(CANCER RESEARCH56. 5728-5733. December 15. 9961

ABSTRACT

We analyzed the hMLHJ gene in 17 unrelated families with putativehereditary nonpolyposis colorectal cancer. The complete hMLHJ cDNAwas amplified in one step, and after a second amplification, four overlap

ping segments were directly sequenced. We detected, in five families thatdid not meet the complete Amsterdam criteria, five alterations, includinga double-base change resulting in a missense mutation (Lys-618-Ala), asplicing mutation affecting the intron 4 splice acceptor site, a 2-hp deletionat codon 726, a 7-hp deletion at codon 626, and a deletion of exons 13—16.The latter alteration was shown to result from a 22-kb genomic deletiondue to a homologous recombination between Alu repeats located in introns 12 and 16. The detection of five germline hMLHJ mutations in fivefamilies that only partially fulfilled the Amsterdam criteria shows thatthese criteria do not allow the identification of all famifial colorectalcancers due to mutations of the mismatch repair genes. The numerous Alurepeats present within the hMLHJ gene and the observation of largegenomic deletions suggest that (a) Alu-mediated deletions might frequently be involved in hMLHJ inactivation, and (b) reverse transcriptionPCR analysis, which allows the amplification of the entire coding region ofthe hMLHI gene in one step, might be the most appropriate method forthe detection of hMLHI alterations.

INTRODUCTION

HNPCC,3 or Lynch Syndrome, is considered the most commonform of inherited colorectal cancer ( I ), and the recent cloning of theHNPCC genes represent, therefore, important progress in the detection of patients with high genetic risk for colorectal cancer. The genesinvolved in HNPCC are the human homologues of the bacterial MutSand MutL mismatch repair genes (for a review, see Refs. 2 and 3).hMSH2, located on chromosome 2p2l, is homologous to MutS (4, 5),and hMLHJ (6, 7), /iPMSI, and hPMS2 (8), located on chromosomes3p2l, 2q3l-33, and 7p22, respectively, are homologous to MutL.Linkage analysis and mutation reports have suggested that most of theHNPCC cases result from germline mutations of the hMLHI andhMSH2 genes (9—21).

Detection of a germline mismatch repair gene mutation in a patientwith colorectal cancer confirms on a molecular basis the diagnosis ofHNPCC, which has important clinical implications for the patient andthe patient's relatives. HNPCC represents a genetic predisposition notonly for colorectal cancer but also for a wide spectrum of otherneoplasias, such as adenocarcinomas of the endometrium, stomach,ovary, small bowel, and hepatobiliary tract and transitional cell carcinomas of the urinary tract, and numerous patients will developmultiple primary tumors (I, 22). In hMLHJ or hMSH2 mutation

Received 7/26/96; accepted 10/16/96.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance withI8 U.S.C. Section I734 solely to indicate this fact.

I This work was supported by l'Association pour Ia Recherche sur Ic Cancer, Ia

FédérationNationale des Centres de Lutte Contre Ic Cancer, La Ligue Nationale ContreIc Cancer. La Groupement des Entreprises Françaisesdans Ia Lutte Contre Ic Cancer.

2 To whom requests for reprints should be addressed.

3 The abbreviations used are: HNPCC, hereditary nonpolyposis colorectal cancer; RT,

reverse transcription.

carriers, the most important genetic risk is the development of cob

rectal and endometrial cancers, and the lifetime risks for these cancershave been estimated at approximately 90 and at least 40%, respectively (23). Therefore in carriers, as recommended by the InternationalCollaborative Group on HNPCC, colonoscopy must begin at the ageof 25 years and be repeated at least every two years. In women, thissurveillance must be completed by annual uterine transvaginal sonography beginning at age 35.

Mutation screening of mismatch repair genes in patients withHNPCC remains difficult for the following reasons: (a) the involvement of four distinct genes; (b) the large distribution of alterationsalong the coding regions; and (c) the great heterogeneity of thealterations, which include nonsense mutations and small deletionscausing premature translation-termination, missense, and splicing mutations. Recently, a 3.5-kb deletion of the hMLHJ gene has beenidentified in HNPCC families ( 14). We report here the detection in 17families of five novel hMLHJ gcrmlinc mutations, including a 22-kbgenomic deletion.

MATERIALS AND METHODS

Patients. This study involved 17 families (Table 1) that fit the followingcriteria: (a) the family included a patient who developed a colorectal cancerbefore age 50; (b) the patient had at least one first-degree relative with acolorectal cancer or a tumor belonging to the HNPCC spectrum (22); (c) at

least two successive generations were affected; and (tO the family did notexhibit familial adenomatous polyposis. All cancers were histologically verifled. Blood samples were collected after informed consent was obtained.

RNA Extraction and RT-PCR. Peripheral blood lymphocytes were purifled from 10 ml of blood and placed directly in 400 pAof RNA lysis buffer(Pharmacia Biotech, Uppsala, Sweden) and stored at —20°C.mRNA wasextracted, and random hexamer-primed cDNAs were synthesized as describedpreviously (24). The complete open reading frame of hMLJ-lI was thenamplified from 2 pAof the cDNA reaction using MAFS as sense primer andMBRS as antisense primer (Table 2). PCR was performed in a final volume of20 @&lcontaining 0.5 @xMprimer and 2.5 units of Pfu DNA polymerase fromStratagene (La Jolla, CA). The PCR consisted of 10 cycles of 15 s at 94°C,1mm at 60°C,and 2 mm at 68°C,then 25 cycles of 15 s at 94°C,1 mm at 60°C,and 2 mm plus 20 s added per cycle at 68°C.PCR was preceded by 3 mm at95°Cand followed by 5 mm at 72°C.The PCR-amplified hMLHI cDNAs weresubmitted to electrophoresis on a 1% agarose gel and visualized by ethidium

bromide staining.Sequencing Analysis of hMLHJ cDNA. One @xlof the initial PCR was

diluted in 100 p1 of water, and I @xlof the diluted template was submitted toa second-stage PCR using four sets of Ml3 reverse and Ml3-2l tailed primers[(MA1F, MA1R), (MA2F, MA2R), (MB1F, MB1R), and (MB2F, MB2R);Table 2], which generated overlapping segments of 682, 512, 634, and 686 bp,respectively. PCR products were purified by electrophoresis on low-meltagarose gel and directly sequenced on both strands using either the PRISMAmpliTaq or the PRISM AmpliTaq FS Ready Reaction Dye Primer sequencing kits (Applied Biosystems and Perkin-Elmer/Cetus) and an Applied Bio

systems model 373A automated sequencer. Identified mutations were confirmed by a second independent RT-PCR analysis. Molecular alterations werefurther characterized by RT-PCR or amplification of the genomic DNA usingprimers containing restriction sites. PCR products were then cloned into the

5728

Identification of Novel Germline hMLH1 Mutations Including a 22 kb Alu-mediatedDeletion in Patients with Familial Colorectal Cancer1

Jacques L. Mauillon, Pierre Michel, Jean-Marc Limacher, Jean-Baptiste Latouche, Pierre Dechelotte,Françoise Charbonnier, Cosette Martin, Viviane Moreau, Josette Metayer, Bernard Paillot, and Thierry Freboure

Laboratoire de GénétiqueMoléculaireIf. L M.. f-B. L. F. C.. C. M.. V. M., T. Fl. Centre de Dépistageet de Traitement des Tumeurs Digestives (P. M.. B. P.1, and Laboratoired'Anatomie ci çvtologie Pathologique If. MI, Centre Hospitalo-Universitaire de Rouen, I rue de Germont. 76031 Rouen Cedex: Groupe de Biochimie et de PhysiopathologieDigestive et Nutritionnelle, Facultéde Médecineet de Pharmacie, 76800 Saint Etienne dii Rouvray [P. DI: Hbpitaux Universitaires, 67091 Strasbourg, (f-M. LI; and InstitutFédératifde Reeherches Multidisciplinaires sur les Peptides. 76821 Mont St. Aignan Cedex (J. L M., P. D., F. C., C. M., V. M., T. Fl, France

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

No. of patientsFamily with cancerNo.

of cases ofcolorectal cancerOther tumorsAge

at onset(yrs)Location

of thealterationNucleotidechange24

263 22 3Pharynx41—44 50—65726—728―Deletion

ofCA73

42Endometrium, brain24—37626-628―Deletion ofTCTC'lTI'142c3435—68ND1432243—54ND16022Ureter41—51ND1742447—72ND18923Endometrium42—66ND210

2245—50ND451 42Breast,lung―41-46ND531

34Bladder,kidney33—59ND64522Endometrium44—48Introns 12—1622.4-kbdeletion69921Ovary, smallbowel35-65ND756

2224—58618―AAG—*GCG910c43Endometrium34—54ND1042

31Breast,ovary40—68ND104455Ovary, endometrium32—66Intron 4 splice acceptorsite5'-tagAGC-3'--s5'-tggAGC-3'aCodonb

ND, no mutation wasdetected.C

Family fulfilling the Amsterdam

d Adenocarcinoma.criteria.

HMLHI MUTATIONS IN FAMILIAL COLORECTAL CANCER

Table 1 Clinical data and hMLHJ mutations in l7families with putative HNPCC

BluescriptSK(+) vector(Stratagene),and after bacterialtransformation,individual clones were sequenced.

Sequencing Analysis ofhMLIfl Introns 12 and 16. Introns 12 and 16 ofthe hMLHJ gene were amplified from normal genomic DNA using the 64SF(5' COG OAT CCC GGA GAA GAG AGO ACC TAC @VFCC 3') and JM2primers (5' COO AAT TCC 0CC ACA TCA OAA TCT TCC CO 3') and the645l6F (5' COG OAT CCC GAG OCT GAO ATO CU GCA GAC 3') and645R (5' COO AAT TCC OAT OAA OAT AGO CAG TCC CTC C 3')primers, respectively. The 64SF and 645l6F primers contain a BamHl restriction site, and JM2 and 645R an EcoPJ restriction site (underlined). To amplifyintron 12, we used TaqPlus DNA polymerase from Stratagene and an extension time of 3 mm. PCR products were then cloned into the Bluescript SK(+)vector, and individual clones were sequenced.

RESULTS

We analyzedthe hMLHJ genein 17 families(Table1) whosepresentation was suggestive of the Lynch syndrome, although only 2met the complete Amsterdam criteria (25). At the time of the study,these families included 46 affected subjects, 12 of whom had develo_ multiple primary cancers. For each family, we analyzed byRT-PCR the complete open reading frame of the hMLHI gene in oneaffected subject. The use of Pfu polymerase and primers containing aphosphorothiate linkage, which protects them from the 3'—5'exonuclease activity of the Pfu polymerase (26), allowed us to easilyamplify the entire coding region of hMLHJ (2268 bp), and after asecond-stage amplification, four overlapping segments were separately and direcily sequenced. These analyses allowed us to detect five

Table 2 Primers usedfor hMLHJ cDNAs amplification and sequencing

Primer Sequence― Position

MAFSb 5@BamHI OCA TCT AGA COT TFC C'fl@GO-s-C 3C Exon 1MBRSd 5@EcoRI CCC ACA GTG CAT AAA TAA C-s-C 3?C Exon 19MA1Fb @,M13R lTf CCT TOG CrC UC TOG 3' Exon 1MA1R― @,M13-2l TAG TOT CCT AAC ATC AOC 3' Exon 8MA2Fb 5, M13R UC AGT ACA CAA TOC AGO 3' Exon 7MA2R― @,Ml3-2l GTC Cr0 GTA OCA AAG ICr GO 3' Exon 12MBlF@' 5' M13R CTA TOC CCA CCA OAT GG 3' Exon 12MBlR@' @,M13-2l CGA TAA CCT GAG AAC ACC 3' Exon 15MB2F@' 5' MI3R TAC CU CTC AAC ACC ACC 3' Exon 14MB2R― @,M13-2l CAG TGC ATA AAT AAC CAT 3' Exon 19

a Primers containing additional sites: BamHl, COG OAT CCC 0; EcoRI, COG AAT

TCC 0; M13R, CAG OAA ACA OCf ATO ACC; Ml3-2l, TGT AAA ACO ACO 0CCAGT.

b Sense primer.

C@ phosphorothioate linkage.

d Antisense primer.

distinct alterations of the hMLHJ gene in five unrelated families(Table 1; Fig. 1).

In family 24, as shown in Fig. 2, we identified a 2-bp deletionoccurring in a CA repeat in exon 19. This deletion, resulting in a stop

codon 15 nucleotides downstream, was confirmed by sequencinganalysis of genomic DNA (data not shown). In family 73, a 7-bpdeletion, resulting in a stop codon 24 nucleotides downstream, wasdetected in exon 16 by direct sequencing of the cDNA (Fig. 2) andconfirmed by cloning and sequencing of the mutant cDNA (data notshown). The proband of family 756 harbored in exon 16 at codon618 a double base change (AAG—@GCG),and cloning of the cDNAsshowed that the two nucleotides substitutions were located on thesame allele (Fig. 2), resulting, therefore, in a single missense mutation(Lys—@Ala).In family 1044, sequencing of the hMLHJ cDNA revealed a deletion of the first 6 bp (AGCAAG) of exon 5 (data notshown). The observation of the AG dinucleotide at the end of thedeleted segment, suggesting a mRNA splicing defect, led us to sequence the intron 4-exon 5 boundary in the affected proband. Thisanalysis showed (Fig. 2) a mutation of the splice acceptor site ofintron 4 (ag—t@gg),which therefore resulted in an activation of thecryptic site located at the beginning of exon 5. In family 645, elec

trophoresis of the PCR-amplificd hMLHJ cDNAs revealed an aberrant pattern (Fig. 3a, Lane 1). Amplification of the partial cDNAbetween exon 12 and 19 confirmed, in addition to the presence of thenormal cDNA, the presence of two aberrant shorter cDNAs (Fig. 3b,Lane 1), which were cloned. Sequencing analysis showed that theseabnormal cDNAs correspond to a complete deletion of exons 13—16and exons 13—17.To characterize the deletion at the genomic level,exons 12—17were amplified from the genomic DNA of the affectedproband. A 1.4-kb PCR fragment was observed in the affected subject(Fig. 3b, Lane 3), whereas the normal size of this hMLHJ region is23.8 kb (10). The sequence revealed that this abnormal genomic PCRproduct contained exon 12, the 5' end of intron 12, the 3' end of intron16, and exon 17. To localize the deletion breakpoint, we completelysequenced introns 12 (2.8 kb) and 16 (0.8 kb) of the hMLHJ genefrom normal genomic DNA. Analysis of the sequence, using theBLAST program (National Center for Biotechnology Information),revealed that intron 12 contained five Mu repeats, whereas intron 16,as reported previously (14), contained one Alu repeat (Fig. ‘Ia).Alignment of the normal intronic sequences to the sequences observedin family 645 revealed that in this family, the first 570 bp of intron 12of hMLHJ were fused to the last 670 bp of intron 16 (Fig. 4b). The

5729

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HMLHI MUTATIONS IN FAMILIAL COLORECTAL CANCER

73

756

24

Brain24

Colon31+1-

645

Fig. I. Partial pedigrees of the families withhMLHJ mutation (families 24, 73, 645, 756, and1044). Filled symbols, affected subjects; open symbols, asymptomatic individuals; oblique lines, deceased; arrow, proband. For each affected subject,the tumor and age of diagnosis are indicated. +1—,heterozygote hMLHJ mutation. Family 1044,shaded symbol corresponds to a mucinous borderline ovarian tumor.

Colon58 Rectum 24+1-

Colon44+1-

1044

Colon32+1-

breakpoint (Fig. 4c), which was located within the first Alu repeat ofintron 12 and the Alu repeat of intron 16, involved a 32-bp regionhomologous between introns 12 and 16 (94% homology). These datashowed that the 22.4-kb deletion of the hMLHJ gene observed infamily 645 was the result of a homologous Alu-mediated recombination and had induced two aberrant splicings between the donor site ofintron 12 and the acceptor sites of introns 16 and 17.

DISCUSSION

We analyzed by RT-PCR and direct sequencing the hMLHI gene in17 families with familial colorectal cancer, only two of which completely fulfilled the Amsterdam criteria (24) for HNPCC (at least threerelatives with histologically verified colorectal cancers, one of whomis a first-degree relative of the other two; at least two successivegenerations affected; and at least one of the cases of colorectal cancerdiagnosed before age 50). We found a germline hMLHI alteration in5 of the 15 families that did not meet the complete criteria at the timeof the study (33%), and this result is in agreement with the recentreport from NystrOm-Lahti et a!. (18), who observed a germlinehMLHJ alteration in 25% of families that only partially fulfilled thecriteria. Although the Amsterdam criteria have allowed the identification of genuine HNPCC families and therefore the positional don

ing of the mismatch repair genes, these criteria appear in practice, asdiscussed previously (1), too stringent. As illustrated by the clinicalpresentation of our families with hMLHJ mutation (Fig. 1), thesecriteria might take into account the size ofthe family, the developmentof extra-colonic cancers such as endometrial cancer, and the development in the same individual of multiple primary tumors, which is astrong indicator of a genetic predisposition for cancer. The fivehMLHJ alterations that we describe have not, to our knowledge, been

reported previously. Although the size of the families did not allow usto perform a cosegregation analysis between these specific mutationsand cancer, we consider that these alterations are probably pathogenic.The Lys-6l8-Ala mutation, which results from two nucleotide substitutions, was not found in 28 unrelated subjects, suggesting that thisvariation is not a common polymorphism. Furthermore, the threelysines present at codons 616—618, which correspond to three AAGrepeats, have previously been shown to represent a hot spot forhMLHJ alteration (1 1, 13, 16, 19, 2 1). The four other mutations that

we reported are also probably pathogenic, because they potentiallyresult in a truncated hMLH1 protein. Two of these mutations highlighttwo mechanisms of hMLHJ deletion. The CA deletion, observed infamily 24, is predicted to result in a truncated protein lacking only the31 C-terminal amino acids of hMLH1. This CA deletion occurred in

5730

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

.@@123

HMLHI MUTATIONS IN FAMILIAL COLORECFAL CANCER

24

A AT 6 T 6 T 6 A GC 6 C A A

A AT GT 6 N 6 N 6 C NNNG

73

T AT T T CT CT T TG 6 A A A

T ATTN NH NH T T6G NH A

Wild-type TA1TfCTC11TGGAAAMutant TA1TGGAAATfGATGA

756CT 6 A AG A AG A AGG CT

CT 6 A AG A AG 6 CG G CT

Wild-type CTGAAGAAGMGGCTMutant CTGAAGAAG@QGGCT

1044

CAT T AG AG CAAGTT

Fig. 2. Detection of hMLHI mutations in families 24, 73, 756, and 1044. Families 24 and 73, sequence of the RT-PCR product;family 756, sequence of the cloned mutant cDNA;family 1044, sequence of the intron 4-exon 5 boundary amplified from genomic DNA. For each family, the sequence observed in the affected proband (bottom) and the correspondingcontrol sequence (top) are shown. The sequences correspond to the + strand except for family 24. The nucleotide changes are indicated.

2323 @ir1929@1371 @ir

Fig. 3. Detection of a AMLHI22.4-kb deletion in family 645. a, RT-PCR analysis of the complete hMLHI cDNA. hMLHI cDNAs were amplified with the MAFS and MBRS primers(Table 2) as described in “Materialsand Methods,―and 10% of the PCR reaction was loaded on a 1% agarose gel. Marker, molecular weight marker BstEll-digested A; Lane I, patient645; Lane 2, normal subject; Lane 3, negative control. The predicted size ofthe normal PCR product is 2349 bp. b, amplification ofthe hMLHJ cDNAs between exon 12 and 19 (LanesI and 2) using primers MB1F and MBRS (Table 2) and of the genomic DNA between exon 12 and I7 (Lanes 3 and 4) using primers 64SF and 645R (Table 2). Lane 1, patient 645;Lane 2, nonnal control; Lane 3, patient 645; Lane 4, normal control; Marker, molecular weight marker HaellI-digested FX174. The predicted size of the normal cDNA is I 190 bp.In patient 645, two other shorter cDNAs were also observed, and sequence analysis revealed that their sizes were 715 and 610 bp. The amplification performed on genomic DNA frompatient645showeda 1.4-kbproduct,whereasno amplificationproductwasdetectedin the normalcontrol.Thefragmentssizes(inbp)of the markersare indicated.

@731

Wild-type AATGTGIGAGCGCAAMutant AATGTGAGCGCAAGG

T CAT TNG AG CAAGTT

Wild-type TCA1T@GAGCAAGTTMutant TCAU@GAGCAAG1T

a sequence of three CA repeats, and a deletion of two CA repeatsoccurring at the same location was reported previously by Papadopoulos et aL (7). Our report confirms that this dinucleotide repeat, likeother di- or trinucleotide repeats characterized within the hMLHJopen reading frame (7, 13, 16, 19, 21), is a hot spot for deletions. Itis remarkable to notice that this type of alteration, which is supposedto result from DNA polymerase slippage, will therefore inactivate the

deletion of hMLHJ reported thus far. Recently, a 3.5-kb hMLHJdeletion resulting from a recombination between one of the six Alurepeats located in intron 15 and the Alu repeat present in intron 16 hasbeen detected in Finnish HNPCC families (14). The deletion observedin family 645 led us to identify new Alu repeats within hMLHJ andrevealed that introns 12 and 16 share a highly homologous 32-bpsequence. Our report and the report from Nystrom-Lahti et a!. (14)

hMLHJ gene and led to a general instability of repeated sequences. In show that introns of the hMLHJ gene contain numerous Alu repeats,

family 645, we described a 22.4-kb deletion, which is the largest which suggests that large genomic deletions of the hMLHJ gene might

a b

.I353-1078872603

I 2 3 4@

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

-@ - -

71 cc'ro@.axrc@AGAGTFCAAGACCAGCCTGA(CCAACATGGTGAAACCCCATCTCTACTAAAAJ4TACAM.A°r@ 4011111111(1((l(((l(llIIII((((((I(l(II(I(l(11(11(11I (((III(((IIII III

71 cc'rcaax@cx AGAGT@rcAx.GAccAGcc'roAIccAAcATGGTGAAACCCCGTCTCTACTAAA TAt@AAA140II II I liii Ill

71 AC@GGGGTCAGOAG@1@FCAAAACCAGCTGGCCAACATGATGAAACCCCGTCTCTACTAAA TAGAAA140

141 TAGCCAGACGTGGTGGCGCATGC@TAATCCCCGCTACTCGGG@GCTGAGACAGGAGAATGACTTGAA210I I ((III I I I (I II I 1111$ I

141 ‘r@.ccc@.GGCG'PGG'PGGC000TACCTGTAATCCAAGCTGCTCAGGAGGCTGACGCAGAAGAATCACTT210

141 A@,TrAGCCAGGco'roGTGGcGGGTAC@TAATCCAAGCTGCTCAGGAGGC@GGCAGAAGAATCACTT210.@ . . .I____@

HMLHI MUTATIONS IN FAMILIALCOLORECTAL CANCER

aintron 12

22,4 kb

intron 16.@

12

bFig. 4. Schematic representation of the Alu-mediated recombinationresulting in a hMLHI 22.4-kb deletion in family 645. a, partial representation of the hMLHI gene. Open boxes correspond to exons andshaded boxes to the Alu repeats located in introns 12 and 16. The Alurepeats are all oriented from 5' to 3', and only the Alu repeats 1, 5, and6 contain left and right arms. b, homologous recombination between thefirst Alu repeat located in intron 12 and the Alu repeat located in intron16. c, alignment between the nucleotide sequences of the normal intron12 (top line), the recombined region in patient 645 (middle line), and thenormal intron 16 (bottom line). Dotted arrows delimit the Alu left arms,and solid arrows indicate the beginning of the Alu right arms. The coresequences are underlined. Box, 32-hp homologue region between introns12 and 16 in which the recombination had occurred.

12 17

°@ /1

intron 12 intron 16

C

1 AcTccc@1tGcCGGG'I'GCTGTGGCTCACACCTAT@CC9@1T1@GGGA@Q@AGGCAGGTGGATCA70

1 ACTCCCTGGCC000TGCTGT GGC'S'CACACCTATAATCCCA GCACI'FTGGGAGGCTGAGGCAGGTGGATCA 70I ((( ( I ( (I (((I ( I II I

1 AAATTPCC,AGCCGGGTGCGGTGGCTCATGGCTGTAATCCCAGCACT@GGGAGGCTGAGGTGGGCAGATA70...@.

be frequently involved in hMLHJ inactivation. These observationshave important practical implications, in term of mutations screening.Screening methods of the mismatch repair genes, which are based onPCR amplification of genomic DNA, require that the genes be amplified exon by exon and might not be able to detect large deletionsbecause only the normal allele will selectively be amplified. AlthoughRT-PCR requires specific conditions of samples collection and storage to prevent mRNA degradation, this approach, as shown by thisstudy, allows us to amplify in one step the entire open reading frameof the hMLHI gene. The observation of large deletions within thehMLI-J1 coding region (this study and Ref. 14) led us to conclude thatRT-PCR analysis might be the most appropriate method for thedetection and characterization of germline hMLHJ alterations.

ACKNOWLEDGMENTS

We thank Richard Iggo, who gave us the idea to perform RT-PCR withphosphorothioate primers, Jean-Michel Flaman and Benoit Thirion for excellent technical assistance, and Phivi Peltomäkiwho kindly provided us with theintron 16 sequence of the hMLHJ gene.

REFERENCES

I. Lynch, H. T., Smyrk, T. C., Watson, P., Lanspa, S. J., Lynch, J. F., Lynch, P. M.,Cavalien, R. J., and Boland, C. R. Genetics, natural history, tumor spectrum, andpathology of hereditary nonpolyposis colorectal cancer: an updated review. Gastroenterology. 104: 1535—1549,1993.

2. Marra, 0., and Boland, C. R. Hereditary nonpolyposis colorectal cancer: the syndrome, the genes, and historical perspectives. J. NatI. Cancer Inst., 87: 1114—1125,1995.

3. Fishel, R., and Kolodner, R. D. Identification of mismatch repair genes and their rolein the development of cancer. Curr. Opin. Genet. Dcv., 5: 382—395,1995.

4. Fishel, R., Lescoe, M. K., Rao, M. R., Copeland, N. 0., Jenkins, N. A., Gather, J.,Kane, M., and Kolodner, R. The human mutator gene homolog MSH2 and itsassociation with hereditary nonpolyposis colon cancer. Cell, 75: 1027—1038,1993.

5. Leach, F. S., Nicolaides, N. C., Papadopoulos, N., Liu, B., Jen, J., Parsons, R.,Peltomtki, P., Sistonen, P., Aaltonen, L. A., Nystrom-Lahti, M., Guan, X-Y., Zhang,J., Meltzer, P. S., Yu, J. W., Kao, F-T., Chen, D. J., Cerosaletti, K. M., Keith Fournier,R. E., Todd, S., Tracey, L., Leach, R. J., Naylor, S. L., Weissenbach, J., Mecklin, J-P.,Jarvinen, H., Petersen, 0. M., Hamilton, S. R., Green, J., Jass, J., Watson, P., Lynch,H. T., Trent, J. M., de la Chapelle, A., Kinzler, K. W., and Vogelstein, B. Mutationsof a mutS homolog in hereditary non-polyposis colorectal cancer. Cell, 75: 1215—1225, 1993.

6. Bronner, C. E., Baker, S. M., Morrison, P. T., Warren, 0., Smith, L 0., Lescoe,M. K., Kane, M., Earabino, C., Lipford, J., Lindblom, A., Tannergard, P., Bollag,R. J., Godwin, A. R., Ward, D. C., Nordenskjdld, M., Fishel, R., Kolodner, R., andLiskay, R. M. Mutation in the DNA mismatch repair gene homologue hMLHJ isassociated with hereditary non-polyposis colon cancer. Nature (Lond.), 368: 258—261, 1994.

7. Papadopoulos, N., Nicolaides, N. C., Wei, Y. F., Ruben, S. M., Carter, K. C., Rosen,C. A., Haseltine, W. A., Fleischmann, R. D., Fraser, C. M., Adams, M. D., Venter,J. C., Hamilton, S. R., Petersen, 0. M., Watson, P., Lynch, H. T., Peltomtki, P.,Mecklin, J-P., de Ia Chapelle, A., Kinzler, K. W., and Vogelstein, B. Mutation of amud.. homolog in hereditary colon cancer. Science (Washington DC), 263: 1625—1629,1994.

8. Nicolaides, N. C., Papadopoulos, N., Liu, B., Wei, Y. F., Carter, K. C., Ruben, S. M.,Rosen, C. A., Haseltine, W. A., Fleischmann, R. D., Fraser, C. M., Adams, M. D.,Venter, J. C., Dunlop, M. 0., Hamilton, S. R., Petersen, 0. M., de la Chapelle, A.,Vogelstein, B., and Kinzler, K. W. Mutations of two PMS homologues in hereditarynonpolyposis colon cancer. Nature (Lond.), 371: 75—80,1994.

9. Nystrom-Lahti, M., Parsons, R., Sistonen, P., Pyllckanen,L., Aaltonen, L. A., Leach,F. S., Hamilton, S. R., Watson, P., Bronson, E., Fusaro, R., Cavalieri, J., Lynch, J.,Lanspa, S., Smyrk, T., Lynch, P., Drouhard, T., Kinzler, K. W., Vogelstein, B.,Lynch, H. T., de la Chapelle, A., and Peltomaki. P. Mismatch repair genes onchromosomes 2p and 3p account for a major share of hereditary nonpolyposiscolorectal cancer families evaluable by linkage. Am. J. Hum. Genet. 55: 659—665,1994.

5732

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HMLHI MUTATIONS IN FAMILIAL COLORECTAL CANCER

10. Kolodner, R. D., Hall, N. R., Lipford, J., Kane, M. F., Morrison, P. T., Finan, P. J.,Burn, J., Chapman, P., Earabino, C., Merchant, E., and Bishop, D. T. Structure of thehuman MUll locus and analysis of a large hereditary nonpolyposis colorectalcarcinoma kindred for mlhl mutations. Cancer Res., 55: 242—248,1995.

I 1. Han, H. J., Maruyama, M., Baba, S., Park, J. 0., and Nakamura, Y. Genomic structureof human mismatch repair gene, hMLHI, and its mutation analysis in patients withhereditary non-polyposis colorectal cancer (HNPCC). Hum. Mol. Genet., 4: 237—242,1995.

12. Tannergard, P., Lipford, J. R., Kolodner, R., Frodin, J. E., Nordenskjöld,M., andLindblom, A. Mutation screening in the hMLHJ gene in Swedish hereditary nonpolyposis colon cancer families. Cancer Res., 55: 6092—6096,1995.

13. Miyaki, M., Konishi, M., Muraoka, M., Kikuchi-Yanoshita, R., Tanaka, K., Iwama.T., Mon. T., Koike, M., Ushio, K., Chiba, M., Nomizu, S., and Utsunomiya, J. Germline mutations of hMSH2 and hMLHI genes in Japanese families with hereditarynonpolyposis colorectal cancer (HNPCC): usefulness of DNA analysis for screeningand diagnosis of HNPCC patients. J. Mol. Med., 73: 515—520,1995.

14. NystrOm-Labti, M., Kristo, P., Nicolaides, N. C., Chang, S. Y., Aaltonen, L. A.,Moisio, A. L., JSrvinen, H. J., Mecklin, J-P., Kinzler, K. W., Vogelstein, B., de IaChapelle, A., and Peltomaki, P. Founding mutations and Alu-mediated recombinationin hereditary colon cancer. Nat. Med., 1: 1203—1206,1995.

15. Maliaka, Y. K., Chudina, A. P., Belev, N. F., Alday, P., Bochkov, N. P., andBuerstedde, J. M. CpG dinucleotides in the hMSH2 and hMLHI genes are hotspots forHNPCC mutations. Hum. Genet., 97: 251—255,1996.

16. Wijnen, J.. Khan, P. M., Vasen, H., Menko, F., van der Klift, H., van den Broek, M.,van Leeuwen-Cornelisse, I., Nagengast, F., Meijers-Heijboer, E. J., Lindhout, D.,Griffloen, 0., Cats, A., Kleibeuker, J., Varesco, L., Bertario, L., Bisgaard, M. L.,Mohr, J., Kolodner, R., and Fodde, R. Majority of hML.H1mutations responsible forhereditary nonpolyposis colorectal cancer cluster at the exonic region 15—16.Am. J.Hum. Genet., 58: 300—307,1996.

17. Liu, B., Parson, R., Papadopoulos, N., Nicolaides, N. C., Lynch, H. 1., Watson, P.,Jass, J. R., Dunlop, M., Wyllie, A., Peltomaki, P., de Ia Chapelle, A., Hamilton, S. R.,Vogelstein, B., and Kinzler, K. W. Analysis of mismatch repair genes in hereditarynon-polyposis colorectal patients. Nat. Genet., 2: 169—174,1996.

18. Nystrom-Lahti, M., Wu, Y., Moisio, A-L., Hofstra, R. M. W., Osinga, J., Mecklin,i-P., Jtrvinen, H. i., Leisti, i., Buys, C. H. C. M., de Ia Chapelle, A., and Peltomaki.P. DNA mismatch repair gene mutations in 55 kindreds with verified or putativehereditary non-polyposis colorectal cancer. Hum. Mol. Genet., 6: 763—769,1996.

19. Hamilton, S. R., Liu, B., Parsons, R. E., Papadopoulos, N., Jen, I., Powell, S. M.,Krush, A. J., Berk, T., Cohen, Z., Tetu, B., Burger, P. C., Wood, P. A., Taqi, F.,Booker, S. V., Petersen, 0. M., Offerhaus, 0. J. A., Tersmette, A. C., Giardello, F. M..Vogelstein, B., and Kinzler, K. W. The molecular basis of Turcot's syndrome.N. EngI. i. Med., 332: 839—847, 1995.

20. Buerstedde, J-M., Alday, P., Torhorst, I., Weber, W., Muller, H., and Scott, R.Detection of new mutations in six out of 10 Swiss HNPCC families by genomicsequencingof the hMSH2andhMLHIgenes.i. Med.Genet.,32: 909—912,1995.

21. Moslem, 0., Tester, D. i., Lindor, N. M., Honchel, R., Cunningham, i. M., French.A. I., HaIling, K. C., Schwab, M., Goretzki, P., and Thibodeau, S. N. Microsatelliteinstability and mutation analysis of hMSH2 and hMLJIJ in patients with sporadic,familial and hereditary colorectal cancer. Hum. Mol. Genet., 5: 1245—1252,1996.

22. Watson, P., and Lynch, H. T. Extracolonic cancer in hereditary nonpolyposis colarectal cancer. Cancer (Phila.), 71: 677-685, 1993.

23. Vasen, H. F. A., Wijnen. I. T., Menko, F. H., Kleibeuker, I. H., Taal, B. 0., Oriffloen,0., Nagengast, F. M., Meijers-Heijboer, E. H., Bertario, L., Varesco, L., Bisgaard,M-L., Mohr, J., Fodde, R., and Kahn, P. M. Cancer risk in families with hereditarynonpolyposis colorectal cancer diagnosed by mutation analysis. Gastroenterology,110:1020—1027,1996.

24. Charbonnier, F., Martin, C., Scone, M., Sibert, L., Moreau, V., and Frebourg. T.Alternative splicing of MUll messenger RNA in human normal cells. Cancer Res.,55: 1839—1841,1995.

25. Vasen, H. F. A., Mecklin, i-P., Meera Kahn, P., and Lynch, H. T. The InternationalCollaborative Group on Hereditary Non-Polyposis Colorectal Cancer (ICO-HNPCC).Dis. Colon Rectum, 34: 424—425, 1991.

26. Skerra A. Phosphorothioate primers improve the amplification of DNA sequences byDNA polymerase with proofreading activity. Nucleic Acids Res., 20: 3@@1—3SS4,I992.

5733

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1996;56:5728-5733. Cancer Res   Jacques L. Mauillon, Pierre Michel, Jean-Marc Limacher, et al.   Cancerkb Alu-mediated Deletion in Patients with Familial Colorectal

Mutations Including a 22hMLH1Identification of Novel Germline

  Updated version

  http://cancerres.aacrjournals.org/content/56/24/5728

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/24/5728To request permission to re-use all or part of this article, use this link

on July 20, 2021. © 1996 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from