Proc. Nall. Acad. Sci. USAVol. 85, pp. 9694-9698, December 1988Immunology

Human T-cell antigen receptor (TCR) 6-chain locus and elementsresponsible for its deletion are within the TCR a-chain locusRICHARD D. HOCKETT*t, JEAN-PIERRE DE VILLARTAYt, KAREN POLLOCK*, DAVID G. POPLACK§,DAVID 1. COHENt, AND STANLEY J. KORSMEYER**Departments of Medicine, Microbiology and Immunology, Howard Hughes Medical Institute, Washington University School of Medicine, Saint Louis, MO63110; and tLaboratory of Chemical Biology, National Institute of Diabetes and Digestive and Kidney Diseases, and tPediatric Branch, National CancerInstitute, Bethesda, MD 20892

Communicated by Emil R. Unanue, August 15, 1988

ABSTRACT Individual T cells express the CD3 molecule inassociation with alternative y8 or ad heterodimeric T-cellreceptors (TCRs). T-cell precursors and occasional y8-expressing T cells in humans possess an unexpected 2.0-kilobase(kb) mRNA in which a tandemly repeated motif, TEA (T earlya), has been spliced to the constant (Ca) region. Long-rangepulsed-field gel mapping as well as molecular cloning showedthat TEA is located immediately 5' to the most upstream joining(J.) segment of the TCR a-chain locus. The TCR 8-chain locusis immediately 5' to TEA, and diversity (Dt,) gene segments, J.,CB, and TEA are linked within 35 kb. The human TCR 8 locusconserves a 12/23-base-pair (bp) spacer paradigm in which Jr1possesses a 12-bp and V;1 a 23-bp spacer, while the Dr segmentshave a 12 bp-D6-23 bp spacer motif. Considerable TCR 8diversity can be generated despite the predominant use ofone Vs8and one .1 segment. Two Dr segments, Dsl and Ds2, are 9 and13 bp long, are frequently recombined as D81-D82, and revealexonucleolytic trimming with extensive N-segment addition. Ay8 clonal T cell possessed an effective VDDJs rearrangement andan intermediate DDJs rearrangement, arguing that the TCR 8locus displays allelic exclusion. Specific rearranging elementsthat delete the 8 locus, 8Rec and qkja, were mapped and foundto separate the 8 locus from the a locus. The 8 locus includingDs]-Ds2-J1-Cs,-TEA was deleted in mature, an-expressing Tcells, whereas Vtl was frequently retained. The location of the6 locus within the a locus may necessitate an exclusive choicebetween 8 or a expression.

Most nature, CD3-bearing peripheral blood T cells have aheterodimeric T-cell antigen receptor (TCR) composed of aand ,B chains (1-4). However, T cells appearing early inthymic ontogeny and dendritic epidermal cells display analternative heterodimeric TCR, consisting of y and 8 chains,in association with the CD3 molecule (5-8). Much is knownabout the genes encoding the a, P, and y chains, and theirTCR products are derived from somatic recombination ofvariable (V), joining (J), and at times diversity (D) genesegments upstream of the constant-region (C) genes found inthese loci (9). Recently, cDNA clones encoding the murineand human 8 subunits have been characterized and aspects ofthe murine 8 genomic region have been elucidated (10-15).To understand the recombination of the human 8 locus, wecharacterized the genomic locus and examined T-cell-typeacute lymphoblastic leukemias (ALLs) as monoclonal ex-pansions of cells at serial stages of thymic development (16).We previously described a 2.0-kilobase (kb) mRNA that

contains C, sequence and is expressed predominantly inearly fetal thymocytes (17). This proved not to contain avariable region, but instead a tandemly repetitive motif wecalled TEA (T early a) spliced to Ca. TEA expression was

diminished in adult thymus, and the TEA genes were fre-quently deleted in mature, af3-expressing T cells. Priorstudies in the mouse indicated that the Cs region was likewisedeleted in mature a/3 T cells (10). These observationsprompted the cloning of the genomic surroundings of TEA,revealing the human TCR 8 locus.$ The 8 germ-line organi-zation displays a DtJ-D82-J8-Cs complex separated from theTCR a locus by 5' and 3' 8-deleting elements.

MATERIALS AND METHODSPulsed-Field Gel Electrophoresis (PFGE). High molecular

weight DNA in agarose cell plugs was prepared and digestedaccording to Smith et al. (18). PFGE was carried out on anorthogonal-field alternating gel electrophoresis (OFAGE)apparatus described by Carle and Olson (19). Molecular sizemarkers consisted of A concatamers and yeast chromosomes(strain AB972). Prior to transfer, gels were soaked in 0.25 MHCI for 30 min. DNA was transferred to nitrocellulose by theammonium acetate procedure (20). Blot hybridization wascarried out in 10% (wt/vol) dextran sulfate/4x SSC/0.8 xDenhardt's solution/herring sperm DNA (20 ,gg/ml)/10 mMTris/40% (vol/vol) formamide at 420C for 8-12 hr. (SSC is0.15 M NaCI/0.015 M sodium citrate, pH 7.0; Denhardt'ssolution is 0.02% polyvinylpyrrolidone/0.02% Ficoll/0.02%bovine serum albumin.) 32P-labeled DNA probes prepared bythe random priming method were used at a concentration of106 cpm/ml (21). Blots were washed twice in 2x SSC/0.1%NaDodSO4 at 250C for 20 min and then twice in 0.1 x SSC/0.1% NaDodSO4 at 540C for 20 min. Multiple gels were runwith varied switch intervals, and at least two cross-hybridization experiments were performed per pair ofprobes, before size estimates were made and fragmentidentities were assigned. Probe washoffs were performedtwice in 0.1% NaDodSO4 at 80'C for 30 min with autoradio-graphic confirmation. All PFGE mapping was done with eryth-roleukemia line K562 and confirmed with a lymphoblastoid cellline.Phage Cloning. All phage isolates were obtained from a

human lung fibroblast genomic library consisting of Mbo Ipartial digestion products cloned in AFIX (Stratagene, SanDiego, CA). Initial screening was done with a 350-base-pair(bp) Fnu4HI-EcoRI TEA probe (17). J,J1 genomic phage wasobtained by screening the library with a partial JC, cDNA.Dr,J genomic phage was obtained by screening with a 1.1-kb

Abbreviations: TCR, T-cell receptor for antigen; ALL, acute lym-phoblastic leukemia; V, variable; D, diversity; J, joining; C, con-stant; TEA, T early a; PFGE, pulsed-field gel electrophoresis;OFAGE, orthogonal-field alternating gel electrophoresis.tTo whom reprint requests should be addressed at: Box 8045,Howard Hughes Medical Institute, Washington University Schoolof Medicine, 660 South Euclid Avenue, Saint Louis, MO 63110.$The sequences reported in this paper are being deposited in theEMBL/GenBank data base (accession no. J04125).

9694

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Aug

ust 8

, 202

0

Proc. Natl. Acad. Sci. USA 85 (1988) 9695

Pst 1-HindI11 fragment obtained from the 5' flank of DDJsfrom ALL no. 7.

Northern Blot Analysis. Total RNA was prepared by aguanidinium thiocyanate method, and 10 pug was denatured informamide, electrophoresed in agarose/formaldehyde gels,and transferred to nitrocellulose paper (22). Hybridizationwas carried out as for PFGE.

Southern Blot Analysis. High molecular weight DNA wasextracted from leukemic cells or placenta. Ten micrograms ofthe genomic DNA was digested to completion with theappropriate restriction endonuclease, size-fractionated in0.7% agarose gels, transferred to nitrocellulose, and hybrid-ized as described.

Size-Selected Library Construction. Rearrangements wereisolated by digesting high molecular weight DNA to comple-tion with Xba I, size-fractionating the DNA fragments invertical 1% agarose gels, cutting the appropriate slice fromthe gel, isolating the DNA by electroelution, and constructingsize-selected libraries in the vector AZAP (Stratagene). Li-braries were screened with the 1.6-kb Xba I J8 genomicfragment, and inserts subcloned in plasmid pBluescript weremapped.DNA Sequencing. Single-strand sequencing of Da1, D82,

J81, DDJ8, and VDDJ8 subclones in M13 phage vectors anddouble-strand sequencing of the V6] genomic subclone inpBluescript were done using T7 polymerase (United StatesBiochemical, Cleveland) and dideoxy chain termination (23).

RESULTSTEA Is Located at the 5' End of J.8 The expression of TEA

in immature thymocytes as a unique fusion transcript with Caindicated that these loci would be linked. Cells with germ-lineTCR loci were digested with rare-cutting restriction endonu-cleases and large DNA fragments were separated by PFGE.Both TEA and the Ja segments were present on the same180-kb Sfi I, 250-kb Sal 1, and 170-kb Sal I-Sfi I fragments,which are located immediately 5' to Ca on human chromo-some segment 14qll (Figs. 1 A and B and 2A). The deletionof TEA in mature a,3CD3 T cells (Table 1) prompted themolecular cloning and characterization of the genomic TEAlocus and surrounding sequences. Genomic clone lilAplaced TEA immediately upstream to Ja75, which is utilizedin human cell line Nalm-1 and located -75 kb 5' to the humanCa region (Fig. 2B) (24, 29). Moreover, TEA proved to beadjacent to a pseudo-Ja region (qiJa) that serves as theacceptor site of a rearrangement that deletes the 8 locus (26).TCR 6 Locus Is Immediately 5' to TEA. We examined TEA

and its surrounding region for transcriptional activity withinclonal T-ALL cells (Fig. 3). TEA itself was noted to beexpressed in a pre-T and a y8 T cell, but not in aB T cells,consistent with its deletion in such mature T cells (Fig. 3 Band C). We noted a 1.4-kb Sph I-Pst I fragment within cloneP3.1, located 11 kb 5' to TEA, that recognized 2.2-, 1.7-, 1.3-,and 0.8-kb mRNAs in y8 ALL no. 7 and 1.7- and 0.8-kbmRNAs in several other T cells (Fig. 3A). This pattern wasidentical to that recognized by the 8 cDNA ofHata et al. (13).DNA sequencing of this genomic fragment established it asthe C8 region (data not shown). Several complete andintermediate cDNAs were isolated with this probe (data notshown). They revealed the sequence of a potential J regionand enabled the Jr,] genomic segment to be identified 12 kb5' to Cs on a 1.6-kb Xba I fragment (Fig. 2B). When this J81genomic clone was used as a probe, it detected two re-arranged TCR 8 alleles in Ry3 ALL no. 7 and one rearrangedallele in pre-T-cell ALL no. 5 (Fig. 4).Germ-Line V&, D&, and J.1 Conserve the 12/23-bp Spacer

Paradigm. Rearranged alleles provided the tools to obtain andcharacterize germ-line V, and Ds regions (Fig. 5 A and B). TheVs region was designated Vs1 because our previously pub-

AO,

x m Cn,fn

a

O.

X- 0 cn

)(COC cn E

0_ \

x nu (n Un

..~-250 - :t_-250 -

-180 - 180-170 :JS -.--170

f

50-40- ¢-:, 50-

TEA*

B ~~~0Coo) XUU)C

250- *

06

X Co u)oo 0-4aoC

-360

-190-170

60- e , _5030

40-30- * 30

Cc .

c 0U)

,~4 4I40 .- -r % a -

x CO Co cn

40-

V5 -

480- 9- -230

-190

190- F-45

!t-650

* -230

Vc 3. V I. 2 V@-,,! 2

- n U

X< (0(cn1)

-250 -'t

180- ,O - 70 _ t*

50- _

40- -

6 Rec* Da1*

FIG. 1. PFGE analysis of TEA, Ja, and D81. Genomic DNA ofK562 erythroleukemia cells was digested with restriction endonu-clease(s) as indicated above each lane. Labeled (*) probes areindicated below each panel. Fragment lengths are indicated inkilobases. (A) OFAGE with 10-sec switch interval at 300 V for 18 hr(range of 30-600 kb). Probes were as follows: TEA, 350-bp Fnu4HI-EcoRI fragment from TEA-Ca cDNA (17); J,,a, B and C as described(24); D81, 1.1-kb Pst 1-HindIll fragment located immediately 5' toD81 (Fig. 5B). The same blot was hybridized sequentially with thethree probes. (B) OFAGE with various switch intervals. Panel 1:switch interval, 6 sec (30-250 kb); probe, 0.4-kb Hpa II fragment ofthe Ca cDNA PY14 (25). Panel 2: switch interval, 10 sec; probe,0.9-kb Pst I fragment immediately 5' to V151 (Fig. 5A). Panel 3: sameblot as in panel Z, rehybridized with a Va3.1 probe, 0.5-kb Sac I-HindIII fragment of our isolate GTH 308 (26, 27). Panel 4: switchinterval, 10 sec; probe, 0.6-kb EcoRI-Hpa II fragment of V,,1.2 (27).Panel 5: 35 sec (100-1000 kb); same probe switch interval, as forpanel 4. (C) OFAGE with 15-sec switch interval. Same blot wasprobed sequentially with 8Rec probe [1.0-kb Sac I-EcoRI fragmentfrom clone GTH310 (26)] and D8l probe as in A.

lished cDNA sequences (13, 14, 30) suggest it is the mostfrequently used V,. It possesses a 23-bp spacer at its 3' flank(Fig. SA). PFGE analysis revealed that it occupies differentSfi 1 (190 kb) and Sal I (360 kb) fragments than the remainder

Immunology: Hockett et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 8

, 202

0

9696 Immunology: Hockett et al.

ASfil Sfil

I ISfi

Proc. Natl. Acad. Sci. USA 85 (1988)

Sf ii

Sagl SallI1

0 xx x x

SOII SPI/,100, cas

Stil Sfu

Sall SallI I

V61

//

D62Jd CdHH

x xz W~_v1

5.12

-~D2A12.1a

503

A2.2a

TEA~Ja, J475H H H

a.x aLo zx \I I I 11 1I II I III - 1T l-

111AP3.1

Bi

2-H2Kb

FIG. 2. Genomic organization of the TCR a/8 locus. (A) PFGE map showing relationship of the a and 8 loci. Sizes of Va- and Y's-containingfragments are shown, but their precise alignment and location are not indicated. 8Rec through Ja segments reside on the same 170-kb Sal I-Sfi I fragment; neighboring Xho I fragments contain 8Rec (-40 kb), D1 (-50 kb), or TEA (-50 kb). (B) Genomic phage map of the 8 locus.

of the 8 locus (D,-J,-Ca-TEA) (Figs. 1B and 2A). Twogerm-line Dr clones were obtained (Fig. SB), and both ofthempossess 23-bp spacers on their 3' flanks and 12-bp spacers ontheir 5' flanks. The Dal segment has but 9 bp (CCTTCCTAC)between signals and the D82 13 bp (ACTGGGGGATACG).PFGE analysis of the Dr, region placed it on the same 180-kbSfi I, 250-kb Sal I, and 170-kb Sfi I-Sal I fragments as Ja andTEA (Figs. 1A and 2A). Analysis of genomic phage clonesestablished that Dal, D82, Jr,, C8, and TEA were within 35kb (Fig. 2B).

Table 1. TCR genes and CD3 phenotypeALL Gene configuration and expression

No. Type a f3 y 8 TEA CD3

5 Pre-T E2.0 G G R, E&.; G, E2.0 -

7 y8 E2.0 G R, E1.5 2R, Ei}1 G, E2.0 +1 Pre-T NE R, E1.0 R, NE 1R, Ed.; G, NE -

4 a3 E1.6 R, E1.3 1R, E1.5 1R, E&.7 1G, NE +1D 1D 1D

6 a/3 R R D D +10 a/3 E1.6 R 1R D D +

1D11 ac3 E1.6 R, EB: R, NE D D23 a/3 E1.6 R R R, NE 1G, NE +

1D13 a/3 E1.6 R, EBa 1R, NE D D +

1D17 a/3 E1.6 R, E1.3 R, NE D D +

TCR gene configuration and expression were assessed as outlinedin Materials and Methods. Analysis of TCR f3 and y and determi-nation of cell surface CD3 phenotype were as described (16);CD3-reactive monoclonal antibody was OKT3 (28). E, expressed;NE, not expressed; G, germ-line; R, rearranged; D, deleted. Sub-and superscripts refer to transcript sizes in kilobases.

Extensive N Segments Characterize VDDJ and DDJ Rear-rangements. The two 8 alleles of y8 ALL no. 7 were clonedas 2.8- and 6.4-kbXba I fragments. The 6.4-kbXba I fragmentof ALL no. 7 proved to contain a VDDJA productiverearrangement (Fig. SC). The 2.8-kb Xba I fragment corre-sponded to the excluded allele and was a DDJs intermediaterearrangement. The 2.2- and 1.3-kb transcripts arise fromcomplete VDJ assemblies, with the length difference reflect-ing alternative 3' poly(A)-addition sites, whereas the 1.7- and0.8-kb mRNAs are also seen in some CD3-negative cells (Fig.3A) (13-15). The orientation of 12- and 23-bp spacers flankingthe germ-line segments (Vs-23, 12-Ds-23, 12-J4) allows DIDrecombination to occur. The DDJ and VDDJ alleles of ALLno. 7 document this fact and illustrate the extent of Nsegments added at all three sites of juncture (Fig. 5C). Thepresence of N segments up to 16 bp in length raises thepossibility that other Ds segments might exist internally. Thisis plausible, but these N regions contain no obvious recurrentmotifs that predict another D8. Moreover, the 0.9-kb regionbetween germ-line D82 and J81 has been sequenced (Fig. SB),and neither the 14-bp N segment of the ALL 7 DDJ, nor the11-bp N segment of the ALL 7 VDDJ, nor further signalsequences reside there (Fig. 5C). Ds1 and D8,2 appear to beused repeatedly in early T cells. Since assembled D segmentsdemonstrate extensive loss from exonuclease activity, it wasthe 5' flank of the DDJ intermediate that identified thegerm-line Ds1.

BRec and .J, Deleting Elements Flank the TCR 6 Locus.PFGE mapping localized V4,1 and the examined V1 regions aconsiderable distance from D-Js,-C6--TEA-Ja (Figs. 1B and2A). The total expanse of this locus has not been determined,but these regions occupy separate Sal I fragments of 360 kb(V8s), 650 or 230 kb (V1a), and 250 kb (D,-Ca) (Figs. 1 and 2).However, 8Rec, a rearranging element that has been shown to

BH

is -aL . . -A g q 1 1 -2 -a -2 la - !6 !a -.4 .. ri-Z.-.0 O., Z 0 m (46A m .91 1 2

22 fit x,-x I fM YL-.., I I I .l I I I .11 I I I I I I I I I I 11 I I .Jfl 11

I I I III I I III I I I I I I I I I I 11 I I 1111 11

Dow

nloa

ded

by g

uest

on

Aug

ust 8

, 202

0

Immunology: Hockett et al. Proc. Natl. Acad. Sci. USA 85 (1988)

y8 aR7 13 PB P8 PB B M

.2_ 1.7-_

1.3-OA WO

PT y8 al3 a/3 PT a,8 a,8PM B PB 7 13 17 5 10 23

A

Ir x T to! m xm

14212.11

-9f ~~~~~~~~~~~~~~~~~~~~17.11 Kb .._ s |

1 Kb

Vd1

AGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCA

GCCTTACAGCTAGAAGATTCAGCAAAGTACTTTTGTACTCTTGGGAAACAGCATTT~~~~~~~~~~~~~~~~~~~~~~~GAAGTGATAGTAAAAGCAAA23bTAGGGCTCAATAAGAGAACCCCTCTACTCC23b

B1Kb

-1.6

C

-2.0

TEA*

FIG. 3. Northern blot analysis of TCR 8 and TEA expression in3,8 or vy T-cell ALLs or pre-T-cell ALLs (numbers above lanes),

three pre-B-cell ALLs (lanes PB), the SUDHL-4 B-cell line (lanes B),and the U937 monoblastic leukemia line (lane M). RNA sizes aregiven in kilobases. (A) C8 probe was the 1.4-kb Sph I-Pst I genomicfragment (Fig. 2). (B) C, probe was as in Fig. 1B. (C) Same blot asin B was rehybridized with TEA probe.

site-specifically recombine with q.Ja to delete the 8 locus (26),is located just upstream to Ds8 on a unique Xho I fragment.8Rec, D81, and TEA coreside on common 250-kb Sal I, 180-kbSfi I, and 170-kb Sfi I-Sal I fragments (Figs. 1 A and C and 2).

DISCUSSIONA long-range and finely detailed restriction map of the humanTCR 8 genomic locus was constructed in order to analyze the

PT y8 a/3 a,35 7 G 10 6

PT ry a/3 a,3G 5 7 10 6

9 Itp 7 D 7 23 b|GGTTTTTAIACTOATOTOTTI Tt ACTTCCTACACAaGTTGGAGTGCATTAAGCCTTT~laCAAAAj

* Xp 7 D2 7 23lpAGTTTTTGRAAAGTTCTGAA CG T61CTGGGGGATAC6ACATTGTACAAAACCTACAGAGACCTO ACAAAAACTGCAGGGGCAAAAGTGCCATTTCCCTGGGATATCCTCACCCTGGGTCCCAT6CCTCAGGAGACAACACAGCAAGCTTCCCTCCCTOCTTTGGGGCCTG6AAG6GATAGCAGOAAGTTGACT6GACCAGGGAGATGACCACAGCT6CTGACCTCTCACACTCACTGCT6TTCTTCCTTGGGTGAAACTGGCATTTCTACATTTTCTTACA6CACATTCCCCAATACAAAAAG6CCTTTCTTAAAAACTATTCTT6TCTTGTTTTCATGTTGATTCTATTGCAAAAGAGAGTTATATGAGCCACCTCATACGGAATTTCTAAATTCAAACCTCTAGAGAGATTTACCCAAGTGCTTTGCTTTOCTTTGCA6TTTGGGAG6AT6GATTT6AAGAGAGATTGATTTTTTTGTAGGCAATCACC6GCCACA6TTGCTCATTCTAAA6CTGACTGCTCTGTAAATCACCCA6TGCTTCATGCCACCCTTTCTCCTCTTGCT6T6CCACAC6TTATCTGCCTTTAAAGCAGCAGCACTGGTGTCT6TAAAGGCCTTAACCCTGGAGTAGTCATGGAGCCAAGACCCACCCCTTTGACAGTGCCAGCTTTCCAACACAGAGAGCTGAOTATGGGTCTAGGAASTGAGAOCAATGTAAAACAATAGAAA6CAACAGTTCAGA6CACTGCATCAAGTGTACTGTGCTG6AAAGGTCCGCCATAG6AAATAT6GTCCTCCATACTCCTCAGACAACAGCCTTCCGAAAGCAAACCT6TCCCTACCTGCAGAT6ATTAACCATCTATGAACCGGCT6G6TAAGCAACAAGTGCCATCTTTCATGGAGCTGAGCCTTAAAGATCCTCCAGTCCTAAAGCTGACGGGAAGAAGGTAGO

I Itp 7 Jd1TGGGAGCAGCGCTGP4GTTTTGGACOTCCTCAAG OCTOTA CACCGATAAACTCATCTTTGGAAAAGGAACCCGTGT

GACTGTGGAACCAAB1AACTCATTTATTTATDS

C17 a8 Kb DDJd

9 12 p 7 Dd0 NGGAAAAAGGAAGAAGAG| TTTTTAACTGATGTGTT ATTTGTCTTCC CTCCCTACTGC

132 N J61TCAT CTOGGGGGATAC CCGACCOTACGTG CCGATAAACTCATCTTTGGAAAAGGAACCCGT

GTGACTGTAGAACCAAGAATAACTCATTTATTTATCTGAAGTTTAAGGTTAAGGCATCCT

DS

6.4-N*..

28-

1.6-*.

i

_ A m -8.5

-6.4

#7 Kb VDDJV61

AATGCAAAAAGTGGTCGCTATTCTGTCAACTTCAAGAAAGCAGCGAAATCCGTCGCCTTAACCATTTCAGCC

V61 N D61 N 062TTACAGCTAGAAGATTCAGCAAAGTACTTTTGTGCTCTTOO CTCTGG~ CTTTCTCTGG CT

N JdAACCATTTACACCGATAAACTCATCTTT AAAAGGAACCCGTGTGACTGTGGAACCAA1AAGTAACTCATTT

DS

FIG. 5. Organization and sequence of genomic V1l region (A)genomic D8, and Jr regions (B), and ALL no. 7 rearrangements (C).The VsJ genomic phage was isolated by using the 5' flank of a VDDJrearrangement as a probe. Dt,2 was located within phage A12.la byusing our D82-J,,a reciprocal joint GTH311 (26). DS, donor splice site.

Xbo IJ6*

Xba IV6 *

FIG. 4. Southern blot analysis of pre-T (PT) T-cell ALLs for 8organization. Jr probe was a 1.6-kb Xba I genomic fragment; Valprobe was as in Fig. 1. Lane G, placental DNA.

complex rearrangements, deletions, and translocations withinthe a/8 locus. We located two D8 segments (Dr1 and D82)upstream of J,-C,. Their identification permitted an accuratecomparison of rearranged genomic and prior cDNA clones,documenting D81/D82 rearrangement and extensive N-

a/3 aB a43 PT4 6 11 5

A

1.7- d

0.8- ;:k:

9697

Cd*

B

2.0-

1.3-

Dow

nloa

ded

by g

uest

on

Aug

ust 8

, 202

0

Proc. Natl. Acad. Sci. USA 85 (1988)

segment addition. Moreover, this study links the TCR 8 locusto TEA and places both at the 5' end of the Ja segments. Wehave characterized a site-specific rearrangement occurring infetal thymus that recombines an isolated heptamer-spacer-nonamer (8Rec) with the 4f Ja region (26). We proposethat this constitutes an important intermediate step that deletesthe TCR 8 locus prior to Va/Ja rearrangement. Consistent withthis hypothesis, this study places the 3' 8-deleting element(qja) between C8 and theJa segments, whereas 8Rec is located5' to Dr1. This design would help ensure that TCR a rear-rangements could not use Ds and Js gene segments. Theprecise role of TEA transcription and of the TEACa splicedtranscript seen in pre-T cells is yet to be determined. In y5ALL no. 7, it is conceivable that the TEACa transcriptoriginates from the DDJ intermediate allele. TEA does notencode an obvious protein, has repetitive motifs resemblingimmunoglobulin switch regions (17), and is strategically lo-cated immediately upstream to the 4Ua acceptor site for 8deletion. The temporal relationship of TEACa expressionsuggests that it may play a regulatory role in opening the Jalocus for an initial 8 deletion and subsequent Va/Ja rearrange-ment.The proximity of D8, Jr, and Cs may ensure faithful

rearrangement and expression of the TCR 8 gene segmentsdespite their location within the larger TCR a locus. The Vi]region and the examined Va regions were located a consid-erable distance from D,8-J8-Cs-TEA-Ja (Figs. 1B and 2A).However, mature a,3 CD3 T cells, which have eliminated theDs-Js-Cs-TEA complex from both alleles, frequently possessone or even both copies of germ-line Vai1 in the presence ofVa/Ja rearrangements. Thus, the mechanism that enables VsJto be preferentially recognized for rearrangement with a Dssegment is more complex than a simple linear gene order ofVa and Vi.

T-cell ALLs represent clonal expansions of maturationallyarrested cells at specific stages of thymic ontogeny. Pre-T-cell ALL no. 5 (Table 1) indicates that TCR 8 rearrange-ments, especially intermediate forms, can occur prior to theactivation of y, /3, or a loci. This is a very immature celldisplaying only surface CD7 (16), a T-lineage marker presenton fetal hematopoietic cells prior to colonization of thethymus (31). ALL no. 1 was also classified as a pre-T cell, asit lacked CD3 and expressed only truncated 8 transcripts.ALL no. 7 possessed a CD3-associated y5 TCR as deter-mined by immunoprecipitation and was a typical yS T cellexcept for the simultaneous presence of CD4 and CD8 (16).This cell illustrates that TCR 8 alleles demonstrate the classicprinciple of allelic exclusion: ALL no. 7 possesses aneffective VDDJ responsible for the complete 2.2- and 1.3-kbmRNAs, whereas the excluded allele bears a DDJ interme-diate that does not predict a complete protein product. ALLno. 4 is an unusual a,8 CD3 T cell that still expresses truncated8 transcripts from the excluded allele (Table 1). This obser-vation argues that 8 rearrangement and a rearrangement arenot mutually exclusive within an individual cell. Whetheralleles with intermediate 8 rearrangements might still pro-gress to a recombination remains an open possibility.The TCR 8 locus is a gene within a gene. In a common

ancestor of humans and mice, the TCR 8-subunit gene, usedin one type of T cell, was placed within the heart of the TCRa-subunit gene used in quite another cell. Since then, thedetails of the 8 locus have been remarkably well conservedover 70 million years (10, 11). The advantage of this evolu-tionary design would have been obvious had C8 and Caregions frequently utilized a common set of V, D, and/or Jsegments. In fact, however, the 8 locus commonly uses oneV, and its own unique D segments and J segment. In strikingcontrast, the a locus uses a multitude of V segments with along stretch of J segments and foregoes all internal 8information. Adoption of this strategy necessitated a com-

plex scheme of chromosomal rearrangements that appears toremove the 8 locus in cells destined to produce the TCR achain. A strong advantage must exist for embracing thiscomplexity and may well reflect a need to ensure thatindividual T cells make but one chain, a or 8. An earlydecision to effectively rearrange or delete the 8 locus may bethe pivotal event establishing separate -yS and a,8 lineages.We wish to thank Mrs. Molly Bosch for her expert technical

assistance. R.D.H. is supported by Grant PRTF-87 from the Amer-ican Cancer Society.1. Allison, J. P., McIntyre, B. W. & Bloch, D. (1982) J. Immunol. 129,

2293-2300.2. Lanier, L. L. & Weiss, A. (1986) Nature (London) 324, 268-270.3. Meuer, S., Fitzgerald, K. A., Hussey, R. E., Hodgdon, J. C.,

Schlossman, S. F. & Reinherz, E. L. (1983) J. Exp. Med. 157, 705-719.

4. Haskins, K., Kubo, R., White, J., Pigeon, M., Kappler, J. &Marrack, P. (1983) J. Exp. Med. 157, 1149-1169.

5. Brenner, M. B., McLean, J., Dialynas, D. P., Strominger, J. L.,Smith, J. A., Owen, F. L., Seidman, J. G., Ip, S., Rosen, F. &Krangel, M. S. (1986) Nature (London) 322, 145-149.

6. Pardoll, D. M., Fowlkes, B. J., Bluestone, J. A., Kruisbeck, A.,Maloy, W. L., Coligan, J. E. & Schwartz, R. H. (1987) Nature(London) 326, 79-81.

7. Koning, F., Stingl, G., Yokoyama, W. M., Yamada, H., Maloy,W. L., Tschachler, E., Shevach, E. M. & Coligan, J. E. (1987)Science 236, 834-837.

8. Bonyhadi, M., Weiss, A., Tucker, P. W., Tigebar, R. E. & Allison,J. P. (1987) Nature (London) 330, 574-576.

9. Kronenberg, M., Siu, G., Hood, L. E. & Shastri, N. (1986) Annu.Rev. Immunol. 4, 529-591.

10. Chien, Y., Iwashima, M., Kaplan, K. B., Elliott, J. F. & Davis,M. M. (1987) Nature (London) 327, 677-682.

11. Chien, Y., Iwashima, M., Wettstein, D. A., Kaplan, K. B., Elliott,J. F., Born, W. & Davis, M. M. (1987) Nature (London) 330, 722-727.

12. Elliott, J. F., Rock, E. P., Patten, P. A., Davis, M. M. & Chien, Y.(1987) Nature (London) 331, 627-631.

13. Hata, S., Brenner, M. B. & Krangel, M. S. (1987) Science 238, 678-682.

14. Loh, E. Y., Lanier, L. L., Turck, C. W., Littman, D. R., Davis,M. M., Chien, Y. & Weiss, A. (1987) Nature (London) 330,569-572.

15. Takihara, Y., Champagne, E., Griesser, H., Kimura, N., Tkachuk,D., Reimann, J., Okada, A., Alt, F. W., Chess, L., Minden, M. &Mak, T. W. (1988) Eur. J. Immunol. 18, 283-287.

16. Felix, C. A., Wright, J. J., Poplack, D. G., Reamon, G. H., Cole,D., Goldman, P. & Korsmeyer, S. J. (1987) J. Clin. Invest. 80, 545-556.

17. de Villartay, J.-P., Lewis, D., Hockett, R., Waldmann, T. A.,Korsmeyer, S. J. & Cohen, D. I. (1987) Proc. NatI. Acad. Sci. USA84, 8608-8612.

18. Smith, C., Lawrance, S. K., Gillespie, G. A., Cantor, C. R.,Weissman, S. M. & Collins, F. S. (1987) Methods Enzymol. 151,461-489.

19. Carle, G. F. & Olson, M. V. (1984) Nucleic Acids Res. 12, 5647-5664.

20. Smith, C. L. & Summers, M. 0. (1980) Anal. Biochem. 109,123-129.21. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 6-13.22. Chirgwin, J. W., Przybyla, A. E., MacDonald, R. J. & Rutter,

W. J. (1979) Biochemistry 18, 5294-5299.23. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Nati. Acad.

Sci. USA 74, 5463-5467.24. Sangster, R. N., Minowada, J., Suciu-Foca, N., Minden, M. &

Mak, T. W. (1986) J. Exp. Med. 163, 1491-1508.25. Yanagi, Y., Chan, A., Chin, B., Minden, M. & Mak, T. W. (1985)

Proc. NatI. Acad. Sci. USA 82, 3430-3434.26. de Villartay, J.-P., Hockett, R. D., Coran, D., Korsmeyer, S. J. &

Cohen, D. I. (1988) Nature (London) 335, 170-174.27. Yoshikai, Y., Kimura, N., Toyonaga, B. & Mak, T. W. (1986) J.

Exp. Med. 164, 90-103.28. Reinherz, E. L., Kung, P. C., Goldstein, G., Levey, R. H. &

Schlossman, S. F. (1980) Proc. Natl. Acad. Sci. USA 77, 1588-1592.29. Champagne, E., Sagman, U., Biondi, A., Lewis, W. H., Mak,

T. W. & Minden, M. D. (1988) Eur. J. Immunol. 18, 1033-1038.30. Hata, S., Satyanarayana, K., Devlin, P., Band , McClean, J.,

Strominger, J. L., Brenner, M. B. & Krangel, M. S. (1988) Science240, 1541-1544.

31. Lobach, D. F., Hensley, W. H. & Haynes, B. F. (1985) J. Immu-nol. 135, 1752-1759.

9698 Immunology: Hockett et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 8

, 202

0