heterologous expression and extracellular secretion of...

Running title: Expression and Secretion of Cellulases in Z. mobilis

1

Heterologous Expression and Extracellular Secretion of 1

Cellulolytic Enzymes in Zymomonas mobilis 2

3

Jeffrey G. Linger1, William S. Adney

2, Al Darzins

1* 4

1National Bioenergy Center,

2 Chemical and Biosciences Center, National Renewable 5

Energy Laboratory, 1617 Cole Blvd, Golden, CO 80401. 6

7

Running Title: Expression and Secretion of Cellulases in Z. mobilis 8

9

* Corresponding Author. Mailing Address: National Renewable Energy 10

Laboratory, 1617 Cole Blvd, Golden, CO 80401. Phone: (303) 384-7757. Email: 11

[email protected] 12

13

14

15

Copyright © 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.00230-10 AEM Accepts, published online ahead of print on 6 August 2010

on July 2, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/


2

Abstract 16

Development of the strategy known as consolidated bioprocessing (CBP) involves the 17

use of a single microorganism to convert pretreated lignocellulosic biomass to ethanol 18

through the simultaneous production of saccharolytic enzymes and fermentation of the 19

liberated monomeric sugars. In this report, the initial steps towards achieving this goal in 20

the fermentation host Zymomonas mobilis were investigated by expressing heterologous 21

cellulases, and subsequently examining the potential to secrete these cellulases 22

extracellularly. Numerous strains of Z. mobilis were found to possess endogenous 23

extracellular activities against carboxymethyl cellulose, suggesting that this 24

microorganism may harbor a favorable environment for the production of additional 25

cellulolytic enzymes. The heterologous expression of two cellulolytic enzymes, E1 and 26

GH12 from Acidothermus cellulolyticus, was examined. Both proteins were successfully 27

expressed as soluble, active enzymes in Z. mobilis although to different levels. While E1 28

was less abundantly expressed, the GH12 enzyme comprised as much as 4.6% of the total 29

cell protein. Additionally, fusing predicted secretion signals native to Z. mobilis to the N-30

termini of E1 and GH12 was found to direct the extracellular secretion of significant 31

levels of active E1 and GH12 enzymes The sub-cellular localization of the intracellular 32

pools of cellulases revealed that a significant portion of both the E1 and GH12 secretion 33

constructs resided in the periplasmic space. Our results strongly suggest that Z. mobilis 34

is capable of supporting the expression and secretion of high levels of cellulases relevant 35

to biofuels production, thereby serving as a foundation for developing Z. mobilis into a 36

CBP platform organism. 37

38


.asm.org/

Dow

nloaded from

http://aem.asm.org/


3

Introduction 39

The biological conversion of lignocellulosic biomass to ethanol potentially 40

represents a major source of future domestic transportation fuels yet the current cost of 41

converting biomass to fermentable sugars still needs to be further reduced (12). Most 42

current strategies for ethanol production via biochemical conversion of lignocellulosic 43

feedstocks utilize simultaneous saccharification and fermentation (SSF) or simultaneous 44

saccharification and co-fermentation (SSCF) processes (8, 21, 22). The process 45

configuration known as consolidated bioprocessing [CBP; (20)] would alleviate the 46

financial strain of producing saccharolytic enzyme cocktails by combining the necessary 47

steps for ethanol production, as an action of one microorganism. 48

A particularly attractive microbial candidate for the development of a CBP 49

microorganism is the gram-negative fermentative bacterium, Zymomonas mobilis. Z. 50

mobilis has been studied for its exceptionally high ethanol production rate, yield, and 51

tolerance to the toxicity of the final product (15-17, 20, 31-33, 35, 43). In addition, Z. 52

mobilis has the ability to ferment sugars at low pH, and has a naturally high tolerance to 53

many of the inhibitory compounds found in lignocellulosic-derived hydrolysates (46, 47) 54

Furthermore, the use of the Entner-Doudoroff pathway (37) allows Z. mobilis to achieve 55

the near-theoretical maximum ethanol yields during fermentation while achieving 56

relatively low biomass formation. Accordingly, Z. mobilis has been used successfully in 57

SSF and SSCF processes (14, 24, 36). Additionally, Z. mobilis has been successfully 58

engineered to ferment the pentose (C5) sugars, xylose (45) and arabinose (10). 59

A necessary prerequisite to establishing Z. mobilis as a CBP host is the ability to 60

achieve high levels of cellulolytic enzyme expression. However, there is not yet a strong 61


.asm.org/

Dow

nloaded from

http://aem.asm.org/


4

consensus on how to achieve maximal heterologous protein expression in Z. mobilis. 62

Multiple groups have attempted heterologous expression of numerous genes including 63

cellulolytic enzymes in Z. mobilis with varying degrees of success (6, 7, 9, 19, 27, 42, 64

44). Unfortunately, there are no obvious correlations between the expression strategies 65

employed compared to the results obtained. Intriguingly, however, when researchers 66

used the tac promoter (Ptac) to drive expression of native Z. mobilis genes they were able 67

to express several genes to extremely high levels (2). The results from this previous 68

study suggest that while the potential to achieve high levels of heterologous cellulase 69

expression in Z. mobilis certainly exists, the ability to do so on a consistent basis will 70

need further investigation. 71

While achieving high-level expression of cellulases is an important hurdle to 72

overcome in the development of the CBP technology, it is imperative that these enzymes 73

additionally be translocated to the extracellular medium in order to directly contact the 74

lignocellulosic substrate. The most obvious means by which to achieve this translocation 75

is by harnessing the host cell’s protein secretion apparatus. There is, however, in general, 76

very little fundamental knowledge regarding the capacity of Z. mobilis to secrete proteins. 77

There is only one account to our knowledge of fusing secretion signals native to Z. 78

mobilis onto proteins from exogenous sources, where extracellular secretion of a 79

recombinant β-glucosidase reached only 11% of the total amount of enzyme synthesized 80

(43). 81

We initially report the finding that several Z. mobilis strains natively produce an 82

endogenous activity against carboxymethyl cellulose (CMC), and that this activity can be 83

detected extracellularly. Together, these results suggest that Z. mobilis may be adept at 84


.asm.org/

Dow

nloaded from

http://aem.asm.org/


5

producing and secreting cellulolytic enzymes, and as this attribute is essential for a CBP 85

organism, Z. mobilis serves as an ideal candidate for further investigation. 86

We next describe the expression of two cellulolytic enzymes (E1 and GH12) in 87

both E. coli and Z. mobilis. “E1” (locus tag: Acel_0614) and “GH12” (locus tag: 88

Acel_0619) are both from the acidothermophile Acidothermus cellulolyticus and are 89

representative of families 5 and 12 glycoside hydrolases, respectively (U.S. Patents 90

5536655 and 7059993). E1 is an endo-1,4-β-glucanase, and GH12 is an uncharacterized 91

enzyme that has a very high sequence identity to the GH12 domain of GuxA (Acel_0615) 92

from A. cellulolyticus. GuxA has activities against a wide variety of substrates including 93

carboxymethyl cellulose, arabinoxylan, xylan and xyloglucan (unpublished results, 94

William Adney). While GH12 has yet to be fully characterized, we used homology 95

modeling (3) to predict the enzyme class of GH12 and found that it strongly resembles an 96

endo-1,4-β-glucanase. These enzymes were chosen because of their relatively small 97

molecular weight, high stability and activity over a broad temperature and pH range using 98

only the catalytic domains (unpublished results, William Adney). We report the 99

successful expression of both enzymes in Z. mobilis by addressing several variables 100

related to gene expression. Additionally, the use of codon optimization was explored as a 101

way of enhancing heterologous expression in Z. mobilis. After successfully 102

demonstrating the intracellular expression of E1 and GH12 in Z. mobilis, we further show 103

that Z. mobilis is capable of secreting these proteins extracellularly through the use of 104

native secretion signals predicted to utilize two separate protein translocation pathways in 105

Z. mobilis the SecB-dependent and Twin Arginine Translocation (TAT) pathways. This 106


.asm.org/

Dow

nloaded from

http://aem.asm.org/


6

finding should prove valuable beyond the production of cellulases and could include all 107

classes of recombinant proteins. 108

109

Materials & Methods 110

Strains, media and growth conditions 111

Z. mobilis strains 39676 (ATCC), ZM4 (ATCC 31821) and CP4 (41) were routinely 112

grown in RMG medium (w/v 1% yeast extract, 0.2% KH2PO4, 2% glucose, and for 113

plates: 1.5% Bactoagar) at 30°C, and shaken at 120RPM. Where applicable, tetracycline 114

was added to a final concentration of 20 µg/mL for plates and 10 µg/mL for liquid 115

culture. 116

117

Z. mobilis transformations 118

The transformation protocol was adapted from Deanda et al. (10). 3-5 µg of plasmid 119

DNA was used to transform approximately 1010

cells per mL of Z. mobilis in 100 µL of 120

10% glycerol. A Biorad Gene Pulser was used with the following conditions: 200 Ω, 25 121

µF, and 1.6 kV in a 0.1 cm cuvette. Following electroporation, 1mL of mating medium 122

(50 g/L Glucose, 10g/L Yeast Extract, 5g/L Tryptone, 2.5g/L (NH4)2SO4, and 0.2g/L 123

K2HPO4, and 1mM MgSO4) was added to the cells then incubated at 30°C for at least 6 124

hours. 100-200µL of cells were then plated onto mating medium agar plates (without 125

MgSO4) supplemented with 20 µg/mL tetracycline and incubated at 30°C for 2-3 days 126

anaerobically. Positive transformants were identified by NotI-restriciton digestion of 127

purified plasmid DNA. 128

129


.asm.org/

Dow

nloaded from

http://aem.asm.org/


7

Gene synthesis, codon optimization and plasmid construction 130

The coding sequences of the catalytic domains of E1and GH12 from A. cellulolyticus 131

were codon optimized using Gene Designer (39) based on the codon bias of Z. mobilis 132

strain ZM4, and synthesized by DNA 2.0 (Menlo Park, CA). 133

Plasmids 134

Schematics of all plasmids used in this study are shown in Table I. All plasmids 135

have been sequence-verified and the Genbank accession numbers associated with novel 136

sequences are listed below. Using standard overlap PCR techniques, the gap promoter 137

region from Z. mobilis genomic DNA (ATCC strain 39676) was fused to the T7 138

terminator region from plasmid pET101/D-topo (Invitrogen, Carlsbad CA) separated by a 139

NotI restriction site to create plasmid pJL100. 140

To create plasmids pJL101 and pJL103, PCR products representing coding 141

sequences for E1 and GH12 were cloned into pFLAG-CTC (Sigma-Aldrich, St. Louis, 142

MO). A. cellulolyticus genomic DNA was used as the PCR template for the E1 and 143

GH12 coding sequences for plasmids pJL101 and pJL103. pJL101 encodes for the first 144

274 amino acid residues of GH12 while pJL103 encodes for amino acid residues 42-404 145

of E1. 146

Plasmids p25143 and p25144 were codon-optimized, synthesized, and sub-cloned 147

by DNA 2.0 (Menlo Park, CA) and encode the amino acid residues 42-422 of E1 and 148

amino acid residues 35-274 of GH12, both lacking the predicted native signal peptide. 149

These sequences entail the catalytic domains and are lacking the cellulose binding 150

domains (CBM). These sequences were then subcloned into the NotI site of vector 151

pZB188 (46) to create plasmids p25143 and p25144, respectively. 152


.asm.org/

Dow

nloaded from

http://aem.asm.org/


8

Plasmid pJL110 was created by PCR amplifying the Z. mobilis strain 39676 pdc 153

gene including extended 5’ (75 base pairs) and 3’ (122 base pairs) non-coding sequences 154

with flanking NotI sequences incorporated. This PCR product was Topo-TA cloned into 155

pYES2.1 (Invitrogen, Carlsbad, CA) to create plasmid pYes2.1-PDC. The E1 gene was 156

PCR amplified using primers with homology to the 5’ and 3’ non-coding sequences of Z. 157

mobilis pdc.. Primer sequences were as follows with E1-specific nucleotides shown in 158

lower case and Z. mobilis pdc homology shown as upper case: Forward: 159

CCTGATTCAGACATAGTGTTTTGAATATATGGAGTAAGCAatgtgtggaattgtgagcgg, 160

Reverse: 161

GGACGGGCTTTTCGCCTTAAGCTCTAAGTTTATTTAAAAAttagcttggactgggactgg 162

Saccharomyces cerevisiae strain w303 was transformed with the resulting PCR product 163

as well as KpnI-linearized pYES2.1-E1. Through endogenous homologous 164

recombination in yeast, the Z. mobilis pdc ORF was exchanged with the E1 ORF on 165

plasmid pYes2.1-E1 to create plasmid pYES2.1-PDC-E1-PDC. The E1 fragment 166

containing the 5’ and 3’ sequences of pdc was excised with NotI and ligated into pZB188 167

to create plasmid pJL110. 168

To create plasmids pJL111 and pJL116 the sequence representing the predicted 169

secretion signal of the phoC gene (ZM0130, 170

ATGATAAAAGTCCCGCGGTTCATCTGTATGATCGCGCTTACATCCAGCGTTCT171

GGCAAGCGGCCTTTCTCAAAGCGTTTCAGCTCAT ) was fused to the 5’ termini of 172

E1 and GH12 genes, respectively. For plasmid pJL112, the predicted secretion signal of 173

the predicted Z. mobilis ORF ZM0331 174

(ATGAAAAGAAAGCTTGGTCGTCGCCAGTTATTAACTGGCTTTGTTGCCCTTG175


.asm.org/

Dow

nloaded from

http://aem.asm.org/


9

GCGGTATGGCGATTACAGCTGGTAAGGCGCAGGCTTCT) was fused to the 5’ 176

terminus of the E1 gene sequence. 177

178

179

Immunoblots and CMC zymogram analysis 180

Following SDS-PAGE, cellular proteins were transferred to a polyvinylidene 181

fluoride (PVDF) membrane at a constant 200V for one hour. A mouse monoclonal αE1 182

antibody diluted 1:4000 in 3% milk in Tris-Buffered Saline Tween-20 (TBST) was added 183

to the PVDF membranes which were allowed to incubate for 2 hours at room 184

temperature. After washing the membranes with TBST they were incubated in TBST 185

containing 3% milk and a goat-anti-mouse alkaline phosphatase conjugated secondary 186

antibody (diluted 1:4000) for 1 hour at room temperature. The protocol used to perform 187

the carboxymethyl cellulose (CMC) zymograms is described by (38), except the reaction 188

buffer used was 50mM sodium citrate buffer, pH 7.0. 189

190

Total and Extracellular Fraction Preparations 191

For each strain an equal volume of cell culture was moved into two separate 192

microcentrifuge tubes. In one of the replicates, the cells were removed by two rounds of 193

centrifugation (5 minutes 15000 X g each) to create the extracellular fraction. Equal 194

volumes of the culture with cells (Total) and the extracellular fraction were treated with 195

10X BugBuster lysis buffer (Novagen) to create a 1x concentration of lysis buffer. Lysis 196

buffer was added to the extracellular fraction to ensure that the presence or absence of 197

lysis buffer had no effect on the enzyme activity assays performed on these fractions. 198


.asm.org/

Dow

nloaded from

http://aem.asm.org/


10

Samples were vortexed and incubated at room temperature for 20 minutes. Samples were 199

centrifuged (5 minutes 15000 X g) and the supernatants were moved to a new tube. 200

201

Subcelluar Fractionations 202

Cultures of Z. mobilis (50mL) were grown to the beginning of stationary phase 203

and cells were centrifuged at 4000 X g for 10 minutes. Cells were resuspended in 204

periplasting buffer (200mM TRIS-HCL, pH 7.5, 20% Sucrose, 1mM EDTA, and 2.5 205

million units of Lysozyme (.00625g/5 mL; Sigma L-6876) at a volume corresponding to 206

4 mL/g of wet weight of the cell pellet. Multiple incubation times were tested 207

empirically to find the longest time point where no more than 5% of the ADH activity 208

was found within the periplasmic fraction (typically 5 minutes; ADH assay detailed 209

below). This was to ensure maximal release of periplasmic contents, while minimizing 210

contamination with cytoplasmic contents. Following the incubation in periplasting 211

buffer, ice-cold H2O was added to a volume corresponding to 6mL/g of wet weight of the 212

original cell pellet. Cells were incubated on ice for 10 minutes and then centrifuged at 213

4°C for 10 minutes at 4000 X g. The periplasmic fraction (supernatant) was transferred 214

to a new tube, and BugBuster HT lysis buffer (Novagen) was added to the cell pellet at a 215

volume corresponding to 10 mL/g wet weight of the original cell pellet. Following 216

vortexing to ensure complete resuspension, this lysing reaction was incubated for 20 217

minutes at room temperature and centrifuged for 5 minutes at 15000 X g. The resulting 218

supernatant represented the cytoplasmic fraction. 219

220

221


.asm.org/

Dow

nloaded from

http://aem.asm.org/


11

E1 and GH12 Activity Assays 222

Protein lysates (10 µL of whole cell lysates, periplasmic and cytoplasmic 223

fractions) were added to 90 µL of reaction buffer [50mM sodium citrate, pH 7.0, and 224

.00125g/5mL 4-methylumbelliferyl β-D-cellobiopyranoside (Sigma Aldrich)] in a 96 225

well microtiter plate. Reactions were incubated at 50°C for 30-60 minutes, and analyzed 226

for fluorescence using a BMG Labtech FLUOstar Omega with an excitation of 355nm, 227

and an emission of 460nm. Measurements were taken at multiple time points to ensure 228

fluorescence-detection was not saturated. Each lysate was created from individual 229

cultures independently at least three times, and each of those was run in triplicate on the 230

same microtiter plate. Assays were blanked against the average of three independent 231

mock reactions. For each experiment, the highest raw value average was set to one and 232

the remaining samples were normalized as a fraction of one. This was done for both the 233

whole cell lysates and the individual sub/extra-cellular fractions. 234

235

ADH assays 236

44 µL of 50mM sodium pyrophosphate, pH 8.8 was added to a 96-well microtiter 237

plate, followed by 2µL of either the periplasmic or cytoplasmic fractions prepared as 238

described above. 50.6 µL of 15mM β-nicotinamide adenine dinucleotide hydrate (Sigma 239

N7004) and 3.4 µL 95% ethanol were added to the wells. The absorbance at 340nm was 240

measured immediately and subsequently every 2 minutes for 14 minutes using a BMG 241

Labtech FLUOstar Omega. The ∆A340nm was calculated and the relative contribution of 242

the periplasmic and cytoplasmic fraction to the total rate was calculated to determine the 243

percent localization of ADH activity. 244


.asm.org/

Dow

nloaded from

http://aem.asm.org/


12

Growth curve analysis and doubling time calculations 245

The protocol used to analyze growth data was adapted from Franden et al. (11). 246

Logarithimically growing cultures were used to inoculate 200µL of RMG medium to an 247

OD600 of 0.05 in a 100-well honeycomb plate. Using a Bioscreen C MBR analyzer 248

(Growth Curves USA, Piscataway, NJ), turbidometric measurements were made using a 249

wide band filter (420-580nm) every 15 minutes for 24 hours with no agitation. Growth 250

rate constant measurements were taken from the early portion of logarithmic growth 251

(from OD420-580 ~0.1 to 0.3), using the following equation: Y=Xo-eµt

where Y is the 252

absorbance at time “t”, Xo is the initial absorbance (near OD420-580= 0.1) and µ is the 253

growth rate. Doubling times shown in the text of the Results section were calculated as 254

µ divided by the natural log of 2. Error measurements (+/-) represent one standard 255

deviation. 256

257

DNA sequence accession numbers 258

GenBank accession numbers for the following expression cassettes are given in 259

parentheses: p25143 (E1-Codon Optimized; HM595415), p25144 (Gh12-Codon 260

Optimized; HM595416), pJL111 (pTac-Z130-E1-T1T2: HM595412), pJL112 (pTac-261

Z331-E1- T1T2; HM595413), pJL116 (pTac-Z130-Gh12-T1T2; HM595416) 262

263

Results 264

265

Zymomonas mobilis has endogenous cellulolytic activities. 266


.asm.org/

Dow

nloaded from

http://aem.asm.org/


13

During the process of investigating cell lysates of Z. mobilis for carboxymethyl 267

cellulose (CMC) activity, it became clearly evident that all of the Z. mobilis strains used 268

in this study (i.e., 39676, ZM4, and CP4) demonstrated hydrolytic activity against the 269

CMC substrate. This activity manifested itself as two, closely spaced, yet distinct 270

molecular weight bands on zymograms (Figure 1A, B). The apparent size of these bands 271

(Figure 1B) are consistent with the predicted molecular weight of the Z. mobilis CelA 272

protein [37 kDa;(30)], suggesting that one (or both) of the bands may represent CelA. 273

Additionally, when grown on agar plates containing CMC Z. mobilis but not E. coli can 274

clearly hydrolyze the CMC as can be seen by the zones of clearing (Figure 1C). 275

Importantly, celA is the only annotated cellulolytic gene found within the published 276

genome of Z. mobilis (http://cmr.jcvi.org) providing further support that the CM-277

cellulolytic activity seen in Figure 1 is likely attributable to CelA. The finding that many 278

Z. mobilis strains naturally express and secrete at least one endogenous cellulase provides 279

support that Z. mobilis might prove adept at expressing and secreting heterologous 280

cellulases. 281

282

Intracellular expression of heterologous cellulolytic enzymes in E. coli and Z. 283

mobilis. 284

An altered codon bias between A. cellulolyticus and Z. mobilis could hinder the 285

successful expression of E1 and GH12 in Z. mobilis. Since there are no commercially 286

available codon-enhanced strains of Z. mobilis, the issue of codon bias was initially 287

addressed by using a codon-enhanced strain of E. coli. Separate plasmids containing Ptac-288

driven genes encoding the E1 and GH12 endoglucanases (Acel-0614 and Acel-0619, 289


.asm.org/

Dow

nloaded from

http://aem.asm.org/


14

respectively) from A. cellulolyticus were introduced into a strain of E. coli designed to 290

enhance the expression of heterologous proteins that contain codons rarely used in E. 291

coli. Figure 2 shows that while expression of E1 and GH12 was not detected upon IPTG 292

induction in E. coli BL21-DE3 cells, both proteins were strongly induced in the codon 293

enhanced Rosetta2 strain of E. coli (EMD; Madison, WI). This data strongly suggests 294

that the differential codon bias between the host organism (A. cellulolyticus) and the 295

expression organism (E. coli) could be a major barrier to heterologous expression in E. 296

coli. By inference, this may also suggest that differential codon usage between A. 297

cellulolyticus and Z. mobilis, may have a detrimental effect on the expression of E1 and 298

GH12 in Z. mobilis. 299

To test the effect that differential codon bias might have on gene expression, the 300

gene sequence encoding the E1 catalytic domain was codon optimized for Z. mobilis 301

(DNA 2.0; Menlo Park, CA) and the synthesized gene was tested for its expression in Z. 302

mobilis. The expression of the native and codon-optimized (version “E1-c/o”) gene 303

sequence of the E1 catalytic domain (“E1”) was examined in multiple strains of Z. 304

mobilis. Both E1 and E1-c/o can be detected using immunoblot and zymogram gel 305

analysis (Figure 3). Surprisingly, both constructs were expressed nearly equally as well in 306

Z. mobilis, though the native E1 protein might have been expressed slightly better than 307

E1-c/o (Figure 3B and 3C), when total protein loading is taken into account (Figure 3A). 308

The fact that the codon-optimized version of E1 did not express significantly better than 309

the native E1 coding sequence suggests that either the codon optimization strategy 310

undertaken was suboptimal, or that differential codon usage bias was not a major obstacle 311

(or at least not the sole obstacle) to achieving higher levels of expression. 312


.asm.org/

Dow

nloaded from

http://aem.asm.org/


15

Expression of the codon optimized E1 gene sequence was also examined using 313

the promoter, and the 5’ and 3’ untranslated regions (UTRs) of the Z. mobilis pdc gene, 314

which is a highly transcribed gene with very stable mRNA (25). It was reasoned that this 315

strategy might increase E1 transcription levels and its mRNA stability thus increasing E1 316

protein expression. We compared the expression of this new construct with that of the 317

Ptac-driven constructs, and surprisingly found very low levels of E1 expression using the 318

pdc transcriptional unit (Figure 3). It should be noted that while Ppdc-driven E1 is 319

difficult to visualize in Figure 3B, it was, in fact, clearly visible on the immunoblot. To 320

ensure that the low level of E1 expression detected was not a strain-specific phenomenon, 321

the expression of the various E1 constructs was examined using multiple Z. mobilis 322

strains. While both Z. mobilis strains 39676 and ZM4 showed similar expression levels 323

of the E1 constructs, strain CP4 repeatedly showed a reduced level of expression for all 324

of the constructs suggesting that differences in gene expression can also be strain-325

specific. The possibility that the E1 protein was being expressed to a high level but was 326

escaping our detection by either being released into the supernatant or forming SDS 327

insoluble aggregates was ruled out by immunoblot analysis of the culture supernatant and 328

using the Agarose Gel Electrophoresis to Resolve Aggregates (AGERA) technique, 329

respectively ((40), data not shown). 330

The intracellular expression of GH12 from A. cellulolyticus in Z. mobilis (Strain 331

39676) was also examined. Using an identical approach to E1, the GH12 catalytic 332

domain was codon-optimized and subcloned it into a plasmid under control of Ptac. 333

Surprisingly, the level of GH12 expression observed in Z. mobilis stood in stark contrast 334

to that of E1. Figure 4A clearly shows that GH12 can be detected by Coomassie stained 335


.asm.org/

Dow

nloaded from

http://aem.asm.org/


16

SDS-PAGE gels (Figure 4A). The GH12 protein represented approximately 4.6% 336

(standard deviation: 1.3%; n=6) of the total cellular protein in logarithmically growing 337

cells (as measured by densitometry analysis of Coomassie-stained polyacrylamide gels), 338

This stands in contrast to the low levels of recombinant E1 protein produced which 339

represented 1.7 % (standard deviation: 0.2%; n=3) of the total protein. Furthermore, a 340

significant portion of the GH12 protein expressed in Z. mobilis was soluble (Figure 4A). 341

In addition, the protein was enzymatically active as evident by the zones of substrate 342

clearing on a CMC-zymogram (Figure 4B). 343

344

Extracellular secretion of heterologously expressed cellulases in Z. mobilis. 345

We next examined the capability of Z. mobilis to secrete both E1 and GH12 346

through the use of predicted secretion signals native to Z. mobilis. We chose two 347

independent secretion signals that are predicted to utilize two separate protein secretion 348

pathways. The first secretion signal was that of the Z. mobilis phoC gene (ZM0130; 349

predicted by Genome Atlas (http://www.cbs.dtu.dk/services/GenomeAtlas/show-350

subcell.php?KLSO=ASC&KLSK=ORGANISMSORT&kingdom=Bacteria&tableType=351

Secreted%20Proteins&segmentid=Zmobilis_ZM4_Main&secType=Cytoplasm) which 352

uses the SecB-dependent (Type II) pathway (34). The second secretion signal was that 353

belonging to a hypothetical protein (ZM0331) of Z. mobilis predicted by Genome Atlas to 354

utilize the Twin Arginine Translocation (TAT) pathway (18). These signal sequences 355

were fused onto the 5’ end of the coding sequence of the E1 catalytic domain to create 356

the plasmid constructs “Z130-E1” (pJL111) and “Z331-E1” (pJL112). The resulting 357

plasmids along with the control vector pZB188 and a plasmid containing an 358


.asm.org/

Dow

nloaded from

http://aem.asm.org/


17

intracellularly expressed version of E1 (p25143) were used to examine the cellular 359

localization of E1 in Z. mobilis cultures. Figure 5A shows an amido black stained PVDF 360

membrane containing the protein in either the total culture (“T”, lysate of whole cells 361

plus growth medium) or the extracellular fraction (“Ex”, mock-lysate of the growth 362

medium with the cells removed by centrifugation). Figure 5B shows an anti-E1 363

immunoblot of the membrane shown in Figure 5A and reveals the location of E1 in either 364

the total culture or extracellular fractions. This figure clearly shows that a significant 365

portion of Z130-E1 can be found extracellularly, while E1 without a secretion signal and 366

Z331-E1 can only be detected in the total fraction suggesting they are localized 367

intracellularly. Furthermore, it is interesting to note that the addition of the Z130 368

secretion signal appears to have increased the overall expression of E1 (Figure 5). 369

To ensure that the E1 enzyme found in the extracellular space was in fact due to 370

protein secretion, and not as a byproduct of passive release due to increased cell 371

death/lysis in the strains with E1 tagged with secretion signals, we examined the growth 372

medium for alcohol dehydrogenase (ADH), an enzyme activity found exclusively in the 373

cytoplasm and frequently used as a cytoplasmic marker (1, 5, 6, 29). While we were able 374

to detect ADH activity in a lysate of cells plus growth medium, we were unable to detect 375

any ADH activity in the culture medium alone suggesting that there was not a significant 376

increase in cell lysis (data not shown). In addition there were no significant differences 377

in the cell viability among the strains as measured by the Live/Dead BacLight bacterial 378

viability test (data not shown). Combined these findings suggest that the E1 protein 379

detected in the extracellular space was a result of protein translocation rather than 380

increased levels of cell death and release of the E1 protein due to cell lysis. 381


.asm.org/

Dow

nloaded from

http://aem.asm.org/


18

In order to determine how well the Z130 and Z331 signal sequences were 382

functioning to translocate the E1 protein to the periplasmic space, we examined the 383

subcellular localization of E1. To achieve this, periplasmic and cytoplasmic fractions in 384

each of the four strains were isolated and examined for the presence of E1. Figure 5C 385

shows the amido-black-stained PVDF membrane and represents the total protein in each 386

subcellular fraction. An anti-E1 immunoblot of the membrane shown in Figure 5D 387

shows that the periplasmic fractions of the strains harboring the E1-secretion plasmids 388

Z130-E1 and Z331-E1 contain more E1 than either the control or the strain harboring the 389

control E1 construct without a secretion signal (Figure 5D and 5E). The cellulolytic 390

activity present in the cytoplasmic, periplasmic and extracellular fractions was 391

determined using the fluorescent substrate, 4-methylumbelliferyl β-D-cellobiopyranoside 392

(MUC). The cellulolytic activity associated with the control E1 construct lacking a 393

secretion signal was found almost exclusively in the cytoplasm (Figure 5F). In contrast, 394

however a significant amount of the enzymatic activity in strains containing constructs 395

Z130-E1and Z331-E1 was found in the periplasmic or extracellular spaces. Importantly, 396

while Z331-E1 was undetectable in the extracellular fraction by immunoblot (Figure 5B), 397

its activity was clearly detected extracellularly as measured by MUC hydrolysis (Figure 398

5E). 399

We also examined the subcellular localization of GH12 and GH12 fused with the 400

Z130 secretion signal. An examination of the expression and activity of the subcellular 401

pools of GH12 by Coomassie-stained SDS-PAGE (Figure 6A) and CMC zymogram 402

analysis (Figure 6B), reveals several important findings. First, it is clear that the total 403

expression of Z130-GH12 is reduced when compared to GH12 without the secretion 404


.asm.org/

Dow

nloaded from

http://aem.asm.org/


19

signal (Figure 6A, lanes 2 and 3). Secondly, it appears that while both GH12 and Z130-405

GH12 show activity in the periplasmic fraction, when compared to the activity found in 406

the cytoplasmic or total fractions, Z130-GH12 contributes a relatively higher activity in 407

the periplasmic fraction. As the data presented in Figures 6A and 6B are qualitative by 408

nature, we confirmed this result and quantified the activity through the measurement of 409

MUC hydrolysis (Figure 6C). The lack of a secretion signal resulted in 96% of GH12 410

activity being localized within the cytoplasm, while the addition of the Z130 signal 411

resulted in a localization of 13% of the GH12 activity in the periplasm and 26% in the 412

extracellular space. Furthermore, no ADH activity was detected in the medium and cell 413

viability associated with each culture was indistinguishable between the strains, 414

suggesting that the extracellular pool of GH12 was in fact due to secretion rather than 415

heightened cell lysis. It is also important to note that contrary to the results obtained with 416

E1 (Figure 5), the Z130 signal served to decrease the overall expression of GH12 as 417

observed by Coomassie-stained polyacrylamide gel, CMC-Zymogram (Figure 6A and 418

6B) and total activity analysis (Figure 6C). Figure 6D qualitatively shows the 419

extracellular CMC-degrading activities of all of the strains examined in Figures 5 and 6. 420

Culture spots shown in the top panel were washed from the plate which was subsequently 421

stained with Congo red to reveal zones of CMC degradation. 422

In order to determine the overall effect of recombinant protein production and 423

secretion, we examined the growth rate of Z. mobilis strain 39676 harboring the various 424

expression constructs (Figure 6E). Doubling times for strains with the indicated plasmids 425

were as follows in RMG medium: Control (pZB188) 2.3h +/- .03, E1 (p25143) 2.7h +/ 426

0.00, Z130-E1 (pJL111) 2.83h +/- 0.51, Z331-E1 (pJL112) 3.06, Gh12 (p25144), 2.82 +/-427


.asm.org/

Dow

nloaded from

http://aem.asm.org/


20

0.04, and Z130-Gh12 (pJL116) 2.56 +/-0.07. These numbers indicate that while the 428

expression of E1 and Gh12 has a modest effect on the growth rate compared to the 429

control strain, the addition of the Z130 signal peptide does little to inhibit growth in the 430

case of E1 and actually enhances growth rate in the case of Gh12. Furthermore, the 431

addition of the Z331 signal peptide to E1 imparts a more detrimental effect on growth 432

rate. 433

434

Discussion 435

The results of our studies first revealed that Z. mobilis has the capacity to degrade 436

carboxymethyl cellulose extracellularly (Figures 1, 4, and 6). Rajnish et al. (2008) 437

identified the Z. mobilis celA gene, (ZMO1086) that shows β-1,4-endocellulolytic 438

activity when expressed in E. coli. However, these investigators were unable to detect 439

any cellulolytic activity in the Z. mobilis strain ZM4. We independently identified a 440

native CM-cellulolytic activity present in Z. mobilis strains 39676, CP4, and ZM4. While 441

the data presented in this report cannot definitively attribute the cellulolytic activity we 442

observed to CelA, the bands showing activity had a molecular weight consistent with that 443

predicted for CelA (Figure 1). While it is possible that one of the bands showing CMC 444

activity may represent an unidentified cellulase, we favor the hypothesis that the larger of 445

the two bands (Figure 1B) represents the full length version of CelA, while the smaller 446

band most likely represents the mature protein with its signal peptide removed. Our 447

reason for believing this is based on subcellular fractionation experiments detailed in 448

Figure 6B which show that the larger of the two bands is the only band present in the 449

cytoplasmic fractions, while both forms are present in the periplasmic fraction. As signal 450


.asm.org/

Dow

nloaded from

http://aem.asm.org/


21

peptides are typically removed in the periplasm (34), this is exactly what would be 451

expected if in fact the two bands represented the full length protein (i.e., protein plus 452

signal sequence) and the mature protein. While future identification of these proteins 453

will be required to validate this hypothesis, cellulolytic activity against CMC was 454

detected extracellularly in several Z. mobilis strains (Figure 1 C). This finding is 455

consistent with the fact that CelA contains a predicted secretion signal at the N-terminus 456

(4). Together these findings suggest that Z. mobilis may have evolved as a cellulose-457

degrading fermentative organism. Given the ability of Z. mobilis to produce at least one 458

cellulase and potentially others (Figure 1), there may be reason to believe that this 459

organism may harbor an environment conducive to the production of additional 460

heterologous cellulolytic enzymes. 461

We also demonstrated in this report the exogenous expression and extracellular 462

secretion in Z. mobilis of two endo-1,4-β-glucanases from A. cellulolyticus useful in the 463

degradation of pretreated lignocellulosic biomass. Importantly, both enzymes we 464

heterologously expressed in Z. mobilis (E1 and GH12 from A. cellulolyticus) were found 465

to be enzymatically active, yet any metabolic burden of their expression resulted in minor 466

changes in the growth rate of Z. mobilis. While we show approximately a 20% reduction 467

in the logarithmic growth rate of cells for cells expressing either E1 and Gh12 when 468

compared to a Z. mobilis control strain, fusing the Z130 secretion signal onto these genes 469

does not seem to impart major additional limitations. Conversely, cultures harboring the 470

Z331-E1 construct, have a much larger growth limitation. Our data, taken together with 471

the results of the Arfman et al. study (1992) suggest that Z. mobilis is capable of handling 472

high levels of additional protein expression before major growth rate limitations occur. 473


.asm.org/

Dow

nloaded from

http://aem.asm.org/


22

This is an important finding, as high level expression of cellulolytic enzymes will be 474

required for the future development of Z. mobilis as a CBP organism, and future efforts 475

should be made to minimize this defect. 476

The robust levels of expression observed in this study using the GH12 construct 477

certainly warrants further investigation. Not only was Z. mobilis able to produce GH12 at 478

levels approaching 5% of the total cellular protein, but this level of expression was a 479

stable throughout the entire logarithmic and stationary phases of growth. The expression 480

plasmids used in this study containing the Ptac lacked the lacI gene, so the cellulase genes 481

were being expressed constitutively without the need for isopropyl-β-D-482

thiogalactopyranoside (IPTG) induction. Constitutive cellulase expression will be an 483

important trait for a CBP organism, and the fact that GH12 can be expressed 484

constitutively to a high level in a largely soluble and enzymatically active form provides 485

an optimistic outlook for developing Z. mobilis as a CBP host. 486

We further show that Z. mobilis is capable of translocating both E1 and GH12 487

through the periplasmic space into the extracellular medium when the genes encoding 488

these cellulases are fused with the previously-uncharacterized N-terminal secretion 489

signals Z130 and Z331. These signal sequences presumably direct the translocation of 490

proteins via the SecB-dependent and TAT secretory pathways, respectively. As the N-491

terminal signals used by both secretion pathways function only to translocate the protein 492

to the periplasmic space (18, 34), it is very significant that when fused to E1 and GH12 493

nearly 50% and 40% of the respective protein translocates through the inner membrane to 494

reside either periplasmically or extracellularly (Figures 5 and 6). An interesting 495

observation is that while the presence of the Z130 secretion signal resulted in an 496


.asm.org/

Dow

nloaded from

http://aem.asm.org/


23

increased expression of the E1 enzyme, it resulted in a decreased expression of GH12 497

(Figures 5 and 6). The reasons for this are unclear, but one possibility is that perhaps the 498

more oxidizing periplasmic environment (28) favors the proper folding of E1 thus 499

increasing its stability. Regarding GH12, it is possible that since this protein is expressed 500

to such a high level (Figures 4 and 6), perhaps the incorporation of the secretion signal is 501

overloading the secretion pathway at some level, and GH12 is getting degraded at a faster 502

rate. A mechanistic hypothesis supposes that perhaps SecB is binding to the N-terminal 503

signal sequence keeping GH12 in its unfolded state, yet the overburdening of the 504

translocase complex is slowing the rate of periplasmic translocation thus leaving GH12 505

more susceptible to cytoplasmic degradation. Another possibility is that GH12 is being 506

efficiently translocated to the periplasmic space, yet periplasmic proteases are degrading 507

the protein at a faster rate than occurs cytoplasmically. A third possibility is that the 508

addition of the signal sequence itself reduces the translation rate of the GH12 protein. 509

While the levels of E1 and GH12 secretion demonstrated here certainly represent a 510

significant step towards achieving high level secretion, the fact remains that in the realm 511

of developing a CBP technology, any cellulolytic enzyme that remains localized within a 512

cell is essentially wasted regarding the degradation of extracellular biomass. Future 513

efforts will be directed to increasing the secretory capacity of Z. mobilis regarding 514

cellulolytic enzymes along three fronts: 1) Increasing the translocation through the inner 515

membrane to the periplasm, 2) Increasing the translocation through the outer membrane 516

to the extracellular space, and 3) Exploring the use of alternate secretion pathways such 517

as the type I secretion pathway which bypasses the two step secretion mechanism and 518

instead translocates proteins across both membranes (26). 519


.asm.org/

Dow

nloaded from

http://aem.asm.org/


24

Ultimately, several classes of cellulolytic enzymes will likely need to be co-expressed 520

in order to effectively break down lignocellulosic biomass. At a minimum, we expect 521

that the simultaneous expression of an endoglucanase, an exoglucanase, and a β-522

glucosidase would be required (13), although the expression of additional enzymes will 523

also quite likely be necessary. We have shown here the effective production and 524

secretion of two endo-1,4-β-glucanases, and future work will need to address the ability 525

of Z. mobilis to express the other two classes of enzymes. 526

We have shown that Z. mobilis can effectively express and secrete heterologously 527

expressed proteins, and while we personally envision this being useful in developing Z. 528

mobilis into a CBP organism, this could theoretically open up a new pipeline for the 529

production of other classes of valuable proteins. E. coli is one of several organisms that 530

have long been favored for high-level production of recombinant proteins. However, 531

despite extensive knowledge about recombinant protein production in E. coli, not all 532

expression attempts have been successful. Furthermore, E. coli is notoriously poor at 533

secreting heterologous proteins (23), which can be an advantageous route in the 534

expression of recombinant proteins. The ability of Z. mobilis to express and secrete 535

recombinant proteins may represent a complementary pathway to E. coli-based 536

expression systems, and may prove valuable to researchers in all disciplines requiring 537

recombinant protein production that is unsuccessful using E. coli. 538

Z. mobilis has proven to be an extremely valuable organism in the conversion of 539

biomass-derived sugars to ethanol and is currently being developed into a commercial 540

fermentation host as part of an integrated lignocellulosic ethanol process. The data 541

presented in this report shows the potential for Z. mobilis to extend its usefulness beyond 542


.asm.org/

Dow

nloaded from

http://aem.asm.org/


25

its fermentative abilities, and play a significant role in the degradation of pretreated 543

lignocellulosic biomass. Given the proven adeptness of Z. mobilis in industrial-scale 544

fermentation, the ability to express high levels of active cellulases shown in this study 545

and the capacity to secrete these enzymes, the foundation has been laid for further 546

investigations in the establishment of Z. mobilis as a CBP organism. While CBP might 547

be considered the ultimate goal, any significant production of cellulolytic enzymes by Z. 548

mobilis could be considered a success. As this would reduce the required loading levels 549

of exogenously-produced cellulases during simultaneous saccharification and 550

fermentation or co-fermentation, processes in which Z. mobilis has already been tried and 551

tested (14, 24, 36). 552

553

Acknowledgements 554

We gratefully thank Min Zhang, Larry Taylor, Yat-Chen Chou and Mary Ann 555

Franden for technical advice and invaluable discussions, and Philip Pienkos and Min 556

Zhang for a critical review of this manuscript. 557

558

References 559

1. Aldrich, H. C., L. McDowell, M. F. Barbosa, L. P. Yomano, R. K. Scopes, 560

and L. O. Ingram. 1992. Immunocytochemical localization of glycolytic and 561

fermentative enzymes in Zymomonas mobilis. J Bacteriol 174:4504-8. 562

2. Arfman, N., V. Worrell, and L. O. Ingram. 1992. Use of the tac promoter and 563

lacIq for the controlled expression of Zymomonas mobilis fermentative genes in 564

Escherichia coli and Zymomonas mobilis. J Bacteriol 174:7370-8. 565


.asm.org/

Dow

nloaded from

http://aem.asm.org/


26

3. Arnold, K., L. Bordoli, J. Kopp, and T. Schwede. 2006. The SWISS-MODEL 566

workspace: a web-based environment for protein structure homology modelling. 567

Bioinformatics 22:195-201. 568

4. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improved 569

prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 340:783-570

795. 571

5. Brestic-goachet, N., P. Gunasekaran, B. Cami, and J. Baratti. 1990. Transfer 572

and Expression of a Bacillus-Licheniformis Alpha-Amylase Gene in Zymomonas 573

mobilis. Archives of Microbiology 153:219-225. 574

6. Brestic-Goachet, N. G., P; Cami, B; Baratti, J 1989. Transfer and expression of 575

an Erwinia chrysanthemi cellulase gene in Zymomonas mobilis. Journal of 576

General Microbiology. Vol. 135:893-902. 577

7. Byun, M. O. K., J. B. Kaper, and L. O. Ingram. 1986. Construction of a New 578

Vector for the Expression of Foreign Genes in Zymomonas mobilis. Journal of 579

Industrial Microbiology 1:9-15. 580

8. Carere, C. R., R. Sparling, N. Cicek, and D. B. Levin. 2008. Third generation 581

biofuels via direct cellulose fermentation. International Journal of Molecular 582

Sciences 9:1342-1360. 583

9. Carey, V. C., S. K. Walia, and L. O. Ingram. 1983. Expression of a Lactose 584

Transposon (Tn951) in Zymomonas mobilis. Appl Environ Microbiol 46:1163-585

1168. 586


.asm.org/

Dow

nloaded from

http://aem.asm.org/


27

10. Deanda, K., M. Zhang, C. Eddy, and S. Picataggio. 1996. Development of an 587

arabinose-fermenting Zymomonas mobilis strain by metabolic pathway 588

engineering. Applied and Environmental Microbiology 62:4465-4470. 589

11. Franden, M. A., P. T. Pienkos, and M. Zhang. 2009. Development of a high-590

throughput method to evaluate the impact of inhibitory compounds from 591

lignocellulosic hydrolysates on the growth of Zymomonas mobilis. Journal of 592

Biotechnology 144:259-267. 593

12. Himmel, M. E., S. Y. Ding, D. K. Johnson, W. S. Adney, M. R. Nimlos, J. W. 594

Brady, and T. D. Foust. 2007. Biomass recalcitrance: engineering plants and 595

enzymes for biofuels production. Science 315:804-7. 596

13. Kumar, R., S. Singh, and O. V. Singh. 2008. Bioconversion of lignocellulosic 597

biomass: biochemical and molecular perspectives. J Ind Microbiol Biotechnol 598

35:377-91. 599

14. Lee, J. H., R. J. Pagan, and P. L. Rogers. 1983. Continuous Simultaneous 600

Saccharification and Fermentation of Starch Using Zymomonas mobilis. 601

Biotechnology and Bioengineering 25:659-669. 602

15. Lee, K. J., M. Lefebvre, D. E. Tribe, and P. L. Rogers. 1980. High Productivity 603

Ethanol Fermentations with Zymomonas mobilis Using Continuous Cell Recycle. 604

Biotechnology Letters 2:487-492. 605

16. Lee, K. J., M. L. Skotnicki, D. E. Tribe, and P. L. Rogers. 1980. Kinetic-606

Studies on a Highly Productive Strain of Zymomonas mobilis. Biotechnology 607

Letters 2:339-344. 608


.asm.org/

Dow

nloaded from

http://aem.asm.org/


28

17. Lee, K. J., D. E. Tribe, and P. L. Rogers. 1979. Ethanol-Production by 609

Zymomonas mobilis in Continuous Culture at High Glucose-Concentrations. 610

Biotechnology Letters 1:421-426. 611

18. Lee, P. A., D. Tullman-Ercek, and G. Georgiou. 2006. The bacterial twin-612

arginine translocation pathway. Annu Rev Microbiol 60:373-95. 613

19. Lejeune, A., D. E. Eveleigh, and C. Colson. 1988. Expression of an 614

Endoglucanase Gene of Pseudomonas fluorescens var. cellulosa in Zymomonas 615

mobilis. Fems Microbiology Letters 49:363-366. 616

20. Lynd, L. R. 1996. Overview and evaluation of fuel ethanol from cellulosic 617

biomass: Technology, economics, the environment, and policy. Annual Review of 618

Energy and the Environment 21:403-465. 619

21. Lynd, L. R., W. H. van Zyl, J. E. McBride, and M. Laser. 2005. Consolidated 620

bioprocessing of cellulosic biomass: an update. Current Opinion in Biotechnology 621

16:577-83. 622

22. Lynd, L. R., P. J. Weimer, W. H. van Zyl, and I. S. Pretorius. 2002. Microbial 623

cellulose utilization: fundamentals and biotechnology. Microbiology and 624

Molecular Biology Reviews 66:506-77, table of contents. 625

23. Makrides, S. C. 1996. Strategies for achieving high-level expression of genes in 626

Escherichia coli. Microbiol Rev 60:512-38. 627

24. McMillan, J. D., M. M. Newman, D. W. Templeton, and A. Mohagheghi. 628

1999. Simultaneous saccharification and cofermentation of dilute-acid pretreated 629

yellow poplar hardwood to ethanol using xylose-fermenting Zymomonas mobilis. 630

Applied Biochemistry and Biotechnology 77-9:649-665. 631


.asm.org/

Dow

nloaded from

http://aem.asm.org/


29

25. Mejia, J. P., M. E. Burnett, H. An, W. O. Barnell, K. F. Keshav, T. Conway, 632

and L. O. Ingram. 1992. Coordination of expression of Zymomonas mobilis 633

glycolytic and fermentative enzymes: a simple hypothesis based on mRNA 634

stability. J Bacteriol 174:6438-43. 635

26. Mergulhao, F. J., D. K. Summers, and G. A. Monteiro. 2005. Recombinant 636

protein secretion in Escherichia coli. Biotechnol Adv 23:177-202. 637

27. Misawa, N., T. Okamoto, and K. Nakamura. 1988. Expression of a Cellulase 638

Gene in Zymomonas mobilis. Journal of Biotechnology 7:167-178. 639

28. Missiakas, D., and S. Raina. 1997. Protein folding in the bacterial periplasm. J 640

Bacteriol 179:2465-71. 641

29. Omullan, P. J., T. Chase, and D. E. Eveleigh. 1992. Purification and Some 642

Properties of Extracellular Invertase-B from Zymomonas mobilis. Applied 643

Microbiology and Biotechnology 38:341-346. 644

30. Rajnish, K. N., G. M. K. Choudhary, and P. Gunasekaran. 2008. Functional 645

characterization of a putative endoglucanase gene in the genome of Zymomonas 646

mobilis. Biotechnology Letters 30:1461-1467. 647

31. Rogers, P. L., Y. J. Jeon, K. J. Lee, and H. G. Lawford. 2007. Zymomonas 648

mobilis for Fuel Ethanol and Higher Value Products. Adv Biochem Eng 649

Biotechnol. 650

32. Rogers, P. L., K. J. Lee, and D. E. Tribe. 1980. High Productivity Ethanol 651

Fermentations with Zymomonas mobilis. Process Biochemistry 15:7-&. 652


.asm.org/

Dow

nloaded from

http://aem.asm.org/


30

33. Rogers, P. L., K. J. Lee, and D. E. Tribe. 1979. Kinetics of Alcohol Production 653

by Zymomonas mobilis at High Sugar Concentrations. Biotechnology Letters 654

1:165-170. 655

34. Sandkvist, M. 2001. Biology of type II secretion. Mol Microbiol 40:271-83. 656

35. Skotnicki, M. L., K. J. Lee, D. E. Tribe, and P. L. Rogers. 1981. Comparison 657

of Ethanol-Production by Different Zymomonas Strains. Applied and 658

Environmental Microbiology 41:889-893. 659

36. Spangler, D. J., and G. H. Emert. 1986. Simultaneous Saccharification 660

Fermentation with Zymomonas mobilis. Biotechnology and Bioengineering 661

28:115-118. 662

37. Swings, J., and J. Deley. 1977. Biology of Zymomonas. Bacteriological Reviews 663

41:1-46. 664

38. Taylor, L. E., 2nd, B. Henrissat, P. M. Coutinho, N. A. Ekborg, S. W. 665

Hutcheson, and R. M. Weiner. 2006. Complete cellulase system in the marine 666

bacterium Saccharophagus degradans strain 2-40T. J Bacteriol 188:3849-61. 667

39. Villalobos, A., J. E. Ness, C. Gustafsson, J. Minshull, and S. Govindarajan. 668

2006. Gene Designer: a synthetic biology tool for constructing artificial DNA 669

segments. Bmc Bioinformatics 7:-. 670

40. Weiss, A., C. Klein, B. Woodman, K. Sathasivam, M. Bibel, E. Regulier, G. 671

P. Bates, and P. Paganetti. 2008. Sensitive biochemical aggregate detection 672

reveals aggregation onset before symptom development in cellular and murine 673

models of Huntington's disease. Journal of Neurochemistry 104:846-858. 674


.asm.org/

Dow

nloaded from

http://aem.asm.org/


31

41. Yablonsky, M. D., A. E. Goodman, N. Stevnsborg, O. G. Delima, J. O. F. 675

Demorais, H. G. Lawford, P. L. Rogers, and D. E. Eveleigh. 1988. Zymomonas 676

mobilis Cp4 - a Clarification of Strains Via Plasmid Profiles. Journal of 677

Biotechnology 9:71-79. 678

42. Yanase, H., J. Kurii, and K. Tonomura. 1986. Construction of a Promoter-679

Cloning Vector in Zymomonas mobilis. Agricultural and Biological Chemistry 680

50:2959-2961. 681

43. Yanase, H., K. Nozaki, and K. Okamoto. 2005. Ethanol production from 682

cellulosic materials by genetically engineered Zymomonas mobilis. Biotechnol 683

Lett 27:259-63. 684

44. Yoon, P., Pack. 1988. Transfer of Bacillus subtilis Endo-β-1,4-glucanase gene 685

into Zymomonas anaerobia. Biotechnology letters 10:213-216. 686

45. Zhang, M., C. Eddy, K. Deanda, M. Finkestein, and S. Picataggio. 1995. 687

Metabolic Engineering of a Pentose Metabolism Pathway in Ethanologenic 688

Zymomonas-mobilis. Science 267:240-243. 689

46. Zhang, M., C. Eddy, K. Deanda, M. A. Franden, M. Finkelstein, and S. 690

Picataggio. 1995. Metabolic Engineering of Zymomonas mobilis for Ethanol-691

Production from Renewable Feedstocks. Abstracts of Papers of the American 692

Chemical Society 209:115-BTEC. 693

47. Zhang, M., M. A. Franden, M. Newman, J. Mcmillan, M. Finkelstein, and S. 694

Picataggio. 1995. Promising Ethanologens for Xylose Fermentation - Scientific 695

Note. Applied Biochemistry and Biotechnology 51-2:527-536. 696

697


.asm.org/

Dow

nloaded from

http://aem.asm.org/


32

Figure Legends 698

Figure 1: Activity of the native cellulolytic proteins in Z. mobilis strains. A) 699

Coomassie stained polyacrylamide gel. B) Carboxymethyl cellulose (CMC) zymogram. 700

C) Patched colonies of Z. mobilis and E. coli growing on an RMG-CMC plate, and same 701

plate with cells removed and stained with Congo red to reveal areas of CMC degradation. 702

Figure 2: Expression of E1 and GH12 in E. coli strains Bl21-DE3 and Rosetta 2. A) 703

Coomassie stained polyacrylamide gel of protein lysates from E. coli strains BL21-DE3 704

and Rosetta 2 harboring plasmids pJL101 (“ E1”), and pJL103 (“GH12”) with (+) or 705

without (-) protein induction with 1 mM IPTG 706

Figure 3: Expression of various E1 constructs in multiple strains of Z. mobilis. 707

Protein lysates from Z. mobilis strains 39676, CP4, and ZM4 transformed with the 708

plasmids pZB188 (“control”), pJL113 (“Ptac-E1”), p25143 [“Ptac-E1 (c/o)], and pJL110 709

(“Ppdc-E1”) were run identically on two independent 12% polyacrylamide gels 710

supplemented with 0.12% carboxymethyl cellulose (CMC). A) A PVDF membrane 711

stained with amido black to show total protein. B) Immunoblot probed with an α-E1 712

antibody. C) A CMC zymogram performed on the second of two duplicate 713

polyacrylamide gels to show cellulolytic activity. E1 activity is represented by the upper 714

band, and cellulolytic activity endogenous to Z. mobilis can be seen by the lower band. 715

Figure 4: Expression, solubility analysis, and activity of E1 and GH12 in Z. mobilis 716

strain 39676. Protein lysates from Z. mobilis strain 39676 transformed with pZB188 717

(“control”), p25144 (“GH12”), and p25143 (“E1”) were run identically on two 718

independent 12% polyacrylamide gels supplemented with 0.12% carboxymethyl 719


.asm.org/

Dow

nloaded from

http://aem.asm.org/


33

cellulose (CMC). A) Coomassie stain of one of the duplicate polyacrylamide gels 720

showing total protein. The arrow denotes the location of the GH12 and E1 proteins. B) A 721

CMC zymogram performed on the second of two duplicate polyacrylamide gels designed 722

to show cellulolytic activity. 723

Figure 5: Extracellular secretion, and subcellular localization of E1 in Z. mobilis 724

strain 39676. A) Amido black stained PVDF membrane showing Total (“T”) and 725

Extracellular Medium (“Ex”) protein lysate fractions, to show total protein load. B) 726

Anti-E1 immunoblot of the membrane in “A”. C) Amido black stained PVDF 727

membrane showing total protein load of protein lysates derived from Z. mobilis 728

expressing multiple versions of E1. “Cp” and “Pp” represent the cytoplasmic and 729

periplasmic fractions, respectively. D) Anti-E1 immunoblot of the membrane in “C”. E) 730

Relative quantification of E1 activity against methylumbelliferyl cellobiopyranoside 731

(MUC) in periplasmic, cytoplasmic and extracellular fractions. Relative total activity of 732

equivalent whole cell lysates from the indicated strains is shown in the bottom panel to 733

highlight differential expression between the strains. 734

735

Figure 6: Extracellular secretion, and subcellular localization of Gh12 in Z. mobilis 736

strain 39676. Whole cell protein lysates, periplasmic and cytoplasmic fractions derived 737

from Z. mobilis strain 39676 transformed with plasmids pZB188 (“control”), p25144 738

(“GH12”) and pJL116 (“Z130-GH12”) were run identically on two independent 12% 739

polyacrylamide gels supplemented with 0.12% carboxymethyl cellulose (CMC). A) 740

Coomassie stained gel to show total protein. B) A CMC zymogram performed on the 741

second of two duplicate polyacrylamide gels designed to show cellulolytic activity. C) 742


.asm.org/

Dow

nloaded from

http://aem.asm.org/


34

Relative quantification of GH12 activity against methylumbelliferyl cellobiopyranoside 743

(MUC) in periplasmic, cytoplasmic and extracellular fractions. Relative total activity of 744

equivalent whole cell lysates from the indicated strains is shown in the bottom panel to 745

highlight differential expression between the strains. D) Z. mobilis strain 39676 746

transformed with plasmids pZB188 (“control”), p25143 (“E1”), p25144 (“GH12”), 747

pJL111 (“Z130-E1”), pJL112 (“Z331-E1”), and pJL116 (“Z130-GH12”) were spotted 748

onto an agar plate containing 2% glucose and 0.12% CMC. After 18 hours of anaerobic 749

growth at 30°C, plates were photographed and cells were washed off. The plate was 750

subsequently stained with 0.2% Congo Red and destained with 1M NaCl and 751

photographed again to show CMC degradation. E) Growth curve analysis of Z. mobilis 752

strain 39676 in RMG harboring the plasmids: Control (pZB188; closed diamonds), E1 753

(p25143; open diamonds), Z130-E1 (pJL111; closed triangles), Z331-E1 (pJL112; open 754

triangles), Gh12 (p25144; closed circles), and Z130-Gh12 (pJL116; open circles). 755

756

Table I: Plasmids used in this study. Plasmid names and relevant expression elements 757

are shown graphically. For E1 and GH12 plasmids, amino acids that are encoded for are 758

shown in parentheses. 759

760


.asm.org/

Dow

nloaded from

http://aem.asm.org/

50

37

75

Figure 1

A B

C Z. mobilis E. coli

Strain: CP4 ZM439676 Bl21-DE3

39676

CP4

ZM4

kDa

Bl21-DE3

39676

CP4

ZM4

Bl21-DE3


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Figure 2

E1 Gh12

Bl21-DE3

IPTG: - - - -+ + + +

E1 Gh12

Rosetta 2

100

50

37

25

20

15

kDa


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Fig

ure 3

CP

4

control

Ptac-E1

Ptac-E1 (c/o)

ZM

4

Ppdc-E1

control

Ptac-E1

Ptac-E1 (c/o)

Ppdc-E1

control

Ptac-E1

Ptac-E1 (c/o)

Ppdc-E1

Z. m

obilis

Strain

:

Plasm

id:

39676

50

37

25

20

kD

a

50

37

25

2050

37

25

20

C AB


.asm.org/

Dow

nloaded from

http://aem.asm.org/

37

25

20

37

25

20

Figure 4

Soluble Insoluble

ctrl

Gh

12

E1

ctrl

Gh

12

E1

kDa

A

B


.asm.org/

Dow

nloaded from

http://aem.asm.org/

FIGURE 5

Control

T Ex T Ex T Ex T Ex

E1 Z130-E1 Z331-E1

50

37

25

20

50

37

25

20

kDa:

kDa:

Cytoplasmic

Periplasmic

Extracellular

Control E1 Z331-E1Z130-E1

Nrm

aliz

ed A

ctiv

ity

0

1

0.8

0.6

0.4

0.2

Relative Total

Activity:0 0.38 (+/- .039) 1 (+/- 0.018) 0.32 (+/- 0.028)

9864

50

36

kDa:A.

B. D.

C.

E.

Cp Cp CpCpPp PpPpPp

Control E1 Z130-E1 Z331-E1

22

16

9864

50

36

kDa:

22

16


.asm.org/

Dow

nloaded from

http://aem.asm.org/

FIGURE 6

Total

Contr

ol

Gh12

Z130-G

h12

Contr

ol

Gh12

Z130-G

h12

Contr

ol

Gh12

Z130-G

h12

Cytoplasm Periplasm

50

37

25

20

kDa:75

50

37

25

20

kDa:

75

Control Gh12 Z130-Gh12

Cytoplasmic

Periplasmic

Extracellular

0

0.2

0.4

0.6

0.8

1

Control E1 Gh12

Z130-

Gh12

Z331-

E1

Z130-

E1

A.

Relative

Total Activity: 0 1 (+/- .029) 0.29 (+/- .049)

Norm

aliz

ed A

ctiv

ity

0

1.2

1.0

0.8

0.6

0.4

0.2

OD

420-5

80

0 252015105Time (h)

B.

E.

D.

C.


.asm.org/

Dow

nloaded from

http://aem.asm.org/

pZB188 (Zhang et al., 1995)N/A

pFLAG-CTC Sigma Aldrich (St. Louis, MO)N/A

Zm-PgappJL100 This studypZB188

Zm-Pgap XynApJL100-XynA This studypJL100

pJL101 Ptac Gh12 (AA’s1-274) This studypFLAG-CTC

Ptac E1 (AA’s 42-404)pJL103 This studypFLAG-CTC

Ptac XynApJL105 This studypFLAG-CTC

Ptac E1 (AA’s 42-404)pJL113 This studypZB188

E1-c/o (AA’s 42-404)Zm-5’ & Ppdc Zm-pdc3’ regionpJL110 This studypZB188

Ptac E1-c/o (AA’s 42-404)p25143 This studypZB188

Ptac Gh12-c/o (AA’s1-274)p25144 This studypZB188

Plasmid Expression Schematic Parent vector Source

TABLE I

Ptac Gh12-c/o (AA’s1-274)pJL116 This studypZB188Z130

PtacpJL111 This studypZB188Z130 E1-c/o (AA’s 42-404)

PtacpJL112 This studypZB188Z331 E1-c/o (AA’s 42-404)


.asm.org/

Dow

nloaded from

http://aem.asm.org/

heterologous expression and extracellular secretion of...

Documents