how to characterize a single piece of dna - isolate a small fragment of dna - insert dna into...
Post on 21-Dec-2015
231 views
TRANSCRIPT
![Page 1: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/1.jpg)
How to characterize a single piece of DNA
- Isolate a small fragment of DNA
- Insert DNA into plasmid (or phage vector)
-Transform recombinant DNA molecule into bacteria
-Amplify DNA by culturing transformed bacteria
-Use transformants for variety of purposes (e.g.expression studies,sequencing, mutational analysis, etc.)
-Select for transformants
![Page 2: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/2.jpg)
LE 20-2Bacterium
Bacterialchromosome
Plasmid
Gene inserted intoplasmid
Cell containing geneof interest
Gene ofinterest DNA of
chromosome
RecombinantDNA (plasmid)
Plasmid put intobacterial cell
Recombinantbacterium
Host cell grown in cultureto form a clone of cellscontaining the “cloned”gene of interest
Protein expressedby gene of interest
Protein harvested
Gene ofinterest
Copies of gene
Basicresearchon gene
Basicresearchon protein
Basic research andvarious applications
Gene for pestresistance insertedinto plants
Gene used to alterbacteria for cleaningup toxic waste
Protein dissolvesblood clots in heartattack therapy
Human growth hor-mone treats stuntedgrowth
![Page 3: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/3.jpg)
Restriction Enzymes Used to Make Recombinant DNA
• Bacterial restriction enzymes
– cut DNA molecules at specific DNA sequences called restriction sites
![Page 4: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/4.jpg)
LE 20-3Restriction site
DNA 53
35
Restriction enzyme cutsthe sugar-phosphatebackbones at each arrow.
One possible combination
DNA fragment from anothersource is added. Base pairingof sticky ends producesvarious combinations.
Fragment from differentDNA molecule cut by thesame restriction enzyme
DNA ligaseseals the strands.
Recombinant DNA molecule
Sticky end
EcoRI
MemorizeEcoRI restriction site
palindrome
Catalyzes phosphodiesterbond between5’ phosphate &3’ hydroxyl group of sugar
Ligation
![Page 5: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/5.jpg)
Do restriction digests and ligations always work?
What are the other possible undesirable outcomes?
![Page 6: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/6.jpg)
Clever way to select for recombinant clones
Plasmid
contains LacZ gene-->-galactosidase
X-gal (substrate:one product is blue)
Blue colonies
Restriction site in LacZ gene
if insert DNA fragment -galactosidase
X-gal
White colonies
What is a common strategy to select for transformed bacteria?
Grow bacteria on antibiotic: only plasmid carriers will survive
![Page 7: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/7.jpg)
LE 20-4_3
Isolate plasmid DNAand human DNA.
Cut both DNA samples withthe same restriction enzyme.
Mix the DNAs; they join by base pairing.The products are recombinant plasmidsand many nonrecombinant plasmids.
Bacterial cell lacZ gene(lactosebreakdown)
Humancell
Restrictionsite
ampR gene(ampicillinresistance)
Bacterialplasmid Gene of
interest
Stickyends
Human DNAfragments
Recombinant DNA plasmids
Introduce the DNA into bacterial cellsthat have a mutation in their own lacZgene.
Recombinantbacteria
Plate the bacteria on agarcontaining ampicillin and X-gal.Incubate until colonies grow.
Colony carrying non-recombinant plasmidwith intact lacZ gene
Colony carryingrecombinantplasmid withdisrupted lacZ gene
Bacterialclone
![Page 8: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/8.jpg)
Different goals in creating recombinant clones
1. To examine/utilize the structure and function of a single piece of DNA.
2. To package small pieces of an entire genome: genomic DNA library
To have available all the sequences in the genome for examination and use.
![Page 9: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/9.jpg)
LE 20-6
Bacterialclones
Recombinantplasmids
Recombinantphage DNA
or
Foreign genomecut up withrestrictionenzyme
Phageclones
Plasmid library Phage library
DNA libraries created using plasmids and phage and bacterial hosts
Note: practical limit on the size of DNA cloned into a vectors (plasmid: 5-10 kbp, phage: 45 kbp)
![Page 10: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/10.jpg)
Characterization of DNA by Size
Agarose Gel Electrophoresis
Digest DNA with restriction enzymes
Load DNA into wells of agarose gel
Apply electric current to fractionate DNA fragments by size
In electric field with positive and negative poles, which polewill DNA be attracted to? Why?
How to distinguish one DNA molecule from another?
![Page 11: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/11.jpg)
LE 20-8
Cathode
Powersource
Anode
Mixtureof DNAmoleculesof differ-ent sizes
Gel
Glassplates
Longermolecules
Shortermolecules
-DNA stainedwith fluorescentdye (ethidium bromide)
-DNA fluoresces upon exposure toultraviolet (UV) light
![Page 12: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/12.jpg)
How would you determine whether a particular gene or DNA sequence is present in your cloned DNA?
Southern Blot
![Page 13: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/13.jpg)
LE 20-10
DNA + restriction enzyme Restrictionfragments
Normal-globinallele
Sickle-cellallele
Heterozygote
Preparation of restriction fragments. Gel electrophoresis. Blotting.
Nitrocellulosepaper (blot)
Gel
Sponge
Alkalinesolution
Papertowels
Heavyweight
Hybridization with radioactive probe.
Radioactivelylabeled probefor -globingene is addedto solution ina plastic bag
Paper blot
Probe hydrogen-bonds to fragmentscontaining normalor mutant -globin
Fragment fromsickle-cell-globin allele
Fragment fromnormal -globinallele
Autoradiography.
Film overpaper blot
Southern Blot AnalysisLabeled nucleic acid probe:RNA or DNA
![Page 14: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/14.jpg)
Why are globin DNA fragments different in size?
![Page 15: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/15.jpg)
LE 20-9Normal -globin allele
175 bp 201 bp Large fragment
Sickle-cell mutant -globin allele
376 bp Large fragment
Ddel Ddel Ddel Ddel
Ddel Ddel Ddel
Ddel restriction sites in normal and sickle-cell alleles of-globin gene
Normalallele
Sickle-cellallele
Largefragment
376 bp201 bp175 bp
Electrophoresis of restriction fragments from normaland sickle-cell alleles
Restriction enzyme
![Page 16: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/16.jpg)
Restriction Fragments Length Polymorphisms (RFLP)
- useful in detecting disease alleles
-forensicsto identify individualsno two individuals are alike
(exception?)
![Page 17: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/17.jpg)
LE 20-17Defendant’sblood (D)
Blood from defendant’sclothes
Victim’sblood (V)
Do the RFLPs suggest the defendant was in contact withthe victim?
By themselves,do RFLPSprove she’s guiltyof assault?
![Page 18: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/18.jpg)
Genomics and Molecular Techniques
• Characterization of entire genomes
• Human Genome Project (HPG):• ambitious goal to sequence the entire human
genome (initiated 1990; mostly complete 2003)
• Other genomes also sequenced
• Evolutionary relatedness of key interest->sequence comparison
Ch 20
![Page 19: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/19.jpg)
LE 20-11
Cytogenetic map
Genes locatedby FISH
Chromosomebands
Geneticmarkers
Genetic (linkage)mapping
Physical mapping
Overlappingfragments
DNA sequencing
Stepsin genomemapping
(chromosome map)
![Page 20: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/20.jpg)
DNA Sequencing
• Short DNA fragments sequenced by dideoxy chain-termination method
![Page 21: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/21.jpg)
LE 20-12
DNA(template strand)
5
3
Primer3
5
DNApolymerase
Deoxyribonucleotides Dideoxyribonucleotides(fluorescently tagged)
3
5DNA (templatestrand)
Labeled strands3
Directionof movementof strands
Laser Detector
DNA chainterminators
![Page 22: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/22.jpg)
• Other approach to genome sequencing:
– Shotgun method• Sequence random fragments of DNA• Computer program orders overlapping fragments
into single continuous sequence
![Page 23: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/23.jpg)
LE 20-13
Cut the DNA from many copies of an entire chromosome into overlapping frag-ments short enough for sequencing
Clone the fragments in plasmid or phagevectors
Sequence each fragment
Order the sequences into one overall sequence with computer software
![Page 24: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/24.jpg)
• Genome organization• Gene expression patterns in response to
- environmental change e.g.pollution, global
warming-Development
embryogenesis->senescence
-Disease/Health
Can we learn important information from the genome sequence?
![Page 25: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/25.jpg)
Computer Analysis: Key Tool
Bioinformatics
-analysis and storage of biological data by computing techniques
-key to management & analysis of huge data sets
Example: Identification of proteins coding sequences (ORF)in genomes
agatactagcagctctttcgagcatcagcatcaccgatgcatcgatcacgcgctgtttg…
![Page 26: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/26.jpg)
Think of a sequence feature that a program could search for to identify ORFs.
![Page 27: How to characterize a single piece of DNA - Isolate a small fragment of DNA - Insert DNA into plasmid (or phage vector) -Transform recombinant DNA molecule](https://reader031.vdocuments.mx/reader031/viewer/2022013108/56649d595503460f94a398db/html5/thumbnails/27.jpg)
? ?
?
?
??
?