heme concentration dependence and metalloporphyrin...

Heme concentration dependence and metalloporphyrin inhibition of the

system I and II cytochrome c assembly pathways

Running title: Cytochromes c biogenesis inhibition and heme affinity

Cynthia L. Richard-Fogal†, Elaine R. Frawley

†, Robert E. Feissner

‡, and Robert G.

Kranz†*

†Washington University, Department of Biology Campus Box 1137, 1 Brookings Drive

St. Louis, MO 63130

‡University of Rochester, Department of Pharmacology and Physiology, Box 711, 601

Elmwood Ave. Rochester, NY 14642

Address correspondence to: Robert G. Kranz, Washington University, Department of

Biology Campus Box 1137, 1 Brookings Drive, St. Louis, MO 63130, Tel. (314)935-

4278; Fax. (314)935-4432; e-mail [email protected]

ACCEPTED

Copyright © 2006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01388-06 JB Accepts, published online ahead of print on 3 November 2006

on Novem

ber 30, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

2

ABSTRACT

Studies have indicated that specific heme delivery to the apocytochrome c is a

critical feature of the cytochrome c biogenesis pathways called system I and II. To

determine directly the heme requirements of each system, including if other metal

porphyrins can be incorporated into cytochromes c, we engineered Escherichia coli such

that the natural system I (ccmABCDEFGH) is deleted and exogenous porphyrins are the

sole source of porphyrins (∆hemA). These engineered E. coli that produce recombinant

system I (from E. coli) or system II (from Helicobacter) facilitated studies on the heme

concentration dependence of each system. Using this exogenous porphyrin approach it is

shown that system I uses heme at least 5 fold lower levels than system II, addressing an

important advantage for system I. Neither system could assemble holocytochromes c

with other metal porphyrins, suggesting that the attachment mechanism is specific for Fe

protoporphyrin. Surprisingly, Zn and Sn protoporphyrins are potent inhibitors of the

pathways and exogenous heme competes with this inhibition. It is proposed that the

targets are the heme binding proteins within the pathways (CcmC, CcmE, and CcmF for

system I and CcsA for system II).

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

3

INTRODUCTION

Cytochromes c are electron transport proteins that are essential for most aerobic

and anaerobic respiratory chains, as well as many other cellular processes, such as

photosynthesis and apoptosis. Cytochromes c are distinguished from other cytochromes

by the covalent linkage of the heme vinyl groups to specific cysteine residues present in

the CXXCH motif of the apocytochrome c. Three different c-type cytochrome

biogenesis pathways have been described, called systems I, II, and III (for review see 33,

47, 51; for system I and II see Fig. 1). System III is the simplest of the three systems,

consisting of a single protein, cytochrome c heme lyase, which is found in the

mitochondria of certain eukaryotes (19, 40, 46). System II uses four proteins and is

found in Gram positive bacteria (35, 44), β and ε proteobacteria (4, 30), plant

chloroplasts (32, 59), and cyanobacteria (52). The most complex of the three systems,

system I, uses at least eight proteins encoded by the ccm genes and is found in α and γ

proteobacteria (5, 15, 41, 43), archaea (1, 26), and plant mitochondria (7, 31). Systems I

and II deliver heme to the site of assembly, maintain the apocytochrome c in a reduced

state, and facilitate an energy independent (2, 3), covalent ligation of the heme to the

apocytochrome c.

Progress has been made on the function of many assembly proteins, but the

reasons for the evolution of these three systems remain major questions in the field.

Previously we have shown that CcmE of system I can function as a heme reservoir (24).

It was also shown that the ferrocheletase inhibitor N-methyl protoporphyrin (NMPP) was

able to inhibit recombinant system II at lower concentrations than system I, speculating

that system I might be able to use endogenous heme at lower levels than system II.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

4

Theoretically, heme delivery (or flux) could be the limiting factor in cytochrome c

biogenesis pathways under certain environmental conditions. We have recently proposed

that the CcmA2B1C1 release complex of system I (23) is required for using heme at low

levels in the cell. This suggests that heme is bound with high affinity to CcmC, and that

ATP hydrolysis by the ATP binding cassette (ABC) subunit CcmA is necessary to release

this (as holoCcmE) to the cytochrome c synthetase (CcmF/H). System II, a genetically

distinct system for synthesizing holocytochromes c, does not have an ABC transporter

complex or a heme chaperone such as holoCcmE (see Fig. 1 for model). Rather, system

II has a protein called CcsA with at least six membrane-spanning helices and periplasmic

WWD domain (a putative heme binding site), as is present in CcmC or CcmF. It is

possible that system II possesses a low affinity heme binding site (in CcsA) from which

direct ligation to apocytochrome c occurs (24, 28).

To directly address the differential heme affinities for the two pathways, we

engineered E. coli deleted of its eight ccm genes so that endogenous heme was not

synthesized (by deleting hemA). Expression of chuA, encoding an outer membrane porin

selective for porphyrins, allows the ∆ccm∆hemA strain (RK105) to grow like wild-type

with the addition of exogenous heme. With this approach and the recombinant systems I

and II, heme dependency for each system was quantitated. As shown here with metal

porphyrins, it is feasible to analyze alternative porphyrins for attachment requirements or

for the discovery of pathway inhibitors.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

5

MATERIALS AND METHODS

Bacterial growth conditions - All E. coli strains used in this work were grown

aerobically (shaking at 300 rpm) at 37°C in Luria-Bertani media (LB; Difco). Antibiotics

(Sigma-Aldrich) were used at the following concentrations: carbenicillin 100 µg mL-1

,

tetracycline 15 µg mL-1

, chloramphenicol 20 µg mL-1

, kanamycin 100 µg mL-1

, and

ampicillin 100 µg mL-1

. Aminolevulinic acid (ALA; Sigma) was used at a concentration

of 50 µg mL-1

(300 µM), unless otherwise noted. Metalloporphyrins zinc (II)

protoporphyrin IX (ZnPPIX), tin (IV) protoporphyrin IX (SnPPIX), and cobalt (III)

protoporphyrin IX (CoPPIX) were obtained from Frontier Scientific (Logan, UT) and

were dissolved in 0.1 N NaOH to 10 mg mL-1

stock concentration. Hemin (heme;

Frontier Scientific) was dissolved in 50% DMSO to 10 mg mL-1

stock concentration.

Construction of E. coli strain RK105 - A derivative of the E. coli ∆ccm

[RK103; eight ccm genes replaced with a kanamycin cassette (24)] with the hemA gene

replaced with a kanamycin resistance cassette was constructed by the procedure of

Datsenko and Wanner (14). PCR products were generated on the template plasmid,

pKD4, containing a kanamycin resistance cassette that is flanked by FLP recombinase

target sites, by a pair of oligonucleotide primers, 5’-

CTATCAACGTTGGTATTATTTCCCGCAGACATGACCCTTTGTGTAGGCTGGAG

CTGCTTC- 3’ and 5’ –

TGATGTACTGCTACTCCAGCCCGAGGCTGTCGCGCAGAATCATATGAATATCC

TCCTTAG – 3’. The oligonuclotide primers include sequence identical to the N-

terminal and C-terminal coding sequence, respectively, of the E. coli hemA gene. The 3’

end of the oligonucleotides also incorporate the pKD4 priming sites P1 and P2,

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

6

respectively. The PCR product was introduced into E. coli ∆ccm (RK 104), cured for

kanamycin resistance, expressing the λ phage Red recombinase encoded on pKD46.

Transformants were selected on media with kanamycin and ALA at 37°C. Several

colonies that were resistant to kanamycin but sensitive to ampicillin (indicating a loss of

pKD46) were screened by PCR with oligonucleotide primers flanking the recombination

site to identify strains with a deletion of the hemA gene.

Construction of pRGK368 – Cultures of E. coli RK103 containing pRGK334

(system II from H. pylori) (24), pRGK332 (cytochrome c4:6xHis) (24)and pHPEX2 (55)

yielded inconsistent levels of cytochrome c4:6xHis for unknown reasons. However, the

ccsBA gene cloned from Helicobacter hepaticus yielded consistent levels of cytochrome

c4:6xHis even in the presence of pHPEX2. Therefore, studies described here used the H.

hepaticus ccsBA-encoded system II (pRGK368, see next), unless otherwise noted. E. coli

strain TB1 was used as the initial host for cloning. pGex-4T-1 (Amersham Biosciences)

derived vectors have an N-terminal glutathione S-transferase (GST) fusion to the insert

under the control of the IPTG-inducible tac promoter. The H. hepaticus fused ccsBA

coding region was PCR amplified from genomic DNA with a pair of oligonucleotide

primers, 5’ – CGCGGATCCATGATGAATATAATTAAAACACTTTTTTGTT – 3’ and

5’ – CCGCTCGAGTTATAAATGGGGCATATCAAGCACT – 3’. The amplified

product was cut with BamHI and XhoI and ligated into pGEX-4T-1 to generate

pRGK368 (system II plasmid). The expression of ccsBA from pRGK368 was verified by

complementation of the ccm phenotype of E. coli ∆ccm [RK103 deleted for ccmA-H;

(24)] containing pRGK332 (cytochrome c4:6xHis; not shown).

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

7

Heme addition experiments - Cultures of E. coli RK105 (∆ccm∆hemA) harboring

pRGK333 (system I; ccmA-H genes from E. coli) (24) or pRGK368 (system II),

pRGK332 (cytochrome c4:6xHis), and pHPEX2 [for the expression of the ChuA outer

membrane heme porphyrin receptor (55)] were grown in media overnight in the presence

of 300 µM aminolevulinic acid (ALA). 100 mL cultures were started from the overnight

culture with a 1% innoculum in media devoid of ALA for 2.5 hours. After 2.5 hours, the

100 mL cultures had exhausted their cellular supply of ALA and required exogenous

heme (or ALA) for further growth. The ALA exhausted cultures were divided into 5 mL

aliquots to which IPTG (1 mM, to induce the synthesis of the system I proteins) and

heme (0 µM to 100 µM; Frontier Scientific) were added. It was discovered that heme at

greater than 60 µM would precipitate over time with no IPTG (1 mM) present and at

greater than 100 µM in the presence of IPTG. After one hour, arabinose (0.2% to induce

the synthesis of cytochrome c4:6xHis) was added and cultures were grown for an

additional three hours. Cells were harvested and protein was extracted using B-PER as

previously described (22). Cytochrome c4:6xHis was purified from 200 µg of total

protein over nickel affinity resin (Novagen) with two washes (10 column volumes each)

with 0.5 M NaCl/20 mM Tris-HCl pH 7.9 containing 5 mM and 60 mM imidazole,

respectively, to eliminate free heme and eluted with 100 mM EDTA. 20 µL of each

sample were subjected to SDS-PAGE, transferred to nitrocellulose, and heme stained as

previously described (21). Curve-fits and heme recovery calculations were performed

with the Origin scientific and analysis software package (OriginLab) using the Hill

equation as the curve-fit model.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

8

N-methyl protoporphyrin (NMPP) inhibition experiments - Inhibition

experiments were performed as previously described (24) with a few differences. 100

mL cultures of E. coli RK103 containing pRGK333 (system I), pRGK332 (c4:6xHis), and

pHPEX2 (55) were inoculated with 1% (v/v) from an overnight culture and grown with

aeration at 37°C to an OD600 of approximately 0.5. The mid-log phase cultures were

divided into 5 mL aliquots to which IPTG (1 mM, to induce the synthesis of the system I

proteins and the chuA gene) and NMPP (0 µM to 100 µM; Frontier Scientific) were

added. After one hour 0.2% arabinose was added (to induce the synthesis of the B.

pertussis c4:6xHis) and cultures were incubated an additional three hours. After

harvesting cells by centrifugation, soluble protein was extracted with B-PER Protein

Extraction Reagent (Pierce) as previously described (22). Cytochrome c4:6xHis was

purified from 200 µg of total protein by nickel affinity resin (Novagen) and 20 µL of

each sample was subjected to SDS-PAGE, transferred to nitrocellulose and heme stained

as described below.

Metalloprotoporphyrin IX addition experiments - Overnight cultures of an E.

coli RK103 strain harboring either pRGK333 (system I) or pRGK368 (systemII),

pRGK332 (cytochrome c4:6xHis), and pHPEX2 (55) were diluted into fresh media

(containing the appropriate antibiotics and 8 µM hemin for the E. coli RK105 strain) and

incubated with aeration at 37°C until the OD600 was approximately 0.5. The mid-log

phase cultures were divided into 5 mL aliquots to which IPTG (1mM) and a

metalloprotoporphyrin IX (Zn (II), Sn (IV), or Co (III) at designated concentrations) were

added. Arabinose (0.2%) was added after one hour and incubation continued for an

additional three hours. Cells were harvested and soluble protein was extracted using B-

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

9

PER (22). Cytochrome c4:6xHis was purified from 300 µg of total protein and 20 µL

was subjected to SDS-PAGE and transferred to nitrocellulose. Prior to heme stain and c4

immunoblot, the nitrocellulose blots were screened for fluorescence on an LAS-1000 plus

Luminescent Image Analyzer CCD camera system (Fujifilm; Tokyo, Japan).

NMPP-ZnPPIX combined inhibition experiments - Overnight cultures of the

E. coli RK103 strain harboring pRGK333 (system I), pRGK332 (cytochrome c4:6xHis),

and pHPEX2 were diluted into 100 mL of fresh media containing the appropriate

antibiotics and incubated at 37°C with aeration until an OD600 of approximately 0.5 was

obtained. The cultures were divided into 5 mL aliquots and IPTG (1mM) and NMPP (60

µM and 100 µM) were added to separate cultures and incubation continued for 30

minutes. ZnPPIX (5 µM) was then added to each culture and incubation continued for an

additional 30 minutes. Arabinose (0.2%) was added and incubation continued for an

additional three hours. Cells were harvested by centrifugation and the soluble protein

was extracted with B-PER, as previously described (22). The soluble protein was

processed as for “metalloprotoporphyrin addition experiments”.

Other methods - Protein concentrations were determined with the BCA assay kit

(Pierce) using BSA (bovine serum albumin) as a standard. Heme stains and western blots

were performed as previously described (21) using SuperSignal Femto chemiluminescent

substrate (Pierce). Heme stain quantitation used LOLITA II (Low Light Test Array;

raytest USA; Wilmington, NC) for standardization of light intensity detection on an

LAS1000plus Luminescent Image Analyzer CCD camera system. The reduced (10 mM

sodium dithionite) and oxidized (10 mM ammonia persulfate) absorption spectra were

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

10

obtained with a Shimadzu UV-2101PC scanning spectrophotometer using nickel affinity

purified holocytochrome c4:6xHis.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

11

RESULTS

The exogenous porphyrin approach: characterization of an E. coli

∆∆∆∆ccm∆∆∆∆hemA with a porphyrin porin. Previously, we deleted the eight ccmA-H genes

in E. coli using a kanamycin resistance cassette (RK103; 24). To construct a heme-

dependent strain, we initially screened for excision of this kanamycin resistance cassette.

With this ∆ccm kanamycin-sensitive strain (RK104), the hemA gene was replaced with a

kanamycin resistance cassette. The hemA gene codes for glutamyl-tRNA reductase, the

first committed enzyme in heme biosynthesis, and E. coli cells lacking hemA require

exogenous ALA for growth (58) (Fig. 1). The ∆ccm∆hemA strain (RK105) requires ALA

in the growth media to form colonies (not shown). RK105 with recombinant system I

(pRGK333) or system II (pRGK334) also requires exogenous ALA for growth (Supp.

Fig. 1). To determine if exogenous ALA facilitates cytochromes c synthesis we

transformed these strains with pRGK332 which expresses a C-terminally hexahistidine

(6x) tagged Bordetella pertussis cytochrome c4 under the control of an arabinose-

inducible promotor (24). E. coli RK05 with pRGK333 or pRGK334 and pRGK332 are

unable to synthesize holocytochrome c4:6xHis at the 60 µM ALA concentration (Fig. 2

lanes 1, 2, 6 and 7) but are able to synthesize holocytochrome c4:6xHis at higher ALA

concentrations (Fig. 2 lanes 3, 4, 5, 8, 9, and 10). As noted previously (24), in addition to

the diheme 24 kDa cytochrome c4, a proteolyzed monoheme 12 kDa cytochrome

c4:6xHis* is produced. It is concluded that exogenous ALA is required for growth and

holocytochrome c production in RK105.

To determine if exogenous heme rather than ALA could support growth, an ALA

exhausted culture of RK105 was supplemented with different concentrations of heme (up

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

12

to 100 µM). Growth was not detected until four to five days after the original inoculation,

even at high heme concentrations. No holocytochrome c4:6xHis was detected in cultures

that contained either the system I or system II plasmid and the c4:6xHis reporter under

these conditions.

Previous reports have indicated that the outer membranes of some strains of E.

coli are poorly permeable to heme (8, 38, 57), and for that reason we expressed the heme

porin (chuA) from pHPEX2 (55). The gene is from E. coli O157:H7 and is expressed

from the IPTG-inducible lacUV5 promoter. ChuA is a member of a class of relatively

nonspecific enterobacterial heme receptors that are TonB-dependent and facilitate heme

acquisition (see Fig. 1; 49, 53 and reference therein). ChuA, by analogy with the

Yersinia enterocolitica HemR outer-membrane heme receptor, recognizes free heme and

heme bound to a variety of proteins (49). Growth of E. coli RK105 containing either

pRGK333 or pRGK334 and pHPEX2 is dependent on exogenous heme (Fig. 3).

Expression of chuA (pHPEX2) allows growth to near wild-type levels, suggesting an

efficient uptake of exogenous heme, whereas when the culture is depleted for ALA and

heme is not added, no growth is detectable (Fig. 3 open squares). The pHPEX2 also

facilitates the heme-dependent production of the B. pertussis c4:6xHis when the plasmids

with system I or system II are present (see below).

System I acquires heme at significantly lower concentrations than system II.

To directly examine the differences in heme acquisition between systems I and II, we

supplied varying concentrations of exogenous heme to E. coli RK105 containing

pHPEX2, pRGK332 and either system plasmid. [As noted in Experimental Procedures,

we used a system II ccsBA fusion from Helicobacter hepaticus in these studies, encoded

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

13

by pRGK368, which is compatible with the pHPEX2, yielding consistent levels of

cytochrome c4:6xHis reporter.] Overnight starter cultures (grown in the presence of

ALA) were used to inoculate media devoid of ALA and incubated for 2.5 hours to

exhaust cellular ALA (and heme); IPTG, arabinose, and heme were then added. The

cytochrome c4 acts as a trap, allowing quantitation of the levels of heme that have fluxed

through each system. Cytochrome c4:6xHis was purified over nickel chelating resin to

eliminate free heme and both the 24 kDa and 12 kDa forms were quantitated by heme

stain (Fig. 4A for system I and 4C for system II). For system I, since maximum synthesis

of holocytochrome c4:6xHis occurs at less than 10 µM heme, all subsequent experiments

using system I used heme levels between 0 µM and 10 µM. Averaged over 4 trials for

system I, holocytochrome c4:6xHis levels were restored to 50% (of maximum levels

achieved with exogenous heme) at 1.9 µM +/- 0.4 µM heme (Fig. 4B). For experiments

with system II (CcsBA), an increase in holocytochrome c4:6xHis signal was also

observed as heme concentration increased, with heme levels of 30 µM to 40 µM reaching

maximum synthesis (Fig. 4C). Averaged over 5 trials, holocytochrome c4:6xHis levels

reached 50% of maximum synthesis at 18.6 µM +/- 8.1 µM heme for system II (Fig. 4D).

We conclude that the apparent affinity for heme is at least five-fold higher for system I

than system II.

Zinc protoporphyrin IX (ZnPPIX) is not incorporated into the B. pertussis

cytochrome c4:6xHis biogenesis reporter. No studies have determined if any of the

three cytochromes c biogenesis systems can incorporate other metal porphyrins into the

CXXCH motif of a c-type cytochrome. If they can, then iron itself is not critical for the

attachment mechanism. The porphyrin porins like ChuA also facilitate permeability of

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

14

other metal porphyrins (48). Using the approach described here we tested if heme can be

replaced by other metalloporphyrins in the c-type cytochrome (c4:6xHis) reporter. We

chose three metalloporphyrins to screen for incorporation into the c4:6xHis: ZnPPIX,

SnPPIX, and CoPPIX. These three metal protoporphyrins were selected because all three

metals have been successfully inserted, in vitro, into horse heart cytochrome c by

directly replacing the natural iron for the metal (17, 54).

To determine if Zn, Sn, or CoPPIX could be inserted in place of heme into

cytochrome c4:6xHis we grew cultures of E. coli RK105 containing pRGK333 (systemI),

pRGK332 (c4:6xHis), and pHPEX2 with heme to an OD600 of 0.5. Then IPTG and

metalloporphyrin (8 µM, 12.5 µM, or 25 µM) were added and growth continued for one

hour. Arabinose was added to 0.2% to induce the synthesis of the c4:6xHis and growth

continued for three more hours before cells were harvested. As expected, heme was

detected on c4:6xHis when either 8 µM or 25 µM heme alone was added (Fig. 5 lanes 1

and 2, respectively). When ZnPPIX was present with 8 µM heme, decreasing amounts of

holocytochrome c4 were detected as the ZnPPIX concentration increased (Fig. 5 lanes 3 -

5). At 25 µM ZnPPIX (Fig. 5 lane 5) the level of heme on c4:6xHis was barely

detectable. Concentrations of ZnPPIX above 25 µM did not further reduce the level of

detectable heme (not shown). SnPPIX also reduced the level of detectable heme on

c4:6xHis (see below), but CoPPIX (up to 100 µM) had no affect. It is possible the

ZnPPIX (and SnPPIX), when present with 8 µM heme, competes with heme for ChuA-

dependent transport into the cell. We therefore tested an E. coli ∆ccm strain (RK103) that

has endogenous heme production to determine if ZnPPIX (and SnPPIX) caused a

reduction in holocytochrome c4 levels detectable by heme stain. When E. coli RΚ103

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

15

with pRGK333 (system I), pRGK332, and pHPEX2 were treated with ZnPPIX, a

decrease in holocytochrome c4:6xHis was detected as the concentration of ZnPPIX was

increased (Fig. 6A, lanes 1-5). E. coli RK103 with pRGK368 (system II), pRGK332, and

pHPEX2 also showed a decrease in holocytochrome c4:6xHis with even lower

concentrations of ZnPPIX (Fig 6B, lanes 1-10 and note ZnPPIX is at nanomolar levels).

For SnPPIX and CoPPIX, a decrease in holocytochrome c4:6xHis was observed as

the concentration of SnPPIX was increased (supplemental Fig. 2A lanes 1-5 and 2B lanes

1-10). Addition of CoPPIX (up to 100 µM) showed no decrease, on average, in the level

of heme on c4:6xHis, suggesting that CoPPIX is not incorporated and is not an inhibitor

(see below).

Based on the above results, we decided to focus on the effects of ZnPPIX, which,

at low concentrations, significantly reduces the holo(heme)cytochrome c levels detected

by heme stain. ZnPPIX does not react with the chemiluminescent substrate used to stain

for heme on holocytochrome c4 (unpublished). The absence of a heme stain could

indicate that ZnPPIX is either 1) competing with heme and is being incorporated into

c4:6xHis, or 2) is specifically inhibiting c-type cytochrome biogenesis (i.e. attachment of

heme).

Cytochrome c4 covalently bound to ZnPPIX would be highly fluorescent, a

property of ZnPPIX proteins (20). We were unable to detect fluorescence of ZnPPIX in

purified c4:6xHis preparations from these experiments, suggesting that ZnPPIX is not

incorporated. To confirm that ZnPPIX is not incorporated into the cytochrome c4 we

obtained visible absorption spectra of nickel purified cytochrome c4:6xHis isolated from

E. coli RK103 harboring pRGK333 (system I), pRGK332 (c4:6xHis), and pHPEX2

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

16

grown with 8 µM ZnPPIX (Fig. 7A). Note that at this concentration approximately 20%

of wild type levels of holocytochrome c4:6xHis is produced (see Fig 6A, lane 3). The

sodium hydrosulfite reduced α peak at 552 is characteristic of cytochrome c4 with a c-

type linkage to heme (9, 10). If ZnPPIX were incorporated we would have expected β/α

peaks at 549 and 585, respectively (54). In addition, ESI-MS analysis of this same

protein preparation showed that the holocytochrome c4* (12 kDa proteolytic fragment)

contained only heme, as ZnPPIX incorporation would have yielded a protein that was 10

mass units larger (Fig. 7B and inset). These results confirm that ZnPPIX is not

incorporated into cytochrome c4:6xHis but rather inhibits biogenesis.

We also performed cytochrome c4 immunoblots on nickel affinity purified

c4:6xHis from cultures grown as above in the presence of SnPPIX. It has been

documented that apocytochromes c in mutants unable to attach heme are susceptible to

natural proteases, presumably because they do not fold properly (4, 18, 29). This has

been shown with the B. pertussis c4:6xHis reporter used in these studies (4, 24).

Therefore if SnPPIX is incorporated into the apocytochrome c we expect that the

holocytochrome would be stable and not subject to natural proteolysis. When antisera to

the B. pertussis cytochrome c4 was used (supplemental Fig. 2) a decrease in the levels of

c4:6xHis was detected for both system I (supplemental Fig. 2A lanes 6-10) and system II

(supplemental Fig. 2B lanes 11-20).

ZnPPIX and SnPPIX are specific inhibitors of system I and II. Our results

suggest that ZnPPIX and SnPPIX are not incorporated into the cytochrome c4:6xHis by

either system but rather are inhibiting biogenesis. The inhibition of holocytochrome

c4:6xHis synthesis with system I required significantly higher concentrations of ZnPPIX

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

17

and SnPPIX than with system II, in these experiments (see Fig. 6 and supplemental Fig.

2). The concentration of SnPPIX required for inhibition of holocytochrome c4:6xHis

synthesis was also higher for both systems (compared to ZnPPIX). The concentration of

ZnPPIX required for 50% inhibition of system I is approximately 2 µM and for system II

is approximately 25 nM, whereas the concentration of SnPPIX required for 50%

inhibition of system I is approximately 65 µM and for system II is approximately 18 µM.

To determine if ZnPPIX is affecting some basic cellular processes, growth studies

were performed with E. coli RK103 harboring pRGK333 (system I), pRGK332

(c4:6xHis), and pHPEX2 in the presence and absence of ZnPPIX. Cultures with either

12.5 µM or 25 µM ZnPPIX showed no decrease in the rate or yield of growth when

compared to the same strain without ZnPPIX (supplemental Fig. 3). ZnPPIX has

previously been shown to inhibit the final enzyme in heme biosynthesis, ferrochelatase,

from mouse at a Ki of 4.5 µM (13), however because no defect in growth is observed at

12.5 µM or 25 µM ZnPPIX, we conclude that ferrochelatase is not inhibited in our

system with these concentrations of ZnPPIX. In addition, using a plasmid with c4:Pho

(B. pertussis cytochrome c4 alkaline phosphatase fusion; 24) that is induced with

arabinose, alkaline phosphatase was detectable at equivalent levels in the presence of

ZnPPIX (supplemental Fig 4A lanes 6 and 7). These results indicate that ZnPPIX is not

inhibiting transcription, translation, or secretion of cytochrome c4, further suggesting that

ZnPPIX is specifically inhibiting some step(s) in c-type cytochrome biogenesis.

ZnPPIX specifically inhibits system I c-type cytochrome biogenesis after

holoCcmE synthesis. To begin to examine where ZnPPIX is inhibiting system I c-type

cytochrome biogenesis, we assayed for the presence of heme on cytochrome c4:6xHis

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

18

when both NMPP and ZnPPIX were included in the culture. NMPP is a strong inhibitor

of ferrocheletase and was used to control cellular heme levels (12, 25, 39). With NMPP

inhibition in E. coli (RK103) containing pRGK333 (systemI) and pRGK332 (c4:6xHis),

holocytochrome c synthesis was reduced to a basal level of approximately 38% (24).

This result was shown to be due to the ability of the CcmE protein to act as a reservoir for

heme, permitting residual (38%) synthesis of holocytochrome c4:6xHis when 100 µM

NMPP was added to the culture (24). Thus, in these experiments holoCcmE is present at

levels that allow 38 % of holocytochrome c4 production when ferrocheletase is inhibited.

If ZnPPIX inhibits synthesis significantly more than NMPP, it must be acting after the

formation of this heme reservoir since some holoCcmE is present at the time of ZnPPIX

addition (see Fig. 1). Cultures of E. coli (RK103) containing pRGK333 (system I),

pRGK332 (c4:6xHis), and pHPEX2 were grown and treated as described in Materials and

Methods (NMPP-ZnPPIX combined inhibition experiments). In addition, individual

inhibition experiments were performed that contained NMPP (Fig. 8 diamonds) or

ZnPPIX (Fig. 8 squares). When both NMPP and ZnPPIX (Fig. 8, triangles) were present

the holocytochrome c4:6xHis levels dropped from approximately 54% with NMPP alone

(Figure 8, 60 µM NMPP) to approximately 7% at 60 µM NMPP/5 µM ZnPPIX and from

approximately 30% (Figure 8, 100 µM NMPP) to 0% at 100 µM NMPP/5 µM ZnPPIX.

These results are consistent with previous data, that ZnPPIX inhibits holocytochrome

c4:6xHis production to nearly undetectable levels (for example see Figure 6A lane 5) and

considerably more than NMPP.

Our results suggest that ZnPPIX is inhibiting downstream of holoCcmE since this

“heme reservoir” is no longer available for cytochrome c4 biogenesis. Thus it is feasible

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

19

that the WWD containing protein CcmF is the target for ZnPPIX (see discussion and Fig.

1). If the target for ZnPPIX is a heme binding protein (site), then exogenous heme should

compete with this inhibition (i.e. ZnPPIX binding). To test this, we used the arabinose-

inducible cytochrome c4:Pho fusion for which the holocytochrome c4 component can be

assayed by heme stain in E. coli RK103 harboring system I and pHPEX2. Cultures

grown with ZnPPIX and increasing concentrations of exogenous heme showed a

corresponding increase in holocytochrome c4:Pho (supplemental Fig. 4B lanes 1-5). The

same heme stained polypeptides were confirmed to be full length cytochrome c4:Pho

fusion proteins by Western blot (Supplemental Fig 4A, lane 1-5). We also demonstrated

this heme competition with ZnPPIX using cytochrome c4:6xHis reporter. In the presence

of 8 µM ZnPPIX (supplemental Fig. 4C left panel; system I) or 2 µM ZnPPIX

(supplemental Fig. 4C right panel; system II), increasing concentrations of exogenous

heme showed a corresponding increase in holocytochrome c4:6xHis. We conclude that

heme is able to compete with ZnPPIX inhibition and that ZnPPIX is a specific inhibitor

of c-type cytochrome biogenesis by either system I or system II.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

20

DISCUSSION

Heme affinities of system I compared to system II. We have previously shown

that when heme biosynthesis is inhibited by the ferrocheletase inhibitor NMPP,

cytochrome c assembly persists at higher inhibitor concentrations using system I than

system II (24). We concluded that lower endogenous levels of heme can be used by the

system I pathway. However, with this method, we were not able to directly measure

heme levels, and the use of inhibitors clearly has caveats. For example, it could not be

ruled out that NMPP interferes with cytochrome c biogenesis directly. We develop here

an approach to directly control heme levels and quantify the product of biogenesis,

cytochrome c. We show that exogenous heme utilization by system I occurs at least 5-

fold lower levels than system II. These heme concentration dependence curves (Fig. 4)

also show differences in the kinetics between system I and system II. System I synthesis

exhibits a sigmoidal curve and saturated at low heme levels (around 3 µM), whereas

system II synthesis shows a linear response with a reduced slope, more reminiscent of a

diffusional process. We argue that these heme dependency results represent a true

reflection of the relative differences between systems I and II. Such comparisons must be

undertaken in the same genetic background, as done here. With two different organisms,

each with a natural system I or II, it would be impossible to assure or even expect

exogenous heme levels to reflect the same internal levels (for any given concentration).

With respect to the study here in E. coli, it is likely that the recombinant,

functional system II operates in an environment similar to its natural environment. Other

proteobacteria (e.g. B. pertussis and Helicobacter) probably gained their natural system II

genes from lateral transfer (30), indicating that the Gram negative periplasm and inner

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

21

membrane are appropriate environments. In fact, recently it has been discovered that

Bordetella parapertussis has the genes for both systems I and II (47), making it even

more likely that the Gram negative envelope proffers an environment for the use of either

system. Clearly, selective pressures maintain one or the other but only in this rare case,

both. Here we propose heme availability in the natural habitats as an important pressure.

Because heme biosynthesis depends on central metabolism (e.g. glutamate or

succinyl CoA and glycine), a limiting factor for heme biosynthesis is often free iron

levels (27, 42, 56). Based on the presence of the “heme reservoir” CcmE (24) and the 5-

fold higher affinity for heme, we speculate that organisms that are limited for heme

synthesis, such as those faced with low iron environments, would have an advantage

using system I. Concerning advantages for system II, the synthesis of fewer accessory

components (and not requiring ATP hydrolysis for heme flux through the system) may

confer benefits to some organisms, particularly when they do not need to scavenge for

heme or iron.

Metal porphyrins as inhibitors but not prosthetic groups for cytochrome c

assembly. While the replacement of the central Fe in horse heart cytochrome c with Zn

(54), Co (16), and Sn (54) by in vitro manipulation has been demonstrated, the use of

alternative metal porphyrins by cytochromes c biogenesis systems has not been tested.

Here various methods to detect ZnPPIX (and SnPPIX) insertion into the apocytochrome c

by either the system I or II cytochromes c biogenesis pathways were employed. No

evidence for insertion was obtained, suggesting specificity for FePPIX, at least for system

I and system II. This inability may relate to the specific system I and system II

attachment mechanism(s). Because little is known about the synthetase mechanism, a

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

22

future goal will be to understand the specific need for FePPIX over other metal

protoporphyrins.

Surprisingly, ZnPPIX and SnPPIX inhibit cytochrome c biogenesis. Heme

competes with this inhibitor (supplemental Fig. 4B and 4C), suggesting that protein(s) in

the pathway that bind heme are the likely targets. That heme binding proteins are targets

of non-iron metal porphyrins has also been suggested by Stojilijkovic and colleagues who

found that certain non-iron metal porphyrins have antibacterial properties (48). It is

important to note that the targets they proposed (eg. oxidases) are not the same we

demonstrate here. For example, they showed that gallium protoporhyrin IX (GaPPIX)

inhibits E. coli growth only under aerobic iron limiting conditions. However, wild-type

E. coli normally does not synthesize c-type cytochromes under any aerobic conditions.

We observed no inhibition of E. coli growth with ZnPPIX under aerobic conditions in

liquid media (even with a porphyrin porin). This suggests that the heme biosynthetic

enzyme ferrochelatase is not the target in our studies. Ferrochelatase from mouse is

inhibited by ZnPPIX with a Ki of 4.5 µM (13) but apparently the bovine enzyme is not

significantly inhibited (11). The E. coli enzyme has not been tested to our knowledge.

Stojiljkovic and colleagues (48) showed growth inhibition of Staphylococcus aureus by

GaPPIX and ZnPPIX but not SnPPIX. S. aureus does not have c-type cytochromes (or

system I or II; 34) and thus their putative target(s) are clearly different than studied here.

It is feasible that the inhibition observed by Stojilijkovic et al. (48) is due to the

previously demonstrated inhibition of ferrochelatase activity (13).

The system I pathway has three possible sites of interaction with ZnPPIX; the

proposed heme interacting proteins CcmC and CcmF (via the WWD domain) and the

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

23

“heme reservoir” on the chaperone protein CcmE. Here we show that ZnPPIX further

reduces the incomplete NMPP inhibition of system I to zero, thus inhibiting

holocytochrome c biosynthesis downstream of the CcmE reservoir (e.g. CcmF). (These

experiments do not rule out an additional interaction of ZnPPIX with the CcmC and/or

the CcmE proteins). In the case of system II, we postulate that heme diffuses to the

periplasmic WWD domain of CcsA for ligation to apocytochrome c. Thus there is only

one likely target for ZnPPIX/SnPPIX inhibition in the system II pathway, that being the

WWD domain of CcsA.

ZnPPIX and SnPPIX are potent inhibitors of another heme-binding enzyme, heme

oxygenase [HO-1; (37)] which is responsible for the oxidative cleavage of heme to yield

free iron, carbon monoxide, and biliverdin (50). Metalloporphyrins compete with

FePPIX for binding to the heme-binding pocket of HO-1, but due to the closed shell

nature of zinc and tin, these metalloporphyrins cannot undergo oxidation-reduction

reactions thus they act as inhibitors of HO-1 rather than substrates (36, and references

therein). CoPPIX, recognized mainly for its ability to induce HO-1 synthesis by an

unknown mechanism (45), is also a weak inhibitor of HO-1 enzymatic activity (37).

Metalloporphyrins have also been found to irreversibly inhibit both caspase-3 and -8,

both non heme-binding proteins, by binding to the active site and blocking the binding of

a specific substrate, for example caspase-3 with poly-ADP ribose polymerase (6). This

inhibition was found to be mainly dependent on the porphyrin ring structure as metal-free

protopophyrin IX also exhibited inhibition, but a role for the central metal ion could not

be ruled out (6). Inhibition of cytochrome c assembly pathways I and II add two more

specific targets for metal porphyrins. The approach used here will facilitate further

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

24

analysis of cytochrome c synthetase mechanisms and the discovery of other inhibitors of

these systems.

ACKNOWLEDGEMENTS

We thank Dr. Douglas Goodwin, Auburn University for the pHPEX2 plasmid and Dr.

James Fox, Massachusetts Institute of Technology for Helicobacter hepaticus. This work

was supported by NIH Grant GM47909 to R.G.K.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

25

REFERENCES

1. Allen, J. W., E. M. Harvat, J. M. Stevens, and S. J. Ferguson. 2006. A variant

System I for cytochrome c biogenesis in archaea and some bacteria has a novel

CcmE and no CcmH. FEBS Lett 580:4827-34.

2. Barker, P. D., J. C. Ferrer, M. Mylrajan, T. M. Loehr, R. Feng, Y. Konishi,

W. D. Funk, R. T. MacGillivray, and A. G. Mauk. 1993. Transmutation of a

heme protein. Proc Natl Acad Sci U S A 90:6542-6.

3. Barker, P. D., E. P. Nerou, S. M. Freund, and I. M. Fearnley. 1995.

Conversion of cytochrome b562 to c-type cytochromes. Biochemistry 34:15191-

203.

4. Beckett, C. S., J. A. Loughman, K. A. Karberg, G. M. Donato, W. E.

Goldman, and R. G. Kranz. 2000. Four genes are required for the system II

cytochrome c biogenesis pathway in Bordetella pertussis, a unique bacterial

model. Mol Microbiol 38:465-81.

5. Beckman, D. L., D. R. Trawick, and R. G. Kranz. 1992. Bacterial cytochromes

c biogenesis. Genes Dev 6:268-83.

6. Blumenthal, S. B., A. K. Kiemer, G. Tiegs, S. Seyfried, M. Holtje, B. Brandt,

H. D. Holtje, S. Zahler, and A. M. Vollmar. 2005. Metalloporphyrins inactivate

caspase-3 and -8. Faseb J 19:1272-9.

7. Bonnard, G., and J. M. Grienenberger. 1995. A gene proposed to encode a

transmembrane domain of an ABC transporter is expressed in wheat

mitochondria. Mol Gen Genet 246:91-9.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

26

8. Bracken, C. S., M. T. Baer, A. Abdur-Rashid, W. Helms, and I. Stojiljkovic.

1999. Use of heme-protein complexes by the Yersinia enterocolitica HemR

receptor: histidine residues are essential for receptor function. J Bacteriol

181:6063-72.

9. Cavazza, C., M. T. Giudici-Orticoni, W. Nitschke, C. Appia, V. Bonnefoy,

and M. Bruschi. 1996. Characterisation of a soluble cytochrome c4 isolated from

Thiobacillus ferrooxidans. Eur J Biochem 242:308-14.

10. Conrad, L. S., J. J. Karlsson, and J. Ulstrup. 1995. Electron transfer and

spectral alpha-band properties of the di-heme protein cytochrome c4 from

Pseudomonas stutzeri. Eur J Biochem 231:133-41.

11. Dailey, H. A. 1990. in Biosynthesis of Heme and Chlorophylls. McGraw-Hill,

New York, NY.

12. Dailey, H. A., and J. E. Fleming. 1983. Bovine ferrochelatase. Kinetic analysis

of inhibition by N-methylprotoporphyrin, manganese, and heme. J Biol Chem

258:11453-9.

13. Dailey, H. A., C. S. Jones, and S. W. Karr. 1989. Interaction of free porphyrins

and metalloporphyrins with mouse ferrochelatase. A model for the active site of

ferrochelatase. Biochim Biophys Acta 999:7-11.

14. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of

chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad

Sci U S A 97:6640-5.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

27

15. Deshmukh, M., G. Brasseur, and F. Daldal. 2000. Novel Rhodobacter

capsulatus genes required for the biogenesis of various c-type cytochromes. Mol

Microbiol 35:123-38.

16. Dickinson, L. C., and J. C. Chien. 1975. Cobalt-cytochrome c. I. Preparation,

properties, and enzymic activity. Biochemistry 14:3526-34.

17. Dickinson, L. C., and J. C. Chien. 1975. Cobalt-cytochrome c. II. Magnetic

resonance spectra and conformational transitions. Biochemistry 14:3534-42.

18. Dumont, M. D., A. J. Mathews, B. T. Nall, S. B. Baim, D. C. Eustice, and F.

Sherman. 1990. Differential stability of two apo-isocytochromes c in the yeast

Saccharomyces cerevisiae. J Biol Chem 265:2733-9.

19. Dumont, M. E., J. F. Ernst, D. M. Hampsey, and F. Sherman. 1987.

Identification and sequence of the gene encoding cytochrome c heme lyase in the

yeast Saccharomyces cerevisiae. Embo J 6:235-41.

20. Falk, J. 1964. Porphyrins and Metalloporphyrins, vol. 2. Elsevier Publishing Co.,

New York, NY.

21. Feissner, R., Y. Xiang, and R. G. Kranz. 2003. Chemiluminescent-based

methods to detect subpicomole levels of c-type cytochromes. Anal Biochem

315:90-4.

22. Feissner, R. E., C. S. Beckett, J. A. Loughman, and R. G. Kranz. 2005.

Mutations in cytochrome assembly and periplasmic redox pathways in Bordetella

pertussis. J Bacteriol 187:3941-9.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

28

23. Feissner, R. E., C. L. Richard-Fogal, E. R. Frawley, and R. G. Kranz. 2006.

ABC transporter-mediated release of a haem chaperone allows cytochrome c

biogenesis. Mol Microbiol 61:219-31.

24. Feissner, R. E., C. L. Richard-Fogal, E. R. Frawley, J. A. Loughman, K. W.

Earley, and R. G. Kranz. 2006. Recombinant cytochromes c biogenesis systems

I and II and analysis of haem delivery pathways in Escherichia coli. Mol


25. Ferreira, G. C. 1994. Mammalian ferrochelatase. Overexpression in Escherichia

coli as a soluble protein, purification and characterization. J Biol Chem 269:4396-

400.

26. Fitz-Gibbon, S. T., H. Ladner, U. J. Kim, K. O. Stetter, M. I. Simon, and J.

H. Miller. 2002. Genome sequence of the hyperthermophilic crenarchaeon

Pyrobaculum aerophilum. Proc Natl Acad Sci U S A 99:984-9.

27. Gao, T., and M. R. O'Brian. 2005. Iron-dependent cytochrome c1 expression is

mediated by the status of heme in Bradyrhizobium japonicum. J Bacteriol

187:5084-9.

28. Goldman, B. S., D. L. Beck, E. M. Monika, and R. G. Kranz. 1998.

Transmembrane heme delivery systems. Proc Natl Acad Sci U S A 95:5003-8.

29. Goldman, B. S., D. L. Beckman, A. Bali, E. M. Monika, K. K. Gabbert, and

R. G. Kranz. 1997. Molecular and immunological analysis of an ABC transporter

complex required for cytochrome c biogenesis. J Mol Biol 268:724-38.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

29

30. Goldman, B. S., and R. G. Kranz. 1998. Evolution and horizontal transfer of an

entire biosynthetic pathway for cytochrome c biogenesis: Helicobacter,

Deinococcus, Archae and more. Mol Microbiol 27:871-3.

31. Gonzalez, D. H., G. Bonnard, and J. M. Grienenberger. 1993. A gene involved

in the biogenesis of c-type cytochromes is co-transcribed with a ribosomal protein

gene in wheat mitochondria [corrected]. Curr Genet 24:248-55.

32. Inoue, K., B. W. Dreyfuss, K. L. Kindle, D. B. Stern, S. Merchant, and O. A.

Sodeinde. 1997. Ccs1, a nuclear gene required for the post-translational assembly

of chloroplast c-type cytochromes. J Biol Chem 272:31747-54.

33. Kranz, R., R. Lill, B. Goldman, G. Bonnard, and S. Merchant. 1998.

Molecular mechanisms of cytochrome c biogenesis: three distinct systems. Mol


34. Kranz, R. G., C. S. Beckett, and B. S. Goldman. 2002. Genomic analyses of

bacterial respiratory and cytochrome c assembly systems: Bordetella as a model

for the system II cytochrome c biogenesis pathway. Res Microbiol 153:1-6.

35. Le Brun, N. E., J. Bengtsson, and L. Hederstedt. 2000. Genes required for

cytochrome c synthesis in Bacillus subtilis. Mol Microbiol 36:638-50.

36. Maines, M. D. 2004. The heme oxygenase system: past, present, and future.

Antioxid Redox Signal 6:797-801.

37. Maines, M. D. 1981. Zinc. protoporphyrin is a selective inhibitor of heme

oxygenase activity in the neonatal rat. Biochim Biophys Acta 673:339-50.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

30

38. Mills, M., and S. M. Payne. 1995. Genetics and regulation of heme iron transport

in Shigella dysenteriae and detection of an analogous system in Escherichia coli

O157:H7. J Bacteriol 177:3004-9.

39. Moody, M. D., and H. A. Dailey. 1985. Ferric iron reductase of

Rhodopseudomonas sphaeroides. J Bacteriol 163:1120-5.

40. Nargang, F. E., M. E. Drygas, P. L. Kwong, D. W. Nicholson, and W.

Neupert. 1988. A mutant of Neurospora crassa deficient in cytochrome c heme

lyase activity cannot import cytochrome c into mitochondria. J Biol Chem

263:9388-94.

41. Page, M. D., and S. J. Ferguson. 1997. Paracoccus denitrificans CcmG is a

periplasmic protein-disulphide oxidoreductase required for c- and aa3-type

cytochrome biogenesis; evidence for a reductase role in vivo. Mol Microbiol

24:977-90.

42. Pope, C. D., W. O'Connell, and N. P. Cianciotto. 1996. Legionella

pneumophila mutants that are defective for iron acquisition and assimilation and

intracellular infection. Infect Immun 64:629-36.

43. Ramseier, T. M., H. V. Winteler, and H. Hennecke. 1991. Discovery and

sequence analysis of bacterial genes involved in the biogenesis of c-type

cytochromes. J Biol Chem 266:7793-803.

44. Schiott, T., C. von Wachenfeldt, and L. Hederstedt. 1997. Identification and

characterization of the ccdA gene, required for cytochrome c synthesis in Bacillus

subtilis. J Bacteriol 179:1962-73.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

31

45. Shan, Y., R. W. Lambrecht, and H. L. Bonkovsky. 2004. Identification of key

elements that are responsible for heme-mediated induction of the avian heme

oxygenase-1 gene. Biochim Biophys Acta 1679:87-94.

46. Steiner, H., G. Kispal, A. Zollner, A. Haid, W. Neupert, and R. Lill. 1996.

Heme binding to a conserved Cys-Pro-Val motif is crucial for the catalytic

function of mitochondrial heme lyases. J Biol Chem 271:32605-11.

47. Stevens, J. M., O. Daltrop, J. W. Allen, and S. J. Ferguson. 2004. C-type

cytochrome formation: chemical and biological enigmas. Acc Chem Res 37:999-

1007.

48. Stojiljkovic, I., V. Kumar, and N. Srinivasan. 1999. Non-iron

metalloporphyrins: potent antibacterial compounds that exploit haem/Hb uptake

systems of pathogenic bacteria. Mol Microbiol 31:429-42.

49. Stojiljkovic, I., and D. Perkins-Balding. 2002. Processing of heme and heme-

containing proteins by bacteria. DNA Cell Biol 21:281-95.

50. Tenhunen, R., H. S. Marver, and R. Schmid. 1968. The enzymatic conversion

of heme to bilirubin by microsomal heme oxygenase. Proc Natl Acad Sci U S A

61:748-55.

51. Thony-Meyer, L. 2002. Cytochrome c maturation: a complex pathway for a

simple task? Biochem Soc Trans 30:633-8.

52. Tichy, M., and W. Vermaas. 1999. Accumulation of pre-apocytochrome f in a

Synechocystis sp. PCC 6803 mutant impaired in cytochrome c maturation. J Biol

Chem 274:32396-401.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

32

53. Torres, A. G., and S. M. Payne. 1997. Haem iron-transport system in

enterohaemorrhagic Escherichia coli O157:H7. Mol Microbiol 23:825-33.

54. Vanderkooi, J. M., F. Adar, and M. Erecinska. 1976. Metallocytochromes c:

characterization of electronic absorption and emission spectra of Sn4+

and Zn2+

cytochromes c. Eur J Biochem 64:381-7.

55. Varnado, C. L., and D. C. Goodwin. 2004. System for the expression of

recombinant hemoproteins in Escherichia coli. Protein Expr Purif 35:76-83.

56. Viswanathan, V. K., S. Kurtz, L. L. Pedersen, Y. Abu-Kwaik, K. Krcmarik,

S. Mody, and N. P. Cianciotto. 2002. The cytochrome c maturation locus of

Legionella pneumophila promotes iron assimilation and intracellular infection and

contains a strain-specific insertion sequence element. Infect Immun 70:1842-52.

57. Wandersman, C., and I. Stojiljkovic. 2000. Bacterial heme sources: the role of

heme, hemoprotein receptors and hemophores. Curr Opin Microbiol 3:215-20.

58. Wulff, D. L. 1967. Delta-aminolevulinic acid-requiring mutant from Escherichia

coli. J Bacteriol 93:1473-4.

59. Xie, Z., and S. Merchant. 1998. A novel pathway for cytochromes c biogenesis

in chloroplasts. Biochim Biophys Acta 1365:309-18.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

33

FIGURE LEGENDS

Figure 1. Diagram of the current working model for c-type cytochromes biogenesis from

systems I and II. Also shown is the ChuA heme porin pathway used in this study and the

first dedicated step in heme biosynthesis. The ⊥⊥⊥⊥ symbol denotes targets for inhibitors

used in the current study.

Figure 2. Heme stains of cytochrome c4 with increasing concentrations of ALA. E. coli

RK105 containing pRGK333 (lanes 1-5) or pRGK334 (lanes 6-10) were diluted into

fresh media without ALA, depleting intracellular ALA. ALA was added (concentrations

in µM above corresponding lane number) along with 1 mM IPTG for one hour. The

cytochrome c4:6xHis was induced with 0.2% arabinose for three hours and soluble B-

PER protein extracts were prepared. Above each panel SysI indicates pRGK333, SysII

indicates pRGK334, and c4:6xHis indicates pRGK332.

Figure 3. Growth of E. coli RK105 with exogenous heme. Overnight cultures of E. coli

RK105 (∆ccm∆hemA) or containing pHPEX2 and (A) pRGK333 or (B) pRGK334 were

diluted into media without ALA or heme. The cultures were incubated aerobically at

37°C for two and one-half hours to exhaust the cultures for ALA. Heme was added at the

indicated concentrations when noted and growth (A600) was measured. For reference, the

growth of E. coli RK103 (wild-type) containing either pRGK333 or pRGK334 is shown

(�).

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

34

Figure 4. Exogenous heme acquisition profiles for system I and system II. An E. coli

heme auxotroph (RK105) containing pRGK333 or pRGK368, pRGK332, and pHPEX2

(outer membrane heme porin) were grown and treated as in Materials and Methods.

Heme stains of holocytochrome c4 from representative trials with system I (a) and system

II (c). Curve fits to average heme stain intensity as a percentage of maximum signal

intensity with respect to heme concentration is shown in (b) for system I (n=4) and (d) for

system II (n=5).

Figure 5. Heme stain of holocytochrome c4:6xHis with increasing concentrations of

ZnPPIX. E. coli RK105 containing pRGK333, pRGK332, and pHPEX2 were grown in 8

µM heme (lanes 1, 3-5) or 25 µM heme (lane 2) to an OD600 of approximately 0.5.

ZnPPIX was added (lanes 3-5) and 1 mM IPTG to induce synthesis of the system I

proteins. Incubation continued for one hour and 0.2% arabinose was added for three

hours to induce the synthesis of the cytochrome c4. The concentrations (in µM) of heme

and ZnPPIX are given above each lane. Above the panel SysI is pRGK333 and c4:6xHis

is pRGK332.

Figure 6. Heme stains for detection of holocytochrome c4 synthesis in the presence of

ZnPPIX. E. coli RK103, containing either (A) pRGK333, pRGK332, and pHPEX2 or

(B) pRGK368, pRGK332, and pHPEX2 were grown and treated as stated in Materials

and Methods. The concentrations (in µM or nM) of ZnPPIX are given above each lane.

Above the panel SysI is pRGK333, SysII is pRGK368, c4:6xHis is pRGK332 and ∆ccm

is E. coli RK103.

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

35

Figure 7. Reduced and oxidized absorption spectra and ESI-MS analysis of cytochrome

c4 produced in the presence of ZnPPIX. Overnight cultures of E. coli RK103 containing

pRGK333 (system I), pRGK332 (cytochrome c4:6xHis), and pHPEX2 were diluted into

fresh media and grown to mid-log phase. ZnPPIX (8 µM) and IPTG (1 mM) were added

and incubation continued for an additional hour. Arabinose (0.2%) was added for three

hours to induce synthesis of cytochrome c4:6xHis and soluble B-PER extracts were

prepared. (A) Reduced (sodium hydrosulphite) and oxidized (ammonium persulfate)

absorption spectra and (B) ESI-MS analysis.

Figure 8. Holocytochrome c4 synthesis in the presence of ZnPPIX and NMPP. E. coli

RK103 containing pRGK333(system I), pRGK332 (cytochrome c4:6xHis), and pHPEX2

were grown and treated as stated in Materials and Methods. Independent (NMPP and

ZnPPIX) inhibition experiments were also performed (diamonds and open squares,

respectively). Holocytochrome c4 quantitation by heme stain intensity (in arbitrary units)

from three independent trials. ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

ACCEPTED on Novem


.org/D

ownloaded from

http://jb.asm.org/

ACCEPTED

on Novem


.org/D

ownloaded from

http://jb.asm.org/

heme concentration dependence and metalloporphyrin...

Documents