SUPPLEMENTARY MATERIAL

Chitooligosaccharides prevent osteopenia by promoting bone

formation and suppressing bone resorptionin ovariectomized

rats: Possible involvement of  COX-2

Bingshu Hea and Jun Wangb,*

a Department of Orthopedic Surgery, Hubei Woman and Child Hospital, Wuhan

430070, China; b Department of Pharmacology, College of Medicine, Wuhan University of Science

and Technology,Wuhan 430065, China.

* Author to whom correspondence should be addressed; E-Mail:wangj79@hotmail.com; Tel.: +86-27-87661513; Fax: +86-27-68893590.

Abstract

Chitooligosaccharides(CHOS) added in diet have been foundas potent calcium

fortifiers in conditions of Ca2+ deficiency such as osteoporosis.In this study, we

found thatpharmaceutical intervention using CHOS prevented ovariectomy-

inducedbone mineral density loss and the deterioration of

trabecularmicroarchitecture in a dose-dependent manner(p < 0.05 or

0.01).CHOS (125, 250 mg/kg)suppressed the serum levels of bone resorption

biomarkers CTx and TRACP5b induced by ovariectomy(p < 0.05),

butincreased the levels of osteogenic markers ALP and OC by 11.3-11.6% and

10.7-15.2% of OVX-group (p < 0.05), suggesting CHOS’s exact

pharmacological action in the control of osteoporosis whichmay be the result

of both promoting bone formation and suppressingbone resorption. Bone

turnover-modulating effectsof CHOS appear related to their anti-inflammatory

capacity to down-regulatemRNA and protein expression of COX-2(17.2-32.2%

and 16.4-21.9% of OVX-group, p < 0.05 or 0.01),a key madiatorlinking

between inflammation and osteoporosis.

Keywords: chitooligosaccharides; osteoporosis; cyclooxygenase-2

1

Experimental

Chemical

CHOS(degree of deacetylation of 90% and average molecular weight of 1500 Da)

provided by the company of Qingdao BZ Oligo Biotech Co. Ltd (Qingdao, Shandong,

China) were prepared from chitosan isolated fromcrustaceansshell by enzymatic

hydrolysis. The purity of the CHOS is determined by HPLC and it has achieved 90%

at least.

Animal models and treatment protocols

Female Sprague-Dawley rats (3 months old, 230 ± 10 g) were obtained from the

Experimental Animal Center of the Hubei Province (Certificate No. SCXK-2008-

0005, Hubei, China). Rats were housed at a constant room temperature of 22 °C and

maintained under controlled conditions of 12 h light/12 h dark photoperiod. All

animals received human care according to the criteria outlined in the Guide for the

Care and Use of Laboratory Animals published by the National Institutes of Health,

and the experiments were approved by the Animals Care and Use Committee of

Wuhan University of Science and Technology Medicine College. After

acclimatization for 1 week, surgery of animals was performed under pentobarbital

sodium (50 mg/kg body weight, i.p.) anesthesia. The rats underwent either bilateral

laparotomy (Sham group, n = 10) or bilateral oophorectomy (OVX group, n = 50).

Then the OVX rats were randomly divided into into 5 groups of 10 animals in each

group: OVX control, OVX with low dose CHOS -treated (62.5 mg/kg), medium dose

CHOS –treated (125 mg/kg) and high dose CHOS -treated (250 mg/kg), and positive

control group. All the samples were suspended in normal saline. Rats in the Sham and

OVX control groups were administered with the same volume of normal saline.

Vehicle and CHOS were all administered orally through an oral gavage once per day.

E2 was injected intraperitoneally in animals of positive control group at a dosage of

0.1 mg/kg body weight 3 times per week. The treatments started after 3 days of

recovery from surgery and lasted for 12 weeks. At the end of treatment, the mice were

sacrificed after the blood was collected by cardiac puncture.

Femur and tibia were isolated from adjacent tissues, wrapped in saline-soaked

gauze bandages to prevent dehydration, and stored at −20 ◦C until examination for

BMD and structural analysis. The lumbar L1-L3 were snap frozen in liquid nitrogen

for mRNA and protein preparations.

BMD analysis

2

BMD of the rightfemur and tibia were determined by a dual-energy X-ray

absorptiometer (DEXA; XR-36; Norland, Fort Atkinson, WI) using a mode for small

subjects as described previously (Li et al. 2012).

Bone structure analysis

The left proximal femurs were fixed in formaldehyde sodium phosphate (Na2HPO4)

for 24 to 48 h. Each bone sample was cut longitudinally into sections (6 µm thick)

using a microtome (Polycut E, Leica, Nussloch, Germany) and stained with H&E. For

analysis, well-established quantitative trabecular bone morphometric parameters,

includingBV/TV(%),Tb.Th(μm), Tb.N(1/mm) and Tb.Sp (mm),were calculated using

a light microscope equipped with a HMIAS-20 type high-resolution medical colorful

image analyzing system (Qianping Image Co., Wuhan). The selected regions were 1

mm below the growth plate and extended distally for 1.5 mm.

Detection of bone turnover markers in serum

Blood was allowed to clot for 30min.Serum was then separated via centrifugation at

1500g for 10min. ALP and OC levels, as the biomarkers of bone formation, were

estimated with ALP Activity Assay Kits (Nanjing Jiancheng Bioengineering

Institute, Nanjing, China ) and Rat Osteocalcin EIA Kit (Biomedical Technologies,

Stoughton, MA) according to the manufacturers' instructions, respectively. Serum

levels of bone resorption biomarkers CTx andTRACP5bwere evaluated using

commercial ELISA kits (CTx :Immunodiagnostic Systems Ltd., Boldon,

UK;TRACP5b: Westang, Shanghai, China).

Real-time PCR

To explore the mechanisms associated with CHOS on OVX-induced osteoporosis in

rats, total RNA isolated from frozen lumbar was extracted for analysis of real-time

PCR using the TRIzol reagent according to the manufacturer’s protocol (Invitrogen,

Carlsbad, CA, USA). After quantifying the isolated RNA using a spectrophotometer,

2-lg aliquots were reverse transcribed using a Transcriptor First Strand cDNA

Synthesis Kit (Genecopoiea, USA). The primer sequences used to amplify COX-2

and β-actin mRNA are 5’-ACCGTGGTGAATGTATGAGCATAGGA -3’ (forward)

and 5’-TCAGGTGTTGCACGTAGTCTTCGAT -3’(reverse), and 5’-

TGTTTGAGACCTTCAACACCCC -3’(forward) and 5’-

ACGTCACACTTCATGATGGAA -3’ (reverse), respectively.  Real-time PCR was

carried out in a StepOnePlus™ Real-Time PCR System. Level of COX-2 mRNA

3

were normalized to those of β-actin.The mean ratio of each group was calculated as

the average for 10 animals.

Western blotting analysis

The lumbar tissues were homogenized with a homogenizer in ProteoJET™

Mammalian Cell Lysis Reagent (MBI fermentas) followed by centrifugating at 4 °C,

14,000 rpm for 20 min.The protein concentration in the lysate was measured by the

Lowry method. The supernatants (50 μg protein/lane) were separated by 10% SDS-

PAGE and then transferred to nitrocellulose membrane by electroblotting. The

membrane was then blocked overnight and then incubated for 2 h with a 1:1000

dilution of goat polyclonal COX-2 or β-actin antibody (Santa Cruz, CA, USA). After

incubation with the secondary antibody, proteins were detected with an ECL

chemiluminescence detection kit.The amount of protein expression was corrected by

the amount of β-actin in the same sample.

Statistical analysis

All the grouped data were statistically evaluated with SPSS11 software. Hypothesis

testing methods included one way analysis of variance (ANOVA) followed by least

significant difference (LSD) test; p value of less than 0.05 were considered to indicate

statistical significance. All the results were expressed as the mean ± SD for 10

animals in each group.

Figure S1. BMD of femur (a) and tibia (b). BMD of the right femur and tibia was measured by dual-energy X-ray absorptiometry after 12 weeks treatment. Values are the mean ± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.

4

Figure S2. Histology and parameters of bone. (a)Bone architecture of the proximal femurs after 12 weeks treatment (H&Estain).Osteocytes were visualised in inset. Slides are representative of 10 animals per group; (b) Trabecular bone parameters assessed: bone volume fraction (BV/TV), trabecular thickness(Tb.Th), trabecular number(Tb.N) and trabecular separation(Tb.Sp). Values are the mean ± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.

5

Figure S3. Serum levels of osteoporotic biochemical markers including alkaline phosphatase (ALP), osteocalcin(OC), telopeptides of collagen type I (CTx) and tartrate-resistant acid phosphatase 5b (TRACP5b) in OVX rats. Values are the mean ± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.

Figure S4. Expression of COX-2 in lumbar. (a) Relative amount of COX-2 gene was measured with quantitative real time polymerase chain reaction. Data were normalized to the β-actin gene. (b) Relative amount of COX-2 protein was measured withWestern blotting. β-actin was used as an internal control. Values are the mean ± SD. ** p < 0.01 vs. Sham group; # p < 0.05,# # p < 0.01 vs.OVX group.

6

ReferencesLi TM, Huang HC, Su CM, Ho TY, Wu CM, Chen WC, Fong YC, Tang CH.2012.

Cistanche deserticola extract increases bone formation in osteoblasts.J Pharm

Pharmacol. 64:897–907.

7