haspi medical biology lab 02 background/introduction

Genes, Proteins, and Disease; HASPI Medical Biology Lab 02 89

Name(s): Period: Date:

http://www.abdn.ac.uk/news/images/Krista-cow_rdax_400x600.jpg

HASPI Medical Biology Lab 02 Background/Introduction Before humans even knew of the existence of DNA, they recognized that certain traits were inherited. Through observation they saw that plants and animals raised as food sources often took after their parents. For example, the offspring of cows that produced large amounts of milk or plants that produced a lot of fruit often produced large amounts of milk or fruit themselves. This led to selective breeding and recordings of the practice have been found from more than 2,000 years ago, while the existence of DNA was not discovered until the mid-20th century.

Through biological and engineering advances we now have a much greater understanding of the structure and function of complex microscopic molecules such as DNA and protein. Scientific experiments, simulations, microscopic observations, and computer models of DNA, genes, and proteins have led to amazing breakthroughs in understanding how our bodies function. As a result, our comprehension of diseases related to genes and proteins has and will continue to improve as well.

Genes, Chromosomes, and Proteins Fast-forward 2,000 years and we now know that more than 100,000 proteins function in the human body. Proteins can perform chemical reactions, contract to allow movement, act as hormones, make up cell and body structures, store molecules, or transport molecules as a few examples of their function. Proteins are created by the body, and require a set of directions. These directions are stored in deoxyribonucleic acid or DNA. Every one of the trillions of cells in the human body has a complete set of DNA stored in its nucleus. This means that every single cell in your body holds the directions to make you!

A set of instructions in DNA that is used to make a specific protein is called a gene. The instructions are written in a code using four different nucleotide bases – adenine (A), thymine (T), cytosine (C), and guanine (G). The order of these bases determines the order of amino acids, which build proteins. There are 20 different amino acids and their order determines the structure of the protein the gene creates. The structure of DNA determines the structure of proteins, which carry out essential functions of life through systems of specialized cells.

Where do chromosomes fit into all of this? The structure of DNA is called a double helix. It is a long, twisted strand of about 3.2 billion nucleotide pairs in humans. If DNA was not organized, it would be a mess. Imagine having all of the 35,000 pages of an encyclopedia set (think Wikipedia in books) ripped out and scattered on the floor. Now find the single page on San Diego. Wouldn’t it make more sense to organize the pages to make it easier to find? That’s why there are chromosomes!

http://publications.nigms.nih.gov/insidelifescience/images/dna-structure.jpg



Chromosomes are simply portions of DNA wound up and organized into a form that makes it easier for cells to find the directions, or gene, that it needs to make a specific protein. Different organisms have a different number of chromosomes depending on the amount of DNA, or instructions, needed to build and keep that organism functioning. Humans normally have two sets of 23 chromosomes. One set comes from each parent with the same genes, but with different versions of those genes.

If they are the same, why do we have two sets? Although each chromosome has the same genes that contain the directions for the corresponding protein, these genes can vary slightly and create the differences we see among humans. For example, the gene for eye color that a child may inherit could be blue, brown, green, or hazel. You will learn more about chromosome structure and inheritance in a later activity.

From DNA to Protein Now that you understand that DNA contains the code for proteins, the question becomes how the code in DNA actually leads to proteins? This process is incredibly complex, but can be summarized in three steps: transcription, protein synthesis or translation, and protein folding.

Transcription DNA is very fragile and it is vital that not be damaged. For this reason, our bodies have created a way to make a copy of DNA, specifically a gene, so that it doesn’t have to leave the protection of the nucleus. The copy is made out of RNA, or ribonucleic acid, called messenger RNA, or mRNA. This copying process is called transcription and ONLY occurs in the nucleus.

Protein Synthesis or Translation Once an mRNA copy of the gene has been created, the ribosome can build a protein using the mRNA copy as directions. The ribosome translates the order of amino acids in the protein and bonds them together into a chain.

Protein Folding The length of the amino acid chain produced by ribosomes can range from only a few hundred to hundreds of thousands of amino acids long. The amino acid chain is transported to the endoplasmic reticulum (ER) where they are folded and can even have carbohydrates or lipids added to them to produce functioning proteins. An amino acid chain cannot perform a function until it has been folded into its functional shape.

http://commons.wikimedia.org/wiki/File:Cariotipo_del_paquetismo.gif

http://s2.hubimg.com/u/6092429_f520.jpg



Amino acid chains are also known as polypeptide chains. The interactions and bonds that occur between the different amino acids are what cause the folding and shaping of the protein. Every amino acid has a functional side that can cause or prohibit bonding with other amino acids. Proteins, called chaperones, can assist an amino acid chain during the folding and bonding process to create a finished protein that can now perform a function in the body.

Mutations Even though our body has developed mechanisms to protect DNA, it can still become damaged. A mutation can occur when DNA is not copied correctly or affected by external influences. When a mutation occurs in DNA it can alter the gene, and therefore the order of amino acids. This can change the function of the protein. The best way to demonstrate the impact of a mutation on a protein is to compare it to a sentence. Similar to words in a sentence, the DNA sequence determines the order of amino acids in a protein. Think of a gene as a sentence made up of three-letter words (codons) and each letter is a DNA nucleotide. The DNA sequence might look like this:

Momanddadaresadthepigwasnotfat.

Split into sets of three nucleotides called codons it would read like this:

Mom and dad are sad the pig was not fat.

What if a single letter (DNA nucleotide) was left out? For example, if we remove the third letter of the sentence we get:

Moa ndd ada res adt hep igw asn otf at.

Notice that a single mistake creates a sentence (gene) that no longer makes sense. This is what happens when a mutation occurs within the DNA sequence. Table 1 shows some common mutations.

Table 1. Different Types of Mutations

Normal

Nonsense

Insertion

Missense

Deletion

Silent

http://academic.pgcc.edu/~kroberts/Lecture/Chapter%207/07-21_PointMutations_L.jpg

http://www.interactive-biology.com/wp-content/uploads/2012/05/Human-Insulin-

Protein-Structure-917x1024.jpg



Cystic Fibrosis Cystic fibrosis is a common genetic disease caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The CFTR gene is located on chromosome 7 and has the directions to create the CFTR protein. The CFTR protein is a channel protein that regulates how salts, most commonly sodium (Na+) and chloride (Cl-), and water move through the cell membranes of epithelial cells. Epithelial cells cover surfaces of the body and can be found in the skin, respiratory, and digestive tracts.

Na+ and Cl- help control the movement of water into tissues. When the CFTR protein does not function correctly, chloride (Cl-) is unable to pass through the center channel and sodium (Na+) is also unable to pass through he cell membrane. When they are imbalanced, watery substances like mucus are unable to move into the tissues and the mucus becomes extremely sticky and thick. (The role of mucus is to lubricate the surfaces of the body.) As a result, symptoms of cystic fibrosis include:

• Extremely salty skin • Thick, sticky mucus that can block respiratory and digestive tracts • Frequent respiratory infections due to bacteria trapped in mucus • Wheezing, persistent cough, and shortness of breath • Lack of digestion leading to poor growth/weight

The cystic fibrosis mutation is a recessive disorder passed from parent to offspring. This means an individual needs two copies of the mutated CFTR gene to have cystic fibrosis. Since the mutation is recessive, a parent may not have symptoms of cystic fibrosis or know they carry the mutation. There are more than 30,000 people in the U.S. with cystic fibrosis and more than 1,000 cases are diagnosed yearly. More than 10 million people in the U.S. are carriers of cystic fibrosis. When cystic fibrosis was first discovered, few sufferers lived past 6 years old, but due to medical advances the median age of survival has increased to 37 years old.

Review Questions – answer questions on a separate sheet of paper 1. What are proteins? Give 3 examples of functions they perform. 2. How are DNA, genes, chromosomes, and proteins related? 3. What are amino acids? Explain how they determine the structure of protein. 4. How many chromosomes do humans have? Why do humans have two sets of chromosomes? 5. Describe transcription. Why is it important for DNA to remain in the nucleus? 6. Describe translation. 7. Describe protein folding. What causes an amino acid chain to fold? 8. What is a mutation? Explain how a mutation in a gene can influence the protein it creates. 9. List and explain 3 types of mutations. 10. What is cystic fibrosis? List 3 symptoms associated with cystic fibrosis. 11. What is the purpose of the CFTR protein? 12. What happens when the CFTR protein is mutated? 13. How does an individual get cystic fibrosis? 14. If a mother is a carrier, and the father is normal, what are the chances their children will have

cystic fibrosis?

http://www.personal.psu.edu/users/j/n/jnb5091/Images/CFTR%20Protein.jpg



HASPI Medical Biology Lab 02 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein’s function.

Background DNA contains the directions to create the proteins that allow our bodies to function. Portions of the DNA that contain directions for a single protein are called genes. Because DNA is delicate we DO NOT want to remove it from the nucleus and instead it makes a copy of the directions using RNA. RNA polymerase is a protein that copies the DNA and the finished copy is made of messenger RNA, or mRNA. This copying process is called transcription. After transcription, the copy leaves the nucleus and is in the nucleus with special organelles called ribosomes. The ribosomes translate the directions from the copy to build a protein in a process called translation. Lastly, the protein must fold into its final shape in order to be able to perform a function.

In this activity, your team will be making a copy of the CFTR gene that contains the directions for creating the CFTR protein. This protein is a transport protein that embeds itself in the cell membrane and regulates certain substances (Na+ and Cl-) moving in and out of the cells in the skin, pancreas, and lungs. If this protein is not built correctly, and therefore not able to function correctly, these substances cannot move in/out of the cell and cause a thickening and build-up of mucus. This causes the condition known as cystic fibrosis.

Materials Scissors Tape 5 Plastic bags Normal CFTR Gene template Mutated CFTR Gene template mRNA Nucleotides template tRNA template RNA Polymerase template Ribosome template 2 Pipe cleaners Glue dots sheet (12)

Weighing boat 10 Glycine beads 2 Methionine beads 5 Alanine beads 5 Arginine beads 5 Asparagine beads 5 Aspartic acid beads 5 Cysteine beads 5 Glutamic acid beads 5 Glutamine beads 5 Histidine beads

5 Isoleucine beads 5 Leucine beads 5 Lysine beads 5 Phenylalanine beads 5 Proline beads 5 Serine beads 5 Threonine beads 5 Tryptophan beads 5 Tyrosine beads 5 Valine beads Cell Membrane template

http://mssdbio.weebly.com/uploads/1/3/7/6/1376185/9730254_orig.jpg

http://learn.genetics.utah.edu/content/disorders/whataregd/cf/images/cfchannel.jpg



Procedure/Directions Your lab team will be given tasks, or directions, to perform on the left. Record your questions, observations, or required response on the right when space is available.

Part A: Set-Up Task Response

1

Obtain the following supplies: • Scissors • Tape • 5 small plastic bags • Normal CFTR Gene sheets (2 pgs) • Mutated CFTR Gene sheets (2 pgs) • mRNA Nucleotides sheets (4 pgs) • tRNA Templates sheets (2 pgs) • 2 RNA Polymerase sheets (1 pg) • 2 Ribosome sheets (1 pg)

2

Cut out the “Normal CFTR Gene” and “Mutated CFTR Gene” strips along the dotted line and tape each end together. Make sure to tape the correct ends to one another to create a single DNA strand of the normal CFTR gene AND the mutated CFTR gene (see image.)

3

Cut out the four sheets of mRNA nucleotides and put each of the four nucleotides into a different plastic bag (see image).

4

Cut out the “tRNA Templates” and put them in a plastic bag.

5

Cut along the dotted lines on the “RNA Polymerase” and “Ribosome” sheets.



Part B: Transcription Task Response

1

Get into a team of 4. Within your team separate into pairs. One pair will be following the procedure with the “Normal CFTR Gene” and the other pair will be following the EXACT same procedure with the “Mutated CFTR Gene.”

2

In this part of the activity, your team will be making a copy of the normal and mutated CFTR gene that contains the directions for creating the CFTR protein.

3 Don’t forget TRANSCRIPTION OCCURS IN THE NUCLEUS!

a. Where does transcription occur?

4

RNA polymerase is the protein that functions to unzip, or open, the DNA double helix and allow RNA nucleotides to match up to the DNA nucleotides. Remember Cytosine bonds to Guanine and Adenine bonds to Thymine. In RNA, Thymine becomes Uracil. Notice on your DNA and RNA nucleotides that the base ends match the base to which they bond (see image).

a. What are the 4 DNA nucleotides? b. What are the 4 RNA nucleotides? c. Which nucleotides match or bond to one another?

5

Place your “RNA Polymerase” template on the table (each pair needs a template). Feed the START end of your CFTR gene into and through the cut you made in the RNA polymerase sheet (see image). Your team will be sharing the RNA nucleotides and tape.

6

Starting at the START end of the CFTR gene, match an RNA nucleotide to the first DNA nucleotide. For example, the Adenine DNA nucleotide will match with a Uracil RNA nucleotide (see image). You are NOT taping the DNA sequence to the RNA nucleotides, ONLY TAPE THE RNA NUCLEOTIDES TOGETHER!

Normal

Mutated



7

Move to the next DNA nucleotide and find the matching RNA nucleotide. Once you have found the correct RNA nucleotide, tape it to the first RNA nucleotide (see image). Try to tape the RNA nucleotides together as straight as possible.

8

As you move down the CFTR gene, slide it through the RNA polymerase. Continue this process of copying the DNA nucleotides with the matching RNA nucleotides until you reach the end of the CFTR gene. Make sure you are taping the RNA nucleotides together as you move down the CFTR gene.

9

Remove the CFTR gene from the RNA polymerase. You have completed an RNA copy of the CFTR gene. This copy is called messenger RNA, or mRNA. In an actual cell, this process would be repeated with the same CFTR gene and RNA polymerase many times, to create multiple mRNA copies.

a. What is the function of RNA polymerase? b. What is mRNA? Why is it important to create mRNA rather than use actual DNA for the next step? c. Summarize the transcription process.



Part C: Translation Task Response

1

In this part of the activity, your team will be using the mRNA copy of the CFTR gene you created in transcription to decode the order of amino acids that make up the CFTR protein.

a. What is the purpose of translation?

2

Obtain two pipe cleaners and a weighing boat for your team.

3

To simulate the structure of proteins, you will be using plastic beads to represent the 20 amino acids that make up protein. Using the weighing boat, collect 5 of every amino acid (colored beads) EXCEPT glycine and methionine. Collect 10 glycine (clear beads) and 2 methionine (clear star beads).

4

First, the mRNA copy must leave the nucleus and move to a ribosome in the cytoplasm of the cell. Your team will be sharing the tRNA templates and beads/amino acids.

a. Why do you think it is important for the mRNA copy to leave the nucleus?

5

Place your “Ribosome” on the table. A ribosome is actually made up of ribosomal RNA (rRNA) and protein. Feed your mRNA copy into the ribosome with the nucleotides facing up (see image). Only the first three mRNA nucleotides should be visible in the window of the ribosome.

6

Every three mRNA nucleotide bases are called a codon. Each codon is actually a 3-base code for a specific amino acid. There are 64 possible codons that code for 20 amino acids. This means some amino acids have more than one codon.



7

Your instructor MAY provide you with an “Amino Acid Chart” that contains all of the 64 codons and the amino acid that each one codes. If not, you will only be using the tRNA molecules to determine the amino acids.

8

Transfer RNA (tRNA) float around in the cytoplasm near ribosomes and the endoplasmic reticulum. One end of a tRNA molecule has an amino acid attached and the other end has a set of 3 bases that can match up to an mRNA codon. This 3-base code located on tRNA is called the anticodon.

9

Using the tRNA molecules that were cut out earlier, find the match for each codon on your mRNA copy. For example, the first mRNA codon is “AUG” so the anticodon is “UAC”, which codes for the methionine amino acid (see image).

10

Once you have a tRNA match, look at the amino acid (pictured at the top of the tRNA). Find the bead that matches in your weighing boat.

11

Slightly bend the end of the pipe cleaner to prevent the amino acids/beads from sliding off the end. Place the amino acid/bead on your pipe cleaner and slide it to the end (see image).

12

Slide the mRNA copy through the ribosome until the next 3 bases, or codon, is visible. Find the tRNA match to determine the amino acid. Find the corresponding bead and slide it onto the pipe cleaner.

13

Continue this process until you reach the end of the mRNA copy and hit a STOP codon. Fold the end of the pipe cleaner to prevent the amino acids/beads from falling off. You have just created an amino acid chain.

a. Summarize the translation process.

Med Bio Lab 02: tRNA Templates There are 64 different tRNA that match each of the 64 different possible codons. Cut out each tRNA to match with the codons on your mRNA strand and determine which amino acid/bead it represents. Not all of the tRNA will be used and some will be used multiple times. !

!!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

!!!!!!!!!!

! ! !

Phenylalanine

tRNA

!

A

A

A

A

A

G

tRNA tRNA tRNA

! ! !!

! ! !!

! ! !!

Phenylalanine

Leuc ine

Leuc ine

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

A

G

G

G

G

G

G

G

C

C

C

C

C

C

C

C

U

U

U

U

U

U

U

U

tRNA tRNA tRNA tRNA

tRNA tRNA tRNA tRNA

tRNA tRNA tRNA tRNA

Leuc ine

Leuc ine

Leuc ine

Leuc ine

Isoleuc ine

Isoleuc ine

Isoleuc ine

Methionine

Valine

Valine

Valine

Valine

amino acid

anticodon



Part D: Protein Folding Task Response

1

So far you have made an mRNA copy of the CFTR gene and decoded the copy to determine the amino acid order. You have an amino acid chain, but it is not yet a functional protein. Different amino acids interact and bond with each other causing the amino acid strand to fold and create a protein that can perform a function.

http://www.piercenet.com/media/ProStructureFig1.gif

2

Obtain a glue dot sheet (share among your team). Place a glue dot in each of the 6 spaces of the methionine amino acid/bead (see image).

3

For your amino acid strand, methionine and glycine will bond to each other.

4

Starting at methionine, follow the amino acid chain until you find a clear bead (glycine). Fold the amino acid strand and connect glycine to a space in methionine at one of the glue dots (see image).

5

Continue down the amino acid chain, folding and connecting any glycine to the next open space on methionine, until all of the glycine amino acids on the chain have been attached.

6

You now have a completed protein!

glue dot

glue dot

glue dot

glue dot

glue dot

glue dot

glycine

methionine

Normal

Mutated



Part E: Protein Function Task Response

1

Now that your team has completed a normal and mutated CFTR proteins, compare their structures.

a. Compare and contrast the structure of your normal and mutated CFTR proteins.

2

CFTR functions to move salts in/out of cells. You have only created a portion of this protein that attaches and anchors the remaining protein to the cell membrane. The complete CFTR protein is actually more than 1,300 amino acids long!

3

The part of the normal CFTR protein that you created is responsible for connecting the CFTR protein to the cell membrane. The green portion of your normal protein would be the active site that binds to a portion of the cell membrane.

4

Your instructor has taped up a simulated cell membrane. Take your normal and mutated CFTR proteins to the simulated cell membrane and see if the green active site binds and stays attached to the green attachment point on the cell membrane (see image).

5

You have completed this activity! DNAà RNA à protein is known as the central dogma of genetics, and you now have first-hand experience as to how this process happens. In actuality, your cells can transcribe a gene that is 1,500 base pairs and produce the protein it codes for within 1.2 seconds!

Med Bio Lab 02: The Cell Membrane The cystic fibrosis transmembrane conductance regulator (CFTR) protein creates a channel for chloride ions (Cl -) to move through the cell membrane of epithelial cells lining the lungs, pancreas, skin, and other surfaces of the body.

• NORMAL PROTEIN: If your CFTR protein is normal and attaches the cell membrane, it will allow Cl – to move through the cell membrane and maintain a balance of ions on the outside and inside of the cell. As a result of this balance, mucus within the airways hydrated and functioning correctly.

• MUTATED PROTEIN: If your CFTR protein is mutated and DOES NOT attach or open Cl – cannot move through the cell membrane. This creates an imbalance in the amount of ions on the outside and inside of the cell membrane and affects the amount of water in the cell. As a result, mucus becomes extra sticky and is difficult to remove from the lungs. This includes any bacteria trapped in the mucus, which can cause numerous respiratory infections. This is only ONE example of a symptom of cystic fibrosis.

!!!!

!!Outside Lung Airway

Cell Membrane

Inside Lung Airway

Cl#$#Cl#$#

Cl#$# Cl#$# Cl#$#

mucus!

mucus! mucus!



Analysis & Interpretation

Analysis Questions – answer questions on a separate sheet of paper 1. Compare and contrast how the normal and mutated proteins adhered to the cell

membrane? How did the mutation impact the function of the CFTR protein? 2. What happened to the green active site of the protein in the mutated CFTR protein?

Why is this a problem? 3. Hypothesize what might happen if the deletion mutation was at the end of the gene

rather than towards the beginning. 4. Explain how the CFTR gene leads to the creation of the CFTR protein? 5. Approximate how many minutes it took to complete this activity (a close estimate is

fine). The complete CFTR gene is actually 230,000 base pairs long. In this activity, you transcribed and translated a section that was 96 base pairs long. Use a ratio to determine how long it would take you to transcribe and translate the entire CFTR protein.

6. There are actually many different types of mutations that can occur in the CFTR gene, any of which can cause cystic fibrosis. More than 70% of cystic fibrosis cases are caused by a 3-nucleotide deletion that results in the loss of phenylalanine at the 508th amino acid. Research and determine the second and third most common types of mutations that cause cystic fibrosis. Cite your source(s).

7. Construct an explanation based on evidence for how the structure of DNA determines the structure of proteins, which carry out essential functions of life through systems of specialized cells. Research and cite at least one source for your explanation.



Connections & Applications Your instructor may assign or allow you to choose any of the following activities. As per NGSS/CCSS, these extensions allow students to explore outside activities recommended by the standards.

1. RESEARCH A GENETIC DISEASE: Choose any genetic disease caused by a mutation in the DNA sequence. Conduct a research and determine the following:

a. Specific mutation(s) that cause the disease including on which chromosome it is located

b. How it is inherited c. Symptoms and treatment options d. Prevalence (how many individuals have the disease and how many are carriers) e. References: Cite at LEAST 3 sources and correctly cite each source. Following each

source, assess the accuracy and credibility of the source by determining which organization(s) or individual(s) endorse the site and monitor the information placed on or within the source.

2. TRANSCRIBE, TRANSLATE, AND MUTATE: Transcribe and translate the following DNA sequence to determine the mRNA sequence and amino acid sequence. Use the chart below to translate each codon rather than using the tRNA templates.

DNA Sequence TACCAGAGGATATTTGTGATT mRNA Sequence

Amino Acid Sequence

b. Now that you have transcribed and translated the DNA sequence, go back and demonstrate each of the following mutations. Transcribe and translate each mutation to show how it impacts the amino acid sequence. i. frameshift mutation ii. nonsense mutation iii. missense mutation iv. silent mutation

http

://ww

w.trite

ch

rese

arc

h.c

om

/sho

p//im

ag

es/a

ac

ha

rt.gif



3. GRAPHING MUTATIONS: There are actually over 1,500 different types of mutations that can result in cystic fibrosis. These mutations have been placed into classes depending on how they impact the function of the CFTR protein. The following table summarizes the mutation classes along with some additional statistics including prevalence and percent of cystic fibrosis patients with each mutation that suffer from bacteria colonization in the lungs and pancreatic failure due to the increase of thick mucus in these organs.

Mutation

What It Causes

Average % of cystic fibrosis patients with

specific mutation

Average % of patients with respiratory

bacterial colonization

Average % of patients with

pancreatic failure Class I CFTR is not made at all 7 59 91 Class II CFTR is misfolded and does

not bind to the membrane 85 59 92

Class III CFTR is in correct place, but does not function normally

2.5 59 92 Class IV CFTR channel is faulty 2.5 37 71 Class V CFTR is made in very small

amounts 2 51 68

Class VI CFTR degrades, or breaks down, quickly

1 46 84

a. Create a graph or chart that summarizes each class of mutation with its prevalence, bacterial colonization, and pancreatic failure. Make sure to include a title and labels on your graph or chart.

b. In which class was your mutated CFTR gene? How common is this mutation? c. Which class of mutation appears to be the most severe? Least severe? Explain your

answer. Resources and References

• NIH. 2013. How Genes Work. NIH, National Institute of Health, National Institute of General Medical Sciences – Basic Discoveries for Better Health; http://www.nigms.nih.gov/.

• Bartoshesky, L.E. 2010. When There Are Problems With Genes. www.kidshealth.org.

haspi medical biology lab 02 background/introduction

Documents