Immunity, Volume 46

Supplemental Information

Glutathione Primes

T Cell Metabolism for Inflammation

Tak W. Mak, Melanie Grusdat, Gordon S. Duncan, Catherine Dostert, YannicNonnenmacher, Maureen Cox, Carole Binsfeld, Zhenyue Hao, Anne Brüstle, MomoeItsumi, Christian Jäger, Ying Chen, Olaf Pinkenburg, Bärbel Camara, MarkusOllert, Carsten Bindslev-Jensen, Vasilis Vasiliou, Chiara Gorrini, Philipp A.Lang, Michael Lohoff, Isaac S. Harris, Karsten Hiller, and Dirk Brenner

1

Supplemental Information

Supplemental Experimental Procedures

Immunoblotting

Immunoblotting was performed as described previously (Brenner et al., 2009). Antibodies

used were as follows: anti-pp38 (Cell Signaling), anti-pERK (Cell Signaling), anti-pJNK

(Santa Cruz), anti-pAKT (Cell Signaling), anti-pGSK3β (Cell Signaling), anti-GSK3β (Cell

Signaling), anti-Gclc (Santa Cruz), anti-actin (Sigma-Aldrich), anti-NFATc1 (Santa Cruz),

anti-IκBα (Santa Cruz), anti-PKM2 (Cell Signaling), and anti-MYC (Santa Cruz).

Cloning and retroviral transduction

The gene encoding murine full length c-Myc was cloned from plasmid pHCMV-Myc-wt

(Herold et al., 2002), kindly provided by S. Herold (University of Würzburg, Germany). This

cDNA was digested with BamHI (5‘ and 3‘) and cloned into the BglII-digested and

dephosphorylated pMIG vector. 293T/17 cells were transfected with pEco, pCGP and

pMIG or pMIG-cMyc plasmids using calcium phosphate precipitation. Viral supernatants

were collected at 24h and 48h post-transfection.

For retroviral transduction, purified naı̈ve CD4+T cells were plated for 19h on culture

plates that were coated with anti-CD3 Abs. Fresh retroviral supernatants were added and

the cells were centrifuged at 2700 rpm for 1.5h at 37oC. After spin infection, the cells were

re-cultured in the stored culture medium. After 24h, T cells were sorted by flow cytometry

on the basis of coexpressed GFP and used for experiments

Quantitative RT-PCR

RNA was isolated from cell pellets using RNAeasy (Qiagen). cDNA was prepared using a

iScript cDNA synthesis kit (Bio-Rad), and RT-PCR was carried out using Sybrgreen Master

Mix (ABI) and the primers listed in Supplemental Table 1. Reactions were run on an ABI

7500HT Fast qRT-PCR instrument. Data were normalized to GAPDH transcription and

analyzed using the ∆∆Ct method.

2

Primer that have been used for quantitative RT-PCRs:

Gene Forward primer Reverse primer

Gclc GGCTCTCTGCACCATCACTT GTTAGAGTACCGAAGCGGGG

Gclm AGGAGCTTCGGGACTGTATCC GGGACATGGTGCATTCCAAAA

Gapdh ACGGCACAGTCAAGGCCGAG CACCCTTCAAGTGGGCCCCG

Surface markers, cytokines, inhibitors and viability

T cells were stimulated as indicated in the Figures and standard protocols were used for

surface marker staining. Antibodies used were: anti-B220 (RA3-6B2), anti-CD4 (RM4-5),

anti-CD8 (53-6.7), anti-CD25 (PC61), anti-CD44 (IM7), anti-CD62L (MEL-14), anti-CD69

(H1.2F3), anti-CD127 (A7R34), and anti-KLRG1 (2F1), (all from Biolegend); and anti-

phospho-mTOR (S2448) and anti-phospho-S6 Ribosomal (S235/S236) (both from

eBiosciences). Viability was assessed by flow cytometry following Annexin V plus 7AAD

staining. Cytokines in culture supernatants were quantified by ELISA using the appropriate

kits according to the manufacturers’ instructions: IL-2 (eBioscience), IFNα (PBL).

Intracellular staining to detect cytokines was performed using Cytofix/Cytoperm™ kits (BD).

Rapamycin (Sigma) and FK506 (Sigma) were used at a final concentration of 100nM. Trolox

(Sigma) was used at a concentration of 250µM and N-acetyl-cysteine (NAC; Sigma) at

10mM. If not otherwise indicated BSO (Sigma) was used at a concentration of 200µM.

Ca2+ measurement

Splenocytes were surface-stained with APC-labeled anti-CD4 and FITC-labeled anti-CD8

mAbs (Biolegend), washed, and labeled with Indo-1 (Invitrogen) at 37°C for 45 min. Washed

cells were warmed to 37°C and stimulated with anti-CD3 Ab and A23187 calcium ionophore

(Iono). Ca2+ flux was measured by flow cytometry using an LSRII cytometer (BD). The Indo-

1 violet:blue ratio over time was plotted using FloJo (Treestar) and Prism 7.0 (GraphPad).

Histology and immunohistochemistry

Specimens for histology and immunohistochemistry analyses were prepared and examined

as previously described (Brustle et al., 2012).

Determination of GSH and ATP

3

T cells were stimulated as indicated and 2x105 T cells/well were measured using the GSH-

Glo™ assay (Promega) for GSH or the CellTiter-Glo assay (Promega) for ATP (Verbist et

al., 2016) according to the manufacturer's protocol.

Alternatively GSH was measured by LC-MS as described below.

LC-MS measurement

Relative quantification of GSH was performed using an Agilent 1290 Series LC coupled to

an Agilent 6550 Q-TOF MS system equipped with a Dual Agilent Jet Stream ESI source.

Column used: Waters ACQUITY UPLC HSS T3 1.8 µm; Length, I.D., Particle Size: 100

mm x 2.1 mm x 1.8 µm; maintained at 45°C. The autosampler was kept at 4 °C and the

injection volume was 1 µL. The flow rate was set to 0.25 mL/min and the mobile phases

consisted of 0.1% formic acid in water (Eluent A) and 0.1% formic acid in methanol (Eluent

B). The run consisted of an isocratic delivery of 1% Eluent B over 5 min, followed by a

linear gradient to 95% Eluent B over 1 min, isocratic delivery of 95% Eluent B for 4 min,

and a re-equilibration phase on starting conditions with 1% Eluent B for 5 min.

MS experiments were performed using electrospray ionization in positive mode (+ESI)

with a capillary voltage of 3.5 kV. The protonated molecules of GSH were monitored in

high resolution mode (slicer position: 5) and Extended Dynamic Range (2GHz) with the

following Q-TOF MS conditions: drying gas temperature: 225°C, drying gas flow: 14 L/min

(nitrogen), nebulizer: 35 psig, sheath gas temperature: 350°C, sheath gas flow: 11 L/min,

fragmentor: 400 V, Oct RF Vpp: 750 V. Full scan spectra were acquired from m/z 100 to

1000 (2 spectra/sec). External mass calibration was performed before measurement of

each set of samples. All data were acquired with Agilent Mass Hunter LC/MS Data

Acquisition (ver B.06.01) and analyzed with Agilent Mass Hunter Qualitative Analysis (ver

B.07.00). The peak area of intracellular GSH (m/z 308.0911, protonated) was divided by

the peak area of the internal standard (m/z 311.0948, protonated) and normalized to the

corresponding cell number multiplied by 1 million.

Cell transfer experiments for LCMV infections

P14-Gclcfl/fl and P14-CD4Cre-Gclcfl/fl CD8+ T cells were purified from spleen and lymph

nodes utilizing the Dynabeads FlowComp Mouse CD8+ kit (Invitrogen). Following CD8+ T

cell isolation, control T cells were labeled with 2.5µM CellTracker Green (Molecular

Probes) for 9 minutes at 37 degrees Celsius. Gclc-deficient T cells were labeled with

4

2.5µM CellTrace Violet (Molecular Probes) for 9 minutes at 37 degrees Celsius. Following

labeling, cells were counted and mixed at a 1:1 ratio and injected intraperitoneally (i.p.)

into recipient CD45.1 animals so that each recipient received 1.6x106 P14-specific Tcells

of each genotype. The following day, recipient mice were infected with 2x105 plaque

forming units of LCMV-Armstrong i.p. Recipient mice were sacrificed 36 and 60 hours

post-infection. Donor P14 T cells were identified based on CD45.2 staining, and genotype

of the transferred T cells were discriminated based on CellTracker Green or CellTrace

Violet staining, respectively.

Supplemental Figure Legends

Supplemental Figure 1, related to Figure 1: Ablation of Gclc does not influence

thymocyte development.

(A) Colorimetric determination of GSH concentrations in WT CD4+ T cells isolated and

pooled from spleen plus lymph nodes (LN) and stimulated in vitro for 24h with the indicated

concentrations of anti-CD3/28 Abs, with or without the GCL inhibitor BSO. Data are derived

from kinetic measurements and are representative of 6 independent experiments. (B)

Immunoblot to detect GCLC protein in Gclcfl/fl and CD4Cre-Gclcfl/fl T cells that were activated

in vitro with 3µg/mL anti-CD3/28 for the indicated times. Actin, loading control. Data are

representative of 2 independent experiments. (C, D) Gclcfl/fl and CD4Cre-Gclcfl/fl mice were

injected i.p. with 150 µg/mouse SEB. After 48h, Vβ8+ CD4+ and CD8+ T cells were sorted

by flow cytometry, and GSH (C) and ROS levels (D) were determined as described in

Experimental Procedures. Data are the mean ± SEM (n=3) and representative of 2

independent experiments. (E) Flow cytometric determinations of thymocyte subsets in thymi

isolated from 6-week-old Gclcfl/fl and CD4Cre-Gclcfl/fl mice. Double negative (DN)

thymocytes were gated after exclusion of Lineage-positive cells

(CD4+/CD8+/CD11b+/CD11c+/Gr-1+/NK1.1+/B220+/TER119+). DN1: CD44+CD25-; DN2:

CD44+CD25+; DN3: CD44-CD25+; DN4: CD44- CD25-, Double positive (DP): CD4+CD8+.

Data are the mean ± SEM (n=6) and representative of 2 experiments. (F) Flow cytometric

analysis of lymphoid cell subsets that were harvested from peripheral blood of Gclcfl/fl and

CD4Cre-Gclcfl/fl mice. Data are the mean ± SEM (n=4) and representative of 3 experiments.

*p<0.05.

5

Supplemental Figure 2, related to Figure 1: Effects of Gclc deficiency on T cell

signaling and ROS levels.

(A) Immunoblots to detect the indicated proteins in CD4+ and CD8+ T cells that were isolated

from Gclcfl/fl or CD4Cre-Gclcfl/fl spleen plus LN and stimulated with PMA/Iono for the

indicated times. Data are representative of 3 independent experiments. (B) Immunoblot to

detect the indicated phosphorylated proteins in CD4+ T cells that were isolated from spleen

plus LN of Gclcfl/fl or CD4Cre-Gclcfl/fl mice and stimulated with PMA/Iono for the indicated

times. GSKβ, loading control. Data are representative of 3 experiments. (C) Flow cytometric

FSC/SSC measurement of the cells in Fig.1F. Data are representative of 2 trials. (D) Flow

cytometric determination of % viability of Gclcfl/fl and CD4Cre-Gclcfl/fl T cells that were

stimulated with the indicated concentrations of anti-CD3/28 Abs for 48hr and stained with

7AAD/AnnexinV. Data are the mean ± SEM (n=3) and representative of 6 independent

experiments. (E) Flow cytometric determination of DCF-DA staining of Gclcfl/fl and CD4Cre-

Gclcfl/fl CD4+ T cells that were stimulated with anti-CD3/28 for 24h and co-incubated with or

without NAC or GSH, as indicated. Data are representative of 4 independent experiments.

Supplemental Figure 3, related to Figure 3: Gclc deficiency alters T cell metabolism.

(A) Schematic illustration of a glutamine fluxmap and U-13C-glutamine isotopomer

distribution through progressive TCA cycling. (B) Mathematical determination of the M2/M4

citrate isotopologues ratio in activated Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ T cells. Data are

the mean ± SEM and representative of 3 independent experiments. ***p<0.001. (C) Flow

cytometric measurement of % viability of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ T cells that were

left unstimulated (non-stim.) or stimulated with 10µg/mL anti-CD3/28 Abs or PMA/Iono for

24h and stained with 7AAD/ AnnexinV. Data are the mean ± SEM of triplicate measurements

and representative of 3 independent experiments. (D) Proliferation assessment by 3H-

thymidine incorporation of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ T cells that were stimulated with

anti-CD3/28 Abs and supplemented with the indicated concentrations of glutamine for 48h.

Data are the mean ± SEM (n=3) and representative of 3 independent experiments. (E)

Proliferation assessment as in (C) of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ and CD8+ T cells that

were stimulated with anti-CD3/28 Abs and supplemented with the indicated concentrations

of dimethyl-α-ketoglutarate (DMK) for 24h. Data are the mean ± SEM (n=3) and

representative of 3 independent experiments. (F) Schematic illustration of a glucose fluxmap

and U-13C-glucose isotopomer distribution through progressive TCA cycling. (G)

6

Determination of the oxygen consumption rate (OCR) of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+

and CD8+ T cells that were stimulated with anti-CD3/28 Abs for 24h. Data are the mean ±

SEM (n=6) and representative of 2 independent experiments.

Supplemental Figure 4 related to Figure 5: BSO reduces GSH, increases ROS and

exogenous IL-2 cannot restore the proliferation of Gclc-deficient T cells.

(A, B,C) Determinations of GSH and ROS levels as in Suppl. Fig. 1C, D in WT CD4+ T cells

that were isolated from spleen and LN and activated in vitro with anti-CD3/28 Abs for 24h in

the presence or absence of BSO ± NAC. Data are the mean ± SEM (n=4) and representative

of 2 independent experiments. (B) Immunoblot to detect PKM2 protein in Gclcfl/fl and

CD4Cre-Gclcfl/fl CD4+ and CD8+ T cells that were left unstimulated (0) or stimulated for 24h

with anti-CD3/28 Abs. Data are representative of 2 independent experiments. (C) Flow

cytometric determination of Ca2+ mobilization in Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+

splenocytes that were stimulated with anti-CD3 or ionomycin at the indicated timepoints

(positive controls). Data are representative of 3 experiments. (C) Proliferation assessment

by 3H-thymidine incorporation of Gclcfl/fl and CD4Cre-Gclcfl/fl CD4+ and CD8+ T cells that

were stimulated with the indicated concentrations of anti-CD3/28 Abs in the absence or

presence of 250U/ml IL-2. Data are the mean ± SEM (n=3) and representative of 2

independent experiments.

Supplemental Figure 5, related to Figure 6: ROS scavenging is needed to coordinate

metabolic fluxes in T cells.

(A, B) Measurement of the extracellular glucose and lactate secretion rates (A), and the

ratio of molecules of lactate produced per molecules of glucose consumed (B), in Gclcfl/fl

and CD4Cre-Gclcfl/fl CD4+ T cells that were stimulated with anti-CD3/28 Abs for 24h in the

presence or absence of GSH. Data are the mean ± SEM of triplicate measurements of

pooled cells from 4 mice/genotype and representative of 2 independent experiments. (C, D)

WT CD4+ T cells were incubated with U-13C-glutamine (C) or U-13C-glucose (D) and

stimulated with anti-CD3/28 Abs with or without BSO for 24h in the presence or absence of

NAC or GSH. Left: Fluxmaps. Right: Mass isotopomer distributions of citrate. Data are the

mean ± SEM (n=3) and representative of 2 independent experiments. (E, F) Proliferation

assessment by 3H-thymidine incorporation of CD4Cre-Gclcfl/fl T cells that were stimulated

with anti-CD3/28 Abs for 24h in the absence or presence of NAC, GSH or NAC plus FK506

7

(E) or NAC plus rapamycin (Rap.) (F). Data are the mean ± SEM (n=3) and representative

of 2 independent experiments.

Supplemental Figure 6, related to Figure 7: Gclc ablation in T cells affects adaptive,

but not innate, immune responses.

(A) Histological analysis of spinal cords of Gclcfl/fl and CD4Cre-Gclcfl/fl mice at day 30 (d30)

after EAE induction. Cross-sections were stained with H&E, anti-CD3 (T cells) or anti-Mac-

1 (macrophages, activated microglia). Scale bars: 400µm. Data are from one mouse of 3

mice per group and representative of 2 independent experiments. (B) Intracellular flow

cytometric determinations of the indicated populations of antigen-specific memory T cells

secreting the indicated cytokines in Gclcfl/fl and CD4Cre-Gclcfl/fl mice at d60 post-LCMV

infection. Data are the mean ± SEM (n=6) and representative of 2 experiments. (C) ELISA

determination of serum IFNα in Gclcfl/fl and CD4Cre-Gclcfl/fl mice on the indicated days post-

LCMV infection. Data are the mean ± SEM (n=6). (C) CD8+ T cells from LCMV-specific TCR

transgenic P14-Gclcfl/fl (n=6) and P14-CD4Cre-Gclcfl/fl (n=6) mice were isolated from LN and

spleen, labeled with CFSE or VCT, respectively, and transferred into WT recipient mice.

Recipient mice were infected with LCMV-Armstrong, and the proliferation of LN and splenic

T cells was analyzed at the indicated timepoints post-infection by flow cytometry. Data are

the mean ± SEM (n=4) and representative of 2 experiments.

Supplemental References

Brenner, D., Brechmann, M., Rohling, S., Tapernoux, M., Mock, T., Winter, D., Lehmann, W.D., Kiefer, F., Thome, M., Krammer, P.H., and Arnold, R. (2009). Phosphorylation of CARMA1 by HPK1 is critical for NF-kappaB activation in T cells. Proceedings of the National Academy of Sciences of the United States of America 106, 14508-14513. Brustle, A., Brenner, D., Knobbe, C.B., Lang, P.A., Virtanen, C., Hershenfield, B.M., Reardon, C., Lacher, S.M., Ruland, J., Ohashi, P.S., and Mak, T.W. (2012). The NF-kappaB regulator MALT1 determines the encephalitogenic potential of Th17 cells. The Journal of clinical investigation 122, 4698-4709. Herold, S., Wanzel, M., Beuger, V., Frohme, C., Beul, D., Hillukkala, T., Syvaoja, J., Saluz, H.P., Haenel, F., and Eilers, M. (2002). Negative regulation of the mammalian UV response by Myc through association with Miz-1. Molecular cell 10, 509-521. Verbist, K.C., Guy, C.S., Milasta, S., Liedmann, S., Kaminski, M.M., Wang, R., and Green, D.R. (2016). Metabolic maintenance of cell asymmetry following division in activated T lymphocytes. Nature 532, 389-393.

� � � � � � � � � � � � ��� �� � �α

� �α

� � �µ

� � � � ����� µ

��

� ����� ��!"# $%�&$" '( )* )+ ), )- ). / +. / 0. / *. / 1

2 3 4 5 6 2 3 4 5 6 7 8 9: ; < ;= > ? @ AB C D C E F G C H I J B C D C K L M K LK L M K L

N O P Q R S P T U V T W X U � ��"# $%�&$" '()* )+ ), )1 ) )- )

Y . -Y . +. /. Z N O P Q R S P T U V T W X U

[\ [] [^ [_ `a bcd ef bcghih jjkl mnef jomp bqrst

u v w x x y z v w x x y { | }z v w x x y { | ~z v w x x y*

*

*� �

��� ����� �� � � �� � � �� � � �� � � �� � � � �� � � � ��β

� � � � � �β

� � � � �� � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � �� � � � � � � � �� � � � � � � � ��β

� � � � � �β

� � � � ��� � � �� � � �� � � ��� ¡¢� £¡¤¥ ¦ § ¨ © ª « ¬

�β

� � � � �¥ ¦ § ¨ © ª « ¬

�β

� � � � �­ ®̄°± ² *

*

*

³ ´ µ ´ ¶ · ¸ ¶ ·¹ º » ´ ¼ ½ ¾ ³ ´ µ ´ ¶ · ¸ ¶ ·

³ ´ µ ´ ¶ · ¸ ¶ ·¹ º » ´ ¼ ½ ¾ ³ ´ µ ´ ¶ · ¸ ¶ ·

� � � �� � � �� � � �� � � � � � � � � � �� � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � � �� � � �� � � �� � � ! " ! # " $ # " % & ' ! ( ) * ! " ! # " $ # " ! " ! # " $ # " % & ' ! ( ) * ! " ! # " $ # "+

κ,α

+κ

,α

- . / . 0 . - . / . 0 . 1 2 3 4 56 7 8 7 9 8 : 9 8 ; < = 7 > ? @ 6 7 8 7 9 8 : 9 8 A B C DA E F C G

βE F C Gβ

H H I J J J HHJ HK HL HM HN HOP QRPSP T UVWXH H I J J J HHK HM HY HOP QRPSP T UVWX Z [ \ [ ] ^ _ ] ^` a b [ c d e Z [ \ [ ] ^ _ ] ^f g h f g iα

j k l mα

j k n o pµ

q r s t uα

j k l mα

j k n o pµ

q r s t u*

*

*

*

v w x y z { | } Z [ \ [ ] ^ _ ] ^` a b [ c d e Z [ \ [ ] ^ _ ] ^` a b [ c d e Z [ \ [ ] ^ _ ] ^~ � � �` a b [ c d e Z [ \ [ ] ^ _ ] ^~ � � � v w x y z { | } � � �

v w x y z { | } � � �

FSC FSC

SSC

SSC

Z [ \ [ ] ^ _ ] ^ ` a b [ c d e Z [ \ [ ] ^ _ ] ^

Counts

Counts

Counts

� � � � � � � � � � � � � � � � � � � � � � ��� � � � � � � � � � � � � � ���� � � � � � �� � � � � �� � � � � � � � � � � �� � �� � � � � � � � �� ! � " # $ � � � � � � � � �*

*

*

% & ' & ( ) * ( * + , - . / 0 1 2 3 , 4 % 5�� �6 �7 �89 :;9<9 = >?@A

αB C D E

αB C F GH I H J K L M N O P Q R S T I H I

� � � � � � � � �� ! � " # $ � � � � � � � � �

* U & V * & U V * & * U V + , - . W - X� � � � � � � � �� ! � " # $ � � � � � � � � ��� � � � � � � � � � � � � � ���� Y W Z

* U & V * & U V * & * U V + , - . W - X�� � � � � � � � � � � � � � ���� Y W [**

*

**

****

****

\ ] � ] ^ _ ` ^ _ a b c d e f g h d � d i j k i j a b c d e f gl m n l m oh d � d i j k i j\ ] � ] ^ _ ` ^ _� � �� � �� � �6 � �� � �pqr? ��s<t �9 uA **

**

α� � � � � � � � � � � � � � � � � � �

α� � �

� � ��� � � � � � � �

� � � � � � � � � � � � � � � ! "# $ % # $� � � � # $ % # $� � � � � � ! "# $ % # $� � � � � � � � � � � # $ % # $��� � � & � � � �

' ' ( ) ( ) ( ) ( ) * + , -. / 0 12343 56756 89:;< =>;?; @AB@AC D E F G H I I J C D K F G H I I J2343 56756 89:;L< =>;?; @AB@A 2343 56756 89:;L< =>;?; @AB@A M G N O P

� � � � � &

QR Q Q Q Q QS Q Q Q Q QT Q Q Q Q QU Q Q Q Q QV W X Y Z W [ \ ] ^_̀abcdef g h i j k l m n op o oq o o oq p o or o o or p o o s t u

� v � wxyz{x |z} ~ � �� ���� � s t u~ � �

� � � � # $ % # $� � � � � � � � � � � # $ % # $ � v � oq o o or o o o� o o owxyz{x |z} s t u~ � �~ � � � � � �

*

*

*

**

**

*

α� � � �

α� � " � �

µ� � � �

α� � � �

α� � " � �

µ� � � �

α� � � �

α� � " � �

µ� � � �

α� � � �

α� � " � �

µ� � � �

� �� � � � � �� � � � � � � � � �� � � � � � � �

� �� � � � � �� � � � � � � � � �� � � � � � � �

� � ��� ����� �� ����� � � � � � � � ! " # $ %� � � � & ! " # $ %'( ' ' ') ' ' '* ' ' '+ ' ' '

, & -. / 0 / 1 2 3 1 24 5 6 / 7 8 9 . / 0 / 1 2 3 1 2 : � � � � � � � � � � � & ; < = >, & -

. / 0 / 1 2 3 1 24 5 6 / 7 8 9 . / 0 / 1 2 3 1 2� � ��� ����� �� ���� ( ' ' ') ' ' '* ' ' '+ ' ' '*

*

*

*

*

*

*

*

*

*

? @ A B C D E F B G B H G I H GF B G B H G I H G? @ A B C D E F B G B H G I H G J K L M? @ A B C D E F B G B H G I H GF B G B H G I H G? @ A B C D E F B G B H G I H G J K L M

�� � � �� � � � � � � � � � � � � � � �

� � �� � � �� � � �� � � ���� α

� ��� ���� �

� � �� � � � !� � "# $%& '()* +,- '.)/01 '+� � �� � � � !� � "# $%& '()* +,- '.)/01 '+� � �� � � � !� � "# $%& '()* +,- '.)/01 '+

2 3 4 5 6 7 7 8 2 3 4 9 6 7 : ; 8 2 3 4 5 6 < = ; 82 3 4 5 6 7 7 8 2 3 4 9 6 7 : ; 8 2 3 4 5 6 < = ; 82 3 4 5 6 7 7 8 2 3 4 9 6 7 : ; 8 2 3 4 5 6 < = ; 8

IL-2

TNF IFNγ

> ? @ ?A B C ? D E F > ? @ ? G H I G HJ K L J KM N O P Q R P S T U V W X Y Z [ \ S X R ]

* * *

*

** * **

^ _ ` _ a b c a b d e f _ g h i ^ _ ` _ a b c a bj k lm n op q r s t

u � v� � v> ? @ ? A B C ? D E F > ? @ ? J K L J KJ K L J Kw x y z { w |