Abstract

Ubiquitin is a small compact, globular, heat stable protein found in all

the eukaryotes . Among the eukaryotes it is highly conserved, differing in only

three residues between yeast and humans. This conservation of residues implies

that some or all residues are important in structural as well as functional aspects

of the protein. It is found throughout the cell (thus, giving rise to its name) and

can exist either in free form or as part of a complex with other proteins. In the

latter case, ubiquitin is attached (conjugated) to proteins through a covalent

bond between the glycine at the C-terminal end of ubiquitin and the side chains

of lysine on the proteins. Ubiquitin helps in the docking of the various protein

substrates to the proteasomes for their degradation .

Previously in the lab various mutants of ubiquitin had been obtained by the

error prone PCR method. The mutants were selected by expressing

the protein in temperature sensitive ubi4 deletion mutants of

ubiquitin. Most of the mutations in ubiquitin gene failed to complement UBI4

phenotype under heat shock. Only one of the mutants caused cell lysis, even at

permissive temperature. Sequencing of the mutant gene showed four completely

novel amino acid substitutions. They are namely, Ser20 to Phe, Ala46 to Ser,

Leu50 to Pro and Ile61 to Thr. The Functional characterization of the above

single mutants revealed that more than one single mutant may be

responsible for the lethality seen . The construction and study of the

functional aspects of the double mutants form part of the work.

1

INTRODUCTION

2

Ubiquitin :

Ubiquitin is a small protein universally present in the eukaryotic cells. It

consists of a single 8565Da polypeptide chain of 76 amino acids. It has no

disulfide bonds and cofactors. The Ubiquitin molecule is extremely resistant to

tryptic digestion despite the presence of seven lysine residues and four arginine

residues. It is stable over a wide range of pH and temperature conditions. It has

half-life of 2hours. The protein has a pronounced hydrophobic core; of the 21

valine, leucine, isoleucine, and methionine residues, 16 are buried within the

interior of the molecule. The molecule comprises a compact globular domain that

consists of a five-stranded β-sheet and an α-helix and flexible tail formed by four

protruding residues. The ubiquitin tail has essential residues Leu73, Arg74,

Gly75 and Gly76. Gly75 and Gly76 are important for ubiquitin conjugation and

deubiquitination1. A hydrophobic patch including Leu8, Ile44 and Val70 is

required for proteasome degradation and plays a critical role in endocytosis. Phe4

and adjacent residues are important for the endocytic role of ubiquitin but do not

function in proteasome binding and degradation2.

Ubiquitin is most conserved protein from yeast to humans. This high degree

of conservation has been considered indicative of the importance of each amino

acid for the functionality of ubiquitin. It highlights the importance of ubiquitin in

regulating the degradation of proteins as well as other functions such as cell-cycle

control3, signal transduction, neuronal 4 and immune function5.

Ubiquitin structure

Secondary Structure6:

3

Figure 1- Ubiquitin’s secondary structure has three and one-half turns of α-helix, a

short piece of 310 helix (a helix with 3 residues per turn instead of 3.6 for α-

helices), a mixed β-sheet that contains five strands, and six reverse turns. Its core is

organized in a β(2)-α-β(2) fashion known as the β-grasp fold.

Tertiary structure1:

4

Machinery of ubiquitin- proteasome system7,8

In general, ubiquitylation occurs as a result of the sequential action of three

classes of enzymes, E1 or ubiquitin activating enzyme, E2 or ubiquitin

conjugating enzyme, and E3 or ubiquitin protein ligase. E1, the first enzyme in the

ubiquitylation pathway, forms a thiol-ester bond between its active site cysteine

and the carboxyl-terminal glycine of ubiquitin. The activated ubiquitin on E1 is

subsequently transferred to the active site cysteine of an E2 by

transthioesterification. E3 binds ubiquitin-charged E2 and substrate and facilitates

formation of an isopeptide linkage between the carboxyl terminal glycine of

ubiquitin and the ε-amino group of an internal lysine residue on the substrate, or an

ubiquitin already attached to the protein. In some cases ubiquitin is attached to the

free α-amino group of the substrate rather than to a lysine.

E1 Enzyme –

It is generally known that a single essential E1 governs ubiquitylation. In

mammals utilization of two translation initiation sites results in two E1 isoforms

referred to as E1a and E1b9. Cells expressing a temperature-sensitive E1 first led

to the discovery that ubiquitylation is essential for cell cycle progression and

provided in vivo evidence of its role in the proteolysis of short-lived proteins10. To

activate ubiquitin, E1 binds to Mg2+ATP and subsequently to ubiquitin, forming a

5

Figure 2

A structural view of human ubiquitin

resolved at 1.80 resolution X-ray

crystallography with helices in purple, the β-

sheet in blue, and coil in grey.

ubiquitin adenylate that serves as the donor of ubiquitin to the active cysteine in

E111. Each fully loaded E1 carries two molecules of ubiquitin, one as a thiol- ester

and the other as an adenylate. The activated ubiquitin is then transferred to the

active site cysteine in E2. The carboxyl-terminal glycine of ubiquitin is essential

for its activation by E1.

E2 Enzyme –

The S. cerevisiae genome encodes a total of 13 E2-like proteins (Ubc1-

Ubc13)12. Mammalian genomes include over 100 E2 domains. A conserved ~15

amino acid core domain (UBC) that includes an invariant cysteine that accepts

ubiquitin from E1 is the hallmark of E2s. These sequences may either facilitate or

preclude interactions with specific E3s13.

Similarly, the amino acid composition in predicted or defined regions of

contact between E2 and E3 may affect productive E2-E3 interactions. With few

exceptions E2s range from 14 to 36 kDa. E2s are subdivided on the basis of their

distinct primary sequences, presumably reflecting their different specificities for

their cognate E3s. For example, class I E2s, such as UBC4, UBC5, UBC7, and

UBC9-13 consist exclusively of UBC domain and may require their cognate E3s

for recognition of substrates, since they cannot alone transfer ubiquitin to

substrates. Class II (UBC1, UBC2/RAD6, UBC3/CDC34, UBC6, and UBC8),

class III (UBC6), and class IV E2s contain unique carboxy or amino terminal

extensions or both that may mediate substrate specificity as well as intracellular

localization.

E3 Enzyme –

E3 ligases or ligase complexes recognize specific motifs on their substrate(s)

and catalyze the transfer of ubiquitin directly or indirectly from a thioester

intermediate from their cognate E2 to form an amide isopeptide bond between

protein substrate and ubiquitin.

6

There are various types of E3-type ligases-

a) HECT Type ligases - A family of proteins that have a highly conserved region

of approximately 350 amino acids similar to the C-terminus of E6-APs. An

active cysteine residue in the C terminus, which forms a high-energy thio-ester

bond with Ub and constitutes a necessary step for the Ub transfer to the substrate14.

b) Ring finger type ligases - They have common 40 to 100 amino acid RING

domain. The RING class of E3 enzymes is further subdivided into the plant

homeobox domain/leukemia-associated protein and U-box families15,16. The RING

finger is defined by eight conserved cysteines and histidines that together

coordinate two zinc ions in a cross-braced fashion [CX2CX(9–39)CX(1–3)HX(2–

C/HX2CX(4–48)CX2C]17.

Proteasome18 –

Proteasome consists of two major assemblies- 28-subunit core particle (CP,

also known as the 20S particle) and a regulatory particle. The CP is a barrel-like

structure whose subunits are arranged in four stacked seven membered rings. The

proteasome’s proteolytic active sites are in internal space of the CP. Regulatory

particle (RP, also known as the 19S particle /PA700) or 19S regulatory complex,

consisting of a lid and a base that binds to the 20S particle to form the 26S

proteasome. The lid recognizes ubiquitinated protein substrates, the base, which

contains six ATPases and caps the end of the 20S proteasome core, unfolds

protein substrates in an ATP-dependent manner.

Ubiquitin mediated protein degradation pathway19 -

7

Figure 3-The pathway can be divided into 3 steps- a) First step (activation)- In this the carboxyl group of Gly-76 of ubiquitin is activated by ubiquitin-activating enzyme (E1) in a two step mechanism - formation of ubiquitinyl- adenylate intermediate, and transfer of this activated UB on to active cys residue on E1. b) Second step - activated ubiquitin is then transferred by transacylation reaction on to a thiol group of an active site Cys residue of E2. c) Third step- ubiquitin is transferred to a target protein, forming an isopeptide bond between the C-terminal glycine of ubiquitin and the ε- amino group of a lysine residue on the target protein .

Substrate Recognition

The N-end rule relates the in vivo half life of a protein to the identity

of its N terminal residue and the underlying proteolytic

pathway is called the N-end rule pathway (Fig. 6). Its Ub ligases

target protein substrates that bear specific destabilizing N-

terminal residues. The corresponding degradation signal (degron),

called the N-degron, consists of a substrate destabilizing N-

terminal residue and an internal Lys residue, the latter being the

site of formation of a substrate- linked poly-Ub chain. A

ubiquitylated substrate is processively degraded by the 26S

proteasome. Because an N-degron must be produced through a proteolytic

cleavage that yields a destabilizing N-terminal residue, a nascent N-end rule

substrate contains a cryptic N-degron, called a pro-degron20

8

Primary Destabilizing Residues21:

Destabilizing activity of these N-terminal residues, denoted N-dP, requires their

physical binding by a protein called N-recognin or E3. In eukaryotes, the type 1

binding site of N-recognin binds N-terminal Arg, Lys, or His, a set of basic N-

dP residues, whereas the type 2 site binds N-terminal Phe, Leu, Trp, Tyr, or Ile-a

set of bulky hydrophobic N-dP residues.

Secondary Destabilizing Residues:

These N-terminal residues denoted N-ds, are Asp and Glu in yeast; and Asp, Glu,

and Cys in mammalian cells. In eukaryotes, destabilizing activity of N-ds residues

requires their accessibility to Arg-tRNA-protein transferase.

Tertiary Destabilizing Residues:

N-terminal Asn and Gln residues denoted N-dt. Destabilizing activity of

N-dt residues requires their accessibility to N-terminal amidohydrolase (Nt-

amidase).

Stabilizing Residues:

A stabilizing N-terminal residue is a "default" residue, in that it is stabilizing

because targeting components of an N-end rule pathway do not bind to it.

9

Figure 4 - THE N- End rule pathway – the primary destabilizing residues are converted into Secondary destabilizing residues by N-ter amidases. This secondary residues are converted into ter destabilizing residues by Arg-transferase and subsequently recognized and degraded by the 26S proteasome pathway.

Biochemical Profile of Yeast Ubiquitin (Information is generated from ProtParam online tool present on ExPASy Proteomics Server)

Protein sequence: 10 20 30 40 50MQIFVKTLTG KTITLEVESS DTIDNVKSKI QDKEGIPPD QRLIFAGKQL 60 70EDGRTLSDYN IQKESTLHLV LRLRGG

- Number of amino acids: 76- Molecular weight: 8556.7- Theoretical pI: 6.56- Amino acid composition: Ala (A) 1 1.3% Arg (R) 4 5.3% Asn (N) 2 2.6% Asp (D) 6 7.9% Cys (C) 0 0.0% Gln (Q) 6 7.9% Glu (E) 5 6.6% Gly (G) 6 7.9% His (H) 1 1.3% Ile (I) 7 9.2% Leu (L) 9 11.8% Lys (K) 7 9.2% Met (M) 1 1.3% Phe (F) 2 2.6% Pro (P) 2 2.6% Ser (S) 5 6.6% Thr (T) 7 9.2% Trp (W) 0 0.0% Tyr (Y) 1 1.3% Val (V) 4 5.3% Pyl (O) 0 0.0% Sec (U) 0 0.0%

10

Yeast Ubiqutin Gene family22

There is family of four ubiquitin-coding loci in the yeast Saccharomyce cerevisiae. UBI1, UBI2 and UBI3 encode hybrid proteins in which ubiquitin is fused to some 'tail' amino acid sequences coding for ribosomal proteins. The ubiquitin coding elements of UBI1 and UBI2 are interrupted at identical positions by non-homologous introns. UBI1 and UBI2 encode identical 52-residue tails, whereas UBI3 encodes a different 76-residue tail. The tail amino acid sequences are highly conserved between yeast and mammals. Each tail contains a putative metal-binding , nucleic acid-binding domain of the form Cys-X2-4-Cys-X2_15-Cys-X2-4-Cys, suggesting that these proteins may function by binding to DNA. The fourth gene, UBI4 , encodes a polyubiquitin precursor protein containing five ubiquitin repeats in a head-to-tail, spacerless arrangement. All four ubiquitin genes are expressed in exponentially growing cells,while in stationary-phase cells the expression of UBI1 and UBI2 is repressed. The UBI4 gene, which is strongly inducible by starvation, high temperatures and other stresses, contains in its upstream region homologies to the consensus 'heatshock box' nucleotide sequence.

Figure 5- Ubiquitin gene family comprises UBI1,UBI2,UBI3 fused with ribosomal proteins.

Conservation of the deduced amino acid sequences of the tails of UBI1-UBI3 protein between yeast and mammals:

11

UBIQUITIN GENE SEQUENCE UBIQUITIN GENE SEQUENCE

[YEAST SYNTHETIC] [YEAST SYNTHETIC]

12

Bgl II Hpa I

1 ATG CAG ATC TTC GTC AAG ACG TTA ACC GGT 30 Met Gln Ile Phe Val Lys Thr Leu Thr Gly

1 5 10

Xbal I

31 AAA ACC ATA ACT CTA GAA GTT GAA TCT TCC 60 Lys Thr Ile Thr Leu Glu Val Glu Ser Ser

11 15 20

61 GAT ACC ATC GAC AAC GTT AAG TCG AAA ATT 90 Asp Thr Ile Asp Asn Val Lys Ser Lys Ile

21 25 30

Bsm I

91 CAA GAC AAG GAA GGC ATT CCA CCT GAT CAA 120 Gln Asp Lys Glu Gly Ile Pro Pro Asp Gln

31 35 40

Xho I

121 CAA AGA TTG ATC TTT GCC GGT AAG CAG CTC 150 Gln Arg Leu Ile Phe Ala Gly Lys Gln Leu

41 45 50

Xho I

151 GAG GAC GGT AGA ACG CTG TCT GAT TAC AAC 180 Glu Asp Gly Arg Thr leu Ser Asp Tyr Asn

51 55 60

Sal I Afl II

181 ATT CAG AAG GAG TCG ACC TTA CAT CTT GTC 210 Ile Gln Lys Glu Ser Thr Leu His Leu Val

61 65 70

Afl II

211 TTA AG A CTA AGA GGT GGT TGA 231 Leu Arg Leu Arg Gly Gly End

71 75 76

13

OBJECTIVES

14

1) Construction of the double mutant YEp96 UB[L50P] [I61T] .

2) Transformation of the above mutant in yeast Saccharomyces cerevisiae.

3) Functional characterization of the above mutant and some already constructed

mutants YEp UB [A46S][L50P], YEp UB [S20F][I61T] , YEp UB [S20F][L50P]

and YEp UB[S20F ][A46S] in Saccharomyces cerevisiae.

15

STRATEGY OF WORK

PCR based Site-directed mutagenesis23

16

(Recombinant PCR)

Figure 6 PCR reactions that produce products which overlap in the region of the

mutation , in the above figure, primer B ,used in the PCR reaction 1, is

complementary to primer C used in the second PCR. Both PCR contain the

required alteration in the sequence ( but on the opposite strandes). If we mix

products of the two reactions , denature and re-anneal, some of the single strands

from reaction1 will anneal to strands from reaction 2 in the region where they

overlap , corresponding to sequences of primers B and C . One of the two possible

hybrid molecules contain 3’ends which can as a primer for extension by DNA

polymerases to produce completed double stranded molecule containing the

mutation.

Cloning strategy

17

Figure 7 – Both PCR product and the yeast expression vector are digested with

BglII and KpnI . both digested product are then ligated to produce a recombinant

clone containing the double mutant ubiquitin gene product .

18

MATERIALS & METHODS

Yeast Strains, Media and Plasmids

19

Strains SUB62 (MATα lys2-801 leu2-3,112 ura3-52 his3-A200 trpl-1) a

SUB60 (MATα ubi4-A2:: LEU2 lys2-801 leu2-3,112 ura3-52 his3-A200 trpl-

1) .Cultures were grow at 30°C at 200 rpm, except where indicated in synthetic

dextrose medium consisted 0.67% Hi-media yeast nitrogen base supplemented

with histidine, leucine ,tryptophan, lysine and uracil as and when required with

2% glucose as carbon source. Ubiquitin is expressed from a high copy number

yeast episomal plasmid that is identical to TRPI copper inducible ubiquitin

expression plasmid YEp 96. YEp 96 is a 2 μm based shuttle vector between

E. coli and S. cerevisiae. The ubiquitin gene is expressed from CUP1

promoter induced by the addition of 100 μM CuS04.

Bacterial Strains and Media

Escherichia coli DH5α culture was grown at 37oc at 200rpm in nutrient rich

Luria broth from Hi-media. Selection pressure of 100μg/ml of ampicillin was used

with the strains transformed by the plasmid .

Plasmid Construction (Yeast Expression Vector)

All ubiquitin gene mutations were carried out in plasmids derived from YEp

96 (Figure 8). Amplicons of mutant ubiquitin gene generated by recombinant PCR

were cloned into the Bgl , Kpn I sites of YEp96.

20

Figure 8 . The YEp 96 vector contains 6179 bps. It contains wild type synthetic yeast ubiquitin gene under the CUP1 promoter, hence copper inducible. It is ampicillin resistant- 50-100μg/ml final concentration. It has one Bgl II, one Kpn I and two EcoR I sites.

The DNA sequence of the Eco R I - Kpn I synthetic yeast ubiquitin gene insert in YEp 96 / UbWt -

GAATTC ATTATGC AGATCT…….Yeast-UB….GGT GGT TGA GGTACC Eco RI Met Bgl II Gly Gly Kpn I

21

Primers Used For Recombinant PCR (Site-Directed Mutagenesis)

The EP I61T vector backbone was used to amplify mutated gene with the primers 42 EP 50 FR, 42 EP 50 RE to bring L50P mutation.

Primer Sequence

175 FP 5’ACAGAATTCATGAACATCTTCGTCAA3’

175 RP 5’ TCCGGTACCCGCTCAACCACCTCTTAG 3’

EP 50 RP 5’ GATC TTT GCC GGC AAG CAG CCT GAG GACGGT AG 3’

EP 50 RP 5’ CT ACC GTC CTC AGG CTG CTT GCC GGC AAA GAT C 3’

Table 3- List of the primers used in the study.

22

Protocol for Yeast Transformation (Lazy Bones)24

Materials:

PLATE Solution • 40% PEG 3350 • 0.1M LiAc (Lithium Acetate) • 10mM Tris-Hcl pH-7.5 • 1mM EDTA

Method:

• 0.5 ml of culture was taken and spun for 10sec in microfuge. The tube was

decanted by inverting it.

• 10μl of carrier DNA (100μg) plus 1μg transforming DNA (in 10μl) was added

and vortexed well.

• 0.5ml PLATE solution was added and vortexed.

• 57μl DMSO was added and vortexed briefly and left for 15min at R.T.

• Heat stock for 15min at 42oC was given.

• Cells were pelleted in microfuge for a few seconds at 10K. Supernatant was

carefully removed.

• 200μl T.E. was added to the cell pellet and gently responded cells by

aspirating up and down a pipette tip . Then suspended cells were

immediately spread on the selective media plates.

23

Protocol for Bacterial Transformation 25

Carried out using CaCl2 method. (Sambrook et al)Materials: • Luria broth- 10ml. • Luria agar- 100ml • MgCl2- 0.1 M, CaCl2- 0.1 M

Method:

• 100μl of over-night grown bacterial culture was inoculated into 10 ml LB

broth in 100ml conical flask. The culture is grown by constant shaking till it

reaches an O.D. of 600 nm.

• The culture was chilled on ice for 10 min. 1.5ml culture was taken in microfuge

tube and spun at 3500rpm for 5-10min for 4oC.

• The supernatant was discarded. The cells were re-suspended in equal volume of

Precooled solution of 0.1M MgCl2 and kept on ice for 15min. The cell

suspension was centrifuged at 3500 rpm for 5min at 4oC.

• The supernatant was discarded. The cells were re-suspended in 100μl of pre-

cooled solution of 0.1M CaCl2 and kept on ice for 30-45mins.

• Plasmid DNA approx. 50ng-1μg was added for each transformation reaction and

kept on ice for 45mins.

• The tubes were transferred to water bath, pre heated to 39-42oC and kept for

90sec.

• 1ml LB was added to each tube and incubated at 30-37oC for 30 min to 1 hr.

24

• An appropriate quantity of cells was spreaded on to selective media using a

glass spreader

• The plates were left open in the laminar hood till the liquid dried up

and then incubated at 37oC for 12-24 hrs.

• The transformants were amplified on Luria agar containing suitable

selection antibiotic and inoculated from this amplified plate in the

LB broth containing appropriate antibiotic for plasmid preparation.

Plasmid Preparation by Alkaline Lysis Method

Materials:

Solution I: 50mM glucose, 25mM Tris-Cl pH-8.0, 10mM EDTA. Solution II: 0.2 N NaOH, 10% SDS. Solution III: 60ml of 5M potassium acetate, 11.5 ml of glacial acetic acid,

28.5 ml H2O TE [pH-8.0]- 10mM Tris-Cl [pH-8.0] Luria broth- 25ml 1mM EDTA [pH-8.0]

Method:

• 25ml overnight grown culture of bacterial cells was harvested by centrifugation

at 4000 g for 10min at 4OC.

• The bacterial pellet was re-suspended in 1ml of solution I and kept at room

temp. for 5mins.

• 2ml of freshly made solution II was added and mixed gently by inverting the

tube several times and kept on ice for 1min.

25

• 1.5ml of ice cold solution of 5M potassium acetate [solution III] was added

and

kept on ice for 15mins.

• It was then centrifuged at 10,000 rpm for 10min at 4oC. Bacterial debris formed

a tight pellet.

• The supernatant was into another tube and equal volume of Phenol:

chloroform:Iso-amyl alcohol (25:24:1) was added and vortexed thoroughly to

mix the contents well. It was then centrifuged at 5000 rpm for 5min.

• The supernatant was transferred to another tube and equal volume of

Chloroform :Iso-amyl alcohol (24:1) was added and vortexed to mix the

contents well. It was then centrifuged at 5000rpm for 5min.

• The supernatant was transferred into another tube and 0.6 volumes of

isopropanol was added and mixed well and kept at room temperature for

15min.

• The DNA was pelleted down by centrifugation at 10,000 rpm for 15min.The

supernatant was discarded and the pellet was washed with cold 70% ethanol at

room temperature, twice. As much as possible ethanol was discarded and then

dried.

• TE [pH-8.0]- 80 to 100μl was added.

26

Agarose Gel Electrophoresis

DNA digested with different restriction enzymes will generate different

sized fragments. These fragments can be separated, identified, and purified with

the help of gel electrophoresis. Location of the DNA in the gel can be detected by

using the fluorescent dye called ethidium bromide, which binds the DNA and

fluoresces when illuminated under UV light of 302nm and can detect as low as 1ng

of DNA. The electrophoretic migration of DNA through the agarose gel depends

upon few main parameters:

• Molecular size of DNA : Molecules of linear or duplex DNA travels

through the gel matrix at rates that are inversely proportional to log 10 of their

molecular weights.

• The agarose concentration: DNA fragment of a particular size will

migrate at different rates through gels containing concentration of agarose.

There is linear relationship between logarithm of electrophoretic mobility of

DNA and the concentration of agarose.

• The conformation of DNA: closed circular [form I], nicked circular [form

II] and linear [form III] DNA of the same molecular weight migrate through

agarose gels at different rates. The relative mobility’s of these forms are

dependent primarily on agarose concentration in the gel, but are also influenced

by the strength of the current applied, the ionic strength of the buffer and the

density of super helical twists in the form DNA.

• The applied current: At low voltages the rate of migration of linear

DNA fragment is proportional to the voltage applied.

• Base composition and temperature: In agarose gel the relative electrophoretic Mobility of DNA fragment of different sizes do not change

27

between 4-30oC. Generally agarose gels are run at room temperature. The gels less the 0.5% are run at 4oC.

DNA PAGE (De-Oxy Nucleic Acid Polyacrylamide Gel Electrophoresis)

Principle:

DNA-PAGE is used to separate, identify and purify fragment s which highly

smaller in size, and cannot be resolved properly on agarose gels, e.g- the PCR

products or the digestion products of the PCR. It consists of acrylamide which

forms linear chains, while bisacrylamide is the cross-linking agent. Acrylamide

and bis-acrylamide, together form a network of very fine pore size. Ammonium

Per- Sulphate (APS) acts as an initiator of the polymerization reaction. TEMED

acts as a catalyst of for the polymerization reaction.

Materials:

• 5X TBE ( Tris Borate EDTA)

• Monomer solution (30%T, 2.7% Cbis) - Acrylamide 58.4g - Bis acrylamide 1.6g - Distilled water make upto 200ml. (Store at 4’C in dark)

10% APS

TEMED 2 μl

Protocol for heat stress complementation Exponentially growing yeast cells were plated on supplemented minimal

medium containing 100 μM CuSO4.

The plates were then incubated at 40° C for 16 hrs.

28

This was followed by a shift to 30 °c for 4 days to allow for colony development .

RESULTS & DISCUSSION

29

Recombinant PCR (Site-Directed Mutagenesis)

Yep96[I61T] plasmid backbone was taken for PCR to generate mutant Yep

[L50P-I61T]. Two complementary mutagenic primers (50 FP and 50RP) were

taken for recombinant PCR. The recombinant PCR product is constructed in three

steps. The first and second PCR steps involves amplification of 162 and 101

base pair products from forward and reverse direction by using one gene specific

primer ( 175 FP and 175 FR) and one internal primer (50 FP and 50 RP) . Third

step involves amplification of 250 bp recombinant product using both gene specific

primers. All the PCR products are shown in the figure 9 below-

LANE 1 2 3 4

Figure 9 - DNA PAGE analysis of the recombinant PCR products, .Lane1 shows a

100 bp marker , Lane 2 indicates the 162 b.p PCR product amplified using primers

175 F.P and EP 50 R.E , Lane 3 is a 101 b.p PCR product amplified using

primers 175 R.P and EP 50 F.P . Lane 4 is a 250 b.p recombinant PCR product

30

produced using the and 101 b.p product as template and the primers 175 FP and

175 RE.

Recombinant PCR Digestion

The recombinant PCR product YEp 96[L50P-I61T] is digested separately with

XhoI , SalI & XbaI. There is no digestion seen with XhoI and SalI, hence the

mutations at 50th and 61th positions as indicated in the figure 11 below are

confirmed-

1 2 3 4 5

Figure 11- Showing the digestion pattern of Recombinant PCR product. The wild type yeast ubiquitin has synthetic gene contain sites for XhoI , SalI & XbaI. Lane 1 is a 100 bp marker, Lane 2 showing the Undigested Recombinant PCR product used as (control) , Lane 3 & Lane 5 showing the digestion with XhoI and SalI has failed and confirms the mutation at the 50th and 61th position. Lane 4 shows digestion of the Recombinant PCR product by XbaI showing the intact restriction site.

31

Confirmation of YEp [L50P I61T] Mutation (Plasmid Digestion)

The confirmation of the mutation was done by plasmid digestion with various

restriction enzymes Hind III, Kpn I, BglII, EcoRI , XhoI and SalI. The

incorporation of the two mutations at 50 th and 61st disrupts the XhoI and SalI

sites and shows identical digestion pattern as the Undigested YEp 96 WT plasmid

, shown in the figure 10 below-

1 2 3 4 5 6 7 8

Figure 10- showing the digestion pattern of YEp 96[L50P-I61T] . Lane 1 is the λ Hind I marker Lane 2 showing the Undigested YEp96 [L50P- I61T] plasmid used as control Lane 3, Lane 6, Lane 7, Lane 8 showing the Linearization of [L50P- I61T] plasmid after digestion with Hind III, Kpn I, Bgl I, EcoR I indicative of intact restriction sites. Lane 4 & lane 5 showing the digestion with XhoI and SalI failed, which confirms the mutation.

32

Confirmation of clone by sequencing

YEp 96 [L50P-I61T] construct has been further confirmed by the

sequencing method . Results shown in the figure 12 below -

Figure 12-Sequencing of the Recombinant PCR product confirms a change of Leu to Pro at 50th amino acid residue and from Ile to Thr at 61th position .

33

Functional characterisation of double mutants

in yeast Saccharomyces cerevisiae

34

Growth curve analysis

The growth curve analysis of the wild type strain SUB 62 ( having WT

UB gene), SUB 60 (UBI4 gene deleted strain ) and SUB 60 cells transformed

with the double mutant constructs namely [A46S][L50P], YEp UB [L50P][I61T],

YEp UB [S20F][I61T], YEp UB [S20F][L50P] and YEp UB[S20F][A46S] was

done for about 32 hours. The growth pattern of all of the above is shown in the

figure below (Figure 13).

Figure 13- Growth curve analysis of the five double mutants along with wild type strains SUB60, SUB 62, SUB60/YEp 96 WT.

35

0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 340.0

0.2

0.4

0.6

0.8

1.0

1.2

1.4 SUB60SUB62YEp96/WTS20F-A46SA46S-L50PS20F-I61TS20F-L50PYEp96/42L50P-I61T

Time in Hours

O.D

.600

Generation time

The generation time of SUB62, SUB 60, and the double mutants [A46S]

[L50P], YEp UB L50P][I61T] , YEp UB [S20F][I61T], YEp UB [S20F][L50P]

and YEp UB[S20F][A46S] have been calculated by taking two log phase values.

Figure 14- The generation time of all the double mutants and the controls.

Conclusion

- YEp UB [A46S][L50P] and YEp UB [L50P][I61T] are showing reduced

growth than the wild type strain SUB 62.

- YEp UB [S20F][I61T] , YEp UB [S20F][L50P] and YEp UB[S20F][A46S] are

showing comparable growth to the wild type .

36

Heat Stress Complementation

In the heat stress complementation experiment, the SUB 62, SUB 60 and SUB 60

transformed with the YEp 96 UB [A46S][L50P] and YEp96 UB [S20F]

[L50P] , YEp UB [S20F][I61T] were plated on selective media and incubated for

various time intervals 4hrs, 8hrs, 12hrs, 16hrs at 400 C and returned to allow

growth at 300C. The percent survival obtained by counting the colonies is shown

in the figure 15 below.

Figure 15- The heat stress complementation experiment was performed with three double mutants by incubating the respective plates for 4hrs, 8hrs, 12hrs,16hrs time intervals.

37

0 4 8 12 160

20

40

60

80

100

120

SUB60SUB60/96WTA46S-L50PS20F-L50PS20F-I61T

Incubation in Hours

% S

urvi

val

Viability of the various double mutants-

The percent viability of mutants were calculated by serially diluting and plating the

cells harboring mutations on selective media. SUB 62, SUB 60 and SUB 60

transformed with the YEp 96 UB [A46S][L50P] and YEp96 UB [S20F][L50P] ,

YEp UB [S20F][I61T] has been shown in the figure 16 below -

Conclusion

YEp 96 UB [A46S][L50P] and YEp96 UB [S20F] [L50P] both are unable to complement for the heat stress. Both mutants lose their viability.

38

SUB60 SUB62 YEp96WT S20F-L50P A46S-L50P S20F-I61T0

100

200

300

400

500SUB60SUB62YEp96WTS20F-L50PA46S-L50PS20F-I61T

No.

of

Col

onie

s

Figure 16 – Percent viability calculated for the three double mutants is shown in the form of a bar graph.

Discussion

Ubiquitin is a small protein found in all eukaryotic cells. It is highly conserved

from yeast to humans differing in only three residues. This implies that

some residues are important for the structural and functional aspects of the

protein.

Katherine et al., 2001 have identified three important structural features on the

surface of ubiquitin involved in many important cellular process such as

proteasomal degaradation, endocytosis etc. The essential surface cluster

including Leu8, Ile44, and Val70 consists of nine amino acids

that extend from the base of the ubiquitin tail up to Gly47 and

Lys48. All of these residues are probably involved in ubiquitin

conjugation and/or proteasome degradation, and they may also

be important for deubiquitination. Lys48 is the major site of

polyubiquitin chain formation that is necessary for proteasome

degradation. The second essential cluster on the globular

domain surface consists of residues Gln2, Phe4, and Thr12.

Phe4 is critical for endocytosis, and Gln2 and Thr12 play a

minor role. The ubiquitin tail consists of the essential residues

Leu73, Arg74, Gly75 and Gly76. Gly75 and Gly76 are important

for ubiquitin conjugation and deubiquitination. Arg74 is

essential even though it is not important for E1 interaction or

ubiquitin conjugation. These residues may be important for

deubiquitination and possibly for proteasome recognition as

well. Arg74 and Leu73 play a minor role in endocytosis.

To understand more about the structural aspects, our lab has obtained some

mutants of ubiquitin by in vitro evolution method. All the mutants were

selected in a UBI4 gene deleted strain (ubi4 is a yeast ubiquitin expressed

39

under the stress conditions). All but one mutant named EP 42 failed to show

complementation to stress survival functions of the ubi4 gene. Sequencing

of the EP42 mutant revealed some four novel amino acid substitution mutations

Ser20 to Phe, Ala46 to Ser, Leu50 to Pro and Ile61 to Thr.

In this work a double mutant construction namely YEp UB [L50P][I61T] has

been carried out . Also Functional study of 5 double mutants namely YEp

UB [A46S] [L50P], YEp UB [S20F] [I61T] , YEp UB [S20F] [L50P] , YEp

UB[S20F][A46S] and YEp UB[L50P][I61T] has been carried out in

Saccharomyces cerevisie.

The results of the functional studies showed that YEp UB [A46S] [L50P] and

YEp UB [L50P] [I61T] are showing reduced growth than the wild type

strain SUB 62. While YEp UB[S20F] [I61T] , YEp UB [S20F] [L50P] and YEp

UB[S20F][A46S] are showing growth comparable to the wild type. Both YEp

96 UB [A46S][L50P] and YEp96 UB [S20F] [L50P] are unable to

complement under heat stress. Here it is observed that the mutation at 46 th

position was not lethal to the cell, while the mutations at 50 th position cannot

complement the heat stress and losing the viability. Thus, A46S in combination

with L50P is proving to be more detrimental to the cell. Ile 61 has been

shown to be important in folding based on the H-D exchange NMR studies. A46S

is showing lesser effect, ser at this position is also found naturally in some SUMO

proteins.

Functional studies on some others parameters and structural data of the above

mutants will help to pinpoint the amino acid residues whose substitution is

responsibe for the dosage dependent lethality.

40

FUTURE PROSPECTS

Functional evaluation of all the double mutants on other parameters

- Antibiotic stress

- N-end rule

- Amino acid analog stress

41

BIBLIOGRAPHY

42

1. S. Vijay-Kumar, C.E. Bugg, and W.J. Cook. Structure of ubiquitin refined at 1.8 °A resolution. J. Mol. Biol., 194:531–544, 1987.

2. Katherine E. Sloper-Mould, Jennifer C. Jemc, Cecile M. Pickart , and Linda Hicke. Distinct functional Surface Regions on Ubiquitin . The Journal of biological chemistry., Vol. 276, No. 32, Issue of August 10, pp. 30483–30489, 2001.

3. Ang, X. L. & Harper, J. W. Interwoven ubiquitination oscillators and control of cell cycle transitions. Sci STKE pe31 2004.

4. Jason j. yi and michael d. ehlers, Emerging Roles for Ubiquitin and Protein Degradationin Neuronal Function., Pharmacol Rev 59:14–39, 2007.

5. Ben-Neriah Y. Regulatory function of ubiquitination in the immune system. Nat.Immunol. 3:20–26.2002

6. Protein data bank

7. Fanga and A. M.Weissmanb. A field guide to ubiquitylation . CMLS, Cell. Mol. Life Sci. 61,1546–1561, 2004.

8. Daniel Finley. Recognition and Processing of Ubiquitin-Protein Conjugates by the Proteasome . Annu. Rev. Biochem ., 78:477–513 , 2009.

9. Handley-Gearhart P. M., Stephen A. G., Trausch-Azar J. S.,Ciechanover A. and Schwartz A. L. Human ubiquitin activating enzyme , E1. Indication of potential nuclear and cytoplasmic subpopulations using epitope-tagged cDNA constructs. J. Biol. Chem. 269: 33171–33178.1994.

10. Ciechanover A., Finley D. and Varshavsky A. Ubiquitin dependence of selective protein degradation demonstrated in the mammalian cell cycle mutant ts85. Cell 37: 57–66 . 1984.

11. Haas A. L. and Rose I. A. The mechanism of ubiquitin activating enzyme. A kinetic and equilibrium analysis. J. Biol.Chem. 257: 10329–10337.1982.

43

12. Jentsch S. Annu Rev Genet ; 26:179±20 .1992.

13. Pickart C. M. Mechanisms underlying ubiquitination Annu. Rev. Biochem. 70: 503–533 ,2001

14. Huibregtse JM, Scheffner M, Beaudenon S, and Howley PM A family of proteins structurally and functionally related to the E6-AP ubiquitin-protein ligase. Proc Natl Acad Sci USA 92:2563–2567. 1995.

15. Boname JM and Stevenson PG MHC class I ubiquitination by a viral PHD/ LAP finger protein. Immunity 15:627–636.2001

16. Koegl M., Hoppe T., Schlenker S., Ulrich H. D., Mayer T. U. and Jentsch S. A novel ubiquitination factor, E4, is involved in multiubiquitin chain assembly. Cell 96: 635–644.1999.

17. Borden KL and Freemont PS The RING finger domain: a recent example of a sequence-structure family. Curr Opin Struct Biol 6:395–401.1996.

18. Jan Smalle and Richard D. Vierstra . The Ubiquitin 26S Proteasome - Proteolytic Pathway Annu. Rev. Plant Biol. 55:555-90.2004.

19. Pickart C. M. Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70: 503–533. 2001.

20. Alexander Varshavsky .The N-end pathway of protein degradation. Genes to Cell 13-28, 1997.

21. Engin Ozkaynak, Daniel Finley, Mark J.Solomon' and Alexander Varshavsky. The yeast ubiquitin genes: a family of natural gene fusions. The EMBO Journal, vol.6 no.5 pp. 1429-1439 , 1987.

22. Daniel Finley , Engin bzkaynak, and Alexander Varshavsky 1987. The Yeast Polyubiquitin Gene Is Essential for Resistance to High Temperatures, Starvation, and Other Stresses, Cell, Vol. 48, 10351046. March 27, 1987.

44

23. Jeremy W dale and Malcolm von schantz .,Genes and Genomes , concepts and applications of DNA technology, John wiley & Sons ,UK.20 .

24. J. S. Richardson, E. D. Getzoff, David C. Richardson, Proc. Natl. Acad. Sd. USA Vol. 75: 2574-2578. 1978.

25. Sambrook and Russel Molecular cloning: A Laboratory Manual,Third edition, Cold Spring Harbour Laboratory Press, New York, 1:1.116,

45