortezomib treated patients. Br. J.Haematol. 138, 396–397.

39. Bristow, M. R. (1993). Changes in myocardial andvascular receptors in heart failure. J. Am. Coll. Cardiol.22, 61A–71A.

40. Port, J. D. & Bristow, M. R. (2001). Altered beta-adrenergic receptor gene regulation and signaling inchronic heart failure. J. Mol. Cell. Cardiol. 33, 887–905.

41. Esler, M., Kaye, D., Lambert, G., Esler, D. & Jennings,G. (1997). Adrenergic nervous system in heart failure.Am. J. Cardiol. 80, 7L–14L.

42. Hart, G. (1994). Cellular electrophysiology in cardiachypertrophy and failure. Cardiovasc. Res. 28, 933–946.

43. Wolk, R. (2000). Arrhythmogenic mechanisms in leftventricular hypertrophy. Europace, 2, 216–223.

44. McIntosh, M. A., Cobbe, S. M., Kane, K. A. & Rankin,A. C. (1998). Action potential prolongation andpotassium currents in left-ventricular myocytes iso-lated from hypertrophied rabbit hearts. J. Mol. Cell.Cardiol. 30, 43–53.

45. Yokoshiki, H., Kohya, T., Tomita, F., Tohse, N.,Nakaya, H., Kanno, M. et al. (1997). Restoration ofaction potential duration and transient outwardcurrent by regression of left ventricular hypertrophy.J. Mol. Cell. Cardiol. 29, 1331–1339.

46. Allessie, M., Ausma, J. & Schotten, U. (2002).Electrical, contractile and structural remodeling dur-ing atrial fibrillation. Cardiovasc. Res. 54, 230–246.

47. Nair, A. & Fischer, A. (2006). Atrial fibrillation inhypertrophic cardiomyopathy: mechanisms, embolicrisk and prognosis. Anadolu Kardiyol. Derg. 6, 40–43.

48. Wu, T. J., Ong, J. J., Hwang, C., Lee, J. J., Fishbein,M. C., Czer, L. et al. (1998). Characteristics of wavefronts during ventricular fibrillation in human heartswith dilated cardiomyopathy: role of increasedfibrosis in the generation of reentry. J. Am. Coll.Cardiol. 32, 187–196.

49. White, S. M., Constantin, P. E. & Claycomb, W. C.(2004). Cardiac physiology at the cellular level: use ofcultured HL-1 cardiomyocytes for studies of cardiacmuscle cell structure and function.Am. J. Physiol. HeartCirc. Physiol. 286, H823–H829.

50. Li, P., Ninomiya, H., Kurata, Y., Kato, M., Miake, J.,Yamamoto, Y. et al. (2011). Reciprocal control of hERGstability by Hsp70 and Hsc70 with implication forrestoration of LQT2 mutant stability. Circ. Res. 108,458–468.

51. Kim, N., Cannell, M. B. & Hunter, P. J. (2010).Changes in the calcium current among differenttransmural regions contributes to action potentialheterogeneity in rat heart. Prog. Biophys. Mol. Biol.103, 28–34.

52. van Tijn, P., Verhage, M. C., Hobo, B., van Leeuwen,F. W. & Fischer, D. F. (2010). Low levels of mutantubiquitin are degraded by the proteasome in vivo. J.Neurosci. Res. 88, 2325–2337.

impairment of ubiquitin–proteasome system by e334k cmybpc modifies channel proteins, leading to...

Documents