hdac8 regulates a stress response pathway in melanoma to ... · cell culture: the 1205lu, wm164 and...

1

HDAC8regulatesastressresponsepathwayinmelanomatomediateescapefromBRAFinhibitortherapy

Michael F. Emmons1, Fernanda Faião-Flores1, Ritin Sharma5, Ram Thapa6, Jane L.

Messina2, Jurgen C. Becker3, Dirk Schadendorf3, Edward Seto4, Vernon K. Sondak2,

John M. Koomen5, Yian A. Chen6, Eric K. Lau1,2, Lixin Wan5, Jonathan D. Licht7, &

Keiran S.M. Smalley1,2*

1The Department of Tumor Biology, 2The Department of Cutaneous Oncology, 5The Department of Molecular Oncology, 6Department of Bioinformatics and Biostatistics, The Moffitt Cancer Center &

Research Institute, 12902 Magnolia Drive, Tampa, FL, USA. 3Department of Translational Skin Cancer Research, German Cancer Consortium (DKTK), University Hospital Essen, Universitätstraße 1, 45141,

Essen, Germany. 4George Washington University, Washington, D.C., USA. 7The University of Florida Health Cancer Center, Gainesville, FL.

*To whom correspondence should be addressed

Department of Tumor Biology, Moffitt Cancer Center, 12902 Magnolia Drive, Tampa, FL, 33612, USA

Tel: 813-745-8725

Fax: 813-449-8260

e-mail: [email protected]

Runningtitle: HDAC8 and melanoma

Wordcount: 4999 words

Grantsupport: Supported by SPORE grant P50 CA168536 (to KSM Smalley, VK Sondak, JL Messina, YA Chen), NCI R21 CA216756 (to KSM Smalley), Florida Department of Health 8BC03 (to KSM Smalley, JD Licht) and Forma Therapeutics (to KSM Smalley). This work has been supported in part by the Proteomics and Metabolomics Core, the Biostatistics and Bioinformatics Core, the Tissue Core, and Flow Cytometry Core Facility at the Moffitt Cancer, an NCI designated Comprehensive Cancer Center (P30-CA076292). Keywords: melanoma, BRAF, MEK, HDAC8, deacetylation, c-Jun, adaptation.Conflictsof interest:VKS serves a consultant for Array, Bristol Myers Squibb, Genentech-Roche, Merck and Novartis. DS has received speaker honoraria from Roche, Novartis, Bristol-Myers Squibb, Merck Sharp & Dome, Amgen, Merck Serono and Pierre-Fabre, advisory board honoraria from Roche, Novartis, Bristol-Myers Squibb, Merck Sharp & Dome, Amgen, Incyte, Merck Serono and Pierre-Fabre as well as research funding from Novartis and Bristol-Myers Squibb. JCB has received speaker honoraria from Amgen, Merck Serono, and Pfizer, advisory board honoraria from Amgen, CureVac, eTheRNA, Lytix, Merck Serono, Novartis, Rigontec, and Takeda as well as research funding from Alcedis, Boehringer Ingelheim, Bristol-Myers Squibb and Merck Serono; he also received travel support from 4SC and Incyte. All other authors declare no conflict of interest.

on April 22, 2020. © 2019 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on April 15, 2019; DOI: 10.1158/0008-5472.CAN-19-0040

http://cancerres.aacrjournals.org/

2

Abstract:

Melanoma cells have the ability to switch to a dedifferentiated, invasive phenotype

in response to multiple stimuli. Here we show that exposure of melanomas to

multiple stresses including BRAF-MEK inhibitor therapy, hypoxia, and UV

irradiation leads to an increase in histone deacetylase 8 (HDAC8) activity and the

adoption of a drug-resistant phenotype. Mass spectrometry-based

phosphoproteomics implicated HDAC8 in the regulation of MAPK and AP-1

signaling. Introduction of HDAC8 into drug-naïve melanoma cells conveyed

resistance both invitro and invivo. HDAC8-mediated BRAF inhibitor resistance was

mediated via receptor tyrosine kinase (RTK) activation, leading to MAPK signaling.

Although HDACs function at the histone level, they also regulate non-histone

substrates, and introduction of HDAC8 decreased the acetylation of c-Jun, increasing

its transcriptional activity and enriching for an AP-1 gene signature. Mutation of the

putative c-Jun acetylation site at lysine 273 increased transcriptional activation of c-

Jun in melanoma cells and conveyed resistance to BRAF inhibition. Invivo xenograft

studies confirmed the key role of HDAC8 in therapeutic adaptation, with both non-

selective and HDAC8-specific inhibitors enhancing the durability of BRAF inhibitor

therapy. Our studies demonstrate that HDAC8-specific inhibitors limit the

adaptation of melanoma cells to multiple stresses including BRAF-MEK inhibition.

Significance: This study provides evidence that HDAC8 drives transcriptional

plasticity in melanoma cells in response to a range of stresses through direct

deacetylation of c-Jun.




3

Introduction

Use of BRAF inhibitors and BRAF-MEK inhibitor combinations is associated with

impressive therapeutic responses and increased overall survival in patients whose

melanomas harbor position 600 mutations in BRAF (1). Despite this, most patients

ultimately fail therapy, and cures remain rare (1, 2). Although much is now known

about the genetic mediators of acquired BRAF and BRAF-MEK inhibitor resistance,

there is still an urgent need to better understand the mechanisms underlying

treatment failure, particularly at the earliest stages, so that new therapeutic

strategies and drug combinations can be developed (2-5). The process of early

adaptation to therapy remains poorly defined but appears to involve the adoption of

a slow-growing “persister” state that is marked by de-differentiation, phenotypic

plasticity and some recovery of MAPK signaling (6). This early rebound in MAPK

signaling is frequently mediated through increased receptor tyrosine kinase (RTK)

signaling, with a number of studies now implicating roles for IGF1R, EGFR, Axl, c-

MET, PDGFR and EphA2 (7-10).

In our previous studies, we used comprehensive mass spectrometry-based

phosphoproteomics to identify a ligand-independent EphA2 driven signaling

network as a driver of an aggressive, EMT-like phenotype in melanoma cells with

acquired BRAF inhibitor resistance (11). This S897-EphA2 driven signaling

network was dependent upon continuous MAPK pathway inhibition and was

reversed following drug withdrawal for >3 weeks (11). The plasticity of this drug-

induced phenotype suggested these changes could be epigenetically mediated (11).

In the present study, we asked whether a common transcriptional state that

emerged when melanoma cells were subjected to stress allowed melanoma cells to

survive diverse insults. Our work identified a novel role for HDAC8 as a mediator of

phenotype switching and the therapeutic adaptation of melanoma cells to BRAF

inhibition. Unexpectedly, we found that HDAC8 regulates BRAF inhibitor sensitivity

and acquired drug resistance through direct effects upon c-Jun acetylation, leading

to transcriptional rewiring and increased RTK and MAPK signaling. Together, these

results point to a new role for the histone deacetylases in regulating the cell

signaling networks at the protein acetylation level that mediates therapeutic escape.




4

Materialsandmethods

CellCulture:The 1205Lu, WM164 and SKMEL-28 cell lines were a generous gift

from Dr. Meenhard Herlyn (The Wistar Institute, Philadelphia, PA). The dual BRAF

and MEK inhibitor resistant (RR) lines 1205LuRR, SKMEL28RR and WM164RR were

established as previously described (12). Panobinostat, PCI-34051 and erlotinib

were from Selleckchem. Hypoxia was achieved via an oxygen control glove box (Coy

Labs (Grass Lake, MI)) for 24 hours in conditions containing 94% N2, 1% O2, and 5%

CO2. All cells were tested for mycoplasma contamination every 3 months using the

Plasmotest-Mycoplasma Detection Test (Invivogen, San Diego, CA). Last test date:

3/18/19. Each cell line was authenticated using the Human STR human cell line

authentication service (ATCC) and frozen stocks of cells were discarded after 10

passages.

Western Blotting: Lysates were acquired and processed for Western Blot and

immunoprecipitation as previously described (11). The anti-HDAC3 and anti-HDAC8

antibodies were described in (13, 14). The antibodies against HDAC1 (2062),

HDAC2 (2540), BIM (2933), Mcl-1 (4572), phospho-ERK (9101), ERK (9102),

phospho-CRAF (56A6, 9427), CRAF (D4B3J, 53745), phospho-EphA2(D9A1, 6347),

EphA2(D4A2, 6997), phospho-AKT(D9E, 4060), AKT(9272), phospho-c-Jun(54B3,

2361), c-Jun(60A8, 9165) and acetyl(9441) were purchased from Cell Signaling

Technology (CST; Danvers, Ma). Anti-HDAC6 (H-300, sc-11420) was purchased from

Santa Cruz Biotechnologies (Dallas, TX). Anti-HDAC11 (ab47036) was purchased

from Abcam (Cambridge, UK). Anti-Vinculin (G8796) and anti-GAPDH (V9131)

were purchased from MilliporeSigma (St. Louis, MO). Ac-SMC3 was a kind gift from

Forma Therapeutics (Watertown, MA). Phospho-RTKs were measured with the

Human Phospho-Receptor Tyrosine Kinase Array Kit (R&D Biosystems,

Minneapolis, MN). Activated and total Ras were measured with the Active Ras Pull-

Down and Detection Kit (ThermoFisher, Carlsbad, CA). For each experiment, all

antibodies were probed on the same blot. In cases where bands were similar, the

blots were washed with Restore Western Blot Stripping Buffer for 10 minutes

before a new antibody was used.




5

CellDeathAssays:Cells were treated with drugs (72 h), harvested and incubated

with Annexin-V APC (BD biosciences (BD), Franklin Lakes, NJ). Fluorescence was

read on a FACSCalibur (BD) and analyzed using Flowjo software. To measure cell

death following induction of stress, 300 cells were counted for cell death by trypan

exclusion using a 0.4% trypan blue solution (MilliporeSigma)

Colony formationassay:Cells were treated with drug for 28 days before being

stained with a 0.5% Crystal Violet solution. Colonies were quantified using ImageJ

software.

Immunohistochemistry: Samples from melanoma patients pre- and post-BRAF

and BRAF-MEK inhibitor therapy were collected from the University Hospital Essen

under a written informed consent protocol. Formalin-fixed, paraffin- embedded

(FFPE) slides were stained for HDAC8 expression using the Ventana Discovery XT

automated system and an anti-HDAC8 antibody (Novus Biologicals, Littleton, CO) at

a 1:100 concentration with 60 minute incubation. Staining was detected using the

Ventana ChromoMap Red kit and slides counterstained with hematoxylin. For

mouse immunohistochemistry, FFPE slides were stained for phospho-c-Jun (Abcam,

ab32385) for 1 hour at a 1:100 concentration and slides were uploaded into an

Aperio AT2 scanner (Leica Biosystems, Buffalo Grove, IL) and visualized using

Aperio Imagescape 12.3.3 (Leica Biosystems)

Proteomics:Cells were lysed in an urea lysis buffer (20mM HEPES pH 8.0, 9M Urea,

1mM Sodium Orthovanadate, 2.5 mM Sodium pyrophosphate, 1 mM β-

glycerophosphate), and protein concentration of the lysate was measured by

Bradford assay. Extracted proteins (10 mg) were digested by trypsin and enriched

for phospho-tyrosine and phospho-serine/threonine as previously described (11).

Extracted proteins from each condition (EV or HDAC8) were trypsin digested and 2

equal aliquots of tryptic peptides (100 µg) were labeled by distinct Tandem Mass

Tags (TMT six-plex reagents, ThermoFisher), combined and subjected to offline high

pH Reverse Phase fractionation (15). Each of the fractions were enriched for

phosphopeptides using a Phos-SELECT Iron Affinity Gel (MilliporeSigma) (16). Mass

spectrometry data was acquired on a QExactive mass spectrometer coupled to a

U3000 RSLCnano system (ThermoFisher) as described previously (16). Two




6

technical replicates were performed for the immune-enriched phosphotyrosine

samples as well as each of the IMAC-enriched fractions. Label-free quantitation was

performed for phosphotyrosine samples while MS2-reporter ion quantitation was

performed for IMAC-enriched samples using MaxQuant (1.2.2.5) (17). Data are

available in PRIDE (PXD012813 and PXD012812).

RNA‐Seq: Isolated RNA was cleaned using a RNAeasy minicleanup kit (Qiagen,

Hilden Germany) and screened for quality on an Agilent BioAnalyzer (Santa Clara,

CA). The samples were then processed for RNA-sequencing using the NuGen

Ovation Human FFPE RNA-Seq Multiplex System. The libraries were then

sequenced on the Illumina NextSeq 500 sequencer (San Diego, CA) with a 2 X 75-

base paired-end run in order to generate 40-50 million read pairs per sample. Data

are available in GEO (GSE127564).

Analysis of sequencing and proteomic data: Combat was used to normalize

phosphotyrosine profiles before further analyses (18). Log2 transformation was

applied to all three datasets (RNA-Seq, and both phosphorylation experiments).

Moderated t-statistics were used to compare the RNA expression between baseline

(EV) and HDAC8 overexpression (HDAC8) samples in RNA-seq data for each of

18,542 genes using the limma package in R (19). In phosphotyrosine residue data,

172 phosphopeptides were used for assessing differential expression in HDAC8

versus EV samples. In serine/threonine phosphopeptide data, 1,976

phosphopeptides were used in assessing differential expression in HDAC8 versus EV

samples. Volcano plots with significant phosphopeptides denoted by fold change >

2 & p-value < 0.05 in the contrast between EV and HDAC8 samples were also used

for visualization.

Normalized phosphoproteomic data was combined and analyzed using GeneGO

software (Metacore, Thomson Reuters). Significant interactions between genes

were determined with an cutoff value of p<0.05. Normalized pY and pS/T proteomic

data were uploaded and analyzed by STRING. The most stringent interaction

threshold of 0.9 was used to find the most significant interactions upregulated in

HDAC8 expressing cells. Significant interactions exported from GeneGO were

organized into a global signaling hub using Cytoscape software. RNA-Seq data was




7

analyzed by Gene Signiture Enrich Analysis (GSEA). The data was analyzed for

significant transcription factors using an FDR cutoff of 0.05.

Transfectionandinfection:Cells were placed in OPTI-MEM media in the presence

of the plasmid or siRNA and lipofectamine 2000. Mcl-1 (ON Target SMART pool)

siRNA and non-targeting control siRNA was purchased from ThermoFisher. The

empty vector plasmids were purchased from Origene Technologies Inc (Rockville,

MD). For infection of MilliporeSigma shRNA viral particles, infection was performed

per manufacterers protocol. After 24 hours, the media was removed and replaced

with media containing 1 µg/ml puromycin (Millipore Sigma). shRNA against HDAC8

(SHCLNV-NM_018486, TRCN0000004851) was purchased from Millipore Sigma.

PCR: EGFR mRNA expression was measured by quantitative RT-PCR. EGFR and

GAPDH primers were purchased from Applied Biosystems (AB, Thermo). cDNA was

made from isolated RNA with the High Capacity cDNA Reverse Transcriptase Kit

(AB) and 100 µg of cDNA was run on a 7900HT Fast Real-Time PCR System for 40

cycles using Taqman master mix (AB). Samples were normalized to control.

Promoter Assay: To assess ATF2 and c-JUN transcriptional activity, we

implemented a dual secreted luciferase assay as previously described (20). At 48

hours after transfection, the cells were treated with specified drugs, and at the

indicated times, media samples containing secreted lucifase were harvested and

measured for luciferase activity using the Pierce Gaussia Luciferase Glow Assay Kit

per manufacturer’s instructions (ThermoFisher).

DNABindingAssay: Binding of c-Jun and c-Jun mutant cells to the consensus JUN

DNA sequence was performed using the Mouse/Human/Rat JUN/c-Jun DNA Binding

ELISA kit (LSBio, Seattle, WA) per the manufacturers instructions. Samples were

read on a plate reader at 450 nm.

Mutagenesis:The following primers were ordered from Integrated DNA

Technologies.268 mutant: 5’ gcatcgctgc ctccagatgc cgaaaaagga agctggagag aatcg 3’

5’ cgatt ctctccagct tcctttttcg gcatctggag gcagcgatgc 3’ 271 mutant: 5’ gcatcgctgc

ctccaagtgc cgaagaagga agctggagag aatcg 3’ 5’ cgatt ctctccagct tccttcttcg gcacttggag

gcagcgatgc 3’273 mutant: 5’ gcatcgctgc ctccaagtgc cgaaaaagga gactggagag aatcg 3’




8

5’ cgatt ctctccagtc tcctttttcg gcacttggag gcagcgatgc 3’ Mutant DNA constructs were

made by a site-directed mutagenesis kit (ThermoFisher) against a WT c-Jun plasmid

(Origene Technologies) per manufacturers instructions. Mutant constructs were

sequenced (Genewiz, South Plainfield, NJ) using plasmid DNA and c-Jun primer

sequence cgtttggagtcgttgaagttg (IDT). DNA was stably transfected into cells using

lipofectamine 2000 and clones were selected for further study. After selection,

endogenuous levels of c-Jun were knocked down using a 3’ shRNA for JUN (SHCLNV-

NM_002228, TRCN0000039588, Millipore Sigma).

In vivo studies: Cells were injected into the hind flank of NOD.CB17-Prkdcscid/J

mice(Taconic, Germantown, NY) in a solution containing 50% L-15 media

(ThermoFisher) with 1mM HEPES (MilliporeSigma) and 50% matrigel (BD). 10

tumors were used for each group in each experiment. All studies were approved by

the University of South Florida IACUC (#IS00004987). PLX 4720 was given using

formulated chow (Research Diets, New Brunswick, NJ) while panobinostat and PCI-

34051 were given by i.p. injections for the duration of the experiment. Weight and

tumor size were measured with calipers and were monitored 3 times weekly.

Statistics:For all experiments, significance was determined between groups using a

One-way ANOVA followed by a post hoc t-test. For all in vitro experiments, 3

independent experiments with an n of 3 were used for an overall n of 9 with a

representative experiment shown. For invivo studies, an n of 10 was used for each

group.

Results

TheBRAFandBRAF‐MEKinhibitoradaptedstateisreversibleandsensitiveto

HDACinhibition

In previous studies, we identified an S897-EphA2-driven signaling interactome that

emerged under continuous BRAF therapy, that was readily reversible following drug

withdrawal (11). We reasoned that this network, and therefore BRAF inhibitor

resistance, may be in part epigenetically regulated. To explore this mechanism, we

treated BRAF-MEK inhibitor resistant melanoma cell lines (designated RR) with the

broad spectrum HDAC inhibitor panobinostat and found that it decreased both




9

S897-EphA2 and pAKT signaling and restored vemurafenib sensitivity in apoptosis

assays (Figures 1A,B). We next asked whether acquired BRAF inhibitor resistance

was associated with an increased expression of specific HDAC genes or proteins by

microarray and Western Blot analysis respectively. It was determined that Class I

HDACs (HDAC1, HDAC2, HDAC3 and HDAC8), Class IIb HDACs (HDAC6) and Class IV

HDACs (HDAC11) were consistently expressed (Supplemental Figure 1A). Although

many HDACs showed alteration following the acquisition of BRAF (designated R)

and BRAF-MEK inhibitor resistance, HDAC8 expression was consistently increased

(>2 fold) in 5/5 of the drug resistant melanoma cell lines (Figure 1C and

Supplemental Figure 1B). Increased expression of HDAC6 (>2 fold) was also noted

in 4/5 of the cell lines (M229R, SKMEL-28RR, 1205LuRR and WM164RR) (Figure 1C

and Supplemental Figure 1B). Expression of HDAC8 and c-JUN was also noted in

melanoma cells with intrinsic BRAF inhibitor resistance, whereas those with initial

BRAF inhibitor sensivity expressed little c-JUN and an HDAC8 doublet

(Supplemental Figure 2) (21). A role for HDAC8 in the restoration of drug sensitivity

was suggested by the ability of an HDAC8 inhibitor (PCI-34051), but not an HDAC6

inhibitor (tubastatin), to restore the sensitivity of BRAF inhibitor resistant

melanoma cell lines to vemurafenib (Figure 1D and Supplemental Figure 3). As

increased expression is not always indicative of increased enzymatic activity, we

also probed for the validated HDAC8 target, acetylated-SMC3 (22), and noted a

decrease in acetylation of SMC3 in the resistant cell lines (Figure 1E).

To explore whether increased HDAC8 activity was a common response of melanoma

cells to stress, we next treated 1205Lu melanoma cells with either UV radiation

(254 nm: 3.75 J/m2) or hypoxia (1% O2 for 24 hrs). Exposure to both of these

stresses induced HDAC8 expression, with overexpression of HDAC8 leading to

reduced cell death following UV irradiation or hypoxia (Figure 1F,G). The clinical

relevance of these findings was investigated through immunohistochemical (IHC)

staining of a cohort of matched pre- and post-BRAF inhibitor treated melanoma

patient specimens (Supplemental Table 1). It was found that HDAC8 was either

highly expressed at baseline (6/8) and did not change on therapy or showed

increased expression post-therapy (2/8 cases) (Figure 1H). Collectively these data




10

demonstrated that HDAC8 was induced under multiple stress conditions, including

BRAF-MEK inhibitor therapy and that expression of HDAC8 could provide

protection to melanoma cells. Continuous drug exposure was required to maintain

the HDAC8-driven adapted state with drug removal for >3 weeks leading to reduced

expression of HDAC8 (Supplemental Figure 4).

HDAC8mediatesBRAFinhibitortolerance

We next generated stable HDAC8 expressing clones of drug naïve WM164 and

1205Lu melanoma cells, that had protein expression levels equivalent to that

induced by continuous BRAF inhibitor therapy (Figure 2A). The introduction of

HDAC8 increased the tolerance of melanoma cells to BRAF inhibitor therapy in 4-

week colony formation assays (Figures 2B,C) and led to a significant reduction in

vemurafenib-induced apoptosis (Figure 2D) which was not associated with

increased cell proliferation (Supplemental Figure 5). These effects were also

observed following administration with a combination of BRAF-MEK inhibitors

(Supplemental Figure 6A-B). Conversely, it was found that the silencing of HDAC8

reversed resistance to vemurafenib in colony formation assays (Figure 2E-G) and

restored apoptosis levels to those of the drug-naïve cell lines (Figure 2H). We next

determined the functional consequences of modulating HDAC8 expression in terms

of apoptosis regulation. We focused upon BIM and Mcl-1, as 1) both of these

proteins are regulated by mutant BRAF in melanoma cells and are 2) important

regulators of the apoptotic response following BRAF inhibition (23, 24). HDAC8

introduction, followed by BRAF inhibitor treatment, was associated with a

suppression of pro-apoptotic BIM expression (Figure 2I) and the maintenance of

Mcl-1 levels (Figure 2I), while silencing HDAC8 increased BIM expression

(Supplemental Figure 7A-C). The critical role of Mcl-1 maintenance in the pro-

survival effects of HDAC8 overexpression was demonstrated through the siRNA

silencing of Mcl-1, which restored the sensitivity of the HDAC8 overexpressing cells

to vemurafenib (Figure 2J,K).




11

Massspectrometry‐basedphosphoproteomicanalysesrevealsadirectrolefor

HDAC8inregulatingMAPKandJUNsignalinginBRAF‐mutantmelanoma

We reasoned that the introduction of HDAC8 increased melanoma cell survival

under stress by rewiring the signaling network. To explore this, we utilized mass

spectrometry-based phosphoproteomics to map the entire signaling network. The

introduction of HDAC8 into drug-naïve BRAF-mutant melanoma cell lines led to

significant increases in the tyrosine phosphorylation of 5 peptides and the

serine/threonine phosphorylation of 113 peptides (Figure 3A). These data

demonstrated HDAC8 overexpression enriched for networks associated with the

adoption of an epithelial mesenchymal transition (EMT), as well as MAPK and AP-1

transcription factor signaling (Figure 3B). These findings with HDAC8 mirrored

those reported previously by our group on melanomas with acquired BRAF

inhibitor resistance (11). Grouping of the proteomic data into cellular processes

using STRING analysis demonstrated HDAC8 to be involved in ribosomal function,

RNA binding, cell cycle regulation, ERK signaling and organization of the

cytoskeleton (Figure 3C). Analysis of individual phosphopeptides identified the

emergence of a signaling interactome that was dependent upon MAPK1 and c-Jun

(Figure 3D). Other members of the HDAC8-driven signaling network included

MAPK pathway members (p38 MAPKα and p38MAPKγ), cytoskeleton regulators

(FAK, paxillin, stathmin, LIMA1, PTRF, MARCKS), cell cycle/spindle regulators

(CDK1, ASPM, TPX2), transcriptional initiation (EIF6, EEF1D) and PKC signaling

(PRKCD).

HDAC8enhancestherapeuticescapethrough increasedRTK‐mediatedMAPK

signaling

Our phosphoproteomic studies identified MAPK1 as a major HDAC8-regulated

signaling hub. We next used two isogenic cell line pairs transduced with either

empty vector (EV) or HDAC8 to evaluate its role in MAPK signaling. HDAC8

introduction increased baseline phospho-ERK levels in both cell lines, and MAPK

signaling was maintained in the presence of a BRAF inhibitor, i.e. the drug never

inhibited the pathway by >50% (Figure 4A,B). These effects were also seen




12

following administration of a combination of BRAF-MEK inhibitors (Supplemental

Figure 6A-B). Conversely, shRNA knock down of HDAC8 reduced MAPK signaling in

the presence of a BRAF inhibitor (Supplemental Figure 7A-C). The increased MAPK

signaling we observed occurred upstream of ERK, with a more pronounced and

rapid induction of phospho-CRAF signaling being noted in the HDAC8 expressing

cells compared to the EV controls (Figure 4C). Ras-GTP pulldown experiments

demonstrated that HDAC8 overexpression increased the level of Ras-GTP loading,

indicating the reactivation of signaling upstream of RAF (Figure 4D).

We next turned our attention to RTKs, and used RTK-arrays to demonstrate that

HDAC8 introduction altered the basal phosphorylation of multiple RTKs including

EGFR, c-MET and FGFR3 (Figures 4E,F and Supplemental Figure 8A-D). Among the

RTKs identified, EGFR appeared critical for the increased MAPK signaling associated

with HDAC8, with studies showing that erlotinib resensitized HDAC8-expressing

melanoma cells to BRAF inhibitor mediated apoptosis (Figure 4G). Use of the c-MET

inhibitor, crizotinib, or the FGFR inhibitor, BGJ398, also resensitized HDAC8

expressing melanoma cells to BRAF inhibition (Supplemental Figure 9A,B). Together

these data indicate that increased HDAC8 activity contributes to stress tolerance

through maintenance of survival signaling.

HDAC8increasesMAPKactivityinmelanomacellsthroughdeacetylationofc‐

Jun.

We next performed RNA-Seq analyses on our isogenic (EV and HDAC8 introduced)

cell lines (Figure 5A) and used GSEA to identify transcriptional programs associated

with HDAC8 expression. One of the top hits was an AP-1 gene signature, indicative

of c-Jun transcriptional activity (Figure 5B). Unbiased kinome array analysis showed

HDCA8 introduction to be associated with increased c-JUN, p53, AKT and HSP60

phosphorylation (Supplemental Figure 10A,B). Functional studies showed HDAC8

introduction led to increased c-Jun phosphorylation following BRAF inhibitor

treatment (Figure 5C), and enhanced c-Jun transcriptional activity both immediately

following and at 4 hours after BRAF inhibitor treatment (Figure 5D). A role for

increased c-Jun expression/activity in BRAF inhibitor tolerance was indicated by the




13

observation that c-Jun silencing restored vemurafenib sensitivity to HDAC8

expressing melanoma cells (Supplemental Figure 11A-B).

Previous studies have demonstrated that c-Jun is acetylated at Lys268, Lys271 and

Lys273 (25). We performed immunoprecipitation studies and demonstrated that

the introduction of HDAC8 led to the deacetylation of c-Jun (Figure 5E). A structural

analysis revealed that the three potential acetylation sites (268, 271 and 273) are

located within the DNA-binding domain of c-Jun (Figure 5F). A series of acetylation

deficient K->R c-Jun mutants were generated at each of the three individual lysines

(K268R, K271R, K273R) (Supplemental Figure 12), along with the silencing of the

endogenous protein through a 3’-UTR directed shRNA. Mutating lysine 273 led to a

reduction of BRAF inhibitor sensitivity by both apoptosis (Figure 5G) and colony

formation assays (Supplemental Figure 13A,B). Introduction of K273R c-JUN also

limited the pro-apoptotic effects of combined HDAC8 and BRAF inhibition in

apoptosis assays (Supplemental Figure 13C). Functionally, these effects were

associated with increased levels of ERK phosphorylation in addition to decreased

levels of BIM expression following BRAF inhibition (Figure 5H). Mutating lysine 273

also increased the binding of c-Jun to the consensus JUN/c-Jun DNA sequence as

determined by ELISA (Figure 5I) and significantly increased levels of EGFR mRNA as

measured by qRT-PCR (Figure 5J). These results were supported by kinome and

RTK arrays that demonstrated K273R introduction to be also associated with

increased EGFR phosphorylation and enhanced p53, AKT, STAT3, WNK1 and HSP60

signaling, (Supplemental Figures 14A,B-15A,B).

Co‐targetingofBRAFandHDAC8suppressestherapeuticescape

As the final step we asked whether HDAC8 inhibition improved BRAF inhibitor

responses invivo. For the initial studies, we injected isogenic WM164 and 1205Lu

melanoma cells that expressed empty vector (EV), had HDAC8 expression (HDAC8)

or were stably knocked down (shRNA) for HDAC8 into the flanks of NSG mice. When

tumor volumes reached 25-40 mm3, treatment with the BRAF inhibitor PLX4720

was initiated. In these xenografts, melanoma cells expressing HDAC8 showed

resistance to BRAF inhibitor treatment, whereas the melanoma with HDAC8 stably




14

knocked down “crashed” following initiation of BRAF inhibitor treatment (Figure

6A,B). At the completion of the experiments, the HDAC8 shRNA knockdown tumors

were significantly smaller than both the HDAC8 expressing and empty vector

control cells. Western Blot studies confirmed the increased expression of HDAC8

and showed this to be associated with a suppression of BIM expression under BRAF

inhibitor therapy (Figure 6C). Increased nuclear accumaultion of phospho-c-JUN

was also seen in the tumors with HDAC8 expression (Figure 6D). It was not possible

to analyze the HDAC8 shRNA tumors by Western Blot due to very low tumor

volumes after BRAF inhibitor therapy. We then determined whether similar results

could be achieved with small molecule HDAC inhibitors. Here, we used two HDAC

inhibitors (the broad spectrum HDAC inhibitor panobinostat and the HDAC8-

specific inhibitor PCI-34051) in combination with the BRAF inhibitor PLX4720. For

these studies, the animals received a lead-in dose of each of the HDAC inhibitors (to

mimic the effects of having the HDACs silenced prior to initiating BRAF inhibitor

therapy) before continuing treatment with the combination of HDAC and BRAF

inhibitors. Co-treatment with both drugs significantly reduced tumor growth

compared to either agent alone and was associated with durable responses in these

model systems (Figures 6E, F).

Discussion

Adaptation to therapy is a major factor that limits the long-term responses of BRAF-

mutant melanoma patients to BRAF inhibitor monotherapy and BRAF-MEK inhibitor

combination therapy (3, 6, 26). Despite this, relatively little is known about the early

events that permit limited numbers of cells to evade the effects of BRAF inhibition.

Work from our group and others has demonstrated that diverse therapeutic

interventions, including targeted therapy and immune therapy, induce a

dedifferentiated state that is reminiscent of an EMT (11, 27-31). Melanoma cells that

have undergone this transition typically exhibit increased invasion and resistance to

most therapies (11, 27-31). Previous studies from our lab showed this phenotype to

be reversible upon drug withdrawal and possibly epigenetically mediated (11).

Given the postulated links between stress, phenotype switching and drug resistance




15

in melanoma, we asked whether there was a unifying cellular program that

regulated the response of melanoma cells to multiple stresses.

We began by demonstrating that the drug-adapted, EMT-like state (here marked by

increased S897-EphA2 signaling) could be reversed following treatment with HDAC

inhibitors such as panobinostat. HDACs are enzymes that catalyze the hydrolysis of

acetyl groups from acetylated proteins. The HDACs have many targets, both nuclear

and cytoplasmic, with the best characterized of these being the N-terminal tails of

histones (32). Our studies revealed that HDAC8 was frequently upregulated in

melanoma cells with acquired BRAF and BRAF-MEK inhibitor resistance and that

introduction of exogenous HDAC8 conveyed resistance to MAPK targeted therapies.

HDAC8 is a poorly characterized Class I HDAC found in both the nucleus and

cytoplasm (14, 33). As well as its nuclear activity as a histone deacetylase, HDAC8

also has a number of non-histone substrates including p53, cortactin and SMC3 (22,

34, 35). HDAC8 was not the only HDAC whose expression was altered upon chronic

BRAF inhibitor treatment, with increased HDAC6 expression being observed in

some of the resistant cultures. Despite this, inhibition of HDAC6 did not restore

sensitivity to BRAF inhibition, suggesting that this HDAC played a minor role in the

escape from BRAF inhibitor therapy.

To better understand how HDAC8 regulates signaling in melanoma cells we

performed phosphoproteomic analyses of isogenic melanoma cell line pairs and

noted the emergence of a signaling network dependent upon MAPK1 and c-Jun

following the introduction of HDAC8. These findings closely mirrored our previous

proteomic studies that identified an EGFR, c-JUN signaling network being associated

with acquired BRAF inhibitor resistance (11). In functional terms, introduction of

HDAC8 was associated with increased baseline levels of phospho-ERK and the

maintenance of MAPK signaling following BRAF inhibitor treatment. It is likely that

the shallower level of ERK inhibition associated with HDAC8 introduction reduces

drug efficacy. In the clinical setting, >90% ERK inhibition is required for responses

in melanoma patients (36). The HDAC8-mediated adaptation occurred upstream, at

the level of RTK signaling, with increases noted in Ras-GTP loading and

phosphorylation of CRAF at S338. Ultimately, the increased level MAPK signaling




16

throughput prevented the melanoma cells from being primed for cell death through

a mechanism including reduced levels of BIM expression and maintenance of pro-

survival Mcl-1 levels (24, 37, 38). Both BIM and Mcl-1 are known to be regulated

through the MAPK pathway, with BIM in particular being rapidly targeted for

degradation following its phosphorylation by MAPK at Ser69 (23). Mcl-1 exerts its

anti-apoptotic activity by binding to, and blocking the function of BIM-EL and

through inhibition of pro-apoptotic Bak/Bax. In melanoma, Mcl-1 conveys

resistance to anoikis and its downregulation is required for the cytotoxic activity of

the HSP90 inhibitor XL888 (24, 39).

As both our proteomics and RNA-Seq analyses suggested that HDAC8 expression

was associated with c-Jun signaling and Jun/AP-1 driven-transcription we next

asked whether HDAC8 mediated its effects via direct c-Jun regulation. c-Jun is a key

transcriptional regulator of melanoma cells that has been implicated in melanoma

progression, phenotype switching and therapy resistance (40-42). The expression

and activation of c-Jun is subject to complex regulation at both the transcriptional

and the post-translational levels. In BRAF and NRAS-mutant melanoma cells, c-Jun

activation occurs as a result of a complex signaling loop dependent upon ERK-

mediated GSK3 and CREB phosphorylation (40). Other recent studies have tied the

activation of c-Jun to decreased expression of the ERK target gene SPRY-4, following

BRAF inhibition (43). Work in other systems has suggested that Jun transcriptional

activity can be regulated through acetylation at Lys268 (25). Through

immunoprecipitation and site-directed mutagenesis studies we here demonstrated

that HDAC8 was required for deacetylation of c-Jun at Lys273 and that the

introduction of K273R mutant of c-Jun mimicked the effects of HDAC8.

Mechanistically it was found that the introduction of the K273R acetyl mutant of c-

Jun led to increased transcription of EGFR, the maintenance of ERK signaling and the

escape of the melanoma cells from BRAF inhibitor therapy. There is already

evidence that c-Jun transcriptional activity can be induced in response to stresses

such as UV (44). Our work provides the first evidence that HDAC8 activity is

increased in responses to multiple, diverse cellular stresses and that this turn




17

initiates a transcriptional program that is associated with increased melanoma cell

survival (29, 43, 45).

Invivomodels were then used to demonstrate the requirement for HDAC8 in the

adaptation of melanomas to BRAF inhibitor therapy. Treatment of HDAC8-silenced

melanoma xenografts with the BRAF inhibitor PLX4720 showed them to be unable

to adapt to therapy. In contrast, introduction of HDAC8 into the same melanoma

cells made them BRAF inhibitor tolerant, and the tumors grew rapidly in the

presence of drug. To determine if these effects could be recapitulated by small

molecule HDAC inhibitors, we performed two experiments in which drug naïve

melanoma cells were co-treated with either a broad spectrum HDAC inhibitor

(panobinostat) and PLX4720 or an HDAC8-specific inhibitor (PCI-03451) and

PLX4720. In both cases the combination of the BRAF inhibitor and the HDAC

inhibitor out performed either single agent, with particularly striking effects being

seen for the broad spectrum HDAC inhibitor/BRAF inhibitor combination. Although

significantly improved responses were seen for the HDAC8 inhibitor plus the BRAF

inhibitor, these were not as impressive as with panobinostat or HDAC8 silencing.

Possible explanations for this difference include the potential minor contribution of

other HDACs to the process of therapeutic escape, or the failure of PCI-03451 to

inhibit HDAC8 to the same extent as the HDAC8 shRNA silencing in vivo.

Nevertheless, these findings provide a strong rationale to pursue the development

of more selective and potent HDAC8 inhibitors for future evaluation as drugs that

can limit phenotype switching and therapeutic escape in melanoma. In support of

this goal, there is already evidence that melanomas with acquired BRAF-MEK

inhibitor resistance exhibit sensitivity to the broad spectrum HDAC inhibitor

vorinostat (46), and that HDAC inhibitors can restore expression of BIM and BMF in

melanomas with acquired BRAF inhibitor resistance (47).

In summary, we have shown that HDAC8 is a critical driver of a cellular program

that allows melanoma cells to rapidly adapt to multiple cellular stresses, including

BRAF inhibitor therapy. The mechanism of this adaptation is complex and involves

the deacetylation of c-Jun leading to a transcriptional program that allows

melanoma cells to re-wire their signaling to maintain MAPK pathway activity. To




18

date, attempts to therapeutically target c-Jun and indeed, phenotype switching in

melanoma have proven to be difficult. The development of potent HDAC8 inhibitors

is a promising strategy to limit this plasticity in melanoma cells allowing therapeutic

responses to be improved.

Acknowledgements:

We would like to thank Bin Fang, Ph.D. for his assistance with the

phosphoproteomic experiments and Divya Bhat for her assistance with the invivo

experiments.

References

1. Long GV, Stroyakovskiy D, Gogas H, Levchenko E, de Braud F, Larkin J, et al. Overall survival for dabrafenib and trametinib versus dabrafenib and placebo in V600 BRAF-mutant melanoma: a multi-center, double-blind, phase 3 randomised controlled trial. Lancet. 2015. 2. Fedorenko IV, Gibney GT, Sondak VK, Smalley KSM. Beyond BRAF: where next for melanoma therapy? British Journal of Cancer. 2015;112:217-26. 3. Rizos H, Menzies AM, Pupo GM, Carlino MS, Fung C, Hyman J, et al. BRAF Inhibitor Resistance Mechanisms in Metastatic Melanoma: Spectrum and Clinical Impact. Clinical Cancer Research. 2014;20:1965-77. 4. Shi HB, Hong AY, Kong XJ, Koya RC, Song CY, Moriceau G, et al. A Novel AKT1 Mutant Amplifies an Adaptive Melanoma Response to BRAF Inhibition. Cancer Discov. 2014;4:69-79. 5. Shi HB, Hugo W, Kong XJ, Hong A, Koya RC, Moriceau G, et al. Acquired Resistance and Clonal Evolution in Melanoma during BRAF Inhibitor Therapy. Cancer Discov. 2014;4:80-93. 6. Emmons MF, Faiao-Flores F, Smalley KS. The role of phenotypic plasticity in the escape of cancer cells from targeted therapy. Biochem Pharmacol. 2016. 7. Villanueva J, Vultur A, Lee JT, Somasundaram R, Fukunaga-Kalabis M, Cipolla AK, et al. Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1R/PI3K. Cancer Cell. 2010;18:683-95. 8. Nazarian R, Shi H, Wang Q, Kong X, Koya RC, Lee H, et al. Melanomas acquire resistance to B-RAF(V600E) inhibition by RTK or N-RAS upregulation. Nature. 2010;468:973-7. 9. Sun C, Wang L, Huang S, Heynen GJ, Prahallad A, Robert C, et al. Reversible and adaptive resistance to BRAF(V600E) inhibition in melanoma. Nature. 2014;508:118-22. 10. Konieczkowski DJ, Johannessen CM, Abudayyeh O, Kim JW, Cooper ZA, Piris A, et al. A melanoma cell state distinction influences sensitivity to MAPK pathway inhibitors. Cancer Discov. 2014;4:816-27.




19

11. Paraiso KH, Thakur MD, Fang B, Koomen JM, Fedorenko IV, John JK, et al. Ligand-Independent EPHA2 Signaling Drives the Adoption of a Targeted Therapy-Mediated Metastatic Melanoma Phenotype. Cancer Discov. 2015;5:264-73. 12. Smyth T, Paraiso KH, Hearn K, Rodriguez-Lopez AM, Munck JM, Haarberg HE, et al. Inhibition of HSP90 by AT13387 delays the emergence of resistance to BRAF inhibitors and overcomes resistance to dual BRAF and MEK inhibition in melanoma models. Mol Cancer Ther. 2014;13:2793-804. 13. Zhang X, Ozawa Y, Lee H, Wen YD, Tan TH, Wadzinski BE, et al. Histone deacetylase 3 (HDAC3) activity is regulated by interaction with protein serine/threonine phosphatase 4. Genes Dev. 2005;19:827-39. 14. Lee H, Rezai-Zadeh N, Seto E. Negative regulation of histone deacetylase 8 activity by cyclic AMP-dependent protein kinase A. Mol Cell Biol. 2004;24:765-73. 15. Mertins P, Qiao JW, Patel J, Udeshi ND, Clauser KR, Mani DR, et al. Integrated proteomic analysis of post-translational modifications by serial enrichment. Nat Methods. 2013;10:634-7. 16. Kim JY, Welsh EA, Fang B, Bai Y, Kinose F, Eschrich SA, et al. Phosphoproteomics Reveals MAPK Inhibitors Enhance MET- and EGFR-Driven AKT Signaling in KRAS-Mutant Lung Cancer. Mol Cancer Res. 2016;14:1019-29. 17. Cox J, Mann M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nature Biotechnology. 2008;26:1367-72. 18. Johnson WE, Li C, Rabinovic A. Adjusting batch effects in microarray expression data using empirical Bayes methods. Biostatistics. 2007;8:118-27. 19. Phipson B, Lee S, Majewski IJ, Alexander WS, Smyth GK. Robust Hyperparameter Estimation Protects against Hypervariable Genes and Improves Power to Detect Differential Expression. Ann Appl Stat. 2016;10:946-63. 20. Varsano T, Lau E, Feng Y, Garrido M, Milan L, Heynen-Genel S, et al. Inhibition of melanoma growth by small molecules that promote the mitochondrial localization of ATF2. Clin Cancer Res. 2013;19:2710-22. 21. Paraiso KH, Xiang Y, Rebecca VW, Abel EV, Chen YA, Munko AC, et al. PTEN loss confers BRAF inhibitor resistance to melanoma cells through the suppression of BIM expression. Cancer Research. 2011;71:2750-60. 22. Deardorff MA, Bando M, Nakato R, Watrin E, Itoh T, Minamino M, et al. HDAC8 mutations in Cornelia de Lange syndrome affect the cohesin acetylation cycle. Nature. 2012;489:313-7. 23. Cartlidge RA, Thomas GR, Cagnol S, Jong KA, Molton SA, Finch AJ, et al. Oncogenic BRAF(V600E) inhibits BIM expression to promote melanoma cell survival. Pigment Cell Melanoma Res. 2008;21:534-44. 24. Boisvert-Adamo K, Longmate W, Abel EV, Aplin AE. Mcl-1 is required for melanoma cell resistance to anoikis. Molecular cancer research : MCR. 2009;7:549-56. 25. Vries RG, Prudenziati M, Zwartjes C, Verlaan M, Kalkhoven E, Zantema A. A specific lysine in c-Jun is required for transcriptional repression by E1A and is acetylated by p300. EMBO J. 2001;20:6095-103.




20

26. Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, et al. Improved Survival with Vemurafenib in Melanoma with BRAF V600E Mutation. N Engl J Med. 2011. 27. O'Connell MP, Marchbank K, Webster MR, Valiga AA, Kaur A, Vultur A, et al. Hypoxia induces phenotypic plasticity and therapy resistance in melanoma via the tyrosine kinase receptors ROR1 and ROR2. Cancer Discov. 2013;3:1378-93. 28. Fallahi-Sichani M, Becker V, Izar B, Baker GJ, Lin JR, Boswell SA, et al. Adaptive resistance of melanoma cells to RAF inhibition via reversible induction of a slowly dividing de-differentiated state. Mol Syst Biol. 2017;13:905. 29. Titz B, Lomova A, Le A, Hugo W, Kong X, Ten Hoeve J, et al. JUN dependency in distinct early and late BRAF inhibition adaptation states of melanoma. Cell Discov. 2016;2:16028. 30. Smith MP, Brunton H, Rowling EJ, Ferguson J, Arozarena I, Miskolczi Z, et al. Inhibiting Drivers of Non-mutational Drug Tolerance Is a Salvage Strategy for Targeted Melanoma Therapy. Cancer Cell. 2016;29:270-84. 31. Muller J, Krijgsman O, Tsoi J, Robert L, Hugo W, Song C, et al. Low MITF/AXL ratio predicts early resistance to multiple targeted drugs in melanoma. Nat Commun. 2014;5:5712. 32. Seto E, Yoshida M. Erasers of histone acetylation: the histone deacetylase enzymes. Cold Spring Harb Perspect Biol. 2014;6:a018713. 33. Chakrabarti A, Oehme I, Witt O, Oliveira G, Sippl W, Romier C, et al. HDAC8: a multifaceted target for therapeutic interventions. Trends Pharmacol Sci. 2015;36:481-92. 34. Yan W, Liu S, Xu E, Zhang J, Zhang Y, Chen X, et al. Histone deacetylase inhibitors suppress mutant p53 transcription via histone deacetylase 8. Oncogene. 2013;32:599-609. 35. Li J, Chen S, Cleary RA, Wang R, Gannon OJ, Seto E, et al. Histone deacetylase 8 regulates cortactin deacetylation and contraction in smooth muscle tissues. Am J Physiol Cell Physiol. 2014;307:C288-95. 36. Bollag G, Hirth P, Tsai J, Zhang J, Ibrahim PN, Cho H, et al. Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF-mutant melanoma. Nature. 2010;467:596-9. 37. O'Connor L, Strasser A, O'Reilly LA, Hausmann G, Adams JM, Cory S, et al. Bim: a novel member of the Bcl-2 family that promotes apoptosis. Embo J. 1998;17:384-95. 38. Hsu SY, Lin P, Hsueh AJ. BOD (Bcl-2-related ovarian death gene) is an ovarian BH3 domain-containing proapoptotic Bcl-2 protein capable of dimerization with diverse antiapoptotic Bcl-2 members. Molecular endocrinology (Baltimore, Md. 1998;12:1432-40. 39. Haarberg HE, Paraiso KH, Wood E, Rebecca VW, Sondak VK, Koomen JM, et al. Inhibition of Wee1, AKT, and CDK4 underlies the efficacy of the HSP90 inhibitor XL888 in an in vivo model of NRAS-mutant melanoma. Molecular Cancer Therapeutics. 2013;12:901-12. 40. Lopez-Bergami P, Huang C, Goydos JS, Yip D, Bar-Eli M, Herlyn M, et al. Rewired ERK-JNK signaling pathways in melanoma. Cancer Cell. 2007;11:447-60.




21

41. Spangler B, Kappelmann M, Schittek B, Meierjohann S, Vardimon L, Bosserhoff AK, et al. ETS-1/RhoC signaling regulates the transcription factor c-Jun in melanoma. Int J Cancer. 2012;130:2801-11. 42. Spangler B, Vardimon L, Bosserhoff AK, Kuphal S. Post-transcriptional regulation controlled by E-cadherin is important for c-Jun activity in melanoma. Pigment Cell Melanoma Res. 2011;24:148-64. 43. Ramsdale R, Jorissen RN, Li FZ, Al-Obaidi S, Ward T, Sheppard KE, et al. The transcription cofactor c-JUN mediates phenotype switching and BRAF inhibitor resistance in melanoma. Sci Signal. 2015;8:ra82. 44. Wang YN, Chen YJ, Chang WC. Activation of extracellular signal-regulated kinase signaling by epidermal growth factor mediates c-Jun activation and p300 recruitment in keratin 16 gene expression. Mol Pharmacol. 2006;69:85-98. 45. Fallahi-Sichani M, Moerke NJ, Niepel M, Zhang T, Gray NS, Sorger PK. Systematic analysis of BRAF(V600E) melanomas reveals a role for JNK/c-Jun pathway in adaptive resistance to drug-induced apoptosis. Mol Syst Biol. 2015;11:797. 46. Wang L, Leite de Oliveira R, Huijberts S, Bosdriesz E, Pencheva N, Brunen D, et al. An Acquired Vulnerability of Drug-Resistant Melanoma with Therapeutic Potential. Cell. 2018;173:1413-25 e14. 47. Shao Y, Aplin AE. BH3-only protein silencing contributes to acquired resistance to PLX4720 in human melanoma. Cell death and differentiation. 2012;19:2029-39.

Figurelegends

Figure1:HDAC8proteinexpressionisupregulatedinBRAFinhibitorresistant

celllinesandconfersresistancetoBRAFinhibitors.

A) HDAC inhibition reduces phospho-AKT and phospho(S897)-EphA2 expression in

BRAF-MEK inhibitor resistant 1205LuRR, SKMEL28RR and WM164RR melanoma

cells. Cells were treated with 100 nM of Panobinostat or DMSO vehicle control (VC)

for 24 hours and probed for phospho-EphA2, EphA2, phospho-AKT and AKT by

Western Blot. B) HDAC inhibition restores BRAF inhibitor-induced apoptosis.

1205Lu, 1205LuRR, WM164 and WM164RR cells were treated with vemurafenib (3

µM for 1205Lu and 1 µM for WM164) alone or in combination with 20 nM

panobinostat for 72 hours. Apoptosis was measured by Annexin V staining using

flow cytometry. C) BRAF-MEK inhibitor resistance is associated with increased




22

expression of multiple HDACs. A Western Blot shows expression of HDACs in

matched sensitive and resistant cell lines. Densitometry values for expression

normalized to GAPDH is shown under each blot. D) HDAC8 inhibition restores BRAF

inhibitor sensitivity. 1205Lu, 1205LuRR, WM164 and WM164RR cells were treated

with vemurafenib (3 µM for 1205Lu and 1 µM for WM164) alone or in combination

with 5 μM PCI-34051 for 72 hours. Apoptosis was measured by Annexin V staining

and flow cytometry. E) BRAF-MEK inhibitor resistance is associated with increased

HDAC8 activity. A Western Blot shows expression of HDAC8 and the HDAC8

substrate acetylated SMC3 (acSMC3) in matched sensitive and resistant cell lines.

Densitometry for expression over basal levels is shown under each blot. F) HDAC8

induction is a generalized response to stress. 1205Lu cells were treated with either

UV (254 nm: 3.75 J/m2) or hypoxia (1% O2, 24 hours) before being probed for

HDAC8 expression by Western Blot. G) HDAC8 protects from UV and hypoxia-

induced cell death. Cells were treated with either UV or hypoxia (as described for F)

and cell death measured 24 hours later by trypan exclusion. H) HDAC8 expression

is increased in melanoma patient samples post BRAF inhibitor therapy. Pre and

post-treatment specimens were stained for HDAC8 by IHC. All experiments were

performed in triplicate and significance was determined with a one way ANOVA

followed by a post hoc t test with #=p>0.05 (non-significant), *=p<0.05 and

**=p<0.01.

Figure2:HDAC8confersresistancetoMAPKtargetedtherapiesinmelanoma.

A) An empty vector (EV) or HDAC8 construct were introduced into 1205Lu and

WM164 cells. A Western Blot shows levels of HDAC8 expression. Densitometry

values for expression normalized to GAPDH are shown under each blot. B‐C) HDAC8

increases vemurafenib tolerance in colony formation assays. Isogenic (EV and

HDAC8) 1205Lu and WM164 cells were treated with vemurafenib continuously (28

days, 3 µM for 1205Lu and 1 µM for WM164) before being stained with crystal

violet. A representative experiment is shown in B) and results were quantified in C)

using imageJ. D) HDAC8 introduction increases cell survival following BRAF

inhibition. Isogenic (EV and HDAC8) 1205Lu and WM164 cells were treated with




23

vemurafenib (72 hours, 3 µM for 1205Lu and 1 µM for WM164) and apoptosis

measured by Annexin-V binding and flow cytometry. E) HDAC8 was knocked down

by shRNA (shHDAC8) or non-silencing control (shN.S.) in BRAF-MEK inhibitor

resistant 1205LuRR and WM164RR cells. A Western Blot shows levels of HDAC8

expression and densitometry was performed as in A). F‐G) A colony formation

assay demonstrates silencing HDAC8 reverses BRAF inhibitor resistance. Isogenic

(shNS and shHDAC8) 1205LuRR and WM164RR cells were treated with

vemurafenib continuously (28 days, 5 µM for 1205LuRR and 3 µM for WM164RR)

before being stained with crystal violet. A representative experiment is shown in F)

and results were quantified in G) using imageJ. H) Silencing of HDAC8 increases

vemurafenib-induced apoptosis. Isogenic cell line pairs (shN.S. or shHDAC8) were

treated with vemurafenib (72 hrs, 5 µM for 1205LuRR and 3 µM for WM164RR).

Apoptosis was measured by Annexin V staining and flow cytometry. I) Introduction

of HDAC8 suppresses BIM and stabilizes Mcl-1 following vemurafenib treatment.

Isogenic 1205Lu cell lines (EV or HDAC8) were treated with vemurafenib (3μM, 0-

48 hr) and expression of BIM and Mcl-1 was assessed by Western Blot. J‐K)

Silencing of Mcl-1 restores BRAF inhibitor sensitivity to HDAC8 expressing

melanoma cells. J) A Western Blot was probed for Mcl-1 following transfection of

WM164 EV and HDAC8 cells with Mcl-1 siRNA. K) Analysis of vemurafenib-

mediated apoptosis following Mcl-1 silencing. Isogenic 1205Lu and WM164 (EV and

HDAC8) cells were silenced for Mcl-1 and treated with vemurafenib (72 hours, 3 µM

for 1205Lu and 1 µM for WM164). Apoptosis was measured by Annexin V staining

and flow cytometry. Experiments were performed in triplicate and significance was

determined with a one way ANOVA followed by a post hoc t test with #=p>0.05

(non-significant), *=p<0.05, **=p<0.01 and ***=p<0.001.

Figure3:Systemslevelproteomicsidentifiedc‐JunandMAPK1askeyHDAC8‐

regulatedsignalinghubs.

A) Key proteins including MAPK1 and c-Jun are significantly upregulated following

increased HDAC8 expression in BRAF inhibitor naïve cells. A volcano plot analysis

was performed on a phosphoproteomics study (serine/threonine/tyrosine




24

phosphorylation) comparing isogenic (EV and HDAC8) 1205Lu cells. Significant

changes are denoted by fold change > 2 and a p-value < 0.05 and are shown in blue.

B) Key signaling pathways including MAPK, AP-1 and EGFR are upregulated

following increased HDAC8 expression in BRAF inhibitor naïve cells. Significantly

changed proteins in A) were analyzed using GeneGo software. Shown are the most

significantly changed pathways, along with the log10 of the p-value. C) Key pathways

with significantly altered protein/protein interactions, including interactions

involving ERK signaling and cell migration, were changed following increased

HDAC8 expression. STRING analysis identified key protein signaling hubs changed

in HDAC8 expressing 1205Lu cells. Protein interactions in STRING surpassing the

most stringent interaction threshold of .9 were exported and visualized by Gephi

visualization software using the OpenORD algorithm. D) A global analysis of

significantly changed protein/protein interactions determined MAPK1 and c-Jun to

be the most altered proteins when HDAC8 is expressed in 1205Lu cells.

Significantly altered protein/protein interactions were determined by Genego

analysis following input of significantly changed proteins following introduction of

HDAC8 into cells. Interactions were visualized using cytoscape.

Figure4:HDAC8modulatesBRAF inhibitorsensitivity throughregulationof

RTK/RAS/RAF/MEK/ERKsignaling

A) Introduction of HDAC8 increases basal phospho-ERK levels in melanoma cells

and MAPK signaling under BRAF inhibitor therapy. Control (EV) and HDAC8

expressing melanoma cells 1205Lu (3 µM) and WM164 (1 µM) were treated with

vemurafenib for increasing periods of time (0-48 hr) before being subjected to

Western Blotting for phospho-ERK (p-ERK) and total ERK expression. B)

Quantification of phospho-ERK levels relative to total ERK levels. C) HDAC8

introduction is associated with increased CRAF phosphorylation following BRAF

inhibition. WM164 cells were treated with vemurafenib (1 µM) for increasing

periods of time (0-48 hours) and probed for phospho-CRAF (S338, p-CRAF) and

CRAF expression. D) HDAC8 introduction increases Ras signaling. Isogenic (EV and

HDAC8 expressing) WM164 (1 µM) and 1205Lu (3 µM) cells were treated for




25

vemurafenib for 24 hours and probed for activated Ras (GTP-bound) and total Ras.

E‐F) Introduction of HDAC8 increases baseline RTK signaling. Isogenic pairs of E)

1205Lu and F) WM164 cells were analyzed using a phospho-RTK array. Resulting

membranes were scanned and densitometry was performed (ND symbolizes none

detected). Data show the increase in phosphorylation of the RTKs EGFR(p-EGFR), c-

MET(p-c-MET), and FGFR3 (p-FGFR3) following HDAC8 introduction. G) EGFR

inhibition restores BRAF inhibitor sensitivity in cell lines that express HDAC8.

Isogenic 1205Lu and WM164 melanoma cells were treated with vehicle,

vemurafenib (BRAFi, 3 M for 1205Lu, 1 µM for WM164), erolitinib (EGFRi, 1 M)

or both drugs in combination (BRAFi/EGFRi) for 72 hours and apoptosis was

measured by Annexin V staining and flow cytometry. Significance was determined

with a one way ANOVA followed by a post hoc t test with #=p>0.05 (non significant),

**=p<0.01.

Figure 5: HDAC8 deacetylates the transcription factor c‐Jun at lysine 273

leadingtoincreasedtranscriptionalactivity,increasedphospho‐ERKsignaling

andBRAFinhibitorresistance.

A) HDAC8 introduction is associated with a unique gene signature. Heatmap of an

RNA-seq analysis of WM164 and 1205Lu melanoma cells introduced with either

empty vector (EV) or HDAC8. B) GSEA analysis identifies an AP-1 gene signature is

upregulated in melanoma cells expressing HDAC8. C) HDAC8 expression increases

phospho-c-Jun levels following BRAF inhibition. Isogenic WM164 cells were treated

with vemurafenib (1 M, 0-48 hours) and probed for phospho-c-Jun (p-c-Jun) and c-

JUN by Western Blot. D) HDAC8 expression leads to increased c-Jun transcriptional

activation following BRAF inhibition. Isogenic 1205Lu cells were transiently

transfected with a c-Jun- (TRE) or ATF2- (JUN2) targeted promoter luciferase

constructs and treated for 4 hours with vehicle (VC) or vemurafenib (3M, BRAFi).

Luciferase levels were measured and quantified. E) HDAC8 decreases c-Jun

acetylation. Total c-JUN was immunoprecipitated (ip) from isogenic 1205Lu (EV)

and 1205Lu-HDAC8 cells and blotted for total protein acetylation (ac-c-Jun). c-Jun




26

was used as an input control. F) Structure of c-Jun identifying 3 potential

acetylation sites (at lysine residues) in the DNA binding domain. G)Acetylation-

deficient c-Jun at residue 273 increases melanoma cell survival following BRAF

inhibition. 1205Lu cells expressing acetyl mutants of c-Jun (K268R, K271R, or

K273R) in addition to WT c-Jun were treated with vemurafenib (3 µM: 72 hrs)

before being analyzed for annexin V positivity by flow cytometry. H) Acetylation-

deficient c-Jun at residue 273 leads to increased phospho-ERK (p-ERK) with

decreased levels of BIM. Isogenic 1205Lu cells expressing WT, K268R, K271R,

K273R constructs of c-Jun were treated with vemurafenib (3 µM: 0-24 hr) and

probed for c-Jun, HDAC8, phospho-ERK, ERK, and BIM expression by Western Blot.

I) Mutating lysine 273 of c-Jun confers increased binding to DNA. Isogenic 1205Lu

cells expressing WT, K268R, K271R, K273R constructs of c-Jun as well as a negative

control (NC) and positive control (PC) were incubated with a plate- bound

consensus DNA sequence of c-Jun and read at a wavelength of 450 nm. J) Mutating

lysine 273 of c-Jun increases mRNA expression of EGFR. qRT-PCR was performed

on samples using primers for EGFR. Readings were normalized to GAPDH control.

Experiments were performed in triplicate and significance was determined with a

one way ANOVA followed by a post hoc t test with *=p<0.05 and **=p<0.001.

Figure6:HDAC8inhibitionimprovesthedurationofBRAFinhibitortherapy

A) Responses to vemurafenib invivo are HDAC8 dependent. Isogenic 1205Lu cell

lines (EV control, HDAC8 expressing and HDAC8 shRNA silenced) were xenografted

into NOD.CB17-Prkdcscid/J mice. Tumors were allowed to engraft for 10 days and

then were treated with 10 mg/kg PLX 4720 (BRAFi) orally. Data show mean tumor

volume +/- S.E. mean. B) Isogenic WM164 cells were xenografted and treated as in

A). C)HDAC8 expressing tumors exhibited increased levels of HDAC8 and lower

levels of BIM by Western Blot. HDAC8 shRNA tumors were too small to analyze. D)

HDAC8 expressing xenografts have increased nuclear phospho-c-JUN expression.

Data show IHC analysis of HDAC8 expressing, EV control and shHDAC8 containing

1205Lu and WM164 tumors. E) Broad spectrum HDAC inhibition limits BRAF

inhibitor failure in treatment-naïve melanoma cells. Xenografts of 1205Lu




27

melanoma cells were treated with vehicle, panobinostat alone (10 mg/kg every 5

days), vemurafenib alone (10 mg/kg daily) or the two drugs in combination. Tumor

volumes were measured 3 times per week. F) HDAC8 inhibition limits BRAF

inhibitor failure. Drug naïve 1205Lu cells were xenografted into NSG mice. After 10

days, mice were treated with vehicle, PCI-34051 alone (30 mg/kg daily),

vemurafenib alone (10 mg/kg daily) or the 2 drugs in combination. Experiments

were performed with a n=10 for each condition. Significance was determined in A-

B) with t tests comparing VC and BRAFi treatment for each experiment with

#=p>0.05 (non significant), *=p<0.05, and ***=p<0.001. For E-F) significance was

determined with a one way ANOVA followed by a post hoc t test with #=p>0.05

(non-significant), *=p<0.05, and **=p<0.01.




Published OnlineFirst April 15, 2019.Cancer Res Michael F. Emmons, Fernanda Faião-Flores, Ritin Sharma, et al. mediate escape from BRAF inhibitor therapyHDAC8 regulates a stress response pathway in melanoma to

Updated version

10.1158/0008-5472.CAN-19-0040doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2019/04/12/0008-5472.CAN-19-0040.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/early/2019/04/12/0008-5472.CAN-19-0040To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-19-0040

http://cancerres.aacrjournals.org/content/suppl/2019/04/12/0008-5472.CAN-19-0040.DC1

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/early/2019/04/12/0008-5472.CAN-19-0040


hdac8 regulates a stress response pathway in melanoma to ... · cell culture: the 1205lu, wm164 and...

Documents