identification and characterization of the glycoside ...oct 17, 2011 · identification and...
TRANSCRIPT
1
Identification and Characterization of the Glycoside 1
Oxidoreductase from Rhizobium sp. GIN611 Resulting in 2
the Deglycosylation of Ginsenosides 3
4
Eun-Mi Kim1, Juhan Kim2, Joo-Hyun Seo1, Jun-Seong Park3, Duck-Hee Kim3 and Byung-5
Gee Kim1,* 6
1 School of Chemical and Biological Engineering, Seoul National University, Seoul 151-7
742, Republic of Korea 8
2 UCB 216, Cooperative Institute for Research in Environmental Sciences, CIRES 318, 9
University of Colorado, Boulder, CO 80302 10
3 R & D Center, Amore-Pacific Corporation, Yong-In, Kyounggi-do 446-729, Republic of 11
Korea 12
13
* To whom correspondence should be addressed. 14
Telephone: +82-2-880-6774, Fax: +82-2-872-7528, E-mail: [email protected] 15
16
Running title: Novel glycoside oxidoreductase for ginsenosides 17
18
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.06404-11 AEM Accepts, published online ahead of print on 21 October 2011
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
2
Abstract 19
Using enrichment culture, Rhizobium sp. GIN611 was isolated for the deglycosylation of a 20
ginsenoside, Compound K (CK). A purified hetero-dimeric protein complex from 21
Rhizobium sp. GIN611 is consisted of two subunits with molecular weights of 63.5 kDa and 22
17.5 kDa. In genome, a coding sequence of the small subunit was located right after the 23
sequence of the large subunit with one nucleotide overlapped. The large subunit showed the 24
oxidation activity of CK, and the deglycosylation of compound K was performed via 25
oxidation of ginsenoside glucose by glycoside oxidoreductase. Coexpression of small 26
subunit helps soluble expression of the large subunit in the recombinant Escherichia coli. 27
Purified large subunit also showed oxidation activity against other ginsenoside compounds 28
such as Rb1, Rb2, Rb3, Rc, F2, CK, Rh2, Re, F1 and isoflavone daidzin, but with a much 29
slower rate. When oxidized CK was extracted and incubated in phosphate buffer with or 30
without enzyme, PPD(S) was detected in both cases, which suggests that deglycosylation of 31
oxidized glucose is spontaneous. 32
33
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
3
Introduction 34
Ginseng is a traditional plant medicine that has been widely used for preventive and 35
therapeutic purposes in Asian countries over thousands of years. It exhibits various 36
pharmacological effects such as anti-cancer, anti-inflammation, and anti-aging (3, 6, 26, 35). 37
The main physiologically active compounds of ginseng are ginsenosides, having over 40 38
kinds of known structures, which generally fall into three different classes: protopanaxadiol 39
type (PPD type), protopanaxatriol type (PPT type) and oleanolic acid type (14, 31). 40
Previous studies reported that pharmacological functions of ginsenosides come from the 41
deglycosylated forms of ginsenosides generated by intestinal bacteria (3, 14, 29, 32, 34). 42
The absorption of ginsenosides in the human intestine is greatly affected by the presence of 43
glycosyl moiety in its structure. In general, glycosylated ginsenoside is poorly absorbed 44
into the blood stream, compared to the deglycosylated form due to its hydrophilicity. 45
Therefore, the deglycosylated forms often show better pharmacological activity in the body 46
than glycosylated form (17, 21). For example, ginsenoside Compound K (CK) and Rh2, 47
widely known as inducers for tumor cell apoptosis (10, 18) are deglycosylated into PPD. 48
Compared to Rh2, PPD shows better pharmacological effects on B16 melanoma cell (28). 49
Deglycosylation of ginsenoside in the human body greatly varies depending upon the 50
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
4
enzyme activity of microbial flora in the intestines. Since this activity varies between 51
individuals, the medicinal effects of ginseng also vary significantly (39). To understand 52
the exact pharmacological effects of the deglycosylated ginsenosides, pure compound of 53
deglycosylated ginsenoside should be used or administered. However, since it is difficult to 54
obtain a large quantity of such rare deglycosylated ginsenosides, their biological roles and 55
pharmacological effects (6) have not been thoroughly studied. 56
Recent research on ginsenoside is mainly focused on the production of rare and effective 57
ginsenosides through the enzymatic deglycosylation (13, 19, 22, 23, 38). There have been 58
several attempts to produce such biologically active deglycosylated ginsenosides (2, 15, 16, 59
29), using microbial transformation (7, 8), enzymatic deglycosylation (23, 33), and mild 60
acid hydrolysis (12). Among them, enzymatic deglycosylation is the most preferred method, 61
since it is substrate specific, produces less byproducts, requires simple separation, results in 62
high yields, and environmentally friendly. Thus far, isolation of various intestinal anaerobic 63
and food bacteria (e.g. Fusobacterium K-60, Bifidobacterium sp. SJ32, Lactobacillus 64
delbrueckii) (5, 9, 29), and soil bacteria from ginseng farms (e.g. Fusarium sacchari) (13, 65
41) have been reported. In addition, various glycoside hydrolyzing enzymes (e.g. β-66
glucosidase having deglycosylation activity to Rg3) (1, 5, 37, 40, 41) from such 67
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
5
microorganisms were isolated for ginsenoside production. 68
Although there are some reports already available on glycosidases that produce CK (13, 37, 69
40) from various major ginsenosides, there are no reports on enzymatic deglycosylation of 70
CK to produce PPD(S). Some microorganisms (e.g. Eubacterium A44 and Bacteroides 71
HJ15) (2) have been reported as having deglycosylation activities converting CK or Rh2 72
into PPD(S), but with very low productivity. To produce a large amount of rare 73
deglycosylated ginsenosides using enzymes, microorganisms showing serial and/or 74
stepwise deglycosylation activity emulating intestinal bacteria flora in the human body, are 75
required. This study focuses on the screening of novel microorganisms that have 76
deglycosylation activity on CK (Fig. 1) and the isolation of deglycosylating enzymes from 77
the screened microorganism. 78
79
Materials and Methods 80
Chemicals 81
Red ginseng extract, a mixture of various ginsenosides, was prepared by ethyl acetate 82
extraction, and CK (50%) was produced by enzymatic biotransformation following Kim et 83
al method (20). Other ginsenosides Rb2, Rb3, Rc, Rd, F2, Rh2, PPD(S), Re and F1 were 84
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
6
purchased from LKT Laboratories Inc. (St Paul, MN) and ginsenoside Rb1 was purchased 85
from Wako Pure Chemical Co., Ltd. (Osaka, Japan). Isoflavone daidzin was purchased 86
from Sigma (St. Louis, MO) (Table S2). All solvents for HPLC analysis were of HPLC 87
grade from Duksan Pure Chemical (Ansan, Republic of Korea). Methanol and ethanol were 88
purchased from Merck-chemical (Darmstadt, Germany). Chloroform was purchased from 89
Junsei Chemical (Tokyo, Japan). The chemicals required for protein assay and sodium 90
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) were purchased from Bio-91
Rad (Hercules, CA). All other chemicals were purchased from Sigma (St. Louis, MO). 92
93
Screening of microorganism 94
An enrichment culture was performed to isolate a new microorganism which had the ability 95
to catalyze the deglycosylation of ginsenoside CK. After field soil samples from a ginseng 96
farm (10g) were mixed with 50 ml phosphate buffered saline (PBS), the mixture was 97
filtered using filter paper (alpha cotton cellulose, 110 mm diameter, Advantec, Japan). The 98
filtered sample 100 μl was inoculated to 10 ml minimal M9/ginsenoside medium with a 0.2 % 99
(w/v) red ginseng extract (ginsenoside mixture) as a carbon source instead of glucose. 100
Cultures were grown at 30°C under aerobic condition. After several rounds of enrichment 101
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
7
cultures, the culture media were diluted and spread on the M9/ginsenoside minimal media 102
or Luria-Bertani media (LB) agar plate and incubated at 30°C for 20 hr. Fifty colonies were 103
selected randomly, based on the differences of morphology and color. The selected cells 104
were subsequently cultured in 3ml of M9/ginsenoside media at 30°C. Cultured cells were 105
stored at -80°C for further study. After the cells were harvested and washed using PBS, 106
whole cell reactions were performed to find strains with the deglycosylation activity for CK. 107
The strains with high activity for CK deglycosylation were selected. 16S rRNA sequencing 108
(SolGent co., Daejeon, Republic of Korea) was performed to identify the screened 109
microorganism. 110
111
Enzyme assay and analytical methods 112
For screening of the microorganism showing ginsenoside deglycosylation activity, MALDI-113
TOF mass spectrometry (Bruker Datonics Biflex IV, Bremen, Germany) was used. For 114
whole cell reactions, a cell pellet was obtained by centrifugation from 3 mL 115
M9/ginsenoside media grown at 30 °C for 12 hr. The pellets were resuspended in 1 ml of 50 116
mM sodium phosphate buffer (pH 7.0) containing 50 µM CK. The mixture was incubated 117
at 37°C for 12 hr. Reactants and products were extracted with 1 ml ethyl acetate. The 118
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
8
extracted samples went through evaporation using a vacuum concentrator (Biotron, Seoul, 119
Republic of Korea). The dried reaction samples were dissolved in ethanol, and then 120
analyzed by MALDI-TOF using 2, 5-dihydroxybenzoic acid as a matrix. 121
For the activity confirmation of the active fraction during the protein purification, thin layer 122
chromatography (TLC) analysis was performed with silica gel 60 F254 plates (Merck, 123
Darmstadt, Germany). TLC was separated with CHCl3: methanol: H2O (65: 35: 10, v/v/v) 124
and visualized with 10% H2SO4 in ethanol and application of heat. 125
Quantitative analysis of CK deglycosylation reaction was performed using a high-pressure 126
liquid chromatography (HPLC) system (Younglin Instrument, Seoul, Republic of Korea) 127
equipped with Symmetry C18 5 μm column (4.6×150 mm; Waters, MA). The HPLC 128
analysis was performed using 80% acetonitrile (ACN) aqueous solution as an eluent with a 129
flow rate of 0.8 ml/min and the detection wavelength of 203 nm. Reaction profiles of F2 130
were analyzed with HPLC using gradient elution, consisting of the following steps; 30% 131
ACN/70% H2O for 5 min, a gradual increase to 80% ACN/20% H2O for 35 min, further 132
retention for 15min, 100% ACN for an additional 10 min, a decrease to 30% ACN/ 70% 133
H2O for 2 min, and ending with 10 min at 30% ACN/70% H2O at a flow rate of 1 ml/min. 134
135
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
9
Purification of the active protein 136
For the purification of the deglycosylation enzyme, the screened microorganism was 137
cultured in 10 L M9/ginsenoside media. The cells were harvested by centrifugation at 3,000 138
g for 15 min and washed with PBS. The pellet was resuspended in 50 mM sodium 139
phosphate buffer (pH 7.0) containing 1 mM ethylenediaminetetraacetic acid, 1 mM 140
phenylmethylsulfonyl fluoride (PMSF), and 1 mM dithiothreitol (DTT). To obtain the cell 141
extract, the cells were disrupted by sonication and debris was removed by centrifugation at 142
20,000 g for 40 min. All purification steps were carried out at 4°C and proteins in each 143
fraction were monitored using SDS-PAGE. Column chromatography for protein 144
purification was performed with an ÄKTA system (GE Healthcare Europe GmbH, 145
Germany). The extract was fractionated by ammonium sulfate precipitation (between 60 ~ 146
70 % saturation). The prepared sample was loaded on Q-Sepharose FF column (1.6×10 cm, 147
GE Healthcare, NJ) pre-equilibrated with 20 mM Tris-HCl (pH 7.4), and eluted with 20 148
mM Tris-HCl (pH 7.4) by a linear gradient of KCl from 0 to 0.5 M. The active fractions 149
were collected and concentrated with Amicon Ultra-15 Centrifugal Filter Units (MWCO 10 150
kDa, Millipore Corporation, Bedford, MA), and applied to a Sephacryl S-200 (1.6×60 cm, 151
GE Healthcare) pre-equilibrated with 50 mM sodium phosphate buffer (pH 7.5) containing 152
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
10
0.15 M sodium chloride. The separated active fraction was loaded on a HiTrap phenyl HP 153
(1 ml column volume, GE Healthcare) pre-equilibrated with 50 mM sodium phosphate 154
buffer (pH 7.5) containing 1 M ammonium sulfate. The proteins were eluted using a linear 155
gradient of ammonium sulfate from 1 M to 0 M in 50 mM sodium phosphate buffer (pH 7.5) 156
at 1 ml/min of flow rate. The active fractions were pooled and concentrated with an 157
Amicon Ultra-4 Centrifugal Filter Unit (MWCO 10 kDa, Millipore Corporation). The 158
obtained active fraction was applied to a Superdex S-200 column (1.0×30 cm, GE 159
Healthcare) pre-equilibrated with 50 mM sodium phosphate buffer (pH 7.5) containing 0.15 160
M sodium chloride. The final active fraction was separated with native-gel (4-16% 161
NativePAGE Novex Bis-Tris, Invitrogen Korea, Seoul, Republic of Korea) electrophoresis. 162
In the analysis of the native-gel electrophoresis, anode buffer (NativePAGE Running 163
Buffer, Invitrogen Korea) and cathode buffer (NativePAGE Running Buffer and 164
NativePAGE Cathode Additive, Invitrogen Korea) were used. The NativePAGE cathode 165
additive contained 0.002% Coomassie G-250. After staining the native-gel with cathode 166
buffer, the stained bands were sliced and the sliced gels were reacted to select the active 167
protein band. The active band was sliced and crushed into small pieces, which were 168
subjected to load samples onto SDS-PAGE (12%). 169
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
11
170
Analysis of peptide sequences from isolated proteins 171
To determine an N-terminal amino acid sequence, a protein band on a 12% SDS-PAGE was 172
transferred to a polyvinylidene fluoride (PVDF) membrane. As two bands (Fig. S2) were 173
appeared on the SDS-PAGE with the final sample of the purified enzyme, both bands were 174
used for N-terminal sequencing using automated Edman degradation with a Procise 492 175
cLC protein sequencer (Applied Biosystems, Foster City, CA) at the Korea Basic Science 176
Institute (Seoul, Republic of Korea). For internal peptide sequencing, the previous two 177
protein bands were isolated from the SDS-PAGE and digested with sequencing grade 178
trypsin (Promega, WI) to obtain tryptic fragments for mass analysis. The peptide sequences 179
of tryptic fragments were determined by LTQ-Orbitrap (Thermo Electron Corp., San Jose, 180
CA) with nano-spray source in positive-ion mode. The spray tip for the nano-spray was 181
made using the method of Gatlin et al (11) with a P-2000 laser puller (Shutter Instrument, 182
Novato, CA). The tryptic digested sample was loaded into XDB-C18 resin with 5 μm 183
diameter (Agilent, Palo Alto, CA) packed capillary spray tip using a high pressure chamber 184
under the pressure of 1 MPa of nitrogen gas. The loaded sample was eluted using a 5 ~ 100% 185
linear gradient with ACN at the flow rate of 0.3 μl/min. The obtained mass spectrum was 186
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
12
analyzed using a de novo sequencing program, PEAKS 4.5 (Bioinformatics Solutions Inc., 187
Waterloo, Canada). 188
189
Analysis of structural genes 190
Degenerate primers were designed based on the N-terminal sequence and the internal 191
peptide sequences shown in Table S1 in the Supporting Information. The genomic DNA of 192
screened microorganism was prepared using G-spin Genomic DNA Extraction Kit 193
(iNtRON, Seongnam-si, Gyeonggi-do, Republic of Korea). First PCR was performed with 194
the degenerate primers and genomic DNA of the screened microorganism using Taq 195
polymerase (Cosmo co. Ltd, Seoul, Republic of Korea). Obtained PCR products were 196
cloned in pGEM-T Vector (Promega, WI) for the analysis of gene sequence. From the 197
sequencing results, partial sequences of a structural gene were obtained. To obtain entire 198
structural gene sequence, the inverse PCR method was used. The genomic DNA was 199
digested by HindIII restriction enzyme (Koschem, Seoul, Republic of Korea) and fragments 200
were self-ligated using T4 DNA ligase (New England BioLabs, Ipswich, MA). Hind III 201
cleavage site is located in the C-terminal (1,294 bp - 1,299 bp) of the obtained partial 202
sequence. Inverse PCR reaction was performed on the outward direction of the obtained 203
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
13
partial sequence of structural gene using the cyclized genomic DNA library and two 204
primers (5’- CTGCATGACGTCTGCTGCCTGTGTA - 3’; forward primers, 1581 bp – 205
1605 bp, 5’- CACCATGTCTTCACGCATATCGAGT - 3’; backward primers, 1368 bp – 206
1392 bp) which bound to the C-terminal region of the obtained partial sequence. (Fig. S3) 207
208
Cloning and expression of recombinant proteins 209
A coding region of the large subunit was amplified by PCR using 5’ -210
ATATATGGATCCGATGGCGAATAATCATTACGACGCGA - 3’ (forward primer, 211
underlining indicates a restriction site), and 5’ - 212
ATATATGTCGACTTACAGATTTCCCTTCTTGAGCTCT - 3’ (backward primer). For 213
small subunit, primers 5’- ATATATCATATGCTGGATAAAGCCGCTGCGGCAAGGC - 3’ 214
(forward) and 5’- ATATATCTCGAGTCAGGCTGTGCCCCAAGCGGGCGTA - 3’ 215
(backward) were used to amplify its coding gene. The PCR product of the large subunit was 216
digested with BamHI and SalI, and the PCR product of the small subunit was digested with 217
NdeI and XhoI. The two digested PCR products were cloned into multiple cloning sites of 218
isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible expression vector pETDuet-1 (EMD 219
Bioscience, Darmstadt, Germany) which has resistance to ampicillin antibiotic. 220
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
14
Additionally, large subunit gene was cloned alone in pET28b. The large subunit gene was 221
amplified by PCR for cloning in pET28b using 5’- 222
ATATATCCATGGCGAATAATCATTACGACGCGA-3’ (forward) and 5’- 223
ATATATGTCGACTTACAGATTTCCCTTCTTGAGCTCT-3’ (backward). Recombinant 224
pET28b carrying large subunit gene was introduced into Escherichia coli BW25113 (DE3) 225
which has already been transformed with pBAD:groESL plasmid (donated from Prof. Sun-226
Gu Lee, Pusan National University) (24). Transformants of E. coli BW25113 (DE3) were 227
grown in LB broth containing 50 μg/ml of kanamycin, 100 μg/ml of ampicillin and 1 mM 228
of L-arabinose from the beginning of the culture. pETDuet-1 plasmid carrying two genes 229
of large subunit and small subunit was introduced into E. coli Rosetta-gami 2 (DE3, pLysS, 230
EMD Bioscience, Darmstadt, Germany), and the transformant was grown in LB broth 231
containing 100 μg/ml of ampicilin at 37°C. For overexpression of proteins, IPTG was 232
added to be the final 0.5 mM for both transformants of E. coli BW25113 and E. coli 233
Rosetta-gami 2 when the OD600 reached 0.4 ~ 0.6. Cells were further incubated at 20°C for 234
12 hr. The cells were harvested by centrifugation at 7,000 g for 15 min at 4°C. The cell 235
pellets were washed with PBS, and were resuspended in 5 ml, 50 mM Tris-HCl buffer (pH 236
7.4) containing 1 mM PMSF and 1 mM DTT. The crude extract obtained by ultrasonic 237
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
15
disruption and cell debris was removed by centrifugation at 14,000 g for 30 min at 4°C. An 238
expressed large subunit was purified from the crude extract by Ni-NTA affinity purification 239
method (QIAGEN Korea, Seoul, Republic of Korea). 240
241
Analysis of deglycosylation mechanism 242
The first reaction of a purified recombinant enzyme was performed in 1 ml of 50 mM 243
sodium phosphate buffer (pH 6.5) containing 250 µM CK at 55°C for 90 min. The reaction 244
mixture was extracted with 1 ml ethyl acetate and the extracted sample was evaporated 245
using a vacuum concentrator. Dried samples were dissolved in ethanol. Oxidized CK in 246
ethanol was used as a substrate for the second reaction. The second reaction was performed 247
in 1 ml of 50 mM sodium phosphate buffer (pH 8.0) containing oxidized CK for 12 hr. 248
Reactions were performed with and without purified enzyme, respectively. The second 249
reaction samples were extracted and dried by the method used in the first reaction. After the 250
reaction termination by addition of 1 ml of ethyl acetate, the reaction mixture was analyzed 251
using HPLC. 252
253
Characterization of recombinant enzyme 254
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
16
To determine optimum reaction pH, an initial enzyme reaction rate was measured by 255
analyzing the amount of oxidized CK in buffers with various pH; pH 3.5 ~ 5.5 by 50 mM 256
citrate buffer, pH 5.5 ~ 8.5 by 50 mM sodium phosphate buffer and pH 8.5 ~ 10.5 by 50 257
mM borate buffer. For the determination of metal ion effects, divalent metal ions were 258
added as a chloride salt at 10 mM concentration in the reaction mixture (Ca2+ , Mn2+, Mg2+, 259
Fe2+, Ni2+, Co2+ and Zn2+). The optimum temperature was investigated by reactions at 260
various temperatures ranging from 20°C to 65°C. Substrate specificity was investigated 261
using various ginsenosides and glycosides. Kinetic constants were obtained from the 262
oxidation reactions performed by varying the concentrations of CK. 263
To identify an existence of FAD in the enzyme, the purified glycoside oxidoreductase was 264
denatured by boiling for 10 min to release bound FAD. After the denatured protein was 265
removed by centrifugation at 11,000 g, light absorbance of the supernatant was measured at 266
450 nm using UV/Vis spectrometer (Hewlett Packard 8453, Agilent Technologies, Foster 267
City, CA). The extinction coefficient of FAD at 450 nm (11,300 M-1 cm-1) (25) was used to 268
determine the concentration of the FAD in solution. 269
270
Results and Discussion 271
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
17
Screening and identification of microorganism and responsible enzyme for 272
deglycosylation of CK 273
After several rounds of enrichment culture, a strain with CK deglycosylation activity was 274
found. The whole cell reaction using the screened microorganism yielded mass peaks of 275
Na+ adduct of PPD(S) at m/z 483.547 Da and K+ adduct of PPD(S) at m/z 499.500 Da, 276
which were distinctively different peaks from the ones found in non-active cells (Fig. 2). 277
16S rRNA sequencing of the screened microorganism showed 99% identity with the partial 278
16S rRNA gene of Rhizobium sp. R-31762 (99.2% identity, 1,073/1,081). Therefore, this 279
microorganism is named as Rhizobium sp. GIN611. The purified enzyme from R. sp. 280
GIN611 cell, using FPLC, showed the same deglycosylation activity for CK. The final 281
active fraction showed two major bands at about 65 kDa and 20 kDa positions on 12% 282
SDS-PAGE gel (Fig. S1), whereas the same sample showed a single peak at the estimated 283
size of 85 kDa in gel permeation chromatography. The single band in the native PAGE gel 284
analysis was split into two protein bands on SDS-PAGE (Fig. S2), suggesting that it is a 285
complex of two proteins. The two subunits were inseparable when heat-treated at 95°C for 286
10 min without DTT, but only separable when treated with final 100 mM DTT solution, 287
suggesting that the two subunits are covalently linked with disulfide bonds. However, the 288
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
18
formation of disulfide bonds in the cytoplasm is an exceedingly rare event (4). Therefore, 289
although it is not clear whether disulfide bond is formed in vivo or during the purification 290
step, existence of the disulfide bond between two proteins is confirmed by the experiment. 291
Formation of disulfide bond between two proteins indicates that large subunit and small 292
subunit interact, and that two cysteine residues exist at the interface. 293
To clone the enzyme, the N-terminal sequences of the large subunit and small subunit were 294
identified as ANNHYDAIVV and LDKAA, respectively. Their internal peptide sequences 295
were obtained using mass spectrometry (see Table S1). BLAST search using the N-terminal 296
peptide sequence (ANNHYDAIVV) of the large subunit predicted that it is 100% identical 297
to the N-terminal fragment of glucose-methanol-choline oxidoreductase (gi:4174446) from 298
Pseudoalteromonas atlantica T6c, and one of the internal peptide sequence 299
(AADFAVSELKK) is 90% identical to the sequence of the C-terminal region of 300
oxidoreductase (gi: 8724182) from Sphingobacterium spiritivorum ATCC 33861. However, 301
the BLAST search with N-terminal and two internal peptide sequences of the small subunit 302
did not call any protein sequences with significant identity. 303
304
Identification of coding sequences and protein function 305
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
19
Degenerate primers in the supplementary Table S1 were used for PCR to find the coding 306
sequence of large subunit of the purified enzyme. When the forward and reverse 307
degenerative primers based on the N-terminal peptide (ANNHYDAIVV) and the internal 308
peptide (AADFAVSELKK), respectively, were used to perform PCR using genomic DNA 309
of R. sp. GIN611, a 1,674 bp DNA fragment was obtained. The protein sequence deduced 310
from the PCR product matched with 13 peptide sequences obtained from de novo 311
sequencing by LTQ-MS/MS (Fig. S3). However, the whole fragment lacked the 312
information of the C-terminal region of the large subunit, including a stop codon of the 313
transcript. Self-ligated genomic DNA library of R. sp. GIN611 was generated using Hind III, 314
and the library was subjected to inverse PCR to amplify the outward gene sequence of the 315
obtained partial sequence (see Methods). A 1 kb PCR product was obtained and sequenced. 316
The remaining C-terminal region DNA sequence of the large subunit including a TAA stop 317
codon was identified. Interestingly, the sequence from the above 1 kb PCR product, 318
including the C-terminal of the large subunit protein, also contained the sequence of the 319
small subunit protein. A comparison among the deduced protein sequence of the small 320
subunit protein and N-terminal and two other internal sequences obtained from de novo 321
sequencing of the small subunit protein agreed well (Fig. S3 and Table S1). The analysis 322
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
20
revealed that the two subunits of the purified deglycosylating enzyme were encoded by an 323
operon (2243 bp) in R. sp. GIN611. The full DNA and amino acid sequences are shown in 324
Fig. S3. The large subunit protein consisted of 561 amino acid residues (1,686 bp) with 325
theoretical pI of 5.86 and molecular weight of 63,379 Da. The small subunit protein 326
consisted of 185 amino acid residues (558 bp) with theoretical pI of 5.17 and molecular 327
weight of 20,368 Da. The start codon (ATG) of the small subunit was overlapped with the 328
last nucleotide of the stop codon (TAA) of the large subunit. 329
The complete amino acid sequences of the large subunit and small subunit proteins deduced 330
from DNA sequence are shown in Fig. S3. Two protein sequences were submitted in NCBI 331
GenBank. The Large protein accession number is JN683624 and small protein accession 332
number is JN683625. The large subunit protein of R. sp. GIN611 showed the highest 333
identity (93%) to oxidoreductase (gi; 1136251) from Agrobacterium tumefaciens str. C58. A 334
glucose-methanol-choline (GMC) oxidoreductase (gi number 6495394) from 335
Stenotrophomonas maltophilia K279a was the next (75%). The small subunit showed the 336
highest identity (72%) to a hypothetical protein (gi; 1136252) from Agrobacterium 337
tumefaciens str. C58. and the second high identity hit was putative transmembrane protein 338
(44%) (gi number 6395363) from Stenotrophomonas maltophilia K279a. According to 339
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
21
Conserved Domain Database (CDD) analysis (27) in NCBI sequence analysis tool box, the 340
large subunit protein is predicted to have a FAD binding motif (i.e. ‘GSGISG’ ) in its N-341
terminal region which is exactly matched to a known FAD binding motif of ‘GXGXXG’ 342
(36). In conclusion, the large subunit protein appears to be a putative FAD-dependent 343
protein. 344
345
Over-expression and characterization of the two subunit proteins in E. coli 346
To determine which subunit has the deglycosylation activity, each subunit was cloned and 347
over-expressed separately in E. coli Rosetta-gami 2 (DE3, pLysS). The small subunit was 348
over-expressed in soluble form, but it did not show any deglycosylation activity for CK. 349
The large subunit protein could be over-expressed, but as insoluble form in spite of the use 350
of GroEL/GroES chaperone system (Fig. S4 B). It was later known that the large subunit 351
protein can be over-expressed in soluble form, but only when the small subunit is co-352
expressed. However, a purified recombinant large subunit protein alone (Fig. S4. D) 353
exhibits the same deglycosylation activity for CK. When the two proteins were co-354
expressed using one vector in the same E. coli host strain, the His6-tagged large subunit 355
protein purified with Ni-agarose column did not appear to be accompanied by the small 356
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
22
subunit protein, suggesting that the recombinant large subunit protein from E. coli does not 357
covalently bind to the recombinant small subunit (Fig. S2 and Fig. S4 C and D). This result 358
indicates that the small subunit protein is not essential for the deglycosylation activity, but 359
required to make the large subunit protein soluble and active. 360
The His6-tagged recombinant large subunit protein showed distinctive yellow color like the 361
purified enzyme complex from R. sp. GIN611. After enough amounts of the recombinant 362
large subunit protein were prepared, a presence of FAD in the protein was analyzed by 363
boiling method and UV spectrometry. After boiling the protein solution and subsequent 364
removal of aggregate debris by centrifugation, the resulting supernatant yielded yellow 365
color, suggesting that the FAD cofactor was not covalently bound to the enzyme. Maximum 366
absorption spectra of the extracted cofactor were obtained at from 375 to 445 nm, 367
corresponding to the characteristic absorption peaks of FAD (Fig. S7). The FAD-368
oxidoreductase stoichiometry was determined to be 1:1.9, suggesting that the 369
oxidoreductase contained 1 molecule of FAD per monomer oxidoreductase; when it was 370
considered that sample contained some contaminated proteins. 371
372
Analysis of the deglycosylation reaction mechanism 373
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
23
Identifying the purified protein as an oxidoreductase enzyme with FAD binding domain 374
rather than glucosidase was very intriguing and unexpected. One interpretation of this result 375
is a possible mis-annotation of putative glucosidase, and the other possibility is that 376
unknown oxidoreductase is involved in this deglycosylation of ginsenoside. The reaction 377
mixture was analyzed by HPLC to find any unexpected reaction intermediates, and one 378
such peak was detected at 5.5 min (RT) as shown in Fig. 3A. The resulting hydrolyzed 379
PPD(S) was eluted at 15 min under the same condition. The sample from 5.5 min peak was 380
collected and analyzed by MALDI-TOF. It had a molecular mass of 643.348, which was 2 381
Da smaller than the molecular mass of the substrate, CK (Fig. 3B). The same molecular 382
mass was also found from the reaction mixture with whole cell pellet (Fig. 2), suggesting 383
that unknown function of the purified deglycosylating enzyme always lead to the loss of 2 384
Da from the molecular weight of CK in the reaction mixture. In addition, the time course 385
HPLC analysis of the reaction mixture showed that PPD(S) production was followed by the 386
initial accumulation of the unknown peak with the 2 Da less molecular weight (Fig. 3A). 387
One hypothesis drawn from this result was that the oxidation of CK is not a side reaction 388
product catalyzed by this enzyme, but a main product with a loss of two protons from the 389
glucose moiety in CK. After this oxidation, a subsequent deglycosylation reaction is 390
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
24
occurred. To confirm this hypothesis, the other substrate F2 was subjected to the same 391
reaction using the same purified recombinant enzyme. MALDI-TOF analysis showed that 392
the purified recombinant enzyme had the same deglycosylating activity for F2 resulting in 393
PPD(S) (Fig. S5). In Fig. 5, the two peaks appeared at 25 min and 28 min of RT had a 394
molecular masses of 805.611 and 803.498, corresponding to [F2-2H+Na]+ and [F2-395
4H+Na]+, respectively, suggesting that, like the case of CK reaction, the losses of two 396
protons would take place at two different glucose positions in F2. Again, no other products 397
indicating any mass losses from the product PPD(S) were detected. These results led us to a 398
conclusion that the oxidoreductase primarily catalyzes oxidation of glucose moieties of CK 399
and F2, and the subsequent deglycosylation reaction took places in the oxidized 400
intermediates following the unknown mechanism. The time profile analysis of the reaction 401
mixtures in Fig. 3 and Fig. 4 also showed that the non-deglycosylated oxidized CK and F2 402
accumulated in the beginning, and decreased with time. The final product PPD(S) gradually 403
increased in both cases, suggesting that the oxidation reaction was much faster than the 404
deglycosylation reaction. To investigate the deglycosylation reaction mechanism, the 405
oxidized CK prepared by extraction from the first reaction was used for the second reaction. 406
As shown in the Fig. 5, after the 12 hr reaction, the deglycosylation reaction took place 407
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
25
even without the enzyme, indicating that deglycosylation reaction, i.e. the production of 408
PPD(S) from the oxidized form of CK, is spontaneous. 409
410
Characterization of FAD-dependent glycoside oxidoreductase from R. sp. GIN611 411
The recombinant FAD-dependent glycoside oxidoreductase showed the highest activity at 412
pH 6.5 and 55°C. Addition of Ca2+ ion resulted in slightly higher enzyme activity than that 413
in the absence of the metal ion (Fig. S6). The optimized condition was used for further 414
characterization of the FAD-dependent glycoside oxidoreductase. It had broad specificities 415
toward glycosides having various aglycons including isoflavone like daidzin and flavonoids 416
such as camelliaside A, camelliaside B and icariin. It also showed broad specificities toward 417
sugar moieties such as glucose, galactose and xylose (Fig. S8). When analyzed by MALDI-418
TOF, all the reaction mixtures with different substrates contained corresponding oxidized 419
intermediates and deglycosylated products (see Table 1 and Table S2), suggesting that this 420
oxidoreductase had broad specificities toward glycone and aglycon. The enzyme reaction 421
rate calculated by measuring the concentrations of oxidized CK was rather low with kcat of 422
2.71 sec-1, KM of 0.11 mM, and kcat/KM of 2.4 × 104 M-1sec-1 . The yield of the products is 423
over 88 % for 30 min at 2 mM CK. And CK converted oxidized CK completely within 1 h. 424
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
26
The oxidized CK was fully deglycosylated within 12 hr. 425
426
Conclusion 427
In this paper, we report a novel FAD-dependent glycoside oxidoreductase from R. sp. 428
GIN611, as one of the interesting biocatalysts for the oxidation of ginsenoside which results 429
in deglycosylation. The CK deglycosylation enzyme shows its deglycosylating activity 430
through the oxidation of the glucose moiety of ginsenosides, and the subsequent 431
deglycosylation reaction occurs spontaneously on its own (Fig. 6). The reaction mechanism 432
appears to follow a double bond generation in the glucose moiety of CK deducted from the 433
molecular mass analysis using mass spectrometry. In addition, the glycoside oxidoreductase 434
is active towards other glycone units bound to ginsenoside Rb3 (-Xyl), camelliaside A (-Gal) 435
and camelliaside B (-Xyl), suggesting that its deglycosylation activity is not glycone-436
specific like many other glycosidases. Screened glycoside oxidoreductase has following 437
characteristics. This deglycosylation mechanism is quite different from that of common 438
glycosidases. In the BLAST search, glycoside oxidoreductase showed high sequence 439
identities with FAD-dependent glucose-methanol-choline oxidoreductase family. The 440
glycoside oxidoreductase is consisted of two subunits: one large (63.5 KDa) and one small 441
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
27
(17.5 KDa) subunits. The small subunit protein was found to help the soluble expression of 442
the glycoside oxidase. From the above results, it could be verified that the oxidoreductase is 443
responsible for the CK deglycosylation reaction, rather than a mis-annotation of a 444
glucosidase in enzyme data base. 445
Until now, it is well known that the deglycosylation of glycosides is mediated by the 446
traditional β-glucosidase mechanism (30). In this research, we first demonstrated that the 447
deglycosylation of ginsenoside can be occurred through the oxidation of glucose by 448
oxidoreductase and subsequent spontaneous deglycosylation. Furthermore, because 449
glycoside oxidoreductase of R. sp. GIN611 has broad substrate specificity for various kinds 450
of aglycon and glycone, this enzyme appears to be quite a promising biocatalyst for 451
preparation of aglycons from ginsenosides as well as various glyco-conjugate natural 452
compounds. 453
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
28
Acknowledgment 454
This work was supported by Seoul R&BD Program (KU080657M0209721) and the 455
National Research Foundation of Korea (NRF) grant funded by the Korea government 456
(MEST) (No. 20090083035), and World Class University (WCU) program through the 457
Korea Science and Engineering Foundation funded by the Ministry of Education, Science 458
and Technology (R32-2008-000-10213-0) 459
460
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
29
References 461
1. Andreea Neculai, M., D. Ivanov, and M. A. Bernards. 2009. Partial purification 462
and characterization of three ginsenoside-metabolizing beta-glucosidases from Pythium 463
irregulare. Phytochemistry 70:1948-57. 464
2. Bae, E. A., M. J. Han, M. K. Choo, S. Y. Park, and D. H. Kim. 2002. 465
Metabolism of 20(S)- and 20(R)-ginsenoside Rg3 by human intestinal bacteria and its 466
relation to in vitro biological activities. Biol Pharm Bull 25:58-63. 467
3. Bae, E. A., J. E. Shin, and D. H. Kim. 2005. Metabolism of ginsenoside Re by 468
human intestinal microflora and its estrogenic effect. Biol Pharm Bull 28:1903-1908. 469
4. Bessette, P. H., F. Aslund, J. Beckwith, and G. Georgiou. 1999. Efficient folding 470
of proteins with multiple disulfide bonds in the Escherichia coli cytoplasm. Proc Natl Acad 471
Sci U S A 96:13703-8. 472
5. Cameron, R. G., J. A. Manthey, R. A. Baker, and K. Grohmann. 2001. 473
Purification and characterization of a beta-glucosidase from Citrus sinensis var. Valencia 474
fruit tissue. J Agric Food Chem 49:4457-62. 475
6. Chen, C. F., W. F. Chiou, and J. T. Zhang. 2008. Comparison of the 476
pharmacological effects of Panax ginseng and Panax quinquefolium. Acta Pharmacol Sin 477
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
30
29:1103-8. 478
7. Chen, G. T., M. Yang, Y. Song, Z. Q. Lu, J. Q. Zhang, H. L. Huang, L. J. Wu, 479
and D. A. Guo. 2008. Microbial transformation of ginsenoside Rb(1) by Acremonium 480
strictum. Appl Microbiol Biotechnol 77:1345-50. 481
8. Cheng, L. Q., J. R. Na, M. H. Bang, M. K. Kim, and D. C. Yang. 2008. 482
Conversion of major ginsenoside Rb1 to 20(S)-ginsenoside Rg3 by Microbacterium sp. 483
GS514. Phytochemistry 69:218-24. 484
9. Chi, H., D. H. Kim, and G. E. Ji. 2005. Transformation of ginsenosides Rb2 and 485
Rc from Panax ginseng by food microorganisms. Biol Pharm Bull 28:2102-5. 486
10. Choi, K., and C. Choi. 2009. Proapoptotic Ginsenosides Compound K and Rh 487
Enhance Fas-induced Cell Death of Human Astrocytoma Cells Through Distinct Apoptotic 488
Signaling Pathways. Cancer Res Treat 41:36-44. 489
11. Gatlin, C. L., G. R. Kleemann, L. G. Hays, A. J. Link, and J. R. Yates, 3rd. 490
1998. Protein identification at the low femtomole level from silver-stained gels using a new 491
fritless electrospray interface for liquid chromatography-microspray and nanospray mass 492
spectrometry. Anal Biochem 263:93-101. 493
12. Han, B. H., M. H. Park, Y. N. Han, L. K. Woo, U. Sankawa, S. Yahara, and O. 494
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
31
Tanaka. 1982. Degradation of ginseng saponins under mild acidic conditions. Planta Med 495
44:146-9. 496
13. Han, Y., B. Sun, X. Hu, H. Zhang, B. Jiang, M. I. Spranger, and Y. Zhao. 2007. 497
Transformation of bioactive compounds by Fusarium sacchari fungus isolated from the 498
soil-cultivated ginseng. J Agric Food Chem 55:9373-9. 499
14. Hasegawa, H. 2004. Proof of the mysterious efficacy of ginseng: basic and clinical 500
trials: metabolic activation of ginsenoside: deglycosylation by intestinal bacteria and 501
esterification with fatty acid. J Pharmacol Sci 95:153-7. 502
15. Hasegawa, H., J. H. Sung, and Y. Benno. 1997. Role of human intestinal 503
Prevotella oris in hydrolyzing ginseng saponins. Planta Med 63:436-40. 504
16. Hasegawa, H., J. H. Sung, S. Matsumiya, and M. Uchiyama. 1996. Main 505
ginseng saponin metabolites formed by intestinal bacteria. Planta Med 62:453-7. 506
17. Kim, D. H., J. S. Jung, Y. S. Moon, J. H. Sung, H. W. Suh, Y. H. Kim, and D. K. 507
Song. 2003. Inhibition of intracerebroventricular injection stress-induced plasma 508
corticosterone levels by intracerebroventricularly administered compound K, a ginseng 509
saponin metabolite, in mice. Biol Pharm Bull 26:1035-8. 510
18. Kim do, Y., M. W. Park, H. D. Yuan, H. J. Lee, S. H. Kim, and S. H. Chung. 511
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
32
2009. Compound K induces apoptosis via CAMK-IV/AMPK pathways in HT-29 colon 512
cancer cells. J Agric Food Chem 57:10573-8. 513
19. Kim, M. K., J. W. Lee, K. Y. Lee, and D. C. Yang. 2005. Microbial conversion of 514
major ginsenoside rb(1) to pharmaceutically active minor ginsenoside rd. J Microbiol 515
43:456-62. 516
20. Kim, S., B. Y. Kang, S. Y. Cho, D. S. Sung, H. K. Chang, M. H. Yeom, D. H. 517
Kim, Y. C. Sim, and Y. S. Lee. 2004. Compound K induces expression of hyaluronan 518
synthase 2 gene in transformed human keratinocytes and increases hyaluronan in hairless 519
mouse skin. Biochem Biophys Res Commun 316:348-55. 520
21. Kitagawa, S., T. Takahashi, T. Nabekura, E. Tachikawa, and H. Hasegawa. 521
2007. Inhibitory effects of ginsenosides and their hydrolyzed metabolites on daunorubicin 522
transport in KB-C2 cells. Biol Pharm Bull 30:1979-81. 523
22. Ko, S. R., K. J. Choi, K. Suzuki, and Y. Suzuki. 2003. Enzymatic preparation of 524
ginsenosides Rg2, Rh1, and F1. Chem Pharm Bull (Tokyo) 51:404-8. 525
23. Ko, S. R., Y. Suzuki, K. Suzuki, K. J. Choi, and B. G. Cho. 2007. Marked 526
production of ginsenosides Rd, F2, Rg3, and compound K by enzymatic method. Chem 527
Pharm Bull (Tokyo) 55:1522-7. 528
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
33
24. Lee, J. H., M. A. Heo, J. H. Seo, J. H. Kim, B. G. Kim, and S. G. Lee. 2008. 529
Improving the growth rate of Escherichia coli DH5alpha at low temperature through 530
engineering of GroEL/S chaperone system. Biotechnol Bioeng 99:515-20. 531
25. Lewis, J. A., and J. C. Escalante-Semerena. 2006. The FAD-dependent 532
tricarballylate dehydrogenase (TcuA) enzyme of Salmonella enterica converts 533
tricarballylate into cis-aconitate. J Bacteriol 188:5479-86. 534
26. Liu, T. G., Y. Huang, D. D. Cui, X. B. Huang, S. H. Mao, L. L. Ji, H. B. Song, 535
and C. Yi. 2009. Inhibitory effect of ginsenoside Rg3 combined with gemcitabine on 536
angiogenesis and growth of lung cancer in mice. BMC Cancer 9:250. 537
27. Marchler-Bauer, A., J. B. Anderson, F. Chitsaz, M. K. Derbyshire, C. 538
DeWeese-Scott, J. H. Fong, L. Y. Geer, R. C. Geer, N. R. Gonzales, M. Gwadz, S. He, D. 539
I. Hurwitz, J. D. Jackson, Z. Ke, C. J. Lanczycki, C. A. Liebert, C. Liu, F. Lu, S. Lu, G. 540
H. Marchler, M. Mullokandov, J. S. Song, A. Tasneem, N. Thanki, R. A. Yamashita, D. 541
Zhang, N. Zhang, and S. H. Bryant. 2009. CDD: specific functional annotation with the 542
Conserved Domain Database. Nucleic Acids Res 37:D205-10. 543
28. Ota, T., M. Maeda, and S. Odashima. 1991. Mechanism of action of ginsenoside 544
Rh2: uptake and metabolism of ginsenoside Rh2 by cultured B16 melanoma cells. J Pharm 545
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
34
Sci 80:1141-6. 546
29. Park, S. Y., E. A. Bae, J. H. Sung, S. K. Lee, and D. H. Kim. 2001. Purification 547
and characterization of ginsenoside Rb1-metabolizing beta-glucosidase from 548
Fusobacterium K-60, a human intestinal anaerobic bacterium. Biosci Biotechnol Biochem 549
65:1163-1169. 550
30. Rye, C. S., and S. G. Withers. 2000. Glycosidase mechanisms. Curr Opin Chem 551
Biol 4:573-80. 552
31. Shibata, S. 2001. Chemistry and cancer preventing activities of ginseng saponins 553
and some related triterpenoid compounds. J Korean Med Sci 16 Suppl:S28-37. 554
32. Shin, H. Y., S. Y. Park, J. H. Sung, and D. H. Kim. 2003. Purification and 555
characterization of alpha-L-arabinopyranosidase and alpha-L-arabinofuranosidase from 556
Bifidobacterium breve K-110, a human intestinal anaerobic bacterium metabolizing 557
ginsenoside Rb2 and Rc. Appl Environ Microbiol 69:7116-23. 558
33. Son, J. W., H. J. Kim, and D. K. Oh. 2008. Ginsenoside Rd production from the 559
major ginsenoside Rb(1) by beta-glucosidase from Thermus caldophilus. Biotechnol Lett 560
30:713-6. 561
34. Tawab, M. A., U. Bahr, M. Karas, M. Wurglics, and M. Schubert-Zsilavecz. 562
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
35
2003. Degradation of ginsenosides in humans after oral administration. Drug Metab Dispos 563
31:1065-71. 564
35. Wang, W., Y. Zhao, E. R. Rayburn, D. L. Hill, H. Wang, and R. Zhang. 2007. 565
In vitro anti-cancer activity and structure-activity relationships of natural products isolated 566
from fruits of Panax ginseng. Cancer Chemother Pharmacol 59:589-601. 567
36. Wierenga, R. K., P. Terpstra, and W. G. Hol. 1986. Prediction of the occurrence 568
of the ADP-binding beta alpha beta-fold in proteins, using an amino acid sequence 569
fingerprint. J Mol Biol 187:101-7. 570
37. Yan, Q., X. W. Zhou, W. Zhou, X. W. Li, M. Q. Feng, and P. Zhou. 2008. 571
Purification and properties of a novel beta-glucosidase, hydrolyzing ginsenoside Rb1 to CK, 572
from Paecilomyces Bainier. J Microbiol Biotechnol 18:1081-9. 573
38. Ye, L., C. Q. Zhou, W. Zhou, P. Zhou, D. F. Chen, X. H. Liu, X. L. Shi, and M. 574
Q. Feng. 2010. Biotransformation of ginsenoside Rb1 to ginsenoside Rd by highly 575
substrate-tolerant Paecilomyces bainier 229-7. Bioresour Technol. 576
39. Yim, J. S., Y. S. Kim, S. K. Moon, K. H. Cho, H. S. Bae, J. J. Kim, E. K. Park, 577
and D. H. Kim. 2004. Metabolic activities of ginsenoside Rb1, baicalin, glycyrrhizin and 578
geniposide to their bioactive compounds by human intestinal microflora. Biol Pharm Bull 579
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
36
27:1580-3. 580
40. Yu, H., C. Zhang, M. Lu, F. Sun, Y. Fu, and F. Jin. 2007. Purification and 581
characterization of new special ginsenosidase hydrolyzing multi-glycisides of 582
protopanaxadiol ginsenosides, ginsenosidase type I. Chem Pharm Bull (Tokyo) 55:231-5. 583
41. Zhang, C., H. Yu, Y. Bao, L. An, and F. Jin. 2001. Purification and 584
characterization of ginsenoside-beta-glucosidase from ginseng. Chem Pharm Bull (Tokyo) 585
49:795-798. 586
587
588
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
37
Figure Legends 589
590
Fig. 1. Target reaction scheme of ginsenoside Compound K (CK). 591
592
Fig. 2. Analysis of CK deglycosylation. A. MALDI-TOF spectrum of active microorganism. 593
The peaks at m/z = 483.547 and 643.432 indicate the sodium ion adduct [PPD(S)+Na]+ and 594
[CK-2H+Na]+ peaks, respectively. B. The spectrum of the reaction mixture with non-active 595
microorganism. 645.553 is the sodium ion adduct peak of substrate CK. 596
597
Fig. 3. The HPLC reaction analysis of glycoside oxidoreductase with purified recombinant 598
large subunit. A. line 1 is authentic CK (RT; 4.7), line 2 is authentic PPD(S) (RT; 15min), 599
line 3 is the analysis of 3 hr reaction sample, and line 4 is analysis of 12 hr reaction sample. 600
B. MALDI-MS spectrum of RT 5.5 min peak in HPLC. The asterisk and inverted triangle 601
indicate the oxidized CK and PPD(S), respectively. 602
603
Fig. 4. A. HPLC analysis of F2 reaction. Dashed circle indicates the peaks of oxidized CK 604
and oxidized Rh2, B. MALDI-MS result of peaks at 25 min and 28 min of RT. The sodium 605
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
38
ion adduct [F2-2H+Na]+ and [F2-4H+Na]+ peaks at m/z = 805.611 and 803.498 at 25 min 606
and 28 min RT, respectively, indicate the oxidation of one glucose moiety in F2 and 607
subsequent oxidation of the two glucose moiety in F2, respectively. Molecular mass of F2 608
is 784.48 ([F2+Na]+ = 807.487) 609
610
Fig. 5. The reaction results using oxidized CK. Line 1 is the reaction without the 611
oxidoreductase enzyme for 0 hr reaction (control), line 2 is the analysis result of the 612
reaction mixture with the enzyme for 12 hr, line 3 is the analysis result of the reaction 613
mixture without the enzyme for 12 hr. Star and inverted triangle indicate oxidized CK and 614
PPD(S), respectively. 615
616
Fig. 6. The proposed reaction pathway of deglycosylation of CK by glycoside 617
oxidoreductase. 618
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
39
Fig. 1. 619
620
621
622 623
624
625
626
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
40
Fig. 2. 627
628
629
630
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
42
Fig. 3. 634
635
636
637
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
43
Fig. 4. 638
639
640
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
44
Fig. 5. 641
642
643 644
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
45
Fig. 6. 645
646
647
648
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from
46
Table 1. Substrate specificities of glycoside oxidoreductase 649
Substrate Intermediate Final product
Rb1
Oxidized intermediate of ginsenosides
&
Deglycosylated ginsenosides
PPD(S)
Rb2 Compound Y
Rb3 PPD(S)
Rc Mc
F2 Oxidized F1, Oxidized Rh2, Oxidized CK PPD(S)
Rh2 Oxidized Rh2 PPD(S)
CK Oxidized CK PPD(S)
Re Oxidized Re Rg2
F1 Oxidized F1 PPT(S)
Camelliaside A Oxidized camelliaside A 6-O-Rha-Kampferol
Camelliaside B Oxidized camelliaside B 6-O-Rha-Kampferol
Icariin Oxidized icariin Icariside
Daidzin Oxidized Daidzin Daidzein
650
651
on May 7, 2021 by guest
http://aem.asm
.org/D
ownloaded from